KR20020059645A - Nucleic acids of the human abc1 gene and their therapeutic and diagnostic application - Google Patents

Abstract

The present invention relates to the ABC1 gene, which is the cause of cholesterol metabolic dysfunction disorders such as atherosclerosis, more specifically the breakdown of cholesterol reverse transport, and more specifically pathologies associated with familial HDL deficiency (FHD), such as Tangier disease. It relates to nucleic acids corresponding to various exons and introns. The present invention also relates to ABC1 cDNA encoding the novel full length ABC1 protein. The invention also relates generally to means for detecting polymorphisms, in particular mutations, in the ABC1 gene or in the corresponding protein produced by the allele of the ABC1 gene.

Description

Nucleic Acids of Human ABC1 Genes and Their Therapeutic and Diagnostic Applications TECHNICAL ACIDS OF THE HUMAN ABC1 GENE AND THEIR THERAPEUTIC AND DIAGNOSTIC APPLICATION

Lipids are water-insoluble organic biomolecules that are essential components of various biological functions, including energy storage, transport and metabolism, and membrane structure and fluidity. Lipids are derived from two sources in humans and other animals: some lipids are consumed as dietary fats and oils and others are biosynthesized by humans or animals. In mammals at least 10% of body weight is lipids, most of which are in the form of triacylglycerols.

Triacylglycerols, also known as triglycerides and triacylglycerides, consist of glycerol and three fatty acids esterified. Dietary triacylglycerols are stored as adipose tissue as an energy source or hydrolyzed in the digestive tract by triacylglycerol lipases, the most important of which is pancreatic lipase. Triacylglycerols are transported between tissues in the form of lipoproteins.

Lipoproteins are micellar assemblies found in plasma and contain various proportions of different types of lipids and proteins (called apoproteins). There are five main classes of plasma lipoproteins, the main function of which is lipid transport. These classes are kilomicrons, ultra low density lipoproteins (VLDL), medium-density lipoproteins (IDL), low density lipoproteins (LDL), and high density lipoproteins (HDL), in increasing order of density. Although the dominant species of lipids are found associated with each lipoprotein class, each class mainly transports one type of lipid: while triacylglycerols are transported in kilomicrons, VLDL, and IDL; Phospholipids and cholesterol esters are transported to HDL and LDL, respectively.

Phospholipids are also difatty acid esters of glycerol phosphate containing polar groups coupled to phosphates. Phospholipids are hydrolyzed by an enzyme called phospholipase. Phosphatidylcholine, an exemplary phospholipid, is a major component of most eukaryotic membranes.

Cholesterol is an essential component of cell membranes and metabolic precursors of steroid hormones and bile acids. In humans and other animals, cholesterol is consumed in food and also synthesized by the liver and other tissues. Cholesterol is transported between tissues in the form of cholesteryl esters in LDL and other lipoproteins.

The membrane surrounds all living cells and acts as a barrier between intracellular and extracellular compartments. The membrane also encloses the nucleus of the eukaryotic cell, forms the endoplasmic reticulum, and plays a specialized function as in myelin sheath surrounding the axon. Typical membranes contain about 40% lipid and 60% protein, but are quite variable. Main lipid components are phospholipids, specifically phosphatidylcholine and phosphatidylethanolamine, and cholesterol. Physicochemical properties, such as fluidity, can be altered by alteration of the fatty acid profile or cholesterol content of phospholipids. Modulation of the composition and composition of membrane lipids also modulates membrane-dependent cellular functions such as receptor activity, endocytosis, and cholesterol flux.

High density lipoprotein (HDL) is one of four major classes of lipoproteins circulating in plasma. These lipoproteins are involved in various metabolic pathways such as lipid transport, bile acid formation, steroid production, cell proliferation, and also interfere with the plasma proteinase system.

HDL is a complete cholesterol-free receptor and, together with cholesterol ester transfer protein (CETP), lipoprotein lipase (LPL), hepatitis lipase (HL) and lecithin: cholesterol acyltransferase (LCAT), in the transport of cholesterol, ie bile acid form It plays a major role in transporting excess cholesterol in peripheral cells to the liver for removal from the body. HDL plays a pivotal role in the transport of cholesterol from peripheral tissues to the liver.

Various diseases associated with HDL deficiency have been described, including Tangier disease and / or FHD disease, HDL deficiency, and LCAT deficiency. In addition, HDL cholesterol deficiency has been observed in malaria and diabetic patients (Kittl et al., 1992; Nilsson et al., 1990; Djoumessi, 1989; Mohanty et al., 1992; Maurois et al., 1985; Grellier et al. , 1997; Agbedana et al., 1990; Erel et al., 1998; Cuisinier et al., 1990; Chander et al., 1998; Efthimiou et al., 1992; Baptista et al., 1996; Davis et al., 1993; Davis et al, 1995; Pirich et al., 1993; Tomlinson and Raper, 1996; Hager and Hajduk, 1997, Kwiterovich, 1995, Syvanne et al., 1995a, Syvanne et al., 1995b, and French et al. , 1993). Deficiencies associated with tangerine disease and / or FHD disease are associated with cellular defects in the translocation of cellular cholesterol, leading to degradation of HDL and disruption of lipoprotein metabolism. Nevertheless, in the case of Tangier disease and / or FHD disease, the exact nature of the defect is not yet precisely defined.

Tangier's disease is an autosomal co-dominant symptom characterized by homozygous conditions, hepatomegaly, peripheral neuropathy, and frequent premature coronary artery disease (CAD) due to the absence of HDL-cholesterol (HDL-C) from plasma . In heterozygotes, HDL-C levels are about half of normal individuals. Impaired cholesterol outflow from macrophages leads to the presence of foam cells throughout the body, which may explain the increased risk of CAD in some Tangier families.

In patients with Tangier disease, HDL particles do not incorporate cholesterol from peripheral cells, are not metabolized correctly, and are quickly removed from the body. Thus, plasma HDL concentrations are extremely reduced in these patients and HDL no longer guarantees the return of cholesterol to the liver. Cholesterol accumulates in these peripheral cells and causes characteristic clinical signs such as the formation of an orange tonsil. Furthermore, other lipoprotein breakdowns, such as overproduction of triglycerides and increased synthesis of phospholipids and intracellular catabolism, are also observed in patients with Tangier disease.

Tangier's disease, as described above, is classified as a family disease most commonly detected in patients with coronary artery disease associated with metabolism of HDL. Many studies have shown that reduced levels of HDL cholesterol are excellent indicators of individual risk of developing or already suffering from cardiovascular disease. In this context, there has been a growing interest as symptoms associated with HDL deficiency allow them to increase their understanding of the role of HDL in atheroogenesis.

Atherosclerosis is defined in histological terms by deposition in the blood vessel walls of lipids (lipid or fibrolipid plaques) and other blood derivatives, in particular large arteries (aorta, coronary artery, carotened). Depending on the progress of the atherosclerotic process, these plaques, which are somewhat calcified, can be coupled to the lesion and are associated with the vascular accumulation of fatty deposits, which are essentially composed of cholesterol esters. These plaques involve thickening of the blood vessel wall, enlargement of smooth muscle, the appearance of foam cells (lipid-loaded cells resulting from uncontrolled uptake of cholesterol by the assembled macrophages) and accumulation of fibrous tissue. Atheromatous plaques prominently protrude from the wall, imparting a narrowing trait that causes vascular occlusion by atherosclerosis, thrombosis or embolism, which occurs in most diseased patients. These lesions can lead to severe cardiovascular pathologies such as infarction, sudden death, heart failure, and seizures.

Mutations in genes that play a role in lipoprotein metabolism have been identified. Specifically, several mutations in the apo lipoprotein apo A-I have been characterized. Such mutations are rare and can result in a lack of production of apo A-I. Mutations in the gene encoding LPL or its activator apo C-II are associated with severe hypertriglyceridemia and significantly reduced HDL-C levels. Mutations in the gene encoding the enzyme LCAT are also associated with severe HDL deficiency.

In addition, reverse transport dysfunction of cholesterol can be induced by physiological deficiencies that affect one or more steps in the transport of stored cholesterol from intracellular vesicles to the membrane surface that is accepted by HDL.

Thus, there is an increasing need for state-of-the-art techniques to identify genes involved in stages in the metabolism of cholesterol and / or lipoproteins, particularly those associated with dysfunction in the transport of cholesterol from peripheral cells to the liver.

Recently, studies have been conducted on the separation of different allelic forms of 343 microsatellite markers distributed over the entire genome and on average 10.3 cM apart from each other (Rust et al., 1998). This linkage study was conducted on families containing five blood relatives and well characterized over 11 generations, where many members have Tangier's disease. This study identified a region located at the 9q31 locus of human chromosome 9 that is statistically associated with tangerine disease.

However, Rust et al. (1998) merely identified a broad region of the genome where damage is likely to be associated with Tangier disease, and found that the related 9q31-34 region contained EST, and did not reveal any genes. Since then, about 1 cM region located at the 9q31 locus in humans has been shown to be generally associated with familial HDL deficiency (Rust et al., 1999 and Brooks-Wilson et al., 1999). More precisely, the gene encoding the protein of the ABC transporter, which is precisely located in the 1 cM region of the 9q31 locus, has been shown to be involved in the pathology associated with the lack of back transport of cholesterol. Specifically, mutations in genes encoding the ABC-1 transporter have been described in patients with impaired cholesterol transport, particularly in patients with Tangier and FHD (Rust et al., 1999, Brooks-Wilson et al. , 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999).

ABC ("ATP-binding cassette") transport proteins make up a family of proteins that have been extremely conserved during evolution, from bacteria to humans. ABC transport proteins are involved in the transport of various substrates such as, for example, ions, amino acids, peptides, sugars, vitamins or steroid hormones.

Characterization of the complete amino acid sequence of some ABC transporters suggests that these proteins have a common general structure, in particular two nucleotide binding folds with Walker A and B units and two transmembrane domains each consisting of six helices. It was possible to determine that it had (NBF). While the specificity of ABC transporters for various transported molecules appears to be determined by the structure of the transmembrane domain, the energy required for transport activity is provided by the degradation of ATP at the level of the NBF fold.

Several ABC transport proteins identified in humans are associated with various diseases. For example, cystic fibrosis is caused by mutations in the CFTR (cystic fibrosis transmembrane conductivity regulator) gene. Furthermore, several multiple tolerant phenotypes in tumor cells are associated with mutations in genes encoding MDR (multi-tolerant) proteins, which also have ABC transporter structures. Other ABC transporters, such as the ABC-3 protein, are also associated with neurological and tumor diseases (US Pat. No. 5,858,719) or potentially implicated in diseases caused by impaired bioalways of metal. Similarly, another transport ABC, named PFIC2, appears to be involved in the progressive familial hepatic biliary arrest form, which is potentially responsible for the transport of bile salts in humans.

In 1994, a cDNA encoding a new mouse ABC transporter was identified and named ABC1 (Luciani et al., 1994). The protein is characterized by an ABC transporter in that it has a symmetrical structure comprising two transmembrane domains and two NBF units linked to highly hydrophobic fragments.

In humans, partial cDNAs containing 6603 base pair (bp) open reading frames (ORFs) of human ABC1 transporters have been identified (Langmann et al., 1999). Based on this cDNA, the human ABC1 gene is expected to contain 2201 amino acids (aa), producing a protein of approximately 220 kDa size (see above). The study showed that genes encoding these human ABC1 protein isotypes are expressed in various tissues, particularly at high levels in the placenta, liver, lung, adrenal gland and several fetal tissues. The authors also found that expression of the gene encoding human ABC1 protein was induced during the differentiation of monocytes into macrophages in vitro. The study also reported that expression of the gene encoding ABC1 protein is increased when human macrophages are cultured in the presence of acetylated low density lipoprotein (AcLDL). However, it has been found that patients with Tangier and FHD disease have a mutated ABC1 gene (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999), the exact role of human ABC1 protein in lipid transport systems is unknown. It is only assumed that ABC1 protein has translocase activity on membrane phospholipid transport.

Recently, additional portions of the partial exon and intron ABC1 genomic DNA and the 3 ′ untranslated region (UTR) of human ABC1 cDNA have been isolated and identified (Rust et al., 1999).

Because patients with Tangier's disease and FHD disease were carrying mutated ABC1 genes (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, Marcil et al., 1999b, and Lawn et al., 1999), the translocase activity of human ABC1 protein on membrane lipid transport was investigated.

Applicants have discovered and isolated human ABC1 full length cDNAs containing sequences incidental to 5 ′ and 3 ′ UTR (non-detox region) and encoding ABC1 protein, which is longer than that of Langmann et al. (1999). The amino acid sequence is shown. Cholesterol and phospholipid efflux mechanisms were investigated using full length human ABC1 cDNA, demonstrating that specific activity and interaction of full length ABC1 protein with various lipid receptors promote cellular lipid efflux.

Summary of the Invention

The present invention relates to pathologies associated with cholesterol metabolic dysfunction-induced diseases such as atherosclerosis, more specifically the disruption of the reverse transport of cholesterol, and the causative genes of familial HDL deficiency, such as tangerine disease and / or FHD disease. It relates to nucleic acids corresponding to various exo and introns of the human ABC1 gene.

Thus, a first subject of the invention is a nucleic acid comprising a polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence.

The invention also provides a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) nucleotides 1-242 of SEQ ID NO: 53, or a nucleic acid comprising at least eight consecutive nucleotides of the polynucleotide sequence of the complementary polynucleotide sequence.

The invention also provides a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a nucleotide 1-242 of SEQ ID NO: 53, or a polynucleotide sequence of a complementary polynucleotide sequence.

The invention also provides a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) at least 85%, preferably 90%, more preferably 95%, even more preferably 98% of the nucleic acid comprising the nucleotides 1-242 of SEQ ID NO: 53, or the polynucleotide sequence of the complementary polynucleotide sequence; It relates to a nucleic acid having nucleotide identity.

The invention also provides a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) nucleotides 1-242 of SEQ ID NO: 53, or a nucleic acid which hybridizes under high stringency conditions with a polynucleotide of a complementary polynucleotide sequence.

The invention also relates to nucleic acids, in particular cDNA molecules, which encode the full length ABC1 protein. Accordingly, the present invention relates to a nucleic acid comprising the polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising a polynucleotide sequence represented by SEQ ID NO: 69 or SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to nucleic acids comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or complementary polynucleotide sequences.

The invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or complementary polynucleotide sequences.

Subject of the invention is also a nucleic acid having at least 80% identity with a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to nucleic acids comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or complementary polynucleotide sequences, and at least 85%, preferably 90%, more preferably 95%, Even more preferably, it relates to a nucleic acid having 98% nucleotide identity.

Another subject of the invention is a nucleic acid that hybridizes under high stringency conditions with a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.

According to the present invention, a nucleic acid comprising a polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70 encodes a full length ABC1 polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ID NO: 71.

Thus, the present invention also relates to nucleic acids encoding polypeptides comprising the amino acid sequence of SEQ ID NO: 71.

In certain embodiments, the invention also relates to nucleic acids encoding polypeptides comprising amino acids 1-60 of SEQ ID NO: 71.

Accordingly, the present invention also relates to a polypeptide comprising the amino acid sequence of SEQ ID NO: 71.

The invention also relates to a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 71.

The invention also relates to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

The invention also relates to a polypeptide comprising an amino acid having at least 80% amino acid identity with a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

The invention also relates to a polypeptide having at least 85%, preferably 90%, more preferably 95% and even more preferably 98% amino acid identity with a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71. will be.

Preferably, the polypeptide according to the invention comprises 15, 18 or 20 to 25, 35, 40, of a polypeptide according to the invention, in particular a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71; It will have 50, 70, 80, 100 or 200 consecutive amino acids in length.

In contrast, a polypeptide according to the invention comprises a polypeptide according to the invention, in particular 15, 18, 20, 25, 35, 40, 50 of a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71. , 100 or 200 contiguous amino acids in length.

The invention also relates to means of detection of polymorphisms, in particular mutations, in the corresponding proteins produced in the ABC1 gene or by the allele of the ABC1 gene. Recently, it has been shown that patients with Tangier and FHD disease carry a mutated ABC1 gene (Rust et al., 1999, Brooks-Wilson et al., 1999, Bodzioch et al., 1999, and Marcil et al., 1999b). In accordance with the present invention, several additional mutations distributed in different exons of the ABC1 gene have been identified in various patients, especially those suffering from severe forms of diseases associated with cardiovascular disorders. In addition, various polymorphisms have been found in the introns of the ABC1 gene in patients with mild forms of the disease, suggesting that these patients carry certain alleles of the gene, distinct from "wild-type" alleles. These alleles, in part characterized by these polymorphisms, are located in alternating non-coding regions, respectively on the 5 'side of the first exon of the gene or on the 3' side of the final exon, in particular in the regulatory region of the type inducing defects. For example, a substitution, addition or deletion of a nucleotide in a promoter sequence or in an enhancer sequence. Such defects can cause an increase or decrease in the synthesis of the ABC1 polypeptide.

Thus, the present invention also relates to polypeptides encoded by the mutated ABC1 gene, more particularly in patients suffering from a reverse transport deficiency of cholesterol, in particular in patients with Tangier disease.

Accordingly, the present invention relates to a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 89-102.

The invention also relates to a polypeptide comprising an amino acid sequence represented by any one of SEQ ID NOs: 89-102.

Accordingly, another subject of the invention is a nucleic acid encoding a mutated ABC1 polypeptide, wherein the nucleic acid comprises a polynucleotide sequence of any one of SEQ ID NOs: 72-88, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid encoding a mutated ABC1 polypeptide, wherein the nucleic acid comprises a polynucleotide sequence represented by any one of SEQ ID NOs: 72-88, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid encoding a polypeptide comprising any one of SEQ ID NOs: 89-102.

According to another aspect, the invention also relates to the nucleotide sequence of the ABC1 gene comprising at least one biele allele polymorphism. Accordingly, another subject of the invention is a nucleic acid comprising a polynucleotide of any one of SEQ ID NOs: 103 and 109-118, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising a polynucleotide sequence or a complementary polynucleotide sequence comprising any one of SEQ ID NOs: 103 and 109-118.

The invention also relates to a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 103 and 109-118, or a complementary polynucleotide sequence.

Nucleotide probes and primers (genomic DNA, messenger RNA, cDNA) that hybridize with nucleic acid sequences located in the region of the ABC1 nucleic acid, in particular nucleic acid sequences comprising any one of the aforementioned mutations or polymorphisms, also form part of the invention.

According to the invention, a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleic acid fragment derived from a nucleic acid comprising a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, or h) a nucleotide 1-244 of SEQ ID NO: 69, or a polynucleotide sequence of a complementary polynucleotide sequence; Useful for detecting the presence of at least one copy or fragment or variant (containing mutations or polymorphisms) of the nucleotide sequence of the ABC1 gene.

Nucleotide probes or primers according to the invention are a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary poly Nucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) at least a nucleic acid comprising a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, or h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence It contains eight consecutive nucleotides.

Preferably, the nucleotide probe or primer according to the invention is a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137 Or complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) the nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or h) the nucleotides 1-244 of SEQ ID NO: 69 or the nucleotides 1-357 of SEQ ID NO: 70, or 10 of the nucleic acid comprising the complementary polynucleotide sequence , 12, 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, 1500 consecutive nucleotides in length.

In contrast, nucleotide probes or primers according to the invention can be used for nucleic acids according to the invention, in particular a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68 And any one of 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or 12 of the nucleic acid comprising the complementary polynucleotide sequence; And fragments having 15, 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, 1500 consecutive nucleotides in length.

Thus, a nucleotide probe or primer according to the present invention may comprise a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or Complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, or h) a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence; Oligonucleotides that hybridize under stringent hybridization conditions.

Preferred probes and primers according to the invention comprise all or part of a polynucleotide sequence comprising any one of SEQ ID NOs: 119-136, 138, and 141-152, or complementary polynucleotide sequences.

Nucleotide primers according to the invention are nucleic acids according to the invention, more specifically any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or complementary polynucleotide sequences It can be used for amplification of a nucleic acid comprising a polynucleotide sequence of. Alternatively, the nucleotide primers according to the invention can be used for amplifying any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or nucleic acid fragments or variants of complementary polynucleotides. Can be.

In certain embodiments, the nucleotide primers according to the invention comprise a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or Complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, or i) a sequence Any one of Nos. 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a nucleic acid represented by a complementary polynucleotide sequence.

Another subject of the invention is a nucleic acid according to the invention contained in a sample, more specifically a polynucleotide of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137 A method of amplifying a nucleic acid, or nucleic acid fragment or variant thereof, comprising a sequence or complementary polynucleotide sequence, the method comprising: a) amplifying a sample in which the presence of the target nucleic acid is estimated, in the presence of a reagent required for the amplification reaction, and Contacting with a pair of nucleotide primers each having a hybridization position on the 5 'side and the 3' side of the target nucleic acid region of interest; b) detecting the amplified nucleic acid.

Another subject of the invention is a nucleic acid according to the invention contained in a sample, in particular a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68 And any one of 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, or i) a sequence Any one of Nos. 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a nucleic acid represented by a complementary polynucleotide sequence, the method comprising: a) Contacting the presumed sample with a pair of nucleotide primers each having a hybridization site located on the 5 'side and the 3' side of the target nucleic acid region to be amplified in the presence of the reagents required for the amplification reaction; b) detecting the amplified nucleic acid.

The invention also relates to a nucleic acid comprising a polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence, or SEQ ID NO: 1 , 4-65, 68-70, 72-88, 103, 109-118, and 137, or methods for detecting the presence of a nucleic acid fragment or variant of a complementary polynucleotide sequence in a sample, comprising: 1) Contacting one or more nucleotide probes according to the invention with a sample to be tested; 2) detecting a complex that may be formed between the nucleic acid present in the sample and the probe.

According to a particular aspect of the detection method according to the invention, the oligonucleotide probe is immobilized on a support.

According to another aspect, the oligonucleotide probe comprises a detectable marker.

Another subject of the invention is a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68-70, and 137, or complementary poly Nucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, or h) any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137 Or an amplification box or kit of nucleic acid represented by a complementary polynucleotide sequence, wherein the box or kit comprises: 1) hybridization sites located on the 5 'and 3' sides of the target nucleic acid region to be amplified, respectively. A pair of nucleotide primers along; And optionally 2) reagents required for the amplification reaction.

Such amplification boxes or kits will preferably comprise at least one pair of nucleotide primers as described above.

In addition, subject matter of the present invention may include a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary poly Nucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotide sequences, or h) all or part of an amplification box or kit of nucleic acid comprising a nucleotide of SEQ ID NO: 69 or a nucleotide of SEQ ID NO: 70, or a complementary polynucleotide sequence; This box or kit comprises: 1) a pair of nucleotide primers according to the invention wherein hybridization sites are located on the 5 'and 3' sides of the target nucleic acid region to be amplified; And optionally 2) reagents required for the amplification reaction.

Such amplification boxes or kits will preferably comprise at least one pair of nucleotide primers as described above.

The invention also relates to a detection box or kit for the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) at least one nucleotide probe according to the invention; b) optionally, reagents necessary for the hybridization reaction.

According to a first aspect, the detection box or kit is characterized in that the nucleotide probe and primer are immobilized on the support.

According to a second aspect, the detection box or kit is characterized in that the nucleotide probe and the primer comprise a marker detectable.

According to certain embodiments of the above-described detection kits, such kits can be used for the detection of a corresponding target nucleic acid or alternatively for the detection of mutations in non-coding or coding regions of nucleic acids according to the invention. And / or primers. According to a preferred embodiment of the invention, the target nucleic acid comprises a polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary nucleic acid sequence. . In contrast, the target nucleic acid is a nucleic acid fragment or variant of a nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence.

According to a preferred embodiment, the two primers according to the invention are all or part of SEQ ID NOs: 125 and 126, or complementary polynucleotides which allow for amplification of the exon 5 region of the ABC1 gene carrying a mutation as indicated in SEQ ID NO: 72 above Nucleic acids having a sequence.

According to a second preferred embodiment, the two primers according to the invention are all of SEQ ID NOs: 127 and 128 which enable amplification of the region of exon 6 of the ABC1 gene carrying a mutation as indicated above in SEQ ID NOS: 73 or 74, or Nucleic acids having some, or complementary, polynucleotide sequences.

According to a third preferred embodiment, the two primers according to the invention are all of SEQ ID NOs 131 and 132 which enable amplification of the region of exon 8 of the ABC1 gene carrying a mutation as indicated above in SEQ ID NOs 75-77 or Nucleic acids having some, or complementary, polynucleotide sequences.

According to a fourth preferred embodiment, the two primers according to the invention are all or part of SEQ ID NOs. 155 and 156 which enable amplification of the region of exon 27 of the ABC1 gene carrying a mutation as indicated in SEQ ID NO: 84, as described above, Or nucleic acids having complementary polynucleotide sequences.

According to a fifth preferred embodiment, the two primers according to the invention are all or part of SEQ ID NOs: 159 and 160 which enable amplification of the region of exon 32 of the ABC1 gene carrying a mutation as indicated by SEQ ID NO: 85, as described above, Or nucleic acids having complementary polynucleotide sequences.

According to a sixth preferred embodiment, the two primers according to the invention are all of SEQ ID NOs 175 and 176 which enable amplification of the region of exon 47 of the ABC1 gene carrying a mutation as indicated above in SEQ ID NOs 87 or 88 or Nucleic acids having some, or complementary, polynucleotide sequences.

According to another preferred embodiment, the primers according to the invention generally comprise all or part of any one of SEQ ID NOs: 119-136, 138, and 141-152, or complementary sequences.

The invention also relates to a recombinant vector comprising a nucleic acid according to the invention. Preferably such recombinant vector will comprise a nucleic acid selected from the group consisting of:

a) a nucleic acid comprising the polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence,

b) a nucleic acid comprising a polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a polynucleotide sequence represented by a complementary polynucleotide sequence,

c) a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence,

d) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids having at least 8 consecutive nucleotides of nucleic acid;

e) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids having at least 80% nucleotide identity with the nucleic acid;

f) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids having 85%, 90%, 95%, or 98% nucleotide identity with the nucleic acid;

g) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids that hybridize with nucleic acids under high stringency hybridization conditions;

h) a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71; And

i) a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

According to a first aspect, the recombinant vector according to the invention is used for amplification of the inserted nucleic acid following transformation or transfection of the desired cell host.

According to a second aspect, the recombinant vector according to the present invention corresponds to an expression vector comprising, in addition to the nucleic acid according to the present invention, a regulatory signal or nucleotide sequence that directs or regulates the transcription and / or translation of the nucleic acid and its encoded mRNA. .

According to a preferred embodiment, the recombinant vector according to the invention will in particular comprise the following components:

(1) elements or signals for regulating the expression of the nucleic acid to be inserted, such as promoter and / or enhancer sequences;

(2) the nucleotide coding region contained in the nucleic acid according to the present invention to be inserted into the vector (the coding region is arranged in phase with the regulatory element or signal described in (1)); And

(3) A suitable nucleic acid for initiation and termination of transcription of the nucleotide coding region of the nucleic acid described in (2).

The invention also relates to a defective recombinant virus comprising a cDNA nucleic acid encoding the ABC1 polypeptide involved in the transport and metabolism of cholesterol. In another preferred embodiment of the invention, the defective recombinant virus comprises a gDNA nucleic acid encoding an ABC1 polypeptide involved in the transport and metabolism of cholesterol. Preferably, the ABC1 polypeptide comprises the amino acid sequence of SEQ ID 71. More preferably, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

In another preferred aspect, the invention relates to a defective recombinant virus comprising a nucleic acid encoding ABC1 protein involved in the transport and metabolism of cholesterol under the control of a promoter selected from the RSV-LTR or CMV early promoter.

According to certain embodiments, the method of introducing a nucleic acid according to the invention into a host cell, in particular into a host cell obtained from a mammal, is carried out in a pharmaceutically suitable vector and under the control of an appropriate regulatory sequence. While an agent comprising a "naked" nucleic acid according to the present invention is introduced at the level of a selected tissue, for example smooth muscle tissue, by topical injection, the "naked" nucleic acid is taken up by the cells of said tissue.

According to certain embodiments of the invention, the composition is provided for in vivo production of ABC1 protein. The composition comprises a nucleic acid encoding an ABC1 polypeptide disposed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vehicle and / or excipient.

Accordingly, the present invention also relates to compositions comprising nucleic acids encoding polypeptides comprising the amino acid sequence of SEQ ID NO: 71, wherein the nucleic acids are arranged under the control of appropriate regulatory elements.

The invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising a amino acid of SEQ ID NO: 71, wherein the nucleic acid is placed under the control of appropriate regulatory elements.

Accordingly, the present invention also relates to a pharmaceutical composition for the prevention or treatment of a patient or subject with a back transport dysfunction of cholesterol comprising a nucleic acid encoding ABC1 protein, together with one or more physiologically suitable excipients.

Preferably such composition will comprise a nucleic acid comprising the polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70, wherein the nucleic acid is placed under the control of an appropriate regulatory element or signal.

In addition, a subject of the invention is a pharmaceutical composition for the prophylaxis or treatment of a patient or subject with a reverse transport dysfunction of cholesterol comprising a recombinant vector according to the invention with one or more physiologically suitable excipients.

The present invention also relates to the use of a nucleic acid according to the invention encoding the ABC1 protein for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for the treatment of a subject suffering from reverse transport dysfunction of cholesterol.

The invention also relates to the use of a recombinant vector according to the invention comprising a nucleic acid encoding ABC1 protein for the preparation of various forms of atherosclerosis or more specifically for the treatment of a subject suffering from reverse transport dysfunction of cholesterol. It is about.

Accordingly, the subject of the present invention is a recombinant vector comprising a nucleic acid according to the present invention encoding an ABC1 protein or polypeptide involved in the metabolism of cholesterol.

The invention also provides for the preparation of pharmaceutical compositions for the treatment and / or prophylaxis of cardiovascular diseases or symptoms associated with HDL deficiency, such as HDL deficiency, HDL deficiency, LCAT deficiency, malaria, and diabetes associated with Tangerine disease and / or FHD disease. It relates to the use of said recombinant vector for.

The invention also relates to the use of cells which have been genetically modified ex vivo with said recombinant vector according to the invention, or cells which produce a recombinant vector, to allow long-term and effective in vivo expression of a biologically active ABC1 polypeptide. Is implanted in the body.

The present invention further relates to the use of the nucleic acid according to the invention encoding the ABC1 protein for the prevention or treatment of various forms of atherosclerosis or specifically for the preparation of a medicament for the treatment of a subject with a reverse transport dysfunction of cholesterol.

The present invention also provides a nucleic acid encoding the ABC1 polypeptide according to the invention for the preparation of a medicament for the prevention of various forms of atherosclerosis or specifically for the treatment of a subject suffering from reverse transport of cholesterol. It relates to the use of recombinant vectors.

The present invention also provides a nucleic acid encoding the ABC1 polypeptide according to the invention for the preparation of a medicament for the prevention of various forms of atherosclerosis or specifically for the treatment of a subject suffering from reverse transport of cholesterol. It relates to the use of recombinant host cells.

The invention also relates to the use of a recombinant vector, preferably a defective recombinant virus, according to the invention for the manufacture of a pharmaceutical composition for the treatment and / or prophylaxis of pathologies associated with the transport of cholesterol.

The present invention relates to the use of recombinant vectors or defective recombinant viruses for the preparation of pharmaceutical compositions for the treatment and / or prevention of cardiovascular diseases associated with cholesterol back transport deficiency. Accordingly, the invention also relates to pharmaceutical compositions comprising one or more recombinant vectors or defective recombinant viruses according to the invention.

The invention also relates to the use of cells which are genetically modified ex vivo with the virus according to the invention, transplanted into the body, and which permit the sustained and effective in vivo expression of biologically active ABC1 protein.

The present invention shows that nucleic acids encoding ABC1 polypeptides according to the present invention can be incorporated into viral vectors and that these vectors can effectively express biologically active and mature polypeptides. More specifically, the present invention can be achieved by the in vivo expression of ABC1 by direct administration of adenoviruses or by transplantation of genes modified by production cells or adenoviruses or by retroviruses incorporating such nucleic acids. have.

In this regard, another subject of the invention relates to mammalian cells infected with one or more defective recombinant viruses according to the invention. More specifically, the present invention relates to any population of human cells infected with these viruses. These may be certain cells of blood origin (differentiated pluripotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.

Another subject of the invention relates to a graft comprising a mammalian cell or a cell producing a recombinant virus infected with one or more defective recombinant viruses according to the invention, and an extracellular matrix. Preferably, the graft according to the invention comprises 10 ⁵ to 10 ¹⁰ cells. More preferably, they comprise 10 ⁶ to 10 ⁸ cells.

More specifically, in the graft of the present invention, the extracellular matrix comprises a gelling compound and optionally a support that allows fixation of cells.

The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, more specifically a nucleic acid of SEQ ID NO: 69 or SEQ ID NO: 70, or a nucleic acid of a complementary polynucleotide sequence.

The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, more specifically a nucleic acid comprising a nucleotide represented by SEQ ID NO: 69 or SEQ ID NO: 70, or a nucleic acid of a complementary polynucleotide sequence.

Specifically, the present invention provides a recombinant host comprising a nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a nucleic acid of a complementary polynucleotide sequence. It is about a cell.

The invention also provides a recombinant comprising a nucleic acid comprising a polynucleotide represented by any of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a nucleic acid of a complementary polynucleotide sequence. It relates to a host cell.

The present invention also relates to a recombinant host cell comprising a nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or nucleic acids of complementary polynucleotide sequences.

The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71.

The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

According to another aspect, the invention also relates to a recombinant host cell comprising the recombinant vector according to the invention. Accordingly, the present invention also relates to recombinant host cells comprising a nucleic acid of the invention, in particular a recombinant vector comprising a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70 or a nucleic acid of complementary polynucleotide.

Specifically, the present invention provides a recombinant comprising a nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a nucleic acid of a complementary polynucleotide sequence. It relates to a recombinant host cell comprising a vector.

The invention also includes nucleic acids comprising polynucleotide sequences represented by any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or nucleic acids of complementary polynucleotide sequences. It relates to a recombinant host cell comprising a recombinant vector.

The invention also relates to a recombinant host cell comprising a nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a recombinant vector comprising a complementary polynucleotide sequence.

The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID 71.

The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising an amino acid of SEQ ID 71.

The present invention also relates to a method for preparing a polypeptide comprising an amino acid of any one of SEQ ID NOs: 71 and 89-102, or a peptide fragment thereof or a variant thereof, wherein the peptide fragment or variant is an amino acid of SEQ ID NO: 71 1-60, wherein the method

a) inserting the nucleic acid encoding the polypeptide into a suitable vector;

b) in a suitable culture medium, culturing the previously transformed host cell or transfecting the host cell with the recombinant vector of step a);

c) recovering the conditional culture medium or lysing the host cells, for example by sonication or osmotic shock;

d) separating and purifying the polypeptide from the culture medium or otherwise from the cell lysate obtained in step c);

e) optionally, characterizing the resulting recombinant polypeptide.

Certain embodiments of the present invention relate to a method for preparing a polypeptide comprising the amino acid sequence of amino acids 1-60 of SEQ ID NO: 71.

Polypeptides having an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71 and polypeptides referred to as “homology” also form part of the invention. Such homologous polypeptides comprise an amino acid sequence that retains one or more amino acid substitutions by equivalent amino acids, relative to amino acids 1-60 of SEQ ID NO: 71.

ABC1 polypeptide according to the present invention in particular 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NO: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) SEQ ID NO: Polypeptide fragment or variant of the polypeptide comprising the amino acid sequence of any one of 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) SEQ ID NO: Polypeptides comprising amino acids 1-60 of 71 include polypeptides referred to as “homology”.

In certain embodiments, an antibody according to the invention comprises: 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) a sequence Polypeptide fragment or variant of the polypeptide comprising the amino acid sequence of any one of Nos. 71 and 89-102, wherein the polypeptide fragments or variants include amino acids 1-60 of SEQ ID NO: 71, or 4) To a polypeptide called “homology” to a polypeptide comprising amino acids 1-60 of number 71.

The present invention relates to a polypeptide comprising: 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) of SEQ ID NOs: 71 and 89-102 Polypeptide fragment or variant of a polypeptide comprising any one amino acid sequence, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) amino acids 1-60 of SEQ ID NO: 71 An antibody against a polypeptide called “homology” to a polypeptide comprising: forms part of the invention and is produced by a trioma technique or by a hybridoma technique described by Kozbor et al. (1983b). .

Accordingly, the subject of the invention is also a method for detecting the presence of a polypeptide according to the invention in a sample, the method of

a) a sample to be tested comprises 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) SEQ ID NO: 71 and Polypeptide fragment or variant of the polypeptide comprising the amino acid sequence of any one of 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) of SEQ ID NO: 71 Contacting a polypeptide comprising amino acids 1-60 with an antibody against a polypeptide called " homology "

b) detecting the formed antigen / antibody complex.

The invention also relates to a box or kit for diagnosing or detecting the presence of a polypeptide according to the invention in a sample, wherein the box is

a) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising the amino acids 1-60 of SEQ ID NO: 71, 3) any of SEQ ID NOs: 71 and 89-102 Polypeptide fragments or variants of the polypeptide comprising one amino acid sequence, wherein the polypeptide fragments or variants include amino acids 1-60 of SEQ ID NO: 71, or 4) amino acids 1-60 of SEQ ID NO: 71 An antibody against a polypeptide referred to as "homology" to a containing polypeptide, and

b) reagents that allow detection of the formed antigen / antibody complex.

The invention also relates to a pharmaceutical composition comprising a nucleic acid according to the invention.

The invention also includes a pharmaceutical composition comprising a nucleic acid encoding an ABC1 polypeptide according to the invention and an ABC1 polypeptide according to the invention for the treatment of diseases associated with cholesterol back transport deficiency such as tangerine disease and / or FHD disease. It provides a pharmaceutical composition.

The present invention also relates to novel therapies for the treatment of pathologies associated with cholesterol transport, in vivo delivery and expression of nucleic acids encoding the ABC1 protein according to the invention. In particular, the present invention provides new therapies for the treatment and / or prevention of HDL deficiencies, such as HDL deficiency, HDL deficiency, LCAT deficiency, malaria, and diabetes associated with Tangerine disease and / or FHD disease.

Accordingly, the present invention provides new methods for the treatment and prevention of cardiovascular and neurological pathologies associated with abnormalities in the transport and metabolism of cholesterol. In particular, the present invention provides a method for repairing or promoting enhanced back transport of cholesterol in a patient or subject.

As a result, the present invention also relates to a pharmaceutical composition for preventing or treating a subject suffering from reverse transport dysfunction of cholesterol, comprising a nucleic acid encoding the ABC1 protein together with one or more physiologically suitable vehicles and / or excipients.

According to certain embodiments of the present invention, a composition for in vivo production of ABC1 protein is provided. Such compositions comprise nucleic acids encoding ABC1 polypeptides that are placed under the control of appropriate regulatory sequences, in solution in a physiologically suitable vehicle and / or excipient.

Accordingly, the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71, wherein the nucleic acid is arranged under the control of appropriate regulatory elements.

The invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising a amino acid of SEQ ID NO: 71, wherein the nucleic acid is arranged under the control of an appropriate regulatory element.

Preferably such compositions will comprise nucleic acids comprising the polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70, arranged under the control of appropriate regulatory elements.

The invention also relates to a pharmaceutical composition for the prevention or treatment of a subject suffering from reverse transport dysfunction of cholesterol, comprising the recombinant vector according to the invention together with one or more physiologically suitable vehicles and / or excipients.

According to another aspect, the subject of the present invention is also a method for the prevention or curative treatment of diseases caused by deficiency in cholesterol metabolism, specifically in the transport of cholesterol, more specifically in the transport of cholesterol. Administering to the patient a nucleic acid encoding an ABC1 polypeptide according to the invention, wherein the nucleic acid is optionally combined with one or more physiologically suitable vehicles and / or excipients.

The present invention provides a method for treating cholesterol, comprising a polypeptide having an amino acid sequence of SEQ ID NO: 71 or a polypeptide therapeutically effective amount comprising amino acids 1-60 of SEQ ID NO: 71 in combination with one or more physiologically suitable vehicles and / or excipients. The present invention relates to a pharmaceutical composition for preventing or treating a patient or a subject suffering from reverse transport dysfunction.

According to a specific embodiment, a method for introducing a nucleic acid according to the invention into a host cell, in particular a host cell obtained in vivo from a mammal, comprises a pharmaceutically suitable vector and according to the invention under the control of appropriate regulatory sequences. Introducing an agent comprising a naked "nucleic acid at the level of a selected tissue, eg, smooth muscle tissue, by topical injection, wherein the" naked "nucleic acid is taken up by cells of said tissue.

According to another aspect, the subject matter is also a prophylactic or curative treatment of a disease caused by deficiency in cholesterol metabolism, specifically in the transport of cholesterol, more specifically in the transport of cholesterol. Administering to a patient a therapeutically effective amount of an ABC1 polypeptide according to the invention, wherein the polypeptide is optionally combined with one or more physiologically suitable vehicles and / or excipients.

Preferably, the pharmaceutical composition comprising the ABC1 polypeptide according to the present invention will be administered to a patient. Accordingly, the present invention also relates to pharmaceutical compositions for the prevention or treatment of cholesterol metabolism such as atherosclerosis, in particular the transport of cholesterol, more particularly the deficiency of the reverse transport of cholesterol, which are normal ABC1 polypeptides, in particular amino acids of SEQ ID NO: 71 A therapeutically effective amount of a nucleic acid encoding an ABC1 polypeptide having a sequence. In certain embodiments, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

The subject matter also relates to pharmaceutical compositions for the prevention or treatment of cholesterol metabolism such as atherosclerosis, in particular the transport of cholesterol, more specifically the deficiency of the transport of cholesterol, which is a normal ABC1 polypeptide, in particular the amino acid of SEQ ID 71 A therapeutically effective amount of a polypeptide having a sequence. In certain embodiments, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

The present invention also provides small molecules and compounds that act on ABC1 protein to identify agonists and antagonists of the ABC1 polypeptide that are capable of repairing or promoting enhanced back transport of cholesterol to effectively cope with atherosclerosis from a therapeutic standpoint. It provides a method of screening. This method has been used therapeutically in the treatment of diseases caused by deficiencies in the metabolism of cholesterol, in particular the transport of cholesterol, more specifically the reverse transport of cholesterol, such as tangerine disease, and more generally FHD type symptoms. It is useful for the identification of small molecules and compounds.

Accordingly, the present invention also relates to the use of ABC1 polypeptides or cells expressing ABC1 polypeptides according to the invention for the screening of active ingredients for the prevention or treatment of diseases resulting from the reverse transport dysfunction of cholesterol.

The present invention also relates to a method for screening a compound or small molecule, an agonist or antagonist of ABC1 polypeptide, which is active in the metabolism of cholesterol, the method comprising the following steps:

a) preparing a membrane vesicle comprising a lipid substrate comprising an ABC1 polypeptide and a detectable marker;

b) culturing the vesicle obtained in step a) with an agonist or antagonist candidate compound;

c) qualitative and / or quantitative measurement of lipid substrate release comprising a detectable marker; And

d) measuring the release of the labeled lipid substrate by vesicles not previously cultured with the agonist or antagonist candidate compound and comparing the release measurements obtained in step b).

In a first specific embodiment, the ABC1 polypeptide comprises SEQ ID NO: 71.

In a second specific embodiment, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

The invention also relates to a method for screening a compound or small molecule active in the metabolism of cholesterol, an agonist or antagonist of ABC1 polypeptide, the method comprising the following steps:

a) transfecting cells natively or with ABC1 encoding nucleic acid, followed by obtaining cells expressing ABC1 polypeptide, eg, cell lines;

b) culturing the cell of step a) in the presence of an anion labeled with a detectable marker;

c) washing the cells of step b) to remove excess labeled anions that did not penetrate into these cells;

d) culturing the cells obtained in step c) with an agonist or antagonist candidate compound for ABC1 polypeptide;

e) measuring the outflow of labeled anions; And

f) comparing the outflow of the labeling anion measured with cells not previously cultured in the presence of an agonist or antagonist candidate compound for the ABC1 polypeptide and the outflow of the labeling anion measured in step e).

In a first specific embodiment, the ABC1 polypeptide comprises SEQ ID NO: 71.

In a second specific embodiment, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

Subject of the invention is a method of screening for compounds or small molecules active in the metabolism of cholesterol, agonists or antagonists of the ABC1 polypeptide, the method comprising the following steps:

a) cell culturing the human monocyte cell line in a suitable culture medium in the presence of purified human albumin;

b) the cell culture step of step a) in the presence of a compound which simultaneously stimulates the production of IL-1 beta and an agonist or antagonist candidate compound;

c) culturing the cells obtained in step b) in the presence of appropriate concentrations of ATP;

d) measurement of IL-1 beta released into cell culture supernatant; And

e) comparing the value of IL-1 beta released into the culture supernatant of cells not previously cultured in the presence of an agonist or antagonist candidate compound with the release of IL-1 beta obtained in step d).

The present invention relates to a variety of ABC1 genes, which are causes of cholesterol metabolic dysfunction disorders such as atherosclerosis, more specifically, disruption of cholesterol back transport, and more specifically pathologies associated with familial HDL deficiency (FHD), such as Tangier disease. It relates to nucleic acids corresponding to exons and introns. The present invention also relates to ABC1 cDNA encoding the novel full length ABC1 protein. The invention also relates generally to means for detecting polymorphisms, in particular mutations, in the ABC1 gene or in the corresponding protein produced by the allele of the ABC1 gene.

1: ABC1 5 ′ cDNA extension strategy;

Figure 2: Agarose gel analysis of primary and secondary human ABC1 5'cDNA extension PCR reactions;

Figure 3: Agarose gel analysis of nested secondary human ABC1 5'cDNA extended nesting PCR reactions;

Figure 4: Determination of cholesterol efflux in HeLa cell lines expressing human full length ABC1 protein in the absence or presence of apolipoproteins;

Figure 5: Determination of phospholipid efflux in HeLa cell lines expressing human full length ABC1 protein in the absence or presence of apolipoproteins;

Figure 6a: Determination of Cholesterol Runoff in the absence or presence of apo lipoprotein A-I (AI);

Figure 6b: Measurement of phospholipid outflow in the absence or presence of apo lipoprotein A-I (AI);

FIG. 6C: Measurement of Cholesterol efflux with or without HDL;

Figure 6D: Measurement of Cholesterol efflux in the absence or presence of phosphatidylcholine (PC);

Fig. 7: [ ¹²⁵ I] apoA-I cultured ABC1 cells in the absence of apofatty protein □, in the presence of apofatty protein AI (apoA-I) or the presence of apofatty protein A-II (apo-II) Is placed in Ha.

General definition

The present invention contemplates the isolation of genes encoding the ABC1 polypeptides of the invention, including antigenic fragments from the full length, or native form, of ABC1, and from animals, particularly mammals or birds, more specifically of human origin. do.

According to the present invention, conventional molecular biology, microbiology, and recombinant DNA techniques within the art can be used. Such techniques are described in detail in the literature. See, eg, Sambrook et al., 1989; Glover, 1985; Gait, 1984; Hames and Higgins, 1985; Hames and Higgins, 1984; Freshney, 1986; Perbal, 1984; and F. Ausubel et al., 1994].

Thus, when appearing herein, the following terms have the definitions set forth below.

As used herein, the term "gene" refers to an assembly of nucleotides encoding a polypeptide and includes cDNA and genomic DNA nucleic acids.

For the purposes of the present invention, the term "isolated" refers to a biological material (nucleic acid or protein) that has been removed from its original environment (the environment in which it originally existed).

For example, polynucleotides that exist naturally in plants or animals are not isolated. Identical polynucleotides isolated from adjacent nucleic acids that are naturally inserted into the genome of a plant or animal are considered "isolated".

Such polynucleotides may be included in the vector and / or such polynucleotides may be included in the composition but nevertheless remain separated due to the fact that the vector or composition does not constitute a natural environment.

The term "purified" does not require the presence of a substance in a form that exhibits absolute purity, excluding the presence of other compounds. This is rather a relative definition.

The polynucleotides are in a "purified" state after purification of the starting material or natural material by at least one, preferably two or three and preferably four or five fold order of magnitude.

For the purposes of the present invention, the expression “nucleotide sequence” can be used to refer to a polynucleotide or nucleic acid. The expression "nucleotide sequence" includes the genetic material itself and is therefore not limited to information about its sequence.

The terms “nucleic acid”, “polynucleotide”, “oligonucleotide” or “nucleotide sequence” include RNA, DNA, gDNA or cDNA sequences, or alternatively RNA / DNA hybrid sequences of one or more nucleotides, and are single-chain Or double helix, double-stranded.

"Nucleic acid" is a polymeric compound composed of covalently bonded subunits called nucleotides. Nucleic acids include polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single or double stranded. DNA may be cDNA, genomic DNA, synthetic DNA, semisynthetic DNA. The sequence of nucleotides encoding a protein is called a sense sequence or coding sequence.

The term “nucleotide” includes modifications comprising at least one modification, such as natural nucleotides (A, T, G, C) and (1) homologues of purine, (2) homologues of pyrimidine, or (3) analogous sugars. And all modified nucleotides, examples of such modified nucleotides are described, for example, in PCT Application No. WO95 / 04 064.

For the purposes of the present invention, the first polynucleotide is considered "complementary" to the second polynucleotide when each base of the first nucleotide is paired with the complementary base of the second polynucleotide with the opposite orientation. Complementary bases are A and T (or A and U), or C and G.

"Heterologous" DNA refers to DNA that is not natively located in a cell or in a chromosomal site of a cell. Preferably, the heterologous DNA comprises a foreign gene for the cell.

As used herein, the term “homology” in both grammatical form and spelling modifications refers to proteins from the superfamily (eg, immunoglobulin superfamily) and homologous proteins from different species (eg, Light chains, etc. (Reeck et al., 1987), and the relationship between proteins having a "common evolutionary origin". As high sequence similarity reflects, such proteins (and their coding genes) have sequence homology.

Thus, the term "sequence similarity" in all grammatical forms refers to the degree of identity or correspondence between amino acid sequences or nucleic acids of a protein that may or may not share a common evolutionary origin (Reeck et al., Supra). However, in common usage and the present application, the term “homology” may mean sequence similarity when modified with an adverb such as “highly” and does not mean a common evolutionary origin.

In certain embodiments, two DNA sequences are “substantially homologous” when at least about 50% (preferably at least about 75%, more preferably at least about 90 or 95%) of the nucleotides are matched over a defined length of the DNA sequence. "Or" substantially similar ". Substantially homologous sequences can be compared using standard software available in the Sequence Data Bank, or identified in Southern hybridization experiments under stringent conditions, eg, as defined for a particular system. The definition of suitable hybridization conditions is within the skill of the art. See, eg, Maniatis et al., Supra; Glover et al., 1985; See Hames and Higgins, 1985.

Likewise, in certain embodiments, two or more amino acid sequences are "substantially homologous" or "substantially similar" when at least 30% of the amino acids are identical or at least about 60% are similar (functionally identical). Preferably, similar or homologous sequences are identified by alignment using, for example, a Genetic Computer Group, Program Manual for GCG Package, Version 7, Madison, Wisconsin (GCG) fileup program.

For the purposes of the present invention, "% identity" between two nucleotide or amino acid sequences can be determined by comparing two optimally aligned sequences through a comparison window.

Thus, the nucleotide or polypeptide sequence portion in the comparison window may include additions or deletions (eg, “gaps”) relative to the reference sequence to obtain an optimal alignment of the two sequences (the reference sequence may be such an addition or Does not include fruiting).

Percent measures the number of positions where the same nucleic acid base or the same amino acid residue is observed for two compared sequences, then divides the number of positions with identity between the two bases or amino acid residues by the total number of positions in the comparison window and percent It is calculated by doubling the results obtained to obtain sequence identity.

Optimal sequence alignment for comparison can be achieved using a computer with the aid of known algorithms contained in packages from WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, WISCONSIN.

By way of example, with the help of BLAST software (version BLAST 1.4.9 of March 1996, BALST 2.0.4 of February 1998 and BLAST 2.0.6 of September 1998), exclusive default parameters (Altschul et al. 1990; Altschul et al, 1997) it will be possible to calculate percent sequence identity. Blast is described in Altschul et al. With the aid of the algorithm the similar / homologous sequences for the reference “billing” sequences are searched. The database used with the claimed sequence can be peptide or nucleic acid, and any combination.

The term "corresponding" is used herein to mean similar or homologous sequences, and the exact position is the same or different from the molecule for which similarity or homology is measured. Nucleic acid or amino acid sequence alignments can include spaces. Thus, the term "corresponding" means sequence similarity and does not mean numbering amino acid residues or nucleotide bases.

The genes encoding the ABC1 polypeptides of the invention, whether genomic DNA or cDNA, can be isolated from any source, in particular human cDNA or genomic rybraries. Gene harvesting methods are well known in the art as described above (see, eg, Sambrook et al., 1989).

Thus, animal cells can potentially serve as a nucleic acid source for molecular cloning of the ABC1 gene. DNA can be obtained from cloned DNA (eg, DNA "library") by standard procedures known in the art, preferably by chemical synthesis, from cDNA libraries prepared from high-level expressing tissue of proteins, by cDNA cloning, cloning of purified genomic DNA, or fragments thereof, from cells of interest (see, eg, Sambrook et al., 1989; Glover, 1985). Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; Clones derived from cDNA will not contain intron sequences. Any source, the gene must be molecularly cloned into a vector suitable for gene propagation.

In molecular cloning of a gene from genomic DNA, a DNA fragment is produced in which some will encode the gene of interest. DNA can be cleaved at specific sites using various restriction enzymes. Alternatively, DNAse may be used in the presence of manganese to fragment the DNA, or the DNA may be physically sheared, for example by sonication. The linear DNA fragments can then be separated by size by standard techniques, including but not limited to agarose and polyacrylamide gel electrophoresis and column chromatography.

Once the DNA fragments are generated, identification of specific DNA fragments containing the desired ABC1 gene can be accomplished in a number of ways. For example, if the amount of a portion of the ABC1 gene or specific RNA thereof, or fragment thereof, is available and can be purified and labeled, the resulting DNA fragment can be screened by nucleic acid hybridization with a labeled probe ( Benton and Davis, 1977; Grunstein and Hogness, 1975). For example, partial amino acid sequences obtained for ABC1 protein, as performed in certain examples (described below), or as cDNA or mRNA (eg, in combination with poly-T primers for RT-PCR). A set of oligonucleotides corresponding to the information can be prepared and used as a probe for DNA encoding ABC1. Preferably, highly specific fragments of the ABC1 nucleic acid or polypeptide of the invention are selected. These DNA fragments, which are substantially homologous to the probe, will hybridize. As mentioned above, the greater the homology, the more stringent hybridization conditions can be used. In certain embodiments, stringent hybridization conditions are used to identify homologous ABC1 genes.

For example, if a gene encodes a protein product having an isoelectric, electrophoretic, amino acid composition, or a partial amino acid sequence of the ABC1 protein disclosed herein, further selection may be made based on the characteristics of the gene. Thus, the presence of a gene can be detected by analysis based on the physical, chemical, or immunological properties of its expression product. For example, cDNA clones, or DNA clones, may be selected that hybridly select the appropriate mRNA, for example similar or identical isoelectric shifts, electrophoretic focusing or non-equilibrium pH gel electrophoresis behavior, proteolytic maps, or Produce proteins with known antigenic properties for ABC1.

ABC1 genes of the invention can be identified by mRNA selection, ie by nucleic acid hybridization followed by in vitro translation. In this procedure, nucleotide fragments are used to separate complementary mRNAs by hybridization. Such DNA fragments may represent the purified ABC1 DNA available, or may be synthetic oligonucleotides designed from partial amino acid sequence information. Immunoprecipitation assays or functional assays (eg tyrosine phosphatase activity) of the in vitro translation products of the isolated mRNA products identify the complementary DNA fragments containing the mRNA, and thus the desired sequence. In addition, certain mRNAs can be selected by adsorbing a polysome isolated from a cell to an immobilized antibody specific for the ABC1 polypeptide of the invention.

Radiolabeled ABC1 cDNA can be synthesized using selected mRNA (from adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA can then be used as a probe to identify homologous ABC1 DNA fragments from other genomic DNA fragments.

A “variant” of a nucleic acid according to the invention will be understood to mean a nucleic acid which differs from one or more bases relative to the reference polynucleotide. Variant nucleic acids may be naturally occurring, such as naturally occurring allelic variants, or may be, for example, non-natural variants obtained by mutation techniques.

In general, the difference between a reference (generally wild-type) nucleic acid and a variant nucleic acid is so small that the nucleotide sequences of the reference nucleic acid and the variant nucleic acid are nearly similar and identical in many regions. Nucleotide modifications present in variant nucleic acids may be "silent" which means not altering the amino acid sequence encoded by the variant nucleic acid.

However, changes in nucleotides in variant nucleic acids may result in substitutions, additions or deletions in polypeptides encoded by variant nucleic acids relative to polypeptides encoded by reference nucleic acids. In addition, nucleotide modifications in the coding region can result in conservative or non-conservative substitutions of the amino acid sequence of the polypeptide.

Preferably, the variant nucleic acid according to the present invention is a polynucleotide which substantially preserves the same function or biological activity as the polypeptide of the reference nucleic acid or which is recognized by the antibody against the polypeptide encoded by the initial reference nucleic acid. Encode the peptide.

In this way some variant nucleic acids will encode a mutant type of polypeptide that allows its structural studies to infer the structure-activity relationship of the protein. Knowledge of these variants about the disease studied is essential as it allows us to understand the molecular cause of the pathology.

A “fragment” will be understood as a nucleotide sequence having a reduced length relative to the reference nucleic acid and comprising the same nucleotide sequence as the reference nucleic acid over a consensus portion. Such nucleic acid “fragments” according to the invention may optionally be included in larger polynucleotides from which it is a constituent. Such fragments may contain up to 8, 10, 12, 15, 18, 20-25, 30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 conservative nucleotides of a nucleic acid according to the present invention. Or comprise an oligonucleotide leading to

"Nucleic acid molecule" means a nucleoside (adenosine, guanosine, uridine or cytidine; "RNA molecule") or deoxyribonucleoside (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxy Cytidine; "DNA molecule"), or phosphate ester polymer forms (single- or double-stranded helices) of their phosphoester homologues, such as phosphorothioates and thioesters. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The terms nucleic acid molecule and especially DNA or RNA molecule refer to the primary and secondary structures of the molecule and are not limited to any particular tertiary type. Thus, the term specifically includes linear or cyclic DNA molecules (eg, restriction fragments), plasmids, and double-stranded DNA found in chromosomes. In discussing the structure of a particular double-stranded DNA molecule, the sequence is in accordance with the general arrangement of giving only 5 'to 3' sequences along the non-transcribed strand of DNA (ie, the strand with the sequence homologous to the mRNA). It may be described herein. A "recombinant DNA molecule" is a DNA molecule that has undergone molecular biological manipulation.

When the single stranded form of a nucleic acid can be annealed with other nucleic acid molecules under suitable conditions of temperature and solution ionic strength, the nucleic acid molecule is "hybridizable" with other nucleic acid molecules such as cDNA, genomic DNA, or RNA (Sambrook et. al., supra). The conditions of temperature and ionic strength determine the "stringency" of hybridization. For preliminary screening of homologous nucleic acids, low stringency hybridization conditions corresponding to Tm of 55 ° C., such as 5 × SSC, 0.1% SDS, 0.25% milk, and formamide free; Or 30% formamide, 5x SSC, 0.5% SDS can be used. Moderate stringency hybridization conditions correspond to higher Tm, for example 40% formamide, 5x or 6x SCC. High stringency hybridization conditions correspond to a maximum Tm, for example 50% formamide, 5x or 6x SCC. Hybridization requires that both nucleic acids contain complementary sequences, but depending on the stringency of the hybridization, mismatches between bases are possible. Proper stringency for hybridization of nucleic acids depends on the length and degree of complementarity of the nucleic acids, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the Tm value for hybrids of nucleic acids having these sequences. The relative stability (corresponding to higher Tm) of nucleic acid hybridization decreases in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids with lengths greater than 100 nucleotides, the formula for calculating Tm is deduced (see Sambrook et al., Supra, 9.50-0.51). For hybridization with shorter nucleic acids, ie oligonucleotides, the location of mismatches is more important, and the length of the oligonucleotides determines its specificity (see Sambrook et al., Supra, 11.7-11.8). Preferably, the minimum length for the hybridizable nucleic acid is at least about 10 nucleotides; Preferably at least about 15 nucleotides; More preferably, the length is at least about 20 nucleotides.

In certain embodiments, the term "standard hybridization conditions" refers to a Tm of 55 ° C and uses the conditions described above. In a preferred embodiment, Tm is 60 ° C .; In the most preferred embodiment, Tm is 65 ° C.

For the purposes of the present invention "high stringency hybridization conditions" will be understood to mean the following conditions:

1- Membrane Competition and Prehybridization:

Mix: 40 μl salmon sperm DNA (10 mg / ml)

+ 40 μl human placental DNA (10 mg / ml)

Denature at 96 ° C. for 5 min and then immerse the mixture in ice.

Remove 2X SSC and pour 4 ml of formamide mix into hybridization tube containing membrane.

Addition of a mixture of two denatured DNAs.

Incubate at 42 ° C. for 5-6 hours with rotation.

2- labeled probe competition:

-Depending on the repetition, add 10-50 μl Cot 1 DNA to the labeled and purified probes.

Denaturation at 95 ° C. for 7-10 minutes.

Incubate at 65 ° C. for 2 to 5 hours.

3- hybridization

Remove the prehybridized mix.

40 μl salmon sperm DNA + 40 μl human placental DNA mix; Denaturation at 96 ° C. for 5 minutes; And then immersed in ice.

Add 4 ml of formamide mix, two DNA mixtures and denatured and labeled probe / Cot 1 DNA to the hybridization tube.

Incubate at 42 ° C. for 15-20 hours with rotation.

4- washing:

Wash once at room temperature in 2X SSC for cleaning.

Twice 5 minutes with 2X SSC at room temperature and 0.1% SDS at 65 ° C.

2x for 15 min with 1X SSC at 65 ° C. and 0.1% SDS at 65 ° C.

Expose the membrane in a transparent plastic wrap.

The aforementioned hybridization conditions were adjusted to hybridize under high stringency conditions with one molecule of nucleic acid, ranging in length from 20 nucleotides to hundreds of nucleotides. It goes without saying that the above-mentioned hybridization conditions can be adjusted as a function of the length of the nucleic acid desired or the type of label selected for hybridization, according to techniques known to those skilled in the art. Suitable hybridization conditions can be adjusted, for example, according to the teachings in the manual by Hames and Higgins (1985) or in the manual by F. Ausubel et al. (1999).

As used herein, "oligonucleotide" generally refers to a nucleic acid of at least 15 nucleotides, that is, a nucleic acid capable of hybridizing with the nucleic acid according to the present invention. Oligonucleotides may, for example, be labeled with ³² P-nucleotides or nucleotides to which a label such as biotin is covalently conjugated. In one aspect, labeled oligonucleotides can be used as probes for the presence of nucleic acids encoding the ABC1 polypeptides of the invention. In another embodiment, oligonucleotides (one or both that can be labeled) can be used as PCR primers for cloning the full length or fragment of ABC1 nucleic acid, or for detecting the presence of ABC1 encoding nucleic acid. In a further aspect, the oligonucleotides of the present invention may form triple helices with ABC1 DNA molecules. In general, oligonucleotides are preferably prepared synthetically on nucleic acid synthesizers. Thus, oligonucleotides having non-naturally occurring phosphoester homologue bonds such as thioester bonds and the like can be prepared.

"Homologous recombination" refers to the foreign DNA sequence of a vector in a chromosome. Preferably, the vector targets a specific chromosomal site for homologous recombination. In the case of specific homologous recombination, the vector will contain a sufficiently long region homologous to the sequence of the chromosome to allow complementary binding and incorporation of the vector into the chromosome. Longer homologous regions, and greater sequence similarity can increase the efficacy of homologous recombination.

A DNA “coding sequence” is a double-stranded DNA sequence that is transcribed into a polypeptide and transcribed in cells in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by the start codon at the 5 '(amino) terminus and the translation stop codon at the 3' (carboxyl) terminus. Coding sequences may include, but are not limited to, prokaryotic sequences, cDNAs from eukaryotic mRNAs, genomic DNA sequences from eukaryotic (eg, mammalian) DNAs, and synthetic DNA sequences. If the coding sequence is for expression in eukaryotic cells, the polyadenylation signal and transcription termination sequence will typically be located 3 'to the coding sequence.

Transcriptional and translational regulatory sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for encoding sequence expression in a host cell. In eukaryotic cells, the polyadenylation signal is a regulatory sequence.

A "regulatory region" is a nucleic acid sequence that regulates the expression of a nucleic acid. The regulatory region may comprise a sequence originally responsible for the expression of a particular nucleic acid (homologous region) or a sequence of different origin (for expression of a different protein or synthetic protein). In particular, the sequence may be a sequence or derived sequence of a eukaryotic or viral gene that stimulates or inhibits transcription of the gene in a specific or non-specific manner and in an inducible or non-induced manner. Regulatory regions include the origin of replication, RNA splice sites, enhancers, transcription termination sequences, signal sequences that direct polypeptides to the secretory pathway of target cells, and promoters.

Regulatory sequences from “heterologous sources” are regulatory regions that are not originally associated with expressed nucleic acids. Heterologous regulatory regions include regulatory regions from different species, regulatory regions from different genes, hybrid regulatory sequences, and regulatory sequences that do not occur in nature but are devised by those skilled in the art.

"Cassette" refers to a DNA fragment that can be inserted into specific restriction sites. Fragments of DNA encode the polypeptide of interest, and cassettes and restriction sites are designed to ensure insertion of the cassette into a suitable reading frame for transcription and translation.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of downstream (3 'direction) coding sequences. By definition, the promoter sequence extends upstream (5 'direction) to include the minimum number of bases or elements necessary to bind at the 3' end to the transcription initiation site and initiate transcription at a detectable level above background. Within the promoter sequence will be found a transcription initiation site (eg, conveniently defined by mapping with nuclease S1), and a protein binding domain (consensus sequence) responsible for RNA polymerase binding.

When an RNA polymerase transcribes a coding sequence into mRNA, which is then trans-RNA spliced and translated into a protein encoded by the coding sequence, the coding sequence is "under control" of the transcriptional and translational regulatory sequences in the cell.

A "signal sequence" is included at the beginning of the coding sequence of a protein to be expressed on the cell surface. This sequence encodes the signal peptide, N-terminus, to the mature polypeptide, ie, directs the host cell to translocate the polypeptide. The term "translocation signal sequence" refers to this species of signal sequence. Translocation signal sequences can be found to be associated with a variety of proteins unique to eukaryotic and prokaryotic cells, often functioning in both organism types.

A "polypeptide" is a polymeric compound consisting of covalently bonded amino acid residues. Amino acids have the following general structure:

Amino acids are classified into seven groups based on side chain R: (1) aliphatic side chains, (2) side chains containing hydroxyl (OH) groups, (3) side chains containing sulfur atoms, (4) acidic or amides A proline which is a side chain containing a group, (5) a side chain containing a basic group, (6) a side chain containing an aromatic ring, and (7) the side chain is an imino acid fused with an amino group.

A "protein" is a polypeptide that plays a structural or functional role in living cells.

Polypeptides and proteins of the invention can be glycosylated or aglycosylated.

By “homology” is meant the similarity of sequences that reflect a common evolutionary origin. Polypeptides or proteins are said to have homology or similarity when a significant number of amino acids are (1) identical or (2) chemically similar R side chains. If many of the nucleotides are identical, the nucleic acid is said to be homologous.

An "isolated polypeptide" or "isolated protein" is a polypeptide or protein that is substantially free of such compounds (eg, other proteins or polypeptides, nucleic acids, carbohydrates, lipids) that are normally associated together in nature. "Isolated" means the presence of impurities that may be present in an artificial or synthetic mixture with another compound, or without interfering with biological activity, for example due to incomplete tablets, the addition of stabilizers, or a combination in a pharmaceutically acceptable formulation. It does not mean to exclude existence.

By “fragment” of a polypeptide according to the invention is meant a polypeptide comprising an amino acid sequence whose amino acid sequence is shorter than that of the reference polypeptide and which is identical throughout this reference polypeptide. Such fragments may optionally be included in larger polypeptides to which they are part. Such fragments of polypeptides according to the invention may have a length of 10, 15, 20, 30-40, 50, 100, 200 or 300 amino acids.

A “variant” of a polypeptide according to the invention will be understood to mean a polypeptide which, relative to the amino acid sequence of the reference polypeptide, contains an amino acid sequence containing at least one substitution, addition or deletion of at least one amino acid residue, It is understood that amino acid substitutions may be conservative or non-conservative.

A “variant” of a polypeptide or protein is a homologue, fragment, derivative, or mutant derived from a polypeptide or protein and retaining at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be allelic variations characterized by differences in the nucleotide sequence of the structural gene encoding the protein, or may involve differential splicing or post-translational modifications. Variants also include related proteins having substantially the same biological activity but obtained from different species.

One skilled in the art can generate variants with single or multiple amino acid substitutions, deletions, additions, or substitutions. Such variants include, among others: (a) variants in which one or more amino acid residues are replaced with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to a polypeptide or protein, (c) one of the amino acids Variants comprising substitution groups as described above, and d) variants in which the polypeptide or protein is fused with another polypeptide such as serum albumin. Techniques for obtaining these variants, including genes (inhibitions, deletions, mutations, etc.), chemical, and enzymatic techniques are known to those skilled in the art.

If such allelic variants, homologs, fragments, derivatives, mutants, and modifications, including alternative mRNA splicing forms and alternative post-translational modification forms, produce derivatives of the polypeptide that retain the biological properties of the polypeptide, These are intended to be included within the scope of this invention.

A "vector" is a replicon, such as a plasmid, virus, phage or cosmid, to which another DNA fragment may be attached to cause replication of the attached fragment. A "replicon" is a genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, i.e., can replicate under its control.

The present invention also relates to a cloning vector containing the ABC1 polypeptide and genes encoding homologs and derivatives of the ABC1 polypeptide of the invention, which have the same or homologous functional activity as homologs thereof from other species. The production and use of derivatives and homologues related to ABC1 are within the scope of the present invention. In certain embodiments, the derivative or homologue may be functionally active, ie, exhibit one or more functional activities associated with the full length wild type of the ABC1 polypeptide of the invention.

ABC1 derivatives can be made by altering the coding nucleic acid sequence by substitutions, additions or deletions that provide functionally equivalent molecules. Preferably, derivatives are prepared with enhanced or increased functional activity for native ABC1. Alternatively, such derivatives may encode soluble fragments of the ABC1 extracellular domain that have the same or greater activity against the natural ligand of the ABC1 polypeptide of the invention. Such soluble derivatives may be potent inhibitors of ligands that bind ABC1.

Due to the degeneracy of the nucleotide coding sequence, other DNA sequences encoding amino acid sequences substantially identical to the ABC1 gene can be used in the practice of the present invention. These include and include nucleotide sequences that include all or part of the ABC1 gene, altered by alleles, homologous genes from other species, and substitution of different codons encoding the same amino acid residues in the sequence, resulting in a silent change. It is not limited. Similarly, ABC1 derivatives of the present invention include those containing all or a portion of the amino acid sequence of the ABC1 protein as a primary amino acid sequence, including a modified sequence in which residues in the sequence are replaced with functional equivalent amino acid residues resulting in conservative amino acid substitutions. It is not limited to this. For example, one or more amino acid residues in a sequence can be substituted with other amino acids of the same polarity, where the sequence acts as a functional equivalent, resulting in a silent modification. Substitution of amino acids in the sequence may be selected from other members of the class to which the amino acids belong. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Amino acids containing an aromatic ring structure are phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations would not be expected to affect the apparent molecular weight measured by polyacrylamide gel electrophoresis, or isoelectric point.

Particularly preferred substitutions are:

Arg to Lys and vice versa so that a positive charge can be maintained;

Asp to Glu and vice versa so that negative charge can be maintained;

Thr to Ser so that free-OH can be maintained; And

Asn to Gln so that the glass CONH ₂ is maintained.

Amino acid substitutions may also be introduced to substitute amino acids having particularly desirable properties. For example, Cys can be introduced at a potential site for disulfide bridges with another Cys. His can in particular be introduced as a "catalytic" site (ie His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro can be introduced because of the special planar structure that induces b-rotation in the protein structure.

Genes encoding the ABC1 derivatives and homologues of the invention can be produced by a variety of methods known in the art. Manipulations that induce production can occur at the gene or protein level. For example, the cloned ABC1 gene sequence can be modified by a number of strategies known in the art (Sambrook et al., 1989, supra). The sequence can be cleaved at the appropriate site with restriction endonucleases, followed by further enzymatic modification if necessary, isolation and ligation in vitro. In the production of genes encoding derivatives or homologues of ABC1, care should be taken to ensure that in the gene region to which the desired activity is encoded, the modified gene remains in the same reading frame as the ABC1 gene, which is not interrupted by the translation stop signal. do.

In addition, the ABC1-encoding nucleic acid may be mutated in vitro or in vivo to generate and / or disrupt translation, initiation, and / or termination sequences, or to generate mutations in the coding region and / or to a new restriction endonuclease site. Formation or disruption of existing ones can further promote in vitro deformation. Preferably such mutations enhance the functional activity of the mutated ABC1 gene product. In vitro site-directed mutagenesis of the TAB ^R linker (Pharmacia) (Hutchinson, C., et al., 1978; Zoller and Smith, 1984; Oliphant et al., 1986; Hutchinson et al., 1986; Huygen et al. , 1996) mutagenesis techniques known to those skilled in the art, including, but not limited to, use. PCR techniques are preferred for site-directed mutagenesis (Higuch, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification, H. Erlich.ed., Stockton Press, Chapter 6, pp. 61-70).

The identified and isolated genes can then be inserted into suitable cloning vectors. Many vector-host systems known in the art can be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. Examples of vectors include E. coli, bacteriophages such as lambda derivatives, or plasmids such as pBR322 derivatives or pUC plasmid derivatives such as pGEX vectors, pmal-c, pFLAG and the like. Insertion into the cloning vector can be accomplished, for example, by linking the DNA fragment into a cloning vector with complementary cohesive ends. However, if the complementary restriction sites used for DNA fragmentation are not present in the cloning vector, the ends of the DNA molecules can be modified with enzymes. Alternatively, any desired site can be generated by linking a nucleotide sequence (linker) to the DNA terminus; These linked linkers may comprise specific chemically synthesized oligonucleotides encoding restriction endonuclease recognition sequences. Recombinant molecules can be introduced into host cells through transformation, transfection, infection, electroporation, and the like, resulting in multiple copies of the gene sequence. Preferably, if necessary, the cloned gene is contained in a shuttle vector plasmid that provides for easy purification for expansion in cloning cells, eg, E. coli, and subsequent insertion into a suitable expression cell line. For example, a shuttle vector, a vector capable of replicating in one or more organisms, can be used in both E. coli and Saccharomyces cerevisiae by linking sequences from the E. coli plasmid with sequences from the yeast 2m plasmid. It can be prepared for replication.

Alternatively, the gene of interest can be identified and separated after insertion into a suitable cloning vector by the "shot gun" method. For example, enrichment of the desired gene by size fractionation can be performed prior to insertion into the cloning vector.

A nucleotide sequence encoding an ABC1 polypeptide or antigen fragment, derivative or homologue thereof, or functionally active derivative, including a chimeric protein, contains a suitable expression vector, i.e., elements necessary for the transcription and translation of the inserted protein-coding sequence. Can be inserted into a vector. Such elements are referred to herein as "promoters." Thus, the nucleic acid encoding the ABC1 polypeptide of the present invention is operably linked to a promoter in the expression vector of the present invention. Both cDNA and genomic sequences can be cloned and expressed under the control of such regulatory sequences. The expression vector also preferably comprises a replication origin.

Necessary transcriptional and translational signals can be provided on recombinant expression vectors or they can be supplied by native genes encoding ABC1 and / or its flanking regions.

Potential host-vector systems include mammalian cell systems infected with viruses (eg vaccinia virus, adenovirus, etc.); Insect cell systems infected with viruses (eg, baculovirus); Microorganisms such as enzymes containing yeast vectors; Or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The expression elements of the vector vary in their strength and specificity. Depending on the host-vector system used, any one of a number of suitable transcription and translation elements can be used.

The recombinant ABC1 protein of the invention, or functional fragments, derivatives, chimeric constructs, or homologs thereof, can be chromosomally expressed after integration of the coding sequence by recombination. In this regard, a number of amplification systems can be used to achieve high levels of stable gene expression (Sambrook et al., 1989, supra).

Cells containing a recombinant vector comprising a nucleic acid encoding an ABC1 polypeptide according to the present invention are cultured in a suitable cell culture medium under conditions providing expression of the ABC1 polypeptide by the cells.

The methods described above for the insertion of DNA fragments into cloning vectors can be used to construct expression vectors containing genes consisting of appropriate transcriptional / translational regulatory signals and protein coding sequences. These methods may include in vitro DNA and synthetic techniques and in vivo recombination (genetic recombination).

Expression of the ABC1 polypeptide can be regulated by promoter / enhancer elements known in the art, but these regulatory elements must be functional in the host selected for expression. Promoters that can be used for the regulation of ABC1 gene expression include the SV40 early promoter region (Benoist and Chambon, 1981), promoters contained in the 3 ′ long terminal repeat of Raus sarcoma virus (Yamamoto et al., 1980), herpes thymidine kinase Promoter (Wagner et al., 1981), regulatory sequences of metallothionein genes (Brinster et al., 1982); eukaryotic expression vectors such as the b-lactamase promoter (Villa-Kamaroff et al., 1978), or tac promoter (DeBoer et al., 1983); See also “Useful proteins from recombinant bacteria” in Scientific American, 1980, 242: 74-94; Promoter elements from yeast or other fungi such as Gal 4 promoter, ADC (alcohol dehydrokinase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; And animal transcriptional regulatory regions that have shown tissue specificity and have been used in transgenic animals: Elastase I gene regulatory regions that are active in pancreatic vesicle cells (Swift et al., 1984; Ornitz et al., 1986; MacDonald, 1987) ; Insulin gene regulatory region active in pancreatic beta cells (Hanahan, 1985), immunoglobulin gene regulatory region active in lymphoid cells (Grosschedl et al., 1984; Adames et al., 1985; Alexander et al., 1987), mouse breast tumor virus regulatory region active in testis, breast, lymph and mast cells (Leder et al., 1986), albumin gene regulatory region active in the liver (Pinkert et al., 1987), Alpha-fetoprotein gene regulatory region active in the liver (Krumlauf et al., 1985; Hammer et al., 1987), alpha 1-antitrypsin gene regulatory region active in the liver (Kelsey et al., 1987) ), Beta-globin gene regulatory region active in myeloid cells (Mogram et al., 1985; Kollias et al., 1986), myelin basic protein gene regulatory region active in oligodendrome region cells of the brain ( Readhead et al., 1987), myosin nerves active in skeletal muscle 2 gene regulatory region (Sani, 1985), and the band is active in the hypothalamus to release pin Tarragona dot hormone gene control region (Mason et al., 1986) and include, but not limited thereto.

Expression vectors containing nucleic acids encoding the ABC1 polypeptides of the invention can be identified by four general methods: (a) polymerase chain reaction (PCR) amplification of the target plasmid DNA or specific mRNA, (b) Nucleic acid hybridization, (c) the presence or absence of selection marker gene function, (d) analysis by appropriate restriction endonucleases, and (e) expression of the inserted sequences. In the first method, nucleic acids can be amplified by PCR to provide detection of amplification products. In a second method, the presence of the foreign gene inserted into the expression vector can be detected by nucleic acid hybridization using a probe comprising a sequence homologous to the inserted marker gene. In a third method, the recombinant vector / host system is characterized by certain “selection marker” gene functions (eg, b-galactosidase activity, thymidine kinase activity, antibiotic resistance, transformation) resulting from the insertion of a foreign gene into the vector. Phenotype, occlusal formation in baculovirus, etc.) can be identified and selected. In another example, if a nucleic acid encoding an ABC1 polypeptide is inserted into the "selection marker" gene sequence of a vector, recombinants containing ABC1 nucleic acid inserts may be identified by the absence of ABC1 gene function. In a fourth method, recombinant expression vectors are identified by digestion with appropriate restriction enzymes. In a fifth method, recombinant expression vectors can be identified by assessing the activity, biochemical, or immunological characteristics of the gene product expressed by the recombinant, provided that the expressed protein takes a functionally active form.

A wide range of host / expression vector combinations can be used for nucleic acid expression of the invention. For example, useful expression vectors can consist of fragments of chromosomes, non-chromosomes and synthetic DNA sequences. Suitable vectors are derivatives of SV40 and known bacterial plasmids, for example E. coli plasmid col E1, pCR1, pBR322, pMal-C2, pET, pGEX (Smith et al., 1988), pMB9 and derivatives thereof, RP4 and Same plasmid; Phage DNA, eg, multiple derivatives of phage 1, eg NM989, and other phage DNA such as M13 and filamentary single stranded phage DNA; Yeast plasmids such as 2m plasmids or derivatives thereof; Vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; Vectors derived from a combination of plasmid and phage DNA, such as plasmid modified to use phage DNA or other expression control sequences; And the like.

For example, in the baculovirus expression system, pVL941 (BamH1 cloning site; Summers), pVL1393 (BamH1, SmaI, XbaI, EcoR1, XmaIII, BglII, and PStI cloning site; Invitrogen), pVL1392 (BglII, PstI, NotI, Non-fusion delivery vectors (XmaIII, EcoRI, XbaI, SmaI, and BamH1 cloning sites; Summers and Invitrogen), and pBlueBacIII (BamH1, PstI, NcoI, and HindIII cloning sites, blue / white recombinant screenable; Invitrogen) PAc700 (BamH1 and KpnI cloning sites, where the BamH1 recognition site begins with an initiation codon; Summers), pAc701 and pAc702 (same as pAc700, with different reading frames), pAc360 (poly) 36 base pairs of BamH1 cloning site downstream of the headlin initiation codon; Invitrogen (195), and pBlueBacHisA, B, C (3 different reading frames, BamH1, BglII, PstI, NcoI, and HindIII cloning site, for ProBond purification) Blue / white of N-terminal peptide, and plaque Screening combination; but not limited to, such as Invitrogen (220) can be used both fusion transfer vectors.

Mammalian expression vectors contemplated for use in the present invention are vectors having an inducible promoter, such as a dihydrofolate reductase (DHFR) promoter, for example, an expression vector having a DHFR expression vector, or a pED (PstI, SalI, SbaI, SmaI, and EcoRI cloning sites, vectors include expression of both cloned genes and DHFR; expression vectors with DHFR / methotrexate co-expression vectors such as Kaufman, Current Protocols in Molecular Biology, 16.12 (1991). Glutamine synthetase / methionine sulfoximine co-amplification vectors, such as pEE14 (HindIII, XbaI, SmaI, SbaI, EcoRI, and BclI cloning sites, wherein the vector expresses glutamine synthase and cloned genes; Celltech). In a vector that directs episomal expression under the control of Epstein Barr virus (EBV), for example pREP4 (BamH1, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII, and KpnI cloning site, structural RSV- LTR promoter, hygromycin selection marker; Invitrogen), pCEP4 (BamH1, SfiI, XhoI, NotI, NheI, HindIII, NheI, PvuII, and KpnI cloning sites, structural hCMV immediate early gene, hygromycin selection marker; Invitrogen), pMEP4 (Kpn1, PvuI, NheI, HindIII, NotI, XhoI, SfiI, BamH1 cloning site, inducible metallothionein IIa gene promoter, hygromycin selection marker: Invitrogen), pREP8 (BamH1, XhoI, NotI, HindIII, NheI And KpnI cloning site, RSV-LTR promoter, histidinol selection marker; Invitrogen), pREP9 (KpnI, NheI, HindIII, NotI, XhoI, SfiI, and BamHI cloning site, RSV-LTR promoter, G418 selection marker; Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin selection marker, N-terminal peptide which is purified through ProBond and cleaved by enterokinase) can be used. Selectable mammalian expression vectors for use in the present invention include pRc / CMV (HindIII, BstXI, NotI, SbaI, and ApaI cloning sites, G418 screening; Invitrogen), pRc / RSV (HindIII, SpeI, BstXI, NotI cloning sites, G418 selection; Invitrogen) and the like. Vaccinia virus mammalian expression vectors (Kaufman, 1991, supra) for use in accordance with the present invention include pSC11 (SmaI cloning site, TK- and b-gal selection), pMJ601 (SalI, SmaI, AflI, NarI, BspMII, BamHI, ApaI, NheI, SacII, KpnI, and HindIII cloning sites; TK- and b-gal selection), and pTKgptF1S (EcoRI, PstI, SalI, AccI, HindII, SbaI, BamHI, and Hpa cloning sites, TK or XPRT selection ), Including but not limited to.

Yeast expression systems can also be used in accordance with the present invention to express ABC1 polypeptide. For example, just two words non-fused pYES2 vectors (XbaI, SphI, ShoI, NotI, GstXI, EcoRI, BstXI, BamH1, SacI, Kpn1, and HindIII cloning sites; Invitrogen) or fused pYESHisA, B, C ( XbaI, SphI, ShoI, NotI, BstXI, EcoRI, BamH1, SacI, KpnI, and HindIII cloning site, N-terminal peptide purified with ProBond resin and cleaved with enterokinase; Invitrogen) can be used according to the present invention.

Once a particular recombinant DNA molecule has been identified and identified, it can be propagated using several methods known in the art. Once appropriate host systems and growth conditions are established, recombinant expression vectors can be propagated to produce large amounts. As described above, expression vectors that may be used include, but are not limited to, for example, the following vectors or derivatives thereof: human or animal viruses such as vaccinia virus or adenovirus; Insect viruses such as baculovirus; Yeast vectors; Bacteriophages (eg, lambda), and plasmid and cosmid DNA vectors.

In addition, host cell strains may be selected that modulate the expression of the inserted sequences or modify and process the gene product in a specific manner as desired. Different host cells have characteristic and specific mechanisms for transcription and post-translational processing and modification of proteins (eg, glycosylation, cleavage [eg, of signal sequences]). Appropriate cell lines or host systems can be selected to ensure the desired modification and processing of the foreign protein expressed. For example, expression in bacterial systems can be used to produce non-glycosylated core protein products. However, the transmembrane ABC1 protein expressed in bacteria may not be properly folded. Expression in yeast can produce glycosylation products. Expression in eukaryotic cells can increase the likelihood of "native" glycosylation and folding of heterologous proteins. Moreover, expression in mammals may provide a tool for reconstitution, or construction of ABC1 activity. In addition, different vector / host expression systems can affect processing reactions, such as proteolytic cleavage, to different extents.

Vectors are known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosomal fusion), use of gene guns, or DNA vectors Introduced into a desired host cell by a transporter (see, eg, Wu et al., 1992; Wu and Wu, 1988; Hartmut et al., Filed March 15, 1990, Canadian Patent Application No. 2,012,311). .

When such DNA is introduced into a cell, the cell is "transfected" with exogenous or heterologous DNA. When transfected DNA affects phenotypic changes, cells are "transformed" into exogenous or heterologous DNA. Preferably, the transforming DNA should be integrated (covalently linked) into the chromosomal DNA making up the genome of the cell.

Recombinant marker proteins expressed as integral membrane proteins can be isolated and purified by standard methods. In general, integral membrane proteins are used in detergents such as sodium dodecyl sulfate (SDS), triton X-100 polyoxyethylene esters, Ipagel / nonidet P-40 (NP-40) (octylphenoxy) -poly It can be obtained by dissolving (but not limited to) methoxyethanol, digoxin, sodium deoxycholate and the like and mixtures thereof. Solubilization can be enhanced by sonication of the suspension. Soluble forms of the protein can be obtained by collecting the culture or solubilizing the inclusion body by, for example, detergent treatment, and by sonication or other mechanical procedures as necessary. Solubilized or soluble proteins include polyacrylamide gel electrophoresis (PAGE), isoelectric focusing, two-dimensional gel electrophoresis, chromatography (eg, ion exchange, affinity, immunoaffinity, and sizing column chromatography), centrifugation. Separation, differential solubility, immunoprecipitation can be performed using various techniques, or by other standard techniques for protein purification.

Alternatively, nucleic acids or vectors according to the invention can be introduced in vivo by lipofection. Over the past decade, the use of liposomes for encapsulation and transfection of nucleic acids in vitro has been increasing. Synthetic cationic lipids designed to limit the challenges and risks encountered with liposome mediated transfection can be used to prepare liposomes for in vivo transfection of marker coding genes (Felgner et al., 1987; Mackey et al. , 1988; Ulmer et al., 1993). The use of cationic lipids promotes the encapsulation of negatively charged nucleic acids and also promotes fusion with negatively charged cell membranes (Felgner and Ringold, 1989). Lipid compounds and compositions particularly useful for the delivery of nucleic acids are described in WO 95/18863 and W96 / 17823, and in U.S. Patent No. 5,459,127. The use of lipofection in the introduction of exogenous genes into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of advantage. It is apparent that the designation of transfection to specific cell types is particularly desirable in tissues with cell heterogeneity such as pancreas, liver, kidney, and brain. Lipids can be chemically coupled to other molecules for targeting purposes (Macket et al., Supra). Proteins or non-peptide molecules such as targeted peptides, ie hormones or neurotransmitters, and antibodies, can be chemically coupled to liposomes.

Cationic oligopeptides (eg WO 95/21931), peptides derived from DNA binding proteins (eg WO 96/25508), or cationic polymers (eg WO 95/21931). Other molecules, such as 21931), may also be useful for promoting transfection of nucleic acids in vivo.

It is also possible to introduce vectors in vivo as naked DNA plasmids (U.S. Patents 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for gene therapy include methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use of gene guns, or DNA vectors It can be introduced into a host cell of interest by use of a transporter (Wu et al., 1992, Wu and Wu, 1988; Hartmut et al., Filed March 15, 1990, Canadian Patent Application No. 2,012,311). Williams et al., 1991). Receptor-mediated DNA delivery can also be used (Curiel et al., 1992; Wu and Wu, 1987).

“Pharmaceutically acceptable vehicle or excipient” includes diluents and fillers which are pharmaceutically acceptable for the method of administration, sterile and may be aqueous or oily suspensions formulated with suitable dispersing or wetting agents and suspending agents. The ratio of a particular pharmaceutically acceptable carrier and active compound: carrier is determined by the solubility and chemical nature of the composition, the particular mode of administration, and standard pharmaceutical practice.

Nucleic acids, polypeptides, vectors, or host cells of the invention will preferably be introduced in vivo into a pharmaceutically acceptable vehicle or excipient. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically acceptable and that, when administered to a human, typically do not cause allergic reactions such as gastrointestinal disorders, dizziness, or the like. Preferably, as used herein, "pharmaceutically acceptable" means that it is licensed by a federal regulatory authority or is listed in a US pharmacopoeia or other generally recognized pharmacopeia for use in animals, especially humans. it means. The term "excipient" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solution and aqueous dextrose and glycerol solutions are preferably used as excipients, in particular for injection solutions. Suitable pharmaceutical excipients are described in E.W. Martin's "Remington's Pharmaceutical Sciences".

Naturally, the present invention contemplates delivery of a vector that will express a therapeutically effective amount of ABC1 polypeptide for gene therapy applications. The phrase “therapeutically effective amount” reduces clinically significant defects, functions, and responses in the activity of the host by at least about 15%, preferably at least 50%, more preferably at least 90%, even more preferably. Means an amount sufficient to prevent. In addition, a therapeutically effective amount is sufficient to result in improvement of clinically significant symptoms in the host.

"Lipid profile" means a set of cholesterol, triglycerides, lipoprotein cholesterol and other lipids in the human or other animal body.

An "undesired lipid profile" is a condition in which the concentration of cholesterol, triglycerides, or lipoprotein cholesterol is outside the age- and gender-adjusted baseline range. Generally, total cholesterol> 200 mg / dl, plasma triglycerides> 200 mg / dl, LDL cholesterol> 130 mg / dl, HDL cholesterol <39 mg / dl, or total cholesterol: HDL cholesterol ratio> 4.0 are preferred. It is thought to be a lipid profile. Undesired lipid profiles are associated with various pathological conditions, including hyperlipidemia, diabetic hypercholesterolemia, and other forms of coronary artery disease.

Nucleic Acids of the ABC1 Gene

Genomic sequence

With particular reference to the structure of the orthologous ABC1 gene in mice, the human ABC1 gene is believed to contain 48 exons and 47 introns. Recently, partial exons and intron ABC1 genomic DNA have been isolated and identified (Rust et al., 1999). According to the invention, it has been found that the human ABC1 gene comprises 49 exons and 48 introns.

Several partial genomic nucleotide sequences of the ABC1 gene have been isolated and characterized in accordance with the present invention, which genome sequences are novel exon sequences and introns that can be used in particular for the production of various means of detection of the ABC1 gene or its nucleotide expression products in a sample. It contains both sequences. These partial genomic sequences are shown in Table 1 below.

Part (p) genomic DNA of the human ABC1 gene SEQ ID NO: ABC1 genomic DNA One Intron 1 (p), exon 2, intron 2, exon 3, intron 3, exon 4, intron 4 (p) 4 Intron 4 (p), Exon 5, Intron 5 (p) 5 Intron 5 (p), exon 6, intron 6 (p) 6 Intron 6 (p), Exon 7, Intron 7 (p) 7 Intron 7 (p), exon 8, intron 8 (p) 8 Intron 8 (p), exon 9, intron 9, exon 10, intron 10 (p) 9 Intron 10 (p), Exon 11, Intron 11 (p) 10 Intron 11 (p), exon 12, intron 12, exon 13, intron 13, exon 14, intron 14, exon 15, intron 15, exon 16, intron 16, exon 17, intron 17 (p) 11 Intron 17 (p), Exon 18, Intron 18 (p) 12 Intron 38 (p), Exon 39, Intron 39 (p) 13 Intron 42 (p), Exon 43, Intron 43 (p) 14 Intron 43 (p), Exon 44, Intron 44 (p) 15 Intron 44 (p), Exon 45, Intron 45 (p) 16 Intron 45 (p), exon 46, intron 46, exon 47, intron 47 (p) 17 Intron 48 (p), exon 49, 3 ′ terminal sequence

Accordingly, a first subject of the invention is a nucleic acid comprising a polynucleotide sequence of any one of SEQ ID NOs: 1 and 4-17 or of a complementary polynucleotide sequence.

The invention also relates to a) any one of SEQ ID NOs: 1 and 4-8, and 11-16 or to a complementary polynucleotide sequence, b) a nucleotide 3154-3200 of SEQ ID NO: 9, or a complementary polynucleotide sequence, c) SEQ ID NO: 10 Nucleotide 1-242, or a complementary polynucleotide sequence, or d) a nucleotide 1-1851 of SEQ ID NO: 17, or a nucleic acid comprising at least eight consecutive nucleotides of a polynucleotide sequence comprising a complementary polynucleotide sequence.

The subject matter of the present invention also relates to a) any one of SEQ ID NOs: 1 and 4-8, and 11-16 or to a complementary polynucleotide sequence, b) a nucleotide 3154-3200 of SEQ ID NO: 9, or a complementary polynucleotide sequence, c) sequence Nucleotides 1-242 of SEQ ID NO: 10, or a complementary polynucleotide sequence, or d) a nucleotide 1-1851 of SEQ ID NO: 17, or a nucleic acid having at least 80% nucleotide identity with a complementary polynucleotide sequence.

The invention also relates to a) any one of SEQ ID NOs: 1 and 4-8, and 11-16 or to a complementary polynucleotide sequence, b) a nucleotide 3154-3200 of SEQ ID NO: 9, or a complementary polynucleotide sequence, c) SEQ ID NO: 10 At least 85%, preferably 90%, more preferably 95% of nucleic acids comprising nucleotides 1-242, or the complementary polynucleotide sequence of SEQ ID NO: 1, or d) nucleotides 1-1851, or the complementary polynucleotide sequence of SEQ ID NO: 17; And more preferably relates to a nucleic acid having 98% nucleotide identity.

The invention also relates to a) any one of SEQ ID NOs: 1 and 4-8, and 11-16 or to a complementary polynucleotide sequence, b) a nucleotide 3154-3200 of SEQ ID NO: 9, or a complementary polynucleotide sequence, c) SEQ ID NO: 10 Nucleotide 1-242, or a complementary polynucleotide sequence, or d) a nucleotide 1-1851 of SEQ ID NO: 17, or a nucleic acid that hybridizes under high stringency conditions with a complementary polynucleotide sequence.

Several exons of the ABC1 gene have been characterized, at least in part, by their nucleotide sequences and are shown in Table 2 below.

Human ABC1 Exon DNA Exon number SEQ ID NO: Position in SEQ ID NO: Location of 5'nucleotides Position of 3 ′ nucleotides 2 18 One 4647 4740 3 19 One 9274 9415 4 20 One 10685 10803 5 21 4 254 375 6 22 5 161 337 7 23 6 107 199 8 24 7 604 844 9 25 8 615 754 10 26 8 1084 1200 11 27 9 3003 3200 17 28 10 7888 8001 18 29 11 388 559 39 30 12 4 127 43 31 13 266 372 44 32 14 16 157 45 33 15 177 311 46 34 16 377 480 47 35 16 963 1055 49 36 17 195 3088

Accordingly, the present invention relates to a nucleic acid comprising any one of SEQ ID NOs: 18-36 or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 18-36, or a complementary polynucleotide sequence.

The present invention also relates to a) any one of SEQ ID NOs: 18-26 and 28-35, or complementary polynucleotide sequence, b) nucleotide 152-198 of SEQ ID NO: 27, or complementary polynucleotide sequence, c) nucleotide 1 of SEQ ID NO: 36 -1657, or a nucleic acid comprising at least eight consecutive nucleotides of the complementary polynucleotide sequence.

The subject matter of the present invention is also directed to a) any one of SEQ ID NOs: 18-26 and 28-35 or complementary polynucleotide sequence, b) nucleotide 152-198 of SEQ ID NO: 27, or complementary polynucleotide sequence, c) of SEQ ID NO: 36 Nucleotide 1-1657, or a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising a complementary polynucleotide sequence.

The invention also provides a) any one of SEQ ID NOs: 18-26 and 28-35 or a complementary polynucleotide sequence, b) a nucleotide 152-198 of SEQ ID NO: 27, or a complementary polynucleotide sequence, c) nucleotide 1 of SEQ ID NO: 36 -1657, or a nucleic acid having at least 85%, preferably 90%, more preferably 95%, and even more preferably 98% nucleotide identity with a nucleic acid comprising a complementary polynucleotide sequence.

The invention also provides a) any one of SEQ ID NOs: 18-26 and 28-35 or a complementary polynucleotide sequence, b) a nucleotide 152-198 of SEQ ID NO: 27, or a complementary polynucleotide sequence, c) nucleotide 1 of SEQ ID NO: 36 -1657, or a nucleic acid hybridizing under high stringency conditions with a nucleic acid comprising a complementary polynucleotide sequence.

In addition, several introns of the ABC1 gene have been at least partially isolated and characterized. Intron nucleic acids of the ABC1 gene, and fragments thereof and variants thereof, can also be used as nucleotide probes or primers for the detection of at least one copy of the ABC1 gene in a sample, or for the amplification of a given target sequence in the ABC1 gene.

Intron nucleic acid sequences of the ABC1 gene are shown in Table 3.

Human ABC1 Intron DNA Intron number SEQ ID NO: Position in sequence number Position of 5 ′ nucleotides Position of 3 ′ nucleotides 1 (3 'end) 37 One One 4646 2 38 One 4741 9273 3 39 One 9416 10684 4 (5 'end) 40 One 10804 11754 4 (3 'end) 41 4 One 253 5 (5 'end) 42 4 376 571 5 (3 'end) 43 5 One 160 6 (5 'end) 44 5 338 428 6 (3 'end) 45 6 One 106 7 (5 'end) 46 6 200 213 7 (3 'end) 47 7 One 603 8 (5 'end) 48 7 845 1402 8 (3 'end) 49 8 One 614 9 50 8 755 1083 10 (5 'end) 51 8 1201 1808 11 (5 'end) 52 9 3201 3215 11 (3 'end) 53 10 One 639 17 (3 'end) 54 11 One 387 18 (5 'end) 55 11 560 578 38 (3 'end) 56 12 One 3 39 (5 'end) 57 12 128 384 42 (3 'end) 58 13 One 265 43 (5 'end) 59 13 373 386 43 (3 'end) 60 14 One 15 44 (5 'end) 61 14 158 345 44 (3 'end) 62 15 One 176 45 (5 'end) 63 15 312 618 45 (3 'end) 64 16 One 376 46 65 16 481 962 47 (5 'end) 137 16 1056 1329 48 (3 'end) 68 17 One 194

Accordingly, the present invention also relates to a nucleic acid comprising the polynucleotide sequence of any one of SEQ ID NOs: 37-65, 68, and 137, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 37-65, 68, and 137, or a complementary polynucleotide sequence.

The invention also provides a) at least one of SEQ ID NOs: 37-52, 54-65, 68, and 137, or complementary polynucleotide sequences, or b) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotide sequences. It relates to a nucleic acid comprising eight consecutive nucleotides.

The subject matter of the present invention also relates to a) any one of SEQ ID NOs: 37-52, 54-65, 68, and 137, or complementary polynucleotide sequence, or b) nucleotides 1-242, or complementary polynucleotide sequence of SEQ ID NO: 53 A nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising.

The invention also includes a) any one of SEQ ID NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) the nucleotides 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence To a nucleic acid having at least 85%, preferably 90%, more preferably 95%, and even more preferably 98% nucleotide identity with the nucleic acid.

The invention also includes a) any one of SEQ ID NOs: 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence, or b) the nucleotides 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence The present invention relates to a nucleic acid that hybridizes under high stringency conditions.

CDNA molecule encoding full length ABC1 protein

As described above, partial cDNA sequences corresponding to the human ABC1 gene have been identified by Langman et al. (1999). This partial cDNA sequence of ABC1 consists of 6880 nucleotides and contains a 6603 nucleotide open reading frame corresponding to a partial 2201 amino acid (aa) ABC1 polypeptide produced in a subject not affected by cholesterol back transport. In addition, the cDNA sequence described by Langmann et al. (1999) contains a portion of the 5'-nontranslated region (UTR) (nucleotides 1 to 120) and a portion of the 3'-UTR region (nucleotides 6727 to 6880).

Recently, additional portions of the 3′-UTR of human ABC1 cDNA have been isolated and identified (Rust et al., 1999).

CDNA encoding the full length human ABC1 protein was identified according to the invention as a ratio (see Example 2). This new human ABC1 cDNA (SEQ ID NO: 69) comprises a newly identified 5′-region comprising 244 additional 5 ′ nucleotides and a true starting ATG codon. According to the present invention, the new human ABC1 cDNA comprises a larger open reading frame than previously reported by Langmann et al. (199) and Rust et al. (1999). In particular, such cDNA nucleic acid molecules of the invention encode 60 additional amino acids at the N-terminus of full length human ABC1 protein. In addition, these new cDNA molecules of the present invention comprise the newly identified 5'UTR.

In vitro testing of the specific activity of full length ABC1 protein demonstrates that full length ABC1 protein can promote cellular lipid efflux. In fact, the results presented in Examples 16 and 4-7 show that apolipoproteins significantly increased cholesterol and phospholipid efflux in cells transfected with full length ABC1 protein. In comparison, HDL and phosphatidylcholine do not or only partially mediate cholesterol efflux in full length ABC1 transfected cells.

These results seem to suggest that apofatty protein is a receptor for ABC1-mediated cholesterol and phospholipid efflux. In addition, Figure 7 clearly demonstrates the specific binding of apo AI and A-II to full-length ABC1 transfected cells, such that the full-length ABC1 protein acts through direct interaction with apolipoproteins, and this interaction It is suggested that this is required for lipid efflux promoted by the apolipoprotein and full length ABC1 protein. Thus, it is conceivable that apolipoproteins in vivo from the liver and intestine interact with full-length ABC1 protein on the cell surface to circulate and replenish lipid efflux from peripheral cells.

Specifically, the cDNA molecule of the human ABC1 gene having the polynucleotide sequence of SEQ ID NO: 69 includes an open reading frame starting at nucleotide at position 185 (base A of the ATG codon for initiation of readout) and reaching the nucleotide at position 6967 . There is a polyadenylation signal (with the sequence ATTAAA), starting from the nucleotide at position 9698 of the sequence of SEQ ID NO: 69. According to the present invention, ABC1 cDNA comprising SEQ ID NO: 69 encodes the full length ABC1 polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ID NO: 71.

As a result, the present invention also relates to a nucleic acid comprising SEQ ID NO: 69, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising a polynucleotide sequence represented by SEQ ID NO: 69, or a complementary polynucleotide sequence.

The invention also relates to nucleic acid molecules comprising the nucleotides 1-244, or the complementary polynucleotide sequences of SEQ ID NO: 69.

The invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of nucleotides 1-244 of SEQ ID NO: 69, or complementary polynucleotides.

Subject of the invention is also a nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69, or a nucleic acid having at least 80% nucleotide identity with a nucleic acid having a complementary polynucleotide sequence.

The invention also relates to nucleic acids comprising nucleotides 1-244 of SEQ ID NO: 69, or to nucleic acids having complementary polynucleotide sequences, at least 85%, preferably 90%, more preferably 95%, even more preferably 98% It relates to a nucleic acid having nucleotide identity.

Another subject of the invention is a nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69, or a nucleic acid which hybridizes under high stringency conditions with a nucleic acid having a complementary polynucleotide sequence.

A search of the GenBank Database (www.ncbi.nlm.nih.gov) found sequence tags (EST), accession numbers expressed from the brains of standardized infants that overlap with nucleotides 1-179 of SEQ ID NO: 69 in nucleotides 114-292 of EST. Z44377 was found. Until the cDNA molecule according to the present invention was identified, no association between the EST and ABC1 was known. Thus, these ESTs represent ancillary 5′UTR nucleotides of human ABC1 cDNA.

Accordingly, the present invention also relates to cDNA molecules comprising nucleotides 1-113 of EST (GenBank Accession No. Z44377) and nucleotides 1-9741 (SEQ ID NO: 69) of ABC1 cDNA molecules. This second cDNA molecule comprises the nucleotide sequence of SEQ ID NO: 70. The ORF of this second cDNA molecule is located at nucleotides 298 to nucleotide 7080 of SEQ ID NO: 70 and the polyadenylation signal (with sequence ATTAAA) is located at the beginning of nucleotide 9811 of SEQ ID NO: 70. The nucleic acid comprising SEQ ID NO: 70 also encodes a full length human ABC1 protein comprising the amino acid sequence of SEQ ID NO: 71.

As a result, the invention also relates to nucleic acids comprising SEQ ID NO: 70, or the complementary polynucleotide sequence.

The present invention also relates to a nucleic acid comprising a polynucleotide represented by SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising the nucleotides 1-357, or complementary polynucleotide sequences of SEQ ID NO: 70.

The present invention also relates to a nucleic acid comprising at least eight consecutive nucleotides of the nucleotides 1-357 of SEQ ID NO: 70, or the complementary polynucleotide sequence.

The subject matter also relates to a nucleic acid having at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-357, or the complementary polynucleotide sequence of SEQ ID NO: 70.

The invention also provides a nucleic acid having at least 85%, preferably 90%, more preferably 95%, and even more preferably 98% nucleotide identity with a nucleic acid comprising the nucleotide of SEQ ID NO: 70, or a complementary polynucleotide sequence. It is about.

Another subject of the invention relates to a nucleic acid comprising nucleotides 1-357 of SEQ ID NO: 70, or a nucleic acid which hybridizes under high stringency conditions with a nucleic acid having a complementary polynucleotide sequence.

According to the present invention, a nucleic acid comprising a polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70 encodes a full length human ABC1 polypeptide of 2261 amino acids comprising the amino acid sequence of SEQ ID NO: 71.

Accordingly, the invention also relates to nucleic acids encoding polypeptides comprising the amino acid sequence of SEQ ID NO: 71.

The invention also relates to a nucleic acid encoding a polypeptide comprising an amino acid sequence represented by SEQ ID NO: 71.

In certain embodiments, the invention relates to a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

The invention also relates to a polypeptide comprising the amino acid sequence of SEQ ID NO: 71.

The invention also relates to a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 71.

The present invention relates to a polypeptide comprising the amino acid of SEQ ID NO: 71.

The invention also relates to a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71, or a polypeptide having at least 80% amino acid identity with a peptide fragment thereof.

The invention also relates to a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71 at least 85%, preferably 90%, more preferably 95%, even more preferably 98% amino acid identity. It relates to a polypeptide having.

Preferably, the polypeptide according to the invention comprises 15, 18 or 20 to 25, 35, 40, of a polypeptide according to the invention, in particular a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71; It will have 50, 70, 80, 100 or 200 consecutive amino acids in length.

In contrast, a polypeptide according to the invention comprises a polypeptide according to the invention, in particular 15, 18, 20, 25, 35, 40, 50 of a polypeptide comprising an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71. , 100 or 200 consecutive amino acids in length.

Polymorphism in ABC1 Gene

Mutation

Analysis of mutations in the ABC1 gene can be performed on genomic DNA from several individuals in the family, with some members of the family suffering from Tangier's disease and / or FHD disease with immature coronary artery abnormalities. According to the present invention several mutations have been identified in the ABC1 gene sequence region encoding the ABC1 polypeptide. These mutations are found in patients suffering from the severe form of tangery disease, especially associated with severe coronary artery disorders. Seventeen mutations are described in Table 4. Mutations in wild-type (WT) sequences are shown in Table 4 for each mutant sequence.

Mutations found in ABC1 gene ABC1 gene mutation position Nucleotide sequence number of the mutant exon Mutant ABC1 Polypeptide SEQ ID NO: Mutations (WT → mutants) Mutation Effect on ABC1 Protein Exon 5, nt 53 72 - G → A silent from aa158 Exon 6, nt 113 73 89 G → A R → K at aa219 Exon 6, nt 136 74 90 C → T stop at aa226 Exon 8, nt 31 75 91 C → T stop at aa281 Exon 8, nt 123 76 - C → T silent from aa312 Exon 8, nt 135 77 - G → A silent from aa316 Exon 13, nt 109 78 92 G →- Frame shift at aa608 → stop at aa 634 Exon 15, nt 205 79 93 A → C T → P at aa774 Exon 17, nt 9 80 94 G → A G → R at aa851 Exon 17, nt 107 81 95 A → G I → M at aa883 Exon 22, nt 101-102 82 96 CT →- Frame shift from aa1114 → stop at aa1144 Exon 22, nt 102-103 83 97 TC →- Frame shift from aa1114 → stop at aa1144 Exon 27, nt 123 84 98 C → T R → W at aa1342 Exon 32, nt 19 85 99 G → A W → stop at aa1525 Exon 34, nt 62 86 100 G → A R → K at aa1587 Exon 47, nt 2 87 101 A → G M → V at aa2104 Exon 47, nt 27 88 102 C →- Frame shift at aa2112 → stop at aa2130

Means of detection of mutated sequences of ABC1, specific hybridization with mutated sequences of ABC1, utilizing structural features that allow differentiation of normal sequences from mutated sequences of ABC1 (genomic sequence, messenger RNA, cDNA) Can generate a primer or a pair of primers that can selectively amplify regions of the ABC1 gene that carry the mutations described above, and in particular with the aid of the specific probes described above, by identifying the length of the amplified nucleic acid fragments. The presence of these mutations can be performed by hybridization of the amplified fragments or by direct sequencing of these amplified fragments.

Accordingly, the present invention relates to a nucleic acid comprising any one of SEQ ID NOs: 72-88, or a complementary polynucleotide sequence.

The invention also relates to a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 72-88, or a complementary polynucleotide sequence.

A further subject of the invention is a nucleic acid encoding a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 89-102.

The present invention relates to a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 89-102.

Other polymorphism

Other polymorphisms, particularly nucleotide substitutions located in the non-coding region (intron), were found in the ABC1 gene. Each of the eight polymorphisms identified in the ABC1 gene is shown in Table 5. Table 5 shows the wild type (WT) alleles and mutant alleles, wherein the polymorphism itself is defined by two nucleotide sequences, each corresponding to each allele.

Polymorphism found in ABC1 gene ABC1 gene intron location Wild-type allele SEQ ID NO: Mutant allele SEQ ID NO: Polymorphic base allele 1 / allele 2 Intron 7, nt 590 103 111 Insertion of A Intron 24, nt 23 104 112 G → A Intron 31, nt 30 105 113 G → T Intron 32, nt 982 106 114 G → A Intron 32, nt 1099 107 115 G → C Intron 40, nt 146 108 116 C → T Intron 47, nt 13 109 117 A → G Intron 47, nt 88 110 118 A → C

According to another aspect, the invention also relates to a nucleic acid of the ABC1 gene comprising a nucleotide sequence comprising at least one bi-allelic polymorphism described in Table 5.

Accordingly, the present invention relates to a nucleic acid comprising at least one of SEQ ID NOs: 103 and 109-118, or a complementary polynucleotide sequence.

The present invention also relates to nucleic acids comprising the nucleotide sequences represented by SEQ ID NOs: 103 and 109-118, or complementary polynucleotide sequences.

Detection of these ABC1 gene polymorphisms in DNA samples obtained from a subject may include, for example, specific amplification of the nucleotide region of ABC1 containing the polymorphic base, followed by sequencing of the amplified fragments of the allele or by the subject. By measuring the properties of

Detection of such polymorphisms in DNA samples obtained from a subject can also be performed with the aid of nucleotides or primers that specifically hybridize to a given allele containing one of the polymorphic bases of the polymorphism of the ABC1 gene according to the present invention.

By way of example, suitable nucleotide primers are primers which hybridize, for example, a base directly on the 5 'side of the polymorphic base of a fragment comprising polymorphism and a base at the 3' end. After the hybridization step of the specific primer, for example, an extension step by a mixture of two dideoxynucleotides complementary with a polymorphic base of fluorescence differentially labeled polymorphism, and then the detection of the obtained fluorescence signal are two differential It is possible to determine which of the labeled fluorescent dideoxynucleotides are incorporated and to directly deduce the nature of the polymorphic bases present at this polymorphic level.

Various approaches can be used for the labeling and detection of dideoxynucleotides. A homogeneous method based on FRET (“fluorescence resonance energy transfer”) has been described by Chen and Kwok (1997). According to this method, an amplified fragment of genomic DNA containing polymorphism is incubated with a fluorescein-labeled primer at the 5 ′ end in the presence of labeled dideoxynucleotide triphosphate and modified Taq polymerase. Labeled primers extend one base by incorporation of labeled dideoxynucleotides specific for alleles present on the complementary genomic DNA sequence. At the end of this genotyping reaction, the fluorescence intensities for the two labeled compounds for labeled dideoxynucleotides are analyzed directly without separation or purification. All these steps can be performed in the same tube and the modification of the fluorescent signal is monitored in real time. According to another embodiment, the extended primer can be analyzed by MALDI-TOF type mass spectroscopy. Bases located at the level of the polymorphic site are identified by measuring the mass added to the microsequencing primers (Haff and Smimov, 1997).

Such nucleotide primers can be immobilized, for example, on a support. It is also possible to immobilize the above-mentioned multispecific primers on the support, for example, in sequence, each primer being suitable for the detection of one of the polymorphisms of the ABC1 gene according to the invention.

The polymorphism of the ABC1 gene according to the invention relates to the relationship between the presence of a given allele in a subject and the propensity of such subject to one of the pathologies already associated with a given pathology, particularly those associated with chromosomal region 9q31, preferably with pathologies associated with cholesterol reverse transport dysfunction. It is particularly useful as a genetic marker in research.

There are many types of methods for genetic analysis of complex traits (phenotypes) (Lander and Schork, 1994). In general, allelic polymorphisms according to the invention are useful in any of the methods described in the state of the art for demonstrating statistically significant correlations between genotypes and phenotypes. Bi-allelic polymorphisms can be used for association analysis and allelic sharing methods. Preferably, the allelic polymorphism according to the present invention does not require the use of the lineage affected by the trait, but is a method that allows for the identification of genes associated with complex and idiopathic traits. Phenotype).

Other statistical methods of using the allele polymorphism according to the present invention are described, for example, by Forsell et al. (1997), Xiong et al. (1999), Horvath et al. (1998), Sham et al. (1995) or Nickerson et al. (1992). Are described.

Nucleotide Probes and Primers

Nucleotide probes and primers that hybridize with nucleic acids (genome DNA, messenger RNA, cDNA) according to the present invention also form part of the present invention.

According to the invention, a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotides; e) nucleotides 152-198, or complementary polynucleotides of SEQ ID NO: 27; f) nucleotide 1-1657 of SEQ ID NO: 36, or a complementary polynucleotide; g) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotides; Or h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a nucleic acid fragment derived from a complementary polynucleotide sequence, of the ABC1 gene, fragment or variant thereof (containing a mutation or polymorphism) in a sample. Useful for detecting the presence of at least one copy of a nucleotide sequence.

Nucleotide probes or primers according to the invention are a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary poly Nucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotides; e) nucleotides 152-198, or complementary polynucleotides of SEQ ID NO: 27; f) nucleotide 1-1657 of SEQ ID NO: 36, or a complementary polynucleotide; g) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotides, or h) nucleotide sequences comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or complementary polynucleotide sequences .

Nucleotide probes or primers according to the invention are a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or complementary poly Nucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotides; e) nucleotides 152-198, or complementary polynucleotides of SEQ ID NO: 27; f) nucleotide 1-1657 of SEQ ID NO: 36, or a complementary polynucleotide; g) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotides, or h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or at least eight nucleic acids comprising a complementary polynucleotide sequence Contiguous nucleotide sequences.

Preferably, the nucleotide probes or primers according to the invention comprise nucleic acids according to the invention, in particular a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, Any one of 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotides; e) nucleotides 152-198, or complementary polynucleotides of SEQ ID NO: 27; f) nucleotide 1-1657 of SEQ ID NO: 36, or a complementary polynucleotide; g) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotides, or h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or 10, 12 of a nucleic acid comprising a complementary polynucleotide sequence , 15, 18 or 20 to 25, 35, 40, 50, 70, 80, 100, 200, 500, 1000, 1500 consecutive nucleotides in length.

In contrast, a nucleotide probe or primer according to the present invention may be a nucleic acid according to the present invention, more specifically: a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65 Any one of, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotides; e) nucleotides 152-198, or complementary polynucleotides of SEQ ID NO: 27; f) nucleotide 1-1657 of SEQ ID NO: 36, or a complementary polynucleotide; g) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotides, or h) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or 12, 15 of a nucleic acid comprising a complementary polynucleotide sequence , 18, 20, 25, 35, 40, 50, 100, 200, 500, 1000, 1500 contiguous nucleotides in length.

Thus, the definition of a nucleotide probe or primer according to the present invention is defined under the high stringency hybridization conditions described above: a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54- Any one of 65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) hybridization with a nucleic acid comprising a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, or h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence To oligonucleotides.

According to a preferred embodiment, the nucleotide primers according to the invention comprise the nucleotide sequence of SEQ ID NOs: 119-136, 138, and 141-152, or the nucleotide sequence of the complementary nucleic acid sequence.

Examples of primers and primer pairs that allow for amplification of various regions of the ABC1 gene are shown in Table 6. The positions of each primer in SEQ ID NOs: 119-136, 138, and 141-152 and their hybridization regions in SEQ ID NOs: 1, 4-9, 11, and 13-16 are shown in Table 6. The abbreviation “Comp” refers to the complementary nucleic acid sequence.

Primer for Amplifying Nucleic Acid Fragments of ABC1 Gene Primer sequence number Position in sequence number Position in sequence Hybridization Zone 119 One 4621-4642 Intron 1 120 One Comp 4793-4814 Intron 2 121 One 9207-9226 Intron 2 122 One Comp 9583-9603 Intron 3 123 One 10455-10475 Intron 3 124 One Comp 10880-10897 Intron 4 125 4 101-121 Intron 4 126 4 Comp 473-492 Intron 5 127 5 83-102 Intron 5 128 5 Comp 378-395 Intron 6 129 6 4-25 Intron 6 130 6 Comp 193-212 Exxon 7 / Intron 7 131 7 449-470 Intron 7 132 7 Comp 881-899 Intron 8 133 8 451-472 Intron 8 134 8 Comp 916-934 Intron 9 135 8 870-891 Intron 9 136 8 Comp 1311-1330 Intron 10 138 9 Comp 3191-3212 Exxon 11 / Intron 11 141 11 251-269 Intron 17 142 11 Comp 551-570 Exxon 18 / intron 18 143 13 189-209 Intron 42 144 13 Comp 364-385 Exxon 43 / intron 43 145 14 12-32 Intron 43 / exon 44 146 14 Comp 184-202 Intron 44 147 15 23-40 Intron 44 148 15 Comp 437-455 Intron 45 149 16 158-178 Intron 45 150 16 Comp 528-549 Intron 46 151 16 817-836 Intron 46 152 16 Comp 1174-1195 Intron 47

According to certain embodiments of the preferred probes and primers according to the invention, they comprise all or part of a polynucleotide comprising any one of SEQ ID NOs: 119-136, 138, and 141-152, or a nucleic acid having a complementary nucleic acid sequence. .

Nucleotide probes or primers according to the present invention can be prepared by the cloning and action of restriction enzymes or by the phosphodiester method by Narang et al. (1979) or Brown et al. (1979), the diethylphosphoramidate method by Beaucage et al. (1980), or EU Patent No. It may be prepared by any suitable method well known to those skilled in the art, including by direct chemical synthesis according to techniques such as those on solid support described in EP 0,707,592.

Each of the nucleic acids according to the invention, including the aforementioned oligonucleotide probes and primers, can be labeled by incorporating markers that can be detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. For example, such markers may be radioisotopes ( ³² P, ³³ P, ³ H, ³⁵ S), fluorescent molecules (5-bromodeoxyuridine, fluorescein, acetylaminofluorene, digoxigenin) or biotin It may be composed of a ligand such as. Labeling of the probe is preferably carried out by incorporating a molecule labeled into the polynucleotide by primer extension, or by addition at the 5 'or 3' end. Examples of non-radioactive labels of nucleic acid fragments are particularly described in French Patent No. 78 109 75 or in a paper by Urdea et al. (1988) or Sanchez-pescador et al. (1988).

Preferably, nucleotide probes and primers according to the invention are described in Urdea et al. (1991) or in European Patent No. It may have structural features of the type that allow for amplification of signals such as probes described in EP-0,225,807 (CHIRON).

Oligonucleotide probes according to the present invention can be used for hybridization with corresponding messenger RNA, particularly when Southern type hybridization with genomic DNA or expression of the corresponding transcript is sought in the sample.

Probes and primers according to the invention can also be used for detection of mismatches or PCR amplification products.

Nucleotide probes or primers according to the invention can be immobilized on a solid support. Such solid supports are well known to those skilled in the art and include the wall surfaces of microparticles such as microtiter plates, polystyrene beads, magnetic beads, nitrocellulose bands or latex particles.

As a result, the invention also provides a nucleic acid comprising a polynucleotide sequence or a complementary polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or A method of detecting the presence in a sample of a nucleic acid comprising a nucleic acid fragment or variant of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence In this regard, the method

1) contacting one or more nucleotide probes or primers according to the invention with a sample to be tested;

2) detecting a complex that may be formed between the nucleic acid present in the sample and the probe.

According to a particular embodiment of the detection method according to the invention, the oligonucleotide probe and primer are immobilized on a solid phase.

According to another embodiment, the oligonucleotide probe and primer comprise a detectable marker.

The present invention also relates to a box or kit for detecting the presence of a nucleic acid according to the present invention in a sample.

a) one or more nucleotide probes or primers described above;

b) optionally, reagents necessary for the hybridization reaction.

According to a first aspect, the detection box or kit is characterized in that the probe or primer is immobilized on the support.

According to a second aspect, the detection box or kit is characterized in that the oligonucleotide probe comprises a marker detectable.

According to certain embodiments of the above-described detection kits, such kits can be used for the detection of a corresponding target nucleic acid or nucleic acid according to the present invention, more specifically SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118 And any of 137, or a plurality of oligonucleotide probes and / or primers according to the invention that can be used for detection of mutations in the coding region or non-coding region of a nucleic acid comprising a complementary polynucleotide sequence.

Thus, the probe according to the invention immobilized on a support can be aligned in a matrix such as a "DNA chip". Such aligned matrices are particularly described in US Pat. 5,143,854 is described in published PCT applications WO 90/15070 and WO 92/10092.

Support matrices in which the oligonucleotide probes are fixed at high density are described, for example, in US Pat. 5,412,087 and in published PCT application 95/11995.

The nucleotide primer according to the present invention may be any one of the nucleic acids according to the present invention, more specifically, the polynucleotide of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137 Sequences, or complementary polynucleotide sequences, can be used for amplification of nucleic acids. In contrast, nucleotide primers according to the invention include any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or nucleic acid fragments or variants of complementary polynucleotide sequences Can be used for amplification of nucleic acids.

In certain embodiments, the nucleotide primers according to the invention comprise a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or Complementary polynucleotide sequences; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, or i) a sequence It can be used for amplification of nucleic acids represented by any one of the numbers 1, 4-65, 68-70, 72-88, 103, 109-118, and 137 or by complementary polynucleotide sequences.

Another subject of the invention is a nucleic acid according to the invention, more specifically: a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and Any one of 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, or h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, or i) A method for amplifying a nucleic acid represented by any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137 or as a complementary polynucleotide sequence, the method

a) contacting the sample with presumed presence of the target nucleic acid with a pair of nucleotide primers each having a hybridization position at the 5 'side and the 3' side of the target nucleic acid region to be amplified, in the presence of the reagents required for the amplification reaction; ;

b) detecting the amplified nucleic acid.

In order to carry out the amplification reaction described above, the aforementioned nucleotide primers will preferably be used.

In addition, the subject of the present invention is a nucleic acid according to the present invention, more specifically, a) SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68-70 And any one of 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) a nucleotide 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence, h) a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, or i) a sequence An amplification box or kit of nucleic acid represented by any one of Nos. 1, 4-65, 68-70, 72-88, 103, 109-118, and 137 or a complementary polynucleotide sequence, wherein the box or kit is

a) a nucleotide primer pair according to the invention wherein the hybridization site is located on each of the 5 'side and the 3' side of the target nucleic acid to be amplified; And optionally

b) Contains the reagents required for the amplification reaction.

Such amplification boxes or kits will preferably comprise at least one pair of nucleotide primers described above.

In addition, subject matter of the present invention includes a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence ; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; g) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or h) all or a nucleic acid comprising the nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or the complementary polynucleotide sequence; Some amplification boxes or kits,

1) a nucleotide primer pair according to the present invention wherein the hybridization site is located on each of the 5 'side and the 3' side of the target nucleic acid to be amplified; And optionally

2) Contains reagents necessary for amplification reaction.

The amplification box or kit will preferably comprise at least one pair of nucleotide primers described above.

The invention also relates to a box or kit for detecting the presence of a nucleic acid according to the invention in a sample, said box or kit comprising: a) at least one nucleotide probe according to the invention; b) optionally, reagents necessary for the hybridization reaction.

According to a first aspect, the detection box or kit is characterized in that the nucleotide probe and primer are immobilized on the support.

According to a second aspect, the detection box or kit is characterized in that the nucleotide probe and the primer comprise a marker detectable.

According to specific embodiments of the above-described detection kits, such kits can be used for the detection of the corresponding target nucleic acid or for the detection of mutations in the coding region or non-coding region of the nucleic acid according to the present invention, and / or the plurality of oligonucleotides according to the present invention. It will include a primer. According to a preferred embodiment of the invention, the target nucleic acid comprises a polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary nucleic acid sequence. . In contrast, the target nucleic acid is a nucleic acid fragment or variant of a nucleic acid comprising any one of SEQ ID NOs: 1, 4-65,68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence.

According to a preferred embodiment, the two primers according to the invention are all or part of SEQ ID NOs: 125 and 126, or complementary polynucleotides, which allow to amplify the region of exon 5 of the ABC1 gene carrying the mutations set forth in SEQ ID NO: 72 above Nucleic acids having a sequence.

According to a second preferred embodiment, the two primers according to the invention allow for amplification of the region of exon 6 of the ABC1 gene carrying a mutation indicated in SEQ ID NO: 73 or 742 above, or in a nucleic acid having a complementary polynucleotide sequence. , All or part of SEQ ID NOs: 127 and 128.

According to a third preferred embodiment, the two primers according to the invention enable amplification of regions of exon 8 of the ABC1 gene carrying the mutations indicated in SEQ ID NOs: 75-77, or in nucleic acids having complementary polynucleotide sequences. , All or part of SEQ ID NOs: 131 and 132.

According to a fourth preferred embodiment, the two primers according to the present invention are capable of amplifying a region of exon 27 of the ABC1 gene carrying a mutation indicated in SEQ ID NO: 84 above, or in a nucleic acid having a complementary polynucleotide sequence. All or part of numbers 155 and 156;

According to a fifth preferred embodiment, the two primers according to the invention are capable of amplifying a region of exon 32 of the ABC1 gene carrying a mutation indicated in SEQ ID NO: 85 above, or in a nucleic acid having a complementary polynucleotide sequence. It includes all or part of the numbers 159 and 160.

According to a sixth preferred embodiment, the two primers according to the invention allow for amplification of the region of exon 47 of the ABC1 gene carrying the mutations indicated in SEQ ID NOs: 87 or 88, or in nucleic acids having complementary polynucleotide sequences , All or part of SEQ ID NOs: 175 and 176.

According to another preferred embodiment, the primers according to the invention generally comprise all or part of any one of SEQ ID NOs: 119-136, 138, and 141-152, or complementary sequences.

Nucleotide primers according to the present invention are used in genotyping and / or population genotyping methods of subjects, in particular in the context of a linkage study between specific alleles or allele groups in a subject and the presence of specific phenotypes (traits) in these subjects. The incidence of these subjects, for example, for diseases associated with cholesterol reverse transport deficiency, or for pathologies where the candidate chromosomal region is located on chromosome 9, more precisely on the 9q arm, and more precisely on the 9q31 locus. It is particularly useful in the research context of the subject's propensity to develop.

Recombinant vector

The present invention relates to a recombinant vector comprising a nucleic acid according to the present invention. For the purposes of the present invention "vector" will be understood to mean a cyclic or linear DNA or RNA molecule that is in single- or double-stranded form.

Preferably such recombinant vector will comprise a nucleic acid selected from the following nucleic acids:

a) a nucleic acid comprising the polynucleotide sequence of any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence,

b) a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence,

c) a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence,

d) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids having at least 8 consecutive nucleotides of nucleic acid;

e) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids having at least 8 consecutive nucleotides of nucleic acid;

f) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or complementary polynucleotide sequences, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of complementary polynucleotide sequences Nucleic acids having 85%, 90%, 95%, or 95% nucleotide identity with the nucleic acid;

g) 1) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; 2) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; 3) the nucleotide 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; 4) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; 5) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; 6) nucleotide 1-1657, or the complementary polynucleotide sequence of SEQ ID NO: 36; 7) nucleotides 1-242 of SEQ ID NO: 53, or the complementary polynucleotide sequence, or 8) nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or polynucleotide sequences of the complementary polynucleotide sequence Nucleic acids that hybridize with nucleic acids under high stringency hybridization conditions;

h) a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71; And

i) a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

According to a first aspect, the recombinant vector according to the invention is used for amplification of the inserted nucleic acid following transformation or transfection of the cell host of interest.

According to a second aspect, the recombinant vector according to the present invention corresponds to an expression vector comprising, in addition to the nucleic acid according to the present invention, a regulatory signal or nucleotide sequence which directs or regulates the transcription and / or translation of the nucleic acid and its encoded mRNA. .

According to a preferred embodiment, the recombinant vector according to the invention will in particular comprise the following components;

(1) an element or signal that regulates the expression of the nucleic acid to be inserted, such as a promoter and / or enhancer sequence;

(2) a nucleotide coding region contained within the nucleic acid according to the present invention to be inserted into the vector, wherein the coding region is arranged in phase with the regulatory element or signal described in (1); And

(3) a suitable nucleic acid for initiation and termination of transcription of the nucleotide coding region of the nucleic acid described in (2).

In addition, the recombinant vector according to the present invention may comprise one or more origin, marker or selection markers for expression in the cell host to be amplified or expressed.

For example, the bacterial promoter can be a LacI or LacZ promoter, a T3 or T7 bacteriophage RNA polymerase promoter, a lambda phage PR or PL promoter.

Promoters of eukaryotic cells will include the Herpes Simplex Virus (HSV) virus thymidine kinase promoter or the mouse metallothionein-L promoter.

In general, for the selection of suitable promoters, those skilled in the art can refer to the books described by Sambrook et al. (1989) or the techniques described by Fuller et al. (1996) cited above.

If expression of the genomic sequence of the ABC1 gene is desired, vectors which can contain large insertion sequences will preferably be used. In certain embodiments, bacteriophage vectors such as P1 bacteriophage vectors such as the vector p158 or the vector p158 / neo8 described by Sternberg (1992, 1994) are preferably used.

Preferred bacterial vectors according to the invention are, for example, vectors pBR322 (ATCC37017) or pAA223-3 (Pharmacia, Uppsala, Sweden), and pEEM1 (Promega Biotech, Madison, Wisconsin, USA).

Other commercial vectors such as vectors pQE70, pQE60 (Qiagen), psiX174, pBluescript SA, pNH8A, pNH16A, pNH18A, pNH46A, pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene) are also mentioned.

They may also be vectors of baculovirus type, such as the vector pVL1392 / 1393 (Pharmingen) used for transfection of cells of the Sf9 lineage (ATCC No. CRL 1711) derived from Spodogerra frujiferda.

They may also be adenovirus vectors such as type 2 or type 5 human adenoviruses.

Recombinant vectors according to the invention may also be retroviral vectors or adeno-associated vectors (AAV). Such adeno-associated vectors are described, for example, by Flotte et al. (1992), Samulski et al. (1989), or McLaughlin BA et al. (1996).

In order to allow expression of the polynucleotides according to the invention, the latter must be introduced into the host cell. The introduction of polynucleotides according to the invention into host cells can be carried out in vitro according to techniques well known to those skilled in the art for transforming or transfecting cells, either in primer culture or in the form of cell lines. In addition, for the prevention or treatment of diseases associated with the back transport deficiency of cholesterol, the polynucleotides according to the invention can be introduced in vivo or ex vivo.

In order to introduce the polynucleotides or vectors of the present invention into host cells, those skilled in the art are preferably calcium phosphate precipitation (Graham et al., 1973; Chen et al., 1987), DEAE dextran (Gopal, 1985), electric Such as perforations (Tur-Kaspa, 1896; Potter et al., 1984), direct microinjection (Harland et al., 1985), liposomes filled with DNA (Nicolau et al., 1982, Fraley et al., 1979). Reference may be made to various techniques.

Once the polynucleotides are introduced into the host cell, they can be stably integrated into the cell genome. Integration can be achieved at the correct site of the genome by homologous recombination, or it can be integrated randomly. In some embodiments, the polynucleotides can remain stable in the host cell in the form of episomal fragments, wherein the episomes comprise sequences that permit the latter retention and replication independently of the cell cycle or in a cooperative manner.

According to a specific embodiment, the method of introducing a polynucleotide according to the invention into a host cell, especially a host cell obtained from a mammal, in vivo is carried out according to the invention under the control of a pharmaceutically acceptable vector and a suitable regulatory sequence. Introducing a formulation comprising a "naked" polynucleotide by topical injection at the level of selected tissue, such as smooth muscle tissue, wherein the "naked" polynucleotide is taken up by the cells of the tissue.

Compositions for in vitro and in vivo use comprising “naked” polynucleotides are described, for example, in PCT Application No. WO 95/11307 (Institut Pasteur, Inserm, University of Ottawa) and in Tacson et al. (1996) and Huygen et al. (1996).

According to certain embodiments of the present invention, a composition for in vivo production of ABC1 protein is provided. Such compositions include polynucleotides that encode ABC1 polypeptides, which are placed under the control of appropriate regulatory sequences, in solution in a physiologically acceptable vector.

The amount of vector injected into the selected host organism will vary depending on the site of injection. As a guide, about 0.1 to about 100 μg of a polynucleotide encoding the ABC1 protein may be injected into the body of an animal, preferably for patients who may or may have already developed a disease associated with cholesterol back transport deficiency. It can be administered to patients with predisposition or to patients who have already developed the disease.

As a result, the present invention also relates to a pharmaceutical composition for the prophylaxis or treatment of a patient or a subject suffering from the reverse transport dysfunction of cholesterol comprising a nucleic acid encoding ABC1 protein, together with one or more physiologically suitable excipients.

Preferably such a composition will comprise a nucleic acid comprising the polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70, wherein the nucleic acid is under the control of an appropriate regulatory element or signal.

Subject of the present invention is also a pharmaceutical composition for the prophylaxis or treatment of a patient or subject suffering from reverse transport dysfunction of cholesterol comprising a recombinant vector according to the invention, together with one or more physiologically suitable excipients.

The present invention also relates to the use of the nucleic acid according to the invention encoding the ABC1 protein for the prevention of various forms of atherosclerosis or for the preparation of a medicament for treating a subject with cholesterol reverse transport dysfunction.

The present invention also relates to the use of the recombinant vector according to the present invention comprising a nucleic acid encoding ABC1 protein for the prevention of various forms of atherosclerosis or for the preparation of a medicament for treating a subject suffering from cholesterol reverse transport dysfunction.

Accordingly, the subject of the invention is also a recombinant vector comprising a nucleic acid according to the invention which encodes an ABC1 protein or polypeptide involved in cholesterol metabolism.

The invention also provides for the preparation of a pharmaceutical composition for the prophylaxis and / or treatment of cardiovascular diseases or symptoms associated with HDL deficiency such as HDL deficiency, HDL deficiency, LCAT deficiency, malaria, and diabetes associated with tangerine disease and / or FHD disease. The use of a recombinant vector for the present invention.

The invention also relates to the use of cells genetically modified in vitro with a recombinant vector according to the invention, or recombinant vector producing cells, to allow long-term and effective expression of a biologically active ABC1 polypeptide in vivo. Cells are transplanted into the body.

Vectors useful for somatic gene therapy and compositions containing such vectors

The invention also relates to novel therapies for the treatment of pathologies associated with the transport of cholesterol. The present invention provides an advantageous solution to the drawbacks of the prior art by demonstrating the therapeutic potential of pathologies associated with cholesterol transport by gene therapy by in vivo delivery and expression of genes encoding ABC1 protein involved in the transport and metabolism of cholesterol. to provide. Thus, the present invention provides a simple means that allows for the specific and effective treatment of related pathologies such as, for example, atherosclerosis.

Gene therapy involves the introduction of correction and genetic information for deficiencies or abnormalities (mutations, abnormal expressions, etc.) into diseased cells or organs, resulting in the expression of the therapeutic protein. This genetic information can be introduced ex vivo into cells extracted from the organ (the modified cells are then reintroduced into the body) or directly into the appropriate tissue in vivo. In this second case, various techniques exist, such as complexes of DNA and DEAE-dextran (Pagano et al., 1967), complexes of DNA and nuclear proteins (Kaneda et al., 1989), DNA and lipids There are a variety of transfection techniques involving complexes of (Felgner et al., 1987), the use of liposomes (Fraley et al., 1980), and the like. More recently, the use of viruses as vectors for gene transfer has emerged as a promising alternative to this physical transfection technique. In this regard, various viruses have been tested for specific cell population infectivity. Especially retroviruses (RSV, HMS, MMS, etc.), HSV viruses, adeno-associated viruses and adenoviruses.

Accordingly, the present invention also relates to novel therapies for the treatment of pathologies associated with the transport of cholesterol in the in vivo delivery and expression of genes encoding ABC1. In particular, the present invention provides new therapies for the treatment and / or prophylaxis of HDL deficiencies such as HDL deficiency, HDL deficiency, LCAT deficiency, malaria, and diabetes associated with Tangerine disease and / or FHD disease. In a particularly preferred manner, Applicants can construct recombinant vectors comprising nucleic acids encoding ABC1 protein involved in the metabolism of cholesterol, and administer these recombinant vectors in vivo, which administration can be carried out without any cytopathological effects, It has been found to allow stable and effective expression of biologically active ABC1 protein.

The invention also stems from the demonstration that adenoviruses constitute a particularly efficient vector for the delivery and expression of the ABC1 gene. In particular, the present invention shows that the use of recombinant adenovirus as a vector makes it possible to achieve a sufficiently high expression level of the gene to produce the desired therapeutic effect. Other viral vectors are also claimed, such as retroviruses or adeno-associated viruses (AAV) that allow for stable expression of genes.

Accordingly, the present invention provides novel therapeutic and prophylactic methods for the treatment and prevention of cardiovascular and neurological pathologies associated with transport abnormalities of cholesterol.

Accordingly, the subject of the present invention is a defective recombinant virus comprising a nucleic acid according to the present invention encoding an ABC1 protein or polypeptide involved in cholesterol metabolism.

The invention also provides a deficiency for the preparation of a pharmaceutical composition for the treatment and / or prevention of cardiovascular diseases or symptoms associated with HDL deficiency, such as HDL deficiency, HDL deficiency, LCAT deficiency, malaria, and diabetes associated with Tangerine disease and / or FHD disease. It relates to the use of the type recombinant virus.

The invention also provides for the production of cells that have been genetically modified in vivo with a defective recombinant virus according to the invention, or cells which produce a defective recombinant virus, to allow long-term and effective expression of a biologically active ABC1 polypeptide in vivo. In regards to use, wherein the cells are transplanted into the body.

The present invention demonstrates that DNA sequences encoding ABC1 can be incorporated into viral vectors, allowing these vectors to effectively express mature forms of biological activity. More specifically, the present invention shows that in vivo expression of ABC1 can be obtained by direct administration of adenoviruses or by transplantation of genetically modified cells by producing cells or adenoviruses or retroviruses incorporating such DNA. .

The present invention is particularly advantageous because it enables induction of regulated expression of ABC1 without deleterious effects in organs not normally involved in the expression of the protein. In particular, significant release of the ABC1 protein is obtained by producing a vector of the present invention or transplanting an ex vivo infected cell with the vector of the present invention.

The transport activity of cholesterol produced in the context of the present invention may be of the human or animal ABC1 type. The nucleic acid sequence used in the context of the present invention may be a hybrid construct consisting of cDNA, genomic DNA (gDNA), RNA (in the case of a retrovirus) or cDNA into which, for example, one or more introns (gDNA) will be inserted. It may also include synthetic or semisynthetic sequences. In a particularly advantageous manner, cDNA or gDNA is used. In particular, the use of gDNA allows for better expression in human cells. To allow for incorporation into the viral vector according to the invention, these sequences are preferably modified by site-directed mutations, for example for insertion of particularly suitable restriction sites. The sequences described in the prior art were in fact not designed for use according to the present invention and have been shown to require prior modification to achieve substantial expression. In the context of the present invention, the use of nucleic acid sequences encoding human ABC1 protein is preferred. It is also possible to use constructs encoding derivatives of these ABC1 proteins. Derivatives of these ABC1 proteins include, for example, sequences encoding products that are obtained by mutations, deletions and / or additions to native sequences and retain cholesterol transport activity. Such modifications can be carried out by techniques known to those skilled in the art (see General Molecular Biology Techniques below). The biological activity of the derivatives thus obtained can then be readily determined as indicated in particular examples of cholesterol outflow from cells. Derivatives for the purposes of the present invention can also be obtained by hybridization from nucleic acid libraries using native sequences or fragments thereof as probes.

These derivatives are, in particular, molecules with higher affinity to the binding site, molecules that show greater resistance to proteases, molecules with higher therapeutic efficacy or less side effects, or optionally new biological properties. Derivatives also include modified DNA sequences that allow for enhanced expression in vivo.

In a first aspect, the invention relates to a defective recombinant virus comprising a cDNA encoding the ABC1 polypeptide involved in the transport and metabolism of cholesterol. In another preferred embodiment of the invention, the defective recombinant virus comprises genomic DNA (gDNA) encoding the ABC1 polypeptide involved in the transport and metabolism of cholesterol. Preferably, the ABC1 polypeptide comprises the amino acid sequence of SEQ ID 71. More preferably, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

Vectors of the invention can be prepared from various types of viruses. Preferably, vectors derived from adenoviruses, adeno-associated viruses (AAV), herpesviruses (HSV) or retroviruses are used. Preference is given to using adenoviruses for direct administration or ex vivo modification of the cells to be transplanted, or retroviruses for the transplantation of production cells.

The viruses according to the invention are defective, ie they are incapable of autonomous replication in target cells. In general, the genome of the defective virus used in the context of the present invention thus lacks at least the sequence necessary for replication of the virus in the infected cell. These regions can be removed (completely or partially), rendered nonfunctional, or substituted with other sequences, particularly nucleic acid sequences encoding the ABC1 protein. Preferably, the defective virus nevertheless retains the sequence of genes required for the encapsidation of viral particles.

More specifically, adenovirus has been characterized by a variety of serotypes with slightly different structures and characteristics. In these serotypes, type 2 or 5 human adenoviruses (Ad 2 or Ad 5) or adenoviruses of animal origin (see WO 94/26914) are preferably used in the context of the present invention. Adenoviruses of animal origin that may be used in the context of the present invention include dogs, cows, mice (eg Mav1, Beard et al., Virology 75 (1990) 81), sheep, pigs, birds or monkeys (eg For example, adenovirus of SAV) origin can be mentioned. Preferably, the adenovirus of animal origin is a canine adenovirus, more preferably CAV2 adenovirus (eg, Manhattan or A26 / 61 strain (ATCC VR-800)). Preferably, adenoviruses of human or dog or mixed origin are used in the context of the present invention. Preferably, the defective adenovirus of the invention comprises an ITR, a sequence allowing encapsidation and a sequence encoding the ABC1 protein. Preferably, in the adenovirus genome of the present invention, the El region is at least nonfunctional. More preferably, in the genome of the adenovirus of the present invention, at least one of the E1 gene and the E2, E4 and L1-L5 genes is nonfunctional. Viral genes to be contemplated may be rendered nonfunctional by any technique known to those skilled in the art, in particular by complete inhibition, substitution, partial deletion or addition of one or more bases in the gene under consideration. Such modifications can be obtained in vitro (on isolated DNA) or at the site, for example by genetic engineering techniques, or by mutagenesis treatment. Other regions may also be modified, in particular the E3 (WO 95/02697), E2 (WO 94/28938), E4 (WO 94/28152, WO 94/12649, WO 95/02697) and L5 (WO 95/02697) regions. Can be. According to a preferred embodiment, the adenovirus according to the invention is inserted at the level of the El region in which the sequence encoding ABC1 comprises a deletion in the El and E4 regions. According to another preferred embodiment, the deletion is in the El region at the level at which the sequence encoding the E4 region and ABC1 (French patent application FR94 13355) is inserted.

Defective recombinant adenoviruses according to the invention can be prepared by any technique known to those skilled in the art (Levreo et al., 1991, EP 185 573; and Graham, 1984). In particular, they can be prepared by homologous recombination between adenoviruses and plasmids carrying nucleic acids encoding the ABC1 protein in particular. Homologous recombination occurs after cotransfection of adenoviruses and plasmids into appropriate cell lines. The cell line used should be (i) transformable by said element and (ii) preferably contain sequences capable of complementing a portion of the defective adenovirus genome in an integrated form to avoid recombination risk. Examples of cell lines include, in particular, human embryonic kidney cell line 293 (Graham et al., 1977) or application No. 1 containing the left portion (12%) of the Ad5 adenovirus genome integrated into the genome. Cell lines capable of complementing El and E4 functions as described in WO 94/26914 and WO 95/02697.

The amplified adenovirus is then recovered and purified according to conventional molecular biology techniques as described in the Examples.

In the case of adeno-associated viruses (AAV), they are relatively small DNA viruses that integrate into the genome of the cells they infect in a stable and site-specific manner. They can infect a broad spectrum of cells without inducing any effect on cell proliferation, morphology or differentiation. Moreover, they do not appear to be involved in pathology in humans. The genome of AAV is cloned and sequenced and characterized. It contains about 4700 bases and at each end contains a reverse repeat region (ITR) of about 145 bases that serves as a replication source for the virus. The remainder of the genome is subdivided into two essential regions that carry capsidation functions: the left part of the genome containing the rep gene, involved in viral replication and expression of viral genes; The right part of the genome containing the cap gene encoding the viral capsid protein.

The use of vectors derived from AAV for the delivery of genes in vitro and in vivo is described in the literature (see in particular WO 91/18088; WO 93/09239; US 4,797,368, US 5,139,941, EP 488 528). These applications include various constructs derived from AAV, in which the rep and / or cap genes are deleted and replaced by the gene, and in vitro (on cells in culture) or in vivo (directly into the organism) of the gene. The use for transfection is described. However, none of these documents describe or imply the use of recombinant AAV for in vitro or ex vivo delivery and expression of the ABC1 protein, or the benefits of such delivery. The defective recombinant AAV according to the present invention comprises a plasmid containing a sequence encoding the ABC1 protein bounded by two AAV reverse repeat regions (ITRs), and a plasmid carrying AAV capsiding genes (rep and cap genes), It can be prepared by cotransfection into cell lines infected with human helper virus (eg, adenovirus). The resulting recombinant AAV is then purified by conventional techniques.

For herpesviruses and retroviruses, the construction of recombinant vectors is extensively described in the literature: Breakfield et al., (1991); EP 453242, EP 178220, Bernstein et al. (1985); See McCormick (1985) et al.

In particular, retroviruses are integrated viruses that infect dividing cells. The genome of the retroviruses in particular essentially comprises two long terminal repeats (LTRs), capsidizing sequences and three coding regions (gag, pol and env). In recombinant vectors derived from retroviruses, the gag, pol and env genes are generally completely or partially deleted and replaced with the corresponding heterologous nucleic acid sequence. Such vectors include, in particular, MoMuLV (“rat Molecular Leukemia Virus”; also called MoMLV), MSV (“Rat Molecular Sarcoma Virus”), HaSV (“Harva Sarcoma Virus”); SNV ("splenic necrosis virus"); It can be produced from various kinds of retroviruses, such as RSV ("Raux sarcoma virus") or Friend virus.

In order to construct recombinant retroviruses containing sequences encoding the ABC1 protein according to the present invention, in particular LTRs, capsidized sequences and plasmids containing the coding sequences are generally constructed and then the plasmids lack the retroviral function. The so-called capsidated cell lines, which can serve as trans, are transfected. In general, the capsid may thus express the gag, pol and env genes. Such capsids are described in the prior art and in particular in the PA317 strain (US 4,861,719), the PsiCRIP strain (WO 90/02806) and the GP + envAm-12 strain (WO 89/07150). In addition, recombinant retroviruses may contain modifications at the level of LTR to inhibit transcriptional activity and extend the capsidation sequence, which contains the gag gene moiety (Bender et al., 1987). The resulting recombinant retroviruses are then purified by conventional techniques.

In order to practice the invention, it is preferred to use a defective recombinant adenovirus. Particularly advantageous properties of adenoviruses are desirable for in vivo expression of proteins with cholesterol transport activity. The adenovirus vectors according to the present invention are particularly preferred for in vivo direct administration of purified suspensions or for ex vivo transformation of cells, especially autonomous cells, from the viewpoint of transplantation. Moreover, the adenovirus vectors according to the invention also show significant advantages, such as very high infection efficiencies, which make it possible to carry out infections using small amounts of virus suspensions.

According to another particularly preferred aspect of the invention, retroviral vector producers containing sequences encoding the ABC1 protein are used for in vivo transplantation. Cell lines that can be used for this purpose in particular modified PA317 (US 4,861,719), PsiCrip (WO 90/02806) and GP + envAm- modified to allow the production of retroviruses containing nucleic acid sequences encoding the ABC1 protein according to the invention. 12 (US 5,278,056) cells. For example, differentiation-potent stem cells that are precursors of blood cell lines can be collected and isolated from the subject. When cultured, these cells can be transfected with retroviral vectors containing sequences encoding the ABC1 protein under the control of viral, nonviral or nonviral promoters specific to macrophages or under the control of their promoters. These cells are then reintroduced into the subject. Differentiation of these cells is responsible for monocytes that participate in the removal of cholesterol from the arterial wall when transformed into blood cells expressing ABC1 protein, especially macrophages. Such macrophages expressing ABC1 protein will have increased ability to metabolize excess cholesterol and its removal by the primary receptor of membrane cholesterol will be available to the cell surface.

Preferably, in the vector of the present invention, the sequence encoding the ABC1 protein is under regulatory signals to allow expression in infected cells. These may be expression signals that are homologous or heterologous, ie signals that are different from those originally responsible for expression of the ABC1 protein. They may also be, in particular, sequences responsible for the expression of other proteins, or synthetic sequences. In particular, they may be sequences of eukaryotic or viral genes or derived sequences that stimulate or inhibit transcription of the gene in a specific or nonspecific manner and in an inducible or non-inducible manner. For example, they may be promoter sequences derived from the genome of the cell to be infected or from the viral genome, in particular the E1A or major late promoter (MLP) gene, cytomegalovirus (CMV) promoter, RSV-LTR, etc. of the adenovirus. have. Examples of eukaryotic promoters include ubiquitous promoters (HPRT, bimentin, α-actin, tubulin, etc.), intermediate filament promoters (desmin, neurofilament, keratin, GFAP, etc.), (MDR, CFTR, or factor VIII types, etc.). ) Promoters of therapeutic genes, tissue-specific promoters (pyruvate kinases, borrowers, promoters of fatty acid binding enteric proteins, promoters of smooth muscle cell α-actin, promoters specific to the liver; Apo Al, Apo All, human albumin, etc.) or to stimulation Corresponding promoters (steroid hormone receptors, retinoic acid receptors, etc.) may be mentioned. In addition, such expression sequences can be modified by addition of enhancers or regulatory sequences and the like. In addition, if the inserted gene does not contain an expression sequence, it may be inserted into the genome of a defective virus lying downstream of this sequence.

In certain embodiments, the invention relates to a defective recombinant virus comprising a nucleic acid encoding an ABC1 protein involved in the metabolism of cholesterol under the control of a promoter selected from among RSV-LTR or CMV early promoters.

As noted above, the present invention also relates to the use of the aforementioned viruses for the manufacture of pharmaceutical compositions for the treatment and / or prevention of pathologies associated with the transport of cholesterol.

The present invention also relates to pharmaceutical compositions comprising one or more of the defective recombinant viruses described above. Such pharmaceutical compositions may be formulated for administration by topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular or transdermal routes and the like. Preferably, the pharmaceutical composition of the present invention comprises a pharmaceutically acceptable vehicle or physiologically suitable excipient for injectable formulation, especially in the case of intravenous injection, such as in the vein of a patient. This relates in particular to isotonic sterile liquids, or to dried, in particular freeze-dried compositions, in the latter case of injection solutions upon addition according to the case of sterile water or physiological saline. Direct injection into the arterial vein of the patient is preferred because it can target infection at the liver level and focus therapeutic effects at this organ level.

The dosage of the defective recombinant virus used for injection can be adjusted as a function of various parameters, in particular the viral vector, the mode of administration used, the relevant pathology or the desired duration of treatment. In general, the recombinant adenovirus according to the invention is formulated and administered at a dosage of 10 ⁴ to 10 ¹⁴ pfu / ml, preferably 10 ⁶ to 10 ¹⁰ pfu / ml. The term pfu (“plaque forming unit”) corresponds to the degree of infection of the viral solution and is determined by measuring the number of plaques resulting from infected cell lysis, usually 48 hours after infection of the appropriate cell culture. Techniques for measuring pfu titers of viral solutions are described in detail in the literature.

In the case of retroviruses, the compositions according to the invention may contain the producing cells directly in terms of transplantation.

In this regard, another subject of the invention relates to any mammalian cell infected with one or more defective recombinant viruses according to the invention. More specifically, the present invention relates to a population of human cells infected with such viruses. These may in particular be cells of blood origin (differentiated pluripotent stem cells or precursors), fibroblasts, myoblasts, hepatocytes, keratinocytes, smooth muscle and endothelial cells, glial cells and the like.

The cells according to the invention can be derived from primary cultures. These are collected by techniques known to those of skill in the art and then cultured under conditions that permit growth. More specifically for fibroblasts, they can be readily obtained from biopsies, for example according to the technique described by Ham (1980). Such cells may be used directly for infection with the virus or may be stored by lyophilization for the purpose of setting up a self-derived library in terms of future use. The cells according to the invention can be, for example, secondary cultures obtained from a predetermined library (see for example EP 228458, EP 289034, EP 400047, EP456640).

Cells in culture are infected with the recombinant virus according to the present invention, conferring the ability to produce biologically active ABC1 protein. Infection is performed in vitro according to techniques known to those skilled in the art. In particular, depending on the cell type used and the desired number of virus copies per cell, one skilled in the art can adjust infection redundancy and optionally the number of infection cycles produced. This step should be performed under appropriate sterile conditions if the cells are for in vivo administration. The dosage of recombinant virus used for cell infection can be adjusted by one skilled in the art according to the desired purpose. The conditions described above for in vivo administration can also be applied to in vitro infections. In the case of infection with retroviruses, the cells to be infected with the cells producing the recombinant retrovirus according to the invention can be cultured together. This may eliminate the need for retrovirus purification.

Another subject of the invention relates to a graft comprising a mammalian cell or a cell producing a recombinant virus infected with one or more defective recombinant viruses according to the invention, and an extracellular matrix. Preferably, the graft according to the invention comprises 10 ⁵ to 10 ¹⁰ cells, more preferably 10 ⁶ to 10 ⁸ cells.

More specifically, in the graft of the present invention, the extracellular matrix comprises a gelling compound and optionally a support that allows for cell fixation.

For the preparation of the grafts according to the invention, various kinds of gelling agents can be used. Such gelling agents are used to promote the encapsulation of cells in a matrix having a gel composition, and, optionally, the fixation of cells on a support. Various cell adhesion agents, in particular collagen, gelatin, glycosaminoglycans, fibronectin, lectins and the like can be used as the gelling agent. Preferably, collagen is used in the context of the present invention. It may be collagen of human, bovine or rat origin. More preferably, type I collagen is used.

As mentioned above, the composition according to the invention advantageously comprises a support which allows for cell fixation. The term fixation refers to biological and / or chemical and / or physical interaction forms that result in adhesion and / or attachment of cells to a support. The cells may also cover the support used, pass through such support, or both. It is preferred in the context of the present invention to use solid non-toxic and / or biocompatible supports. In particular, polytetrafluoroethylene (PTFE) fibers or supports of biological origin can be used.

The present invention provides for the treatment of myocardial infarction, angina, sudden death, cardiac insufficiency and cerebrovascular contingency in the pathologies associated with the transport of cholesterol, in particular obesity, HDL deficiency, hypertriglyceridemia, atherosclerosis, or cardiovascular disease areas Or it provides a very effective means of prevention.

In addition, these therapies can be applied to both humans and animals, such as sheep, cattle, livestock (dogs, cats, etc.), horses, fish, and the like.

Recombinant host cell

The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, more specifically a polynucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to a recombinant host cell comprising a nucleic acid of the invention, more specifically a nucleotide sequence represented by SEQ ID NO: 69 or SEQ ID NO: 70, or a nucleic acid comprising a complementary polynucleotide sequence.

Specifically, the present invention provides a recombinant host cell comprising a nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence. It is about.

The invention also provides a recombinant comprising a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence. It relates to a host cell.

The present invention also relates to a recombinant host cell comprising a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71.

The invention also relates to a recombinant host cell comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

According to another aspect, the invention also relates to a recombinant host cell comprising the recombinant vector according to the invention. Accordingly, the present invention also provides a recombinant host cell comprising a recombinant vector comprising a nucleic acid of the invention, more specifically a nucleic acid comprising a nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 70, or a nucleic acid comprising a complementary polynucleotide sequence. It is about.

More specifically, the present invention provides a recombinant vector comprising a nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence. It relates to a recombinant host cell comprising a.

The invention also provides a recombinant comprising a nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or complementary polynucleotide sequences. It relates to a recombinant host cell comprising a vector.

The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence.

The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71.

The invention also relates to a recombinant host cell comprising a recombinant vector comprising a nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71.

Preferred host cells according to the invention are, for example:

a) Prokaryotic host cells: Escherichia coli (Escherichia coli, strain DH5-α), Bacillus subtilis (Bacillus subtilis), Salmonella Phi mu Solarium (Salmonella typhimurium) strain, or Pseudomonas (Pseudomonas), Streptomyces ( Strain strains of the same genus, such as Streptomyces ) and Staphylococus ;

b) Eukaryotic host cells: HeLa cells (ATCC No. CCL2), Cv 1 cells (ATCC No. CCL70), COS cells (ATCC No. CRL 1650), sf-9 cells (ATCC No. CRL 1711), CHO cells (ATCC No. CCL-61) or 3T3 cells (ATCC No. CRL-6361).

Mutated ABC1 Polypeptide

According to another aspect, the present invention relates to a polypeptide encoded by a mutated ABC1 gene, more particularly by a mutated ABC1 gene of a patient suffering from a reverse transport deficiency of cholesterol, in particular a patient suffering from Tanger's disease.

As noted above, 17 mutations have been identified in the ABC1 gene according to the present invention (Table IV).

Polypeptides represented by SEQ ID NOs: 89-102 are particularly useful for the preparation of antibodies that correspond to non-silent ABC1 gene mutations and specifically recognize them. Such antibodies are mutated ABC1 poly in a sample obtained from a subject to be tested, preferably a patient having a characteristic symptom of a deficiency of reverse transport of cholesterol, more preferably a patient having a characteristic symptom of tangerine disease and / or FHD disease. It constitutes a means for detecting the production of peptides.

According to another aspect, the invention also relates to a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 89-102.

According to another aspect, the invention also relates to a polypeptide comprising an amino acid sequence represented by any one of SEQ ID NOs: 89-102.

In general, polypeptides according to the invention are provided in isolated or purified form.

Production method of ABC1 polypeptide

The invention also relates to a method for producing a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, the method comprising the following steps:

a) inserting a nucleic acid encoding said polypeptide into an appropriate vector;

b) in a suitable culture medium, culturing the host cells already transformed or transfecting the host cells with the recombinant vector of step a);

c) recovering the conditioned culture medium or lysing the host cells, for example by sonication or osmotic shock;

d) separating and purifying the polypeptide from the culture medium or alternatively the cell lysate obtained in step c);

e) Optionally characterize the produced recombinant polypeptides.

Certain embodiments of the invention relate to a method of producing a polypeptide comprising the amino acid sequence of amino acids 1-60 of SEQ ID NO: 71.

Polypeptides according to the invention can be characterized by binding to an immunoaffinity chromatography column in which an antibody against this polypeptide or fragment or variant thereof is already immobilized.

According to another aspect, the recombinant polypeptides according to the invention are known to those skilled in the art and can be purified by passing them over a suitable series of chromatography columns, for example according to the methods described by F. Ausubel et al. (1989). have.

Polypeptides according to the invention can also be prepared by conventional chemical synthesis techniques in homogeneous or solid phase. By way of example, the polypeptides according to the invention can be prepared by the homogenate technique described by Houben Weyl (1974) or by the solid phase synthesis technique described by Merrifield (1965a; 1965b).

“Homologous” polypeptides (polypeptides having amino acid sequences comprising amino acids 1-60 of SEQ ID NO: 71) also form part of the invention. Such homologous polypeptides include amino acid sequences in which one or more substitutions of amino acids by equivalent amino acids, relative to amino acids 1-60 of SEQ ID NO: 71, have occurred.

"Equivalent amino acid" according to the present invention will be understood to mean, for example, substitution of L-type residues with D-type residues or glutamic acid (E) with pyro-glutamic acid, according to techniques well known to those skilled in the art. . By way of example, the synthesis of peptides containing at least one D-type residue has been described by Koch (1977). According to another aspect, two amino acids belonging to the same class, ie two uncharged polar, nonpolar, basic or acidic amino acids, are also considered equivalent amino acids.

Polypeptides comprising at least one non-peptide bond, such as a retro-inverse bond (NHCO), carba bond (CH ₂ CH ₂ ), or ketomethylene bond (CO-CH ₂ ), also form part of the invention.

Preferably, a polypeptide according to the invention comprising one or more additions, deletions, substitutions of at least one amino acid will retain the ability to be recognized by the antibody against the unmodified polypeptide.

Antibodies

ABC1 polypeptide according to the invention, in particular 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) SEQ ID NO: Polypeptide fragment or variant of the polypeptide comprising the amino acid sequence of any one of 71 and 89-102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) SEQ ID NO: “Homologous” polypeptides, which are polypeptides comprising amino acids 1-60 of 71, can be used in the production of antibodies, particularly antibodies for detecting the production of normal or modified forms of the ABC1 polypeptide in patients.

Antibodies to polypeptides comprising amino acids 1-60 of SEQ ID NO: 71 also form part of the present invention.

Antibodies to “homologous” polypeptides, which are polypeptides having an amino acid sequence comprising amino acids 1-60 of SEQ ID NO: 71, also form part of the present invention. Such an antibody is directed to a homologous polypeptide comprising an amino acid sequence in which at least one substitution of an amino acid by an equivalent amino acid has occurred to amino acids 1-60 of SEQ ID NO: 71.

For the purposes of the present invention an "antibody" is in particular the initial recognition of a polyclonal or monoclonal antibody or fragment (eg F (ab) ' ₂ and Fab fragment) or a target polypeptide or polypeptide fragment according to the invention. It will be understood to mean any polypeptide comprising the domain of an antibody.

Monoclonal antibodies can be prepared from hybridomas according to the techniques described by Kohler and Milstein (1975).

According to the invention, polypeptides produced recombinantly or chemically, and fragments or other derivatives or homologs thereof comprising the fusion protein, can be used as immunogens for producing antibodies which recognize the polypeptides according to the invention. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments and Fab expression libraries. Anti-ABC1 antibodies of the invention can be cross-reactive, for example they can recognize ABC1 polypeptides from different species. Polyclonal antibodies are more likely to cross react. In contrast, the antibodies of the present invention may be specific for a single form of ABC1. Preferably such antibodies are specific for human ABC1.

Various procedures known in the art can be used for the production of polyclonal antibodies against ABC1 polypeptides or derivatives or homologues thereof. For the production of antibodies, various host animals, including but not limited to rabbits, mice, rats, sheep, goats, and the like, can be immunized by injecting ABC1 polypeptides, or derivatives thereof (eg, fragments or fusion proteins). have. In one aspect, the ABC1 polypeptide or fragment thereof can be conjugated to an immunogenic carrier such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Depending on the host species, Freund (complete and incomplete), mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluron polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, di Various adjuvants, including but not limited to nitrophenols and potentially useful human adjuvants such as bacille Calmette-Guerin (BCG) and Corynebacterium parvum , can be used to enhance the immune response. .

For the preparation of monoclonal antibodies against ABC1 polypeptides, or fragments, homologs or derivatives thereof, any technique can be used that provides for the production of antibody molecules by continuous cell lines in culture. Hybridoma technology and trioma technology, originally developed by Kohler and Milstein (1975), human B-cell hybridoma technology (Kozbor et al., 1983a); Cote et al. (1983), and EBV-Hybridoma technology (Cole et al., 1985) for producing human monoclonal antibodies. In a further aspect of the invention, monoclonal antibodies can be produced in sterile animals [International Publication No. No. published December 28, 1989]. WO 89/12690]. Indeed, according to the present invention, a technique developed for the production of "chimeric antibodies" by splicing genes from mouse antibody molecules specific for ABC1 polypeptide with genes from human antibody molecules of appropriate biological activity. Morrison et al., (1984); Neuberger et al., (1984); Takeda et al. (1985) can be used; Such antibodies are also within the scope of the present invention. Such human or humanized chimeric antibodies are preferred for use in the treatment of human diseases or disorders (described later), because human or humanized antibodies induce an immune response, especially an allergic reaction, much less than heterologous antibodies. .

According to the present invention, the described techniques for the production of single-chain antibodies [Huston, U.S. Pat. 5,476,786 and 5,132,405; US Patent 4,946,778 may be modified to produce ABC1 polypeptide-specific single chain antibodies. A further aspect of the invention is the rapid and easy use of monoclonal Fab fragments having the desired specificity for ABC1 polypeptides, or derivatives or homologs thereof, using the techniques described for the construction of Fab expression libraries (Huse et al., 1989). Allow one sympathy.

Antibody fragments containing the genotype of an antibody molecule can be produced by known techniques. For example, such fragments include: F (ab ') ₂ fragments that can be produced by pepsin digestion of antibody molecules; Fab 'fragments that can be produced by removing the disulfide bridges of F (ab') ₂ fragments; And Fab fragments that can be produced by treating antibody molecules with papain and a reducing agent.

In the production of antibodies, screening for the desired antibody can be performed using techniques known in the art, such as radioimmunoassay, ELISA (enzyme immunoassay), "sandwich" immunoassay, immunoradiometric assay, gel diffuse sedimentation reaction, immunodiffusion. Assays, in situ immunoassays (eg, using colloidal gold, enzyme or radioisotope labels), western blots, precipitation reactions, aggregation assays (eg, gel aggregation assays, hemagglutination assays), complement binding assays, immunity Fluorescence assay, protein A assay, immunoelectrophoresis and the like. In one aspect, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of the secondary antibody or reagent with the primary antibody. In further embodiments, the secondary antibody is labeled. Various means for detecting binding in immunoassays are known in the art and are within the scope of the present invention. For example, to select antibodies that recognize specific epitopes of the ABC1 polypeptide, the hybridomas produced can be analyzed for products that bind ABC1 polypeptide fragments containing these epitopes. To select an antibody specific for an ABC1 polypeptide from an animal of a particular species, it can be selected based on positive binding with an ABC1 polypeptide expressed by or isolated from an animal of that species. .

The preceding antibodies are known in the art in connection with the positioning and activity of ABC1 polypeptides using any of the detection techniques mentioned above or known in the art, such as Western blotting (in suitable physiological samples). Can be used to determine the level of ABC1 polypeptide.

In certain embodiments, antibodies can be produced that enhance or counteract the activity of the ABC1 polypeptide. Such antibodies can be tested using the assays described below for the identification of ligands.

The present invention provides a polypeptide produced by the trioma technique or hybridoma technique described by Kozbor et al. (1983b), comprising: 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) SEQ ID NO: 71 A polypeptide comprising amino acids 1-60 of 3, 3) a polypeptide fragment or variant of polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, wherein the polypeptide fragment or variant is SEQ ID 71 4) amino acids 1-60, or 4) an antibody against a "homologous" polypeptide, which is also a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, which also form part of the present invention. .

The invention also discloses US patent no. A single-chain Fv antibody fragment (ScFv) described in 4,946,778 or described by Martineau et al. (1998).

Antibodies according to the present invention also include antibody fragments obtained through phage libraries described by Ridder et al. (1995) or humanized antibodies described by Reinmann et al. (1997) and Leger et al. (1997).

The antibody preparation method according to the invention is useful in immunodetection tests to identify the presence of an antigen in a sample and / or the amount of antigen present.

Antibodies according to the invention may also comprise detectable markers that are isotopes or non-isotopes, for example fluorescent, or may be linked with molecules such as biotin according to techniques well known to those skilled in the art.

Accordingly, the subject of the invention is also a method for detecting the presence of a polypeptide according to the invention in a sample, the method comprising the following steps:

a) a sample to be tested comprising 1) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) SEQ ID NOs: 71 and 89 Polypeptide fragment or variant of the polypeptide comprising the amino acid sequence of any one of -102, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) amino acid of SEQ ID NO: 71 Contacting with an antibody against a “homologous” polypeptide that is a polypeptide comprising 1-60,

b) detect the formed antigen / antibody complex.

The invention also relates to a box or kit for identifying or detecting the presence of a polypeptide according to the invention in a sample, said box comprising:

a) a polypeptide comprising an amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, 2) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, 3) any of SEQ ID NOs: 71 and 89-102 A polypeptide fragment or variant of the polypeptide comprising one amino acid sequence, wherein the polypeptide fragment or variant comprises amino acids 1-60 of SEQ ID NO: 71, or 4) amino acids 1-60 of SEQ ID NO: 71 An antibody against a “homologous” polypeptide that is a polypeptide, and

b) reagents that allow detection of the formed antigen / antibody complex.

Pharmaceutical Compositions and Healing Methods

The present invention is also intended to prevent or treat metabolism of cholesterol, such as atherosclerosis, specifically the transport of cholesterol, more specifically the deficiency of cholesterol transport, and comprising a normal ABC1 polypeptide, in particular the amino acid sequence of SEQ ID NO: 71. A pharmaceutical composition comprising a therapeutically effective amount of polynucleotides capable of producing an effective amount of a polypeptide. In a preferred embodiment, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

The subject matter of the present invention is also to prevent or treat metabolism of cholesterol, such as atherosclerosis, specifically the transport of cholesterol, more specifically the lack of reverse transport of cholesterol, and to the normal ABC1 polypeptide, in particular the amino acid of SEQ ID 71 Pharmaceutical composition comprising a therapeutically effective amount of a polypeptide comprising a sequence. In a preferred embodiment, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

The invention also relates to the preparation of a medicament for the purpose of the prevention of various forms of atherosclerosis, and more particularly for the treatment of patients with a reverse transport dysfunction of cholesterol, amino acid sequence of SEQ ID 71 or amino acid 1 of SEQ ID 71 The use of the ABC1 polypeptide having -60.

The present invention relates to a pharmaceutical composition for preventing or treating a patient suffering from reverse transport dysfunction of cholesterol, comprising a therapeutically effective amount of a polypeptide having an amino acid sequence of SEQ ID NO: 71 or amino acids 1-60 of SEQ ID NO: 71.

According to another aspect, the subject matter of the present invention is also a prophylactic or curative treatment of diseases caused by the metabolism of cholesterol, in particular the transport of cholesterol, more specifically the deficiency of cholesterol transport, which method is ABC1 Administering to the patient a therapeutically effective amount of the polypeptide, wherein the polypeptide is optionally combined with one or more physiologically compatible vehicles and / or excipients.

Preferably, the pharmaceutical composition comprising the polypeptide according to the invention will be administered to the patient. Accordingly, the present invention also relates to the prevention or treatment of cholesterol metabolism, such as atherosclerosis, in particular the transport of cholesterol, more specifically the lack of reverse transport of cholesterol, and the amino acid sequence of the normal ABC1 polypeptide, in particular SEQ ID NO: 71 Or to a therapeutically effective amount of polynucleotides capable of producing an effective amount of a polypeptide having amino acids 1-60 of SEQ ID NO: 71.

Subject of the invention is also for the prevention or treatment of cholesterol metabolism, such as atherosclerosis, in particular the transport of cholesterol, more specifically the deficiency of reverse transport of cholesterol, and the amino acid sequence of the normal ABC1 polypeptide, in particular SEQ ID NO: 71 Or a therapeutically effective amount of a polypeptide having amino acids 1-60 of SEQ ID NO: 71.

Such pharmaceutical compositions preferably range from 1 μg / kg / 1 day to 10 mg / kg / 1 day, preferably at least 0.01 mg / kg / 1 day, more preferably from 0.01 to 1 mg / kg / 1 day. The amount of ABC1 polypeptide will be suitable, for example, by parenteral routes.

The present invention also provides a pharmaceutical composition comprising a nucleic acid encoding the ABC1 polypeptide according to the present invention and the pharmaceutical composition comprising the ABC1 polypeptide according to the present invention is deficient in reverse transport of cholesterol such as tangerine disease and / or FHD disease. It is for the treatment of diseases related to.

The invention also relates to a novel therapeutic approach for the treatment of pathologies associated with the transport of cholesterol, comprising the step of delivering and expressing in vivo the nucleic acid encoding the ABC1 protein according to the invention. In particular, the present invention provides novel therapeutic approaches for the treatment and / or prevention of HDL deficiency, HDL deficiency, LCAT deficiency, malaria and diabetes, such as HDL deficiency associated with tangerine disease and / or FHD disease.

Accordingly, the present invention provides a novel approach for the treatment and prevention of cardiovascular and neurological pathologies associated with abnormalities in the transport and metabolism of cholesterol. Specifically, the present invention provides a method for restoring or facilitating recovery of cholesterol in a patient or subject.

As a result, the present invention also relates to a pharmaceutical composition comprising a nucleic acid encoding ABC1 protein with one or more physiologically compatible vehicles and / or excipients for the purpose of preventing or treating a subject suffering from reverse transport dysfunction of cholesterol. will be.

According to certain embodiments of the present invention, a composition is provided for in vivo production of ABC1 protein. The composition comprises nucleic acids encoding ABC1 polypeptides under the control of appropriate regulatory sequences in a physiologically acceptable vehicle and / or excipient solution.

Accordingly, the present invention also relates to a composition comprising a nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71, wherein the nucleic acid is under the control of an appropriate regulatory element.

The present invention also relates to compositions comprising nucleic acids encoding polypeptides comprising amino acids 1-60 of SEQ ID NO: 71, wherein the nucleic acids are under the control of appropriate regulatory elements.

Preferably such a composition will comprise a nucleic acid comprising a polynucleotide sequence of SEQ ID NO: 69 or 70 under the control of appropriate regulatory elements.

According to another aspect, the subject matter is also a prophylactic or curative treatment of a disease caused by the metabolism of cholesterol, in particular the transport of cholesterol, more specifically the deficiency of the transport of cholesterol. Administering to the patient a nucleic acid encoding the ABC1 polypeptide according to the invention, which nucleic acid is optionally combined with one or more physiologically suitable vehicles and / or excipients.

The invention also relates to a pharmaceutical composition comprising the recombinant vector according to the invention, for the purpose of preventing or treating a subject suffering from reverse transport dysfunction of cholesterol and in combination with one or more physiologically suitable excipients.

According to certain embodiments, methods for in vivo introduction of nucleic acids according to the invention into host cells, in particular host cells obtained from mammals, comprise pharmaceutically suitable vectors and "naked" nucleic acids according to the invention (under the control of appropriate regulatory sequences). Preparation comprising the step of introducing by topical injection at the level of the selected tissue, eg, smooth muscle tissue, wherein the "naked" nucleic acid is taken up by the cells of this tissue.

The present invention also relates to the use of a nucleic acid according to the invention encoding the ABC1 protein for the prevention or treatment of various forms of atherosclerosis, more specifically for the preparation of a medicament for the treatment of a subject with a reverse transport dysfunction of cholesterol. .

The present invention also relates to a recombinant vector according to the present invention comprising a nucleic acid encoding ABC1 protein for the prevention of various forms of atherosclerosis, more specifically for the preparation of a medicament for the treatment of a subject suffering from reverse transport of cholesterol. It is about use.

As noted above, the present invention also relates to the use of the defective recombinant virus according to the invention for the preparation of a pharmaceutical composition for the treatment and / or prophylaxis of pathologies associated with the transport of cholesterol.

The present invention relates to the use of such defective recombinant viruses for the preparation of pharmaceutical compositions for the treatment and / or prophylaxis of cardiovascular diseases associated with reverse transport deficiency of cholesterol. Accordingly, the invention also relates to pharmaceutical compositions comprising one or more defective recombinant viruses according to the invention.

The present invention also relates to the use of producing cells, such as cells which have been genetically modified in vitro with a virus according to the present invention or a virus transplanted into the body, which enables long-term and effective expression of biologically active ABC1 protein in vivo. will be.

The present invention shows that it is possible to introduce nucleic acids encoding ABC1 polypeptides into viral vectors, which vectors can effectively express biologically active and mature forms. More specifically, the present invention shows that in vivo expression of ABC1 can be achieved by direct administration or production of adenoviruses or transplantation of cells genetically modified by adenoviruses or retroviruses that introduce such DNA.

Preferably, the pharmaceutical composition of the present invention comprises an injectable formulation, in particular a pharmaceutically acceptable vehicle or physiologically suitable excipient for intravenous injection, such as for example in the context of a patient. These may in particular be related to dry, in particular lyophilized compositions which allow the preparation of injectable solutions upon addition, in the case of isotonic sterile solutions or sterile water or physiological saline. Direct injection into the patient's context is preferred because it is possible to target infection at the level of the liver and focus treatment efficacy at the level of this organ.

“Pharmaceutically acceptable vehicle or excipient” includes diluents and fillers which are pharmaceutically acceptable, sterile, and aqueous or oily suspensions formulated with suitable dispersing or wetting agents and suspending agents for the method of administration. The ratio of specific pharmaceutically acceptable carrier and active compound to carrier is determined by the solubility and chemical nature of the composition, the particular mode of administration and standard pharmaceutical behavior.

Any nucleic acid, polypeptide, vector or host cell of the invention will preferably be introduced in vivo with a pharmaceutically acceptable vehicle or excipient. The phrase “pharmaceutically acceptable” refers to molecular moieties and compositions that, when administered to humans, do not normally cause physiologically acceptable and allergic or similar difficult reactions such as acute gastric dysfunction, dizziness, and the like. Preferably, as used herein, the term “pharmaceutically acceptable” refers to a US pharmacopoeia or other generally recognized pharmacopoeia or that has been authorized by the federal or state authorities for use in animals, more specifically humans. It means that it is listed in. The term "excipient" refers to a diluent, adjuvant, excipient or vehicle with which the compound is administered. Such pharmaceutical carriers may be sterile liquids such as water and oils including oils of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline and aqueous dextrose and glycerol solutions are preferably used, in particular, as excipients for injection. Suitable pharmaceutical excipients are described in E.W. Martin's "Remington's Pharmaceutical Sciences".

The pharmaceutical compositions according to the invention can be well and uniformly administered by the oral, rectal, parenteral, intravenous, subcutaneous or transdermal route.

The invention also provides for the prevention of various forms of atherosclerosis, specifically for the preparation of a medicament for the treatment of a patient or subject with a reverse transport dysfunction of cholesterol, amino acid sequence of SEQ ID NO: 71 or amino acids 1-60 of SEQ ID NO: 71 It relates to the use of the ABC1 polypeptide having a.

The present invention includes a polypeptide having an amino acid sequence of SEQ ID NO: 71 or a polypeptide therapeutically effective amount comprising amino acids 1-60 of SEQ ID NO: 71, finally combined with one or more physiologically suitable vehicles and / or excipients, It relates to a pharmaceutical composition for the prophylaxis or treatment of a patient or subject suffering from reverse transport dysfunction of cholesterol.

According to another aspect, the subject matter is also a prophylactic or curative treatment of diseases caused by cholesterol metabolism, specifically the transport of cholesterol, more specifically the deficiency of cholesterol transport, which method is ABC1 poly Administering to the patient or subject a nucleic acid encoding a peptide, wherein the nucleic acid is optionally combined with one or more physiologically suitable vehicles and / or excipients.

According to another aspect, the subject matter is also a prophylactic or curative treatment of a disease caused by cholesterol metabolism, in particular the transport of cholesterol, more specifically the deficiency of cholesterol transport, which method is a patient. Or administering to the patient or subject a therapeutically effective amount of an ABC1 polypeptide according to the invention in a subject, wherein the polypeptide is optionally combined with one or more physiologically compatible vehicles and / or excipients.

In another embodiment, nucleic acids, polypeptides, recombinant vectors and compositions according to the invention can be delivered as vesicles, in particular liposomes (Langer, 1990; Treat et al., 1989; and Lopez-Berestein, 1989).

In another embodiment, nucleic acids, polypeptides, recombinant vectors, recombinant cells and compositions according to the invention can be delivered to a regulatory secretion system. For example, the polypeptide can be administered using intravenous infusion, buried osmotic pumps, transdermal patches, liposomes or other modes of administration. In one aspect, a pump may be used (Langer, 1990; Sefton, 1987; Buchwald et al., 1980; Saudek et al., 1989). In another embodiment, polymeric materials can be used (Langer and Wise, 1974; Smolen and Ball, 1984; Langer and Peppas, 1983; Levy et al., 1985; During et al., 1989; and Howard et al., 1989). In another embodiment, a regulated secretion system may be in close proximity to the target tissue or organ, ie the cardiovascular system, requiring only a portion of systemic administration (Goodson, 1984). Other regulatory secretion systems are described in Langer (1990).

In a further aspect, recombinant cells transfected with a nucleic acid according to the invention and expressing high levels of the ABC1 polypeptide according to the invention can be transplanted into a subject in need of the ABC1 polypeptide. Preferably, cells of autologous tissues transfected with ABC1 encoding nucleic acids according to the present invention are transplanted to avoid rejection; Alternatively, techniques are available for hiding cells of non-autologous tissues that produce soluble factors in a polymer matrix that prevents immune recognition and rejection.

Thus, the ABC1 polypeptide can be delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous route of administration. Alternatively, suitably formulated ABC1 polypeptides can be administered by nasal or oral administration. A constant supply of ABC1 can be ensured by providing a therapeutically effective dose (ie, an effective dose that induces metabolic changes in a subject) at intervals that require a regular interval, such as daily, 12 hours, and the like. These parameters will depend on the severity of the disease symptom to be treated, other behaviors such as changes in the diet being administered, the weight, age and gender of the subject, and other criteria, which can be readily determined by good standard medical practice by those skilled in the art. .

The subject to which administration of the nucleic acid, polypeptide, recombinant vector, recombinant host cell and composition according to the present invention is preferably performed is human, but may be any animal. Thus, as can be easily detected by those skilled in the art, the present invention The methods and pharmaceutical compositions of the present invention are particularly suitable for administration to any animal, especially a mammal, and any animal includes, but is not limited to, farm animal test materials such as cats or dogs, and farm animal test materials such as cattle, horses, goats, sheep and pigs. ), Wild animals (wild or zoo), research animals such as mice, rats, rabbits, goats, sheep, pigs, dogs, cats, etc., bird species such as chickens, turkeys, birds, etc., ie animals for veterinary use It is not limited to this.

Preferably, a pharmaceutical composition comprising a nucleic acid, a recombinant vector, a polypeptide or a recombinant host cell as described above will be administered to a patient or subject.

Screening methods of agonist or antagonist compounds against ABC1 polypeptide

According to another aspect, the present invention also provides treatments useful for the treatment of tangerine disease, more generally the metabolism of cholesterol, such as FHD type symptoms, specifically the transport of cholesterol, and more particularly the disease caused by deficiency of back transport of cholesterol. A method for screening various compounds or small molecules.

The present invention therefore also relates to the use of ABC1 polypeptides or the use of cells expressing ABC1 polypeptides for the screening of active ingredients for the prevention or treatment of diseases resulting from reverse transport dysfunction of cholesterol. Catalytic sites and oligopeptides or immunogenic fragments of the ABC1 polypeptide may be useful for screening product libraries by all existing techniques. Polypeptide fragments used for this type of screening may be free in solution at the cell surface or at the cell, and bound to a solid support. Binding complex formation between the ABC1 polypeptide fragment and the test agent can then be assessed.

Another product screening technique that can be used for high-flux screening that allows access to products having affinity for the protein of interest is described in application WO84 / 03564. In this method applied to the ABC1 protein, various products are synthesized on a solid surface. This product reacts with ABC1 protein or fragments thereof and the complex is washed. The product bound to ABC1 protein is then detected by methods known to those skilled in the art. Non-neutralizing antibodies can also be used to capture and immobilize the peptides to the support.

Another possibility is to carry out product screening methods using ABC1 neutralizing antibody competition, ABC1 protein and products that potentially bind ABC1 protein. In this method, the antibody can be used to detect the presence of a peptide having an antigenic unit in common with an ABC1 polypeptide or protein.

Among the products to be evaluated for the increased ability of ABC1 activity, mention may be made of kinases-specific ATP analogs involved in the activation of molecules and phosphatase which can avoid dephosphorylation resulting from kinases. Particular mention may be made of inhibitors of the phosphodiesterase (PDE) theophylline and 3-isobutyl-1-methylxanthin type or adenylcyclase phospholine activators.

Accordingly, the present invention relates to the use of screening methods of products, i.e. compounds, small molecules, etc., based on the method of translocation of cholesterol between membranes or vesicles (see Example 13), which relates to all synthetic or That is, synthetic or cell types of mammals, insects, bacteria or yeast constitutively expressing or introducing human ABC1 encoding nucleic acids.

Similarly, the ABC1 protein allows for anion transport (Becq et al., 1997 and Yamon et al., 1997) and this transport is associated with an increase in cAMP by agents such as phosphatase inhibitors such as okadaic acid and orthovanadate and, in part, forskolin. It has been described that it is activated by. The present invention also relates to the use of such a system for screening molecules that modulate the activity of ABC1 protein (see Example 14).

Yamon et al. (1997) demonstrated that mouse ABC1 protein is involved in the secretion of pro-inflammatory cytokine IL-1 beta in macrophages of the mouse peritoneum. Thus, one can provide a method for screening products that modulate the activity of ABC1 protein by measuring IL-1 beta release from any cell type expressing both proteins (see Example 15).

In addition, knowing that the destruction of several transporters has been described (van den Hazel et al., 1999), consider the use of cell mutants with characteristic phenotypes, complement their function with ABC1, and use the whole for screening. It became possible.

The present invention also relates to a method for screening an agonist or antagonist of ABC1 polypeptide, which is an active compound or small molecule in the metabolism of cholesterol, the method comprising the following steps:

a) preparing a lipid substrate comprising a membrane vesicle comprising an ABC1 polypeptide and a detectable marker;

b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound;

c) qualitatively and / or quantitatively determining the amount of release of a lipid substrate comprising a detectable marker;

d) The release measurement obtained in step b) is compared with the release measurement of the labeled lipid substrate by vesicles not preincubated with the agonist or antagonist candidate compound.

In a first specific embodiment, the ABC1 polypeptide comprises the amino acid sequence of SEQ ID NO: 71.

In a second specific embodiment, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

According to the first aspect of the screening method, the membrane vesicles are synthetic lipid vesicles, which can be prepared according to techniques well known to those skilled in the art. According to this particular aspect, the ABC1 protein may be a recombinant ABC1 protein.

According to a second aspect, the membrane vesicles are vesicles of plasma membrane derived from cells expressing ABC1 polypeptide. These may be cells that express naturally the ABC1 polypeptide or recombinant vectors comprising cells transfected with a nucleic acid encoding the ABC1 polypeptide or nucleic acids encoding the ABC1 polypeptide.

According to a third aspect of the screening method, the lipid substrate is selected from cholesterol or phosphatidylcholine.

According to a fourth aspect, the lipid substrate is radiolabeled with an isotope selected from, for example, ³ H or ¹²⁵ I.

According to a fifth aspect, the lipid substrate is labeled with a fluorescent compound such as NBD or pyrene.

According to a sixth aspect, membrane vesicles comprising the labeled lipid substrate and the ABC1 polypeptide are immobilized on the surface of the solid support before step b).

According to a seventh aspect, the measurement of the fluorescence or radioactivity released by the vesicles is a direct reflection of the lipid substrate transport activity by the ABC1 polypeptide.

The present invention also relates to a method for screening an agonist or antagonist of ABC1 polypeptide, which is an active compound or small molecule in the metabolism of cholesterol, the method comprising the following steps:

a) after transfection of the original or the cells with ABC1 encoding nucleic acid, obtaining a cell expressing the ABC1 polypeptide, eg, a cell line;

b) culturing the cells of step a) in the presence of an anion labeled with a detectable marker;

c) washing the cells of step b) to remove excess labeled anions that did not penetrate these cells;

d) culturing the cells obtained in step c) with an agonist or antagonist candidate compound for ABC1 polypeptide;

e) measuring the outflow of labeled anions;

f) The effluent value of the labeled anion measured in step e) is compared with the effluent value of the labeled anion measured with cells not previously cultured in the presence of an agonist or antagonist candidate compound for the ABC1 polypeptide.

In a first specific embodiment, the ABC1 polypeptide comprises the amino acid sequence of SEQ ID NO: 71.

In a second specific embodiment, the ABC1 polypeptide comprises amino acids 1-60 of SEQ ID NO: 71.

According to the first aspect of the screening method, the cell used is a cell that naturally expresses the ABC1 polypeptide. These may be human monocytes in primary cultures purified from monocyte populations of human blood. They can also be human monocyte cell lines such as monocyte leukemia lineage THP1.

According to a second aspect, the cells used in the screening methods described above may be cells that do not naturally express ABC1 polypeptide or otherwise express low levels, which cells may express nucleic acids encoding ABC1 polypeptide. Transfected with the recombinant vector according to the invention.

According to a third aspect, the cell may be a cell naturally lacking anion transport or a cell pretreated with one or more anion channel inhibitors such as Verapamil ^™ or tetraethylammonium.

According to a fourth aspect of the screening method, the anion is radiolabeled with an iodide such as salt K ¹²⁵ I or Na ¹²⁵ I.

According to a fifth aspect, the measurement of labeled anion outflow is performed periodically over several hours during the experiment, which also allows for the mechanical measurement of this outflow.

According to a sixth aspect, the labeled anion outflow value is determined by measuring the amount of labeled anion present at a given time in the cell culture supernatant.

According to the seventh aspect, the effluent value of labeled anions is determined as the ratio of radioactivity measured in the cell culture supernatant to total radioactivity corresponding to the total radioactivity measured in the cell lysate and the radioactivity measured in the cell culture supernatant. do.

Subject of the invention is also a method of screening for agonists or antagonists of ABC1 polypeptide, which are active compounds or small molecules in the metabolism of cholesterol, the method comprising the following steps:

a) cells of human monocyte lineage are cultured in the presence of purified human albumin in a suitable culture medium;

b) the cells of step a) are simultaneously cultured in the presence of a compound that stimulates the production of IL-1 beta and an agonist or antagonist candidate compound;

c) culturing the cells obtained in step b) in the presence of appropriate concentrate of ATP;

d) measuring IL-1 beta released into the cell culture supernatant;

e) The release value of IL-1 beta obtained in step d) is compared with the value of IL-1 beta released into the culture supernatant of cells not previously cultured in the presence of an agonist or antagonist candidate compound.

According to the first aspect of the screening method described above, the cells used belong to the human leukemia monocyte line THP1.

According to a second aspect of the screening method, the compound that stimulates production of IL-1 beta is lipopolysaccharide.

According to a third aspect of the method, the production by these cells of IL-1 alpha, IL-6 and TNF alpha is also assessed quantitatively and / or qualitatively.

According to a fourth aspect, the expression level of messenger RNA encoding IL-1 beta is also measured.

The following examples are intended to illustrate the invention in more detail and do not limit the invention.

Example 1 Tissue Distribution of the ABC1 Gene Transcript According to the Present Invention

The expression profile of the polynucleotides according to the invention is assessed according to the protocol of PCR-coupled reverse transcription and Northern blot analysis, in particular described by Sambrook et al. (1989).

For example, in the case of analysis by reverse transcription, a pair of primers as described above can be synthesized from the cDNA of the human ABC1 gene comprising the polynucleotide sequences represented by SEQ ID NOs: 69 and 70. This primer pair can be used to detect the corresponding ABC1 cDNA. More specifically, it is specific for ABC1 and may be 1) the sequence in nucleotide region 1-184 of SEQ ID NO: 69 and the complementary sequence in nucleotide region 6968-9741 of SEQ ID NO: 69, or 2) the nucleotide region 1- of SEQ ID NO: 70 Two oligonucleotide primers comprising the sequence at 297 and the complementary sequence at nucleotide region 7081-9854 of SEQ ID NO: 70 can be used to isolate ABC1 cDNA.

Polymerase chain reaction (PCR) is performed with cDNA templates corresponding to reverse transcribed polyA ⁺ mRNA (Clontech). Reverse transcription to cDNA is performed with enzyme SUPERSCRIPT II (GibcoBRL, Life Technologies) according to the conditions described by the manufacturer. The polymerase chain reaction is carried out in 20 μl of the reaction mixture with 25 ng of cDNA preparation, according to standard conditions. The reaction mixture consists of 400 μM dNTP each, 2 units of Thermus aquaticus (Taq) DNA polymerase (Ampli Taq Gold; Perkin Elmer), 0.5 μM each primer, 2.5 mM MgCl ₂ and PCR buffer. 34 PCR cycles denatured at 94 ° C for 30 seconds, 30 seconds of annealing separated during 34 cycles as follows: 64 ° C (2 cycles), 61 ° C (2 cycles), 58 ° C (2 cycles) and 55 ° C (28 cycles) And 1 minute elongation per kilobase at 72 ° C. is performed after the first denaturation step at 94 ° C. for 10 minutes using a Perkin Elmer 9700 thermocycler. PCR reactions are visualized on agarose gels by electrophoresis. The resulting cDNA fragment can be used as a probe for northern blot analysis and can also be used for accurate determination of polynucleotide sequences.

In the case of Northern blot analysis, the cDNA probe produced as described above is labeled ³² P by the DNA labeling system High Prime (Boehringer) method according to the manufacturer's instructions. After labeling, the probe is Sephadex G50 according to the manufacturer's instructions Purified on microcolumn (Pharmacia). Labeled and purified probes are then used to detect expression of mRNA in various tissues.

Northern blots containing RNA samples from different human tissues (Multiple Tissue Northern, MTN, Clontech, Blot 2, Ref. 77759-1) are hybridized with labeled probes. Protocols for hybridization and washing may be as described by the manufacturer (Instruction manual PT1200-1) or may be known to those skilled in the art or modified using methods described, for example, by F. Ausubel et al. (1999). Can be. Thus, for example, the prehybridization and hybridization temperatures can be altered in the presence of formamide.

For example, the following protocol can be used:

1- Membrane Competition and Prehybridization:

Mix: 40 μl salmon sperm DNA (10 mg / ml)

40 μl of human placental DNA (10 mg / ml)

Denaturing at 96 ° C. for 5 min, then immersing the mixture in ice.

Remove 2X SSC and add 4 ml of formamide mix to the hybridization tube containing the membrane.

Addition of a mixture of two denatured DNAs.

Incubate with rotation at 42 ° C. for 5-6 hours.

2- labeled probe competition:

Add 10-50 μl of labeled and purified probe Cot I DNA, depending on the amount of repeat sequence.

Denaturation at 95 ° C. for 7-10 minutes.

Incubate at 65 ° C. for 2-5 hours.

3- Hybridization:

Removal of the prehybridization mixture.

-Mix 40 μl salmon sperm DNA + 40 μl human placental DNA; Denature at 96 ° C. for 5 min, then immersed in ice.

Add 4 ml of formamide mixture, a mixture of two DNAs and denatured and labeled probe / Cot I DNA to the hybridization tube.

Incubate with rotation at 42 for 15-20 hours.

4- washing:

Wash once with 2X SSC at room temperature (wash).

2x with 2X SSC at room temperature for 5 minutes and 0.1% SDS at 65 ° C.

2x with 1X SSC at 65 ° C. and 0.1% SDS at 65 ° C. for 15 minutes.

After hybridization and washing, blots were analyzed after overnight contact with the in-screen appearing via Storm (Molecular Dynamics, Sunnyvale, Calif.).

Example 2 5 ′ Elongation of Human ABC1 cDNA

This example describes the isolation and identification of cDNA molecules encoding full length human ABC1 protein. The 5 'extension of the partial ABC1 cDNA sequence (GenBank Accession # AJ012376, Langmann et al., 1999) is performed using a modified 5' RACE approach.

Experiment plan:

A human monocyte THP1 cDNA library (from the Lambda phage vector lZip-lox, Life Tech ^R ), previously prepared from THP1 cells fractionated with a pobol ester and then loaded with an acetylated LDL and converted to a foam cell phenotype, is used in this example. It is known that THP1 cells significantly up-regulate the expression of the human ABC1 gene when loaded with cholesterol (Langmann et al., 1999). This THP1 cDNA library is used to 5 'elongate the human ABC1 cDNA because it is rich in ABC1 cDNA.

A set of nesting PCR primers (SEQ ID NOs 155 and 156) hybridized with nucleotides of the 5 'known sequence region of human ABC1 cDNA (Langmann et al., 1999) is used to elongate ABC1 cDNA in the 5' direction (see: Table VII). Two sets of nesting vector arm specific primers (SEQ ID NOs: 2, 140, 153 and 154) were designed to be reversely synthesized for human ABC1 cDNA specific primers (Table 7 and FIG. 1). In Table 7, the term "Comp" refers to the complementary nucleotide sequence of the indicated nucleotide position. In this way, a PCR product corresponding to the true 5 'end of human ABC1 cDNA can be obtained regardless of the orientation in the vector.

5 'ABC1 cDNA Elongation Primer PCR primers PCR primer sequence number Use of primary, secondary, or sequencing reactions Position in SEQ ID NO: 69 Orientation Against Human ABC1 cDNA ABC1-3 ' 155 Primary PCR Comp nt803-824 Antisense ABC1-9 156 2nd PCR Comp nt703-727 Antisense ABC1-7 139 Sequencing Comp nt448-468 Antisense λZip-forward 140 Primary PCR --- sense λZip-reverse 153 Primary PCR --- sense λZip-seq-1 154 2nd PCR --- sense λZip-seq-2 2 2nd PCR --- sense

Material and method:

First PCR . THP1 cDNA library (clarified bacterial lysate containing approximately 5 × 10 ⁹ pfu / ml λ-Zip-lox-THP1-FC library phage, 2.5 × 10 ⁶ recombinant, with an average insert size of 1.5 kb) Heated at 95 ° C. for 10 minutes to dissolve phage and release DNA. 4 μl of the dissolved phage were then 20 mM Tris (pH 8.4), 50 mM KCl, 1.5 mM MgCl ₂ , 0.2 mM dNTP, 2.5 units of Platinum ^R Taq Polymerase-HF (BRL), 0.2 uM of each primer [ ABC1-3 '(SEQ ID NO: 155), [lambda] Zip-forward (SEQ ID NO: 140) or [lambda] Zip-reverse (SEQ ID NO: 153)]. Amplification is performed 35 times for 10 seconds at 94 ° C., 20 seconds at 58 ° C., and 2.5 minutes at 72 ° C. 5 ul of PCR reaction is electrophoresed on a 0.8% agarose / TBE gel containing 0.02 ug / ml ethidium bromide. Gels are taken and examined for evidence of product.

Secondary PCR. One ul of reaction selected from the primary PCR is removed and diluted with 50 ul of 10 mM Tris pH 8.5. One ul of diluted primary PCR reactant was prepared using nesting ABC1 primer (ABC1-9, SEQ ID NO: 156) and a suitable nesting arm primer, λZip-seq-1 (SEQ ID NO: 154) or λZip-seq-2 (SEQ ID NO: 2). Can be used for secondary PCR used. PCR reactions were amplified as above except that only the cycling parameters were modified as follows: 25 cycles at 94 ° C. for 20 seconds, 56 ° C. for 20 seconds, 72 ° C. for 1.5 minutes. 5ul of secondary PCR reaction is analyzed on the agarose gel described above.

Purification of PCR Products. Secondary PCR reactions appearing to have appropriately sized products are analyzed on agarose gels and bands corresponding to ABC1 cDNA 5 ′ amplification products are cleaved and purified using the Qiagen Qiaquick ^™ gel extraction purification system. Purified DNA fragments are eluted at 30 ul of 10 mM Tris pH 8.5. 5 ul of eluted PCR product is analyzed on agarose gel to determine approximate yield.

Sequencing. 5 ul and 20 ng of the ABC1-7 sequencing primer (SEQ ID NO: 139) of each purified PCR product were run using a BigDye ^™ terminator cycle sequencer on an ABI 377 sequencing device. Sequence results of the purified 5 'amplified human ABC1 cDNA PCR product were analyzed using the Lasergene DNA Star software package and the BLAST program at the NCBI web site (http://www.ncbi.nlm.nih.gov).

Results and Discussion:

The first PCR reaction shows only weak bands except the primer is stained (see FIG. 2A). Therefore, a second nesting PCR reaction is performed. The secondary PCR reaction (FIG. 2B) was approximately 800 bp using primers ABC1-9 (SEQ ID NO: 156) and λZip-seq-2 (SEQ ID NO: 2) during the two reactions (see lanes 2B, 3 and 6). While strongly stained single bands were produced, primers of ABC1-9 (SEQ ID NO: 156) and λZip-seq-1 (SEQ ID NO: 154) showed weak bands of about 750 bp in lane 7.

To demonstrate that the above PCR products are specific and specific for human ABC1 cDNA, primers ABC1-7 (SEQ ID NO: 139) and λZip-seq-2 (SEQ ID NO: 154) or λZip-seq-1 (SEQ ID NO: 2), respectively Additional nesting PCR reactions are performed using a diluted primary PCR reaction that yields the band obtained in the secondary PCR reaction using lanes (lanes 3,6,7 in FIG. 2B). This additional nesting PCR reaction produces a product of 254 bp smaller than that obtained in the secondary PCR reaction. This is the case for the samples corresponding to lanes 3 and 6. However, the sample in lane 7 does not produce such a product and therefore appears not to be specific for ABC1 cDNA and is no longer analyzed.

An additional 100 ul PCR reaction is performed to produce more product obtained in the secondary PCR reaction corresponding to the sample in lane 3. Secondary PCR reactions consisting of the first sample 3, 100 ul scale-up sample 3, and sample 6 were gel purified for the preparation of cloning and sequencing (FIG. 3). After purification, 5 ul of three gel purification samples are sequenced using ABC1-7 oligonucleotide (SEQ ID NO: 139) as a primer. In addition, the purified product is cloned into plasmid pcr2.1 (Invitrogen), respectively.

Sequencing results revealed that a nucleic acid comprising 244 nucleotides (SEQ ID NO: 3) additional to 5 'of the published partial human ABC1 cDNA was obtained. Investigation of the open reading frame (ORF) with this nucleic acid was performed, and a new ORF was identified that was continuous with the previously published ORF. This ORF extends the human ABC1 protein up to an additional 60 amino acid residues (amino acids 1-60, SEQ ID NO: 71) when compared to the sequences of Langmann et al. (1999). The newly identified initiating ATG codon (nucleotide 185-187, SEQ ID NO: 3) follows the Kozak consensus sequence for initiation of eukaryotic translation, and importantly the TGA termination codon (nucleotide 176-) in frame upstream of the 9 base of the new ATG initiation codon. 178, SEQ ID NO: 3). The present invention therefore provides a nucleic acid encoding the full length of human ABC1 protein (SEQ ID NO: 71). In particular, the present invention provides a nucleic acid encoding a polypeptide consisting of amino acids 1-60 of SEQ ID NO: 71.

In addition, different bases at positions 2 and 3 at the new positions 260 and 262 of SEQ ID NO: 3, which correspond to positions 16 and 18 of Langmann et al. (1999) compared to the published sequences, were also identified. The difference between these nucleotides is conservative changes: 260: T → C and 262: A → G; It does not cause other codon changes. SEQ ID NOs: 69 and 70 are obtained in this example comprising a new 5 ′ extension ABC1 cDNA region (SEQ ID NO: 3). In particular, nucleotides 1-244 of SEQ ID NO: 3 correspond to 1-244 of SEQ ID NO: 69 and nucleotides 114-357 of SEQ ID NO: 70, respectively.

Various other approaches can be attempted to isolate the complete cDNA of ABC1 and the corresponding cDNA. For example, complete clones can be isolated directly by hybridization by screening cDNA libraries using polynucleotide probes specific for the sequence of the gene of interest. Specifically, specific probes of 30-40 nucleotides can be synthesized using a synthesizer of Applied Biosystem / Perkin Elmer trademark depending on the selected sequence. The obtained oligonucleotides can be labeled with radioactive elements (eg [gamma- ³² P] ATP using T4 polynucleotide kinase) and purified according to conventional methods (eg Maniatis et al., 1982). Or F. Ausubel et al., 1989).

Clonal libraries containing cDNAs to be screened are set up in Petri dishes (1.5% agar) containing appropriate antibiotics according to the conventional methods described above (F. Ausubel et al.). Colonies resulting after culture according to conventional methods are transferred to nitrocellulose filters and screened using radiolabeled nucleotide probes, and colonies that hybridize with the probes are isolated and subcloned.

Thus, the DNA of the identified clones is prepared and analyzed by sequencing. Clones containing fragments corresponding to complete cDNA are purified and recloned into pcDNA3 vectors as shown in protocols well known to those skilled in the art and in examples in F. Ausubel et al. (1989).

Various methods are well known for identifying the 5 'and 3' ends of the cDNA corresponding to the genes described in this application. These methods include, but are not limited to, hybridization cloning, including cloning using protocols similar or equivalent to 3 'or 5' Rapid Amplification of cDNA End-PCR (RACE-PCR), which are well known to those skilled in the art.

For example, Clontech's sales kit (Marathon Ready ^TM cDNA kit, protocol identified by the reference PT1156-1), or alternatively a method similar to 5'RACE, is useful for characterization of cDNAs that lack 5 'ends. (Formont-Racine et al., 1993). In brief, one RNA oligonucleotide is linked to the 5 'end of an mRNA population. After reverse transcription to cDNA, a set of adapters linked to the 5 'of the gene and primers specific for the sequence located at 3' are used for PCR to amplify the 5 'portion of the cDNA of interest. The amplified fragment is used for reconstitution of complete cDNA.

Example 3: Analysis of Gene Expression Profiles for Tangier Disease

Demonstration of impairment of the expression level of the ABC1 gene causing the Tangier cell phenotype can be determined by hybridizing these sequences with probes corresponding to mRNA obtained from fibroblasts of a diseased or otherwise subject, according to the method described below. Can be.

1. Preparation of Total RNA, Poly (A) ⁺ mRNA and cDNA Probes

Total RNA can be obtained using the guanidine isothiocyanate method (Chomczynski & Sacci, 1987) from cultured cells of fibroblasts of normal subjects or those with Tangier disease. Poly (A) ⁺ mRNA can be obtained using affinity chromatography on an oligo (dT) -cellulose column (Sambrook et al., 1989) and the cDNA used as a probe is a fluorescent product (Amersham Pharmacia Biotech; CyDye ^™). ) Can be obtained by RT-PCR with oligonucleotides labeled (DeRisi et al., 1997).

2. Hybridization and Detection of Expression Levels

Glass membranes containing the sequences set forth herein and containing sequences corresponding to Tangier genes are hybridized with cDNA probes obtained from fibroblasts (Iyer et al., 1999). The use of the Amersham / molecular Dynamics System (Avalanche Microscanner ^™ ) allows for quantitative analysis of product expression of sequences in healthy or diseased cell types.

Example 4 Preparation of Expression Vectors Containing Complete cDNA of ABC1 in Mammalian Cells

The ABC1 gene will be expressed in mammalian cells. Typical eukaryotic expression vectors contain a promoter that enables the initiation of transcription of mRNA, a sequence encoding a protein, and a signal necessary for the termination of transcription and polyadenylation of the transcript. It also contains additional signals such as enhancers, Kozak sequences, and sequences required for splicing mRNA. Efficient transcription is achieved by the early and late elements of the SV40 virus promoter, the retroviral LTR or CMV virus early promoter. However, cellular elements such as actin promoters can also be used. Many expression vectors can be used to carry out the invention, and one example of such a vector is pcDNA3 (Invitrogen).

Example 5: Preparation of Normal and Mutant ABC1 Polypeptides

In Example 2 (cloning of complete cDNA), the normal ABC1 polypeptide encoded by the complete cDNA of ABC1 described in the isolation process, or the mutant ABC1 polypeptide of the complete cDNA which can be obtained according to the techniques described in Example 2 Easily produced in mammalian cells in the presence or absence of bacterial or insect cell expression systems or vaccinia virus vectors using baculovirus vectors. All methods are widely described and are well known to those skilled in the art. Its detailed description can be found in the example of F. Ausubel et al. (1989).

Example 6: Preparation of Antibody Against One Mutant ABC1 Polypeptide

Antibodies within the present invention are described in various ways (Current protocols In Molecular Biology Volume 1 edited by Frederick M. Ausubel, Roger Brent, Robert E. Kingston, David D. Moore, JG Seidman, John A. Smith, Kevin Struhl-Massachusetts General Hospital Harvard Medical School, chapter 11,1989). For example, cells expressing a polypeptide of the invention are injected into an animal to induce the preparation of a serum comprising an antibody. One of these methods has been described, in which the protein is prepared and purified to prevent contamination. Such preparations are introduced into animals for the purpose of producing high activity polyclonal antisera.

In a preferred method, the antibody of the invention is a monoclonal antibody. Such monoclonal antibodies can be prepared using hybridoma technology (Kohler et al, 1975; Kohler et al, 1976; Kohler et al, 1976; Hammeling et al., 1981). In general, such methods include immunizing an animal (preferably a rat) with a polypeptide or with a cell expressing the polypeptide. These cells are cultured in a suitable tissue culture medium. However, cultured in Eagle's medium (modified Earle) fed with 10% fetal calf serum (inactive at 56 ° C.) and about 10 g / l essential amino acids, 1000 u / ml penicillin and about 100 μg / ml streptomycin It is preferable.

The splenocytes of these mice are extracted and fused with the appropriate myeloma cell line. However, it is preferred to use available parental myeloma cell line (SP20) from ATCC. Hybridoma cells resulting after fusion are selectively retained in HAT medium and then cloned by limiting dilution as described by Wands et al. (1981). Hybridoma cells after such selection are tested to identify antibody secreting clones capable of binding to the polypeptide.

Other antibodies capable of binding to the polypeptide may also be prepared according to a two-step process using an anti-idiotype antibody, in which such an antibody is their antigen and consequently one antibody is used to target another antibody. It is based on the fact that it is possible to recognize. According to this method, proteins specific antibodies are used to confer immunity to animals, preferably mice. The splenocytes of these animals are then used to produce hybridoma cells, which identify the clones that produce antibodies that are capable of binding to specific antibody-protein conjugates that can be blocked by the polypeptide. Is screened for. These antibodies are used to confer immunity to animals in order to induce large amounts of protein-specific antibody production.

Preference is given to using Fab and F (ab ') 2 and other fragments of the antibodies of the invention according to the methods described herein. Such fragments are usually produced by proteolytic cleavage with the help of enzymes such as papain (to make Fab fragments) or pepsin (to make F (ab ') 2). Alternatively, unknown fragments that recognize the protein may be prepared using recombinant DNA or synthetic chemistry techniques.

For in vivo use of the antibody in humans, preference is given to using “humanized” chimeric monoclonal antibodies. Such antibodies can be prepared using gene compositions derived from hybridoma cells that produce the monoclonal antibodies described above. Methods of making chimeric antibodies are well known to those of skill in the art. (For review see Morrison, (1985); Oi et al., (1986); Cability et al., US Pat. No. 4,816,567; Taniguchi et al. , EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601553; Robinson et sl., WO 8702671; Boulianne et al; (1984); and Neuberger et al., (1985))

Example 7: Correction of Intracellular Phenotype of Tangier Disease

Tangier disease is characterized by accelerated catabolism of high-density lipoprotein (HDL) particles and the accumulation of cholesterol in tissues. In particular, fibroblasts of skin with Tangier's disease have a low cholesterol removal ability due to the influx of cholesterol carried out by the apoprotein AI (apoA-I) and the main protein of HDL (Francis et al., 1995). . This feature, corresponding to loss of function, is also found in fibroblasts of patients suffering from familial HDL deficiency (Marcil et al., 1999a).

Correction of the phenotype of Tangier fibroblasts can be performed by transfecting the complete cDNA of ABC1 according to the invention into said cells. cDNA is inserted into the expression vector to be transfected according to the method described below.

1. Preparation of Fibroblasts from Normal Subjects and Subjects with Tangier Disease

Primary fibroblasts of human skin are obtained by culturing skin biopsies obtained from forearms. These biopsies are performed in patients with Tangier's disease with the clinical and biochemical characteristics of the "homozygote," which is characterized by orange tonsils, plasma concentrate of apoA-I, and cholesterol-HDL rather than 5 ^th percentile. Is performed. Normal fibroblast lines are available from the American Type Culture Collection (Rockville, MD). Fibroblasts were composed of 10% fetal calf serum, 2 mM glutamine, 100 IU / ml penicillin, and 100 μg / ml streptomycin, EMMEM (Eagle-modified minimum essential medium (GIBCO) medium (medium designated as EMMEM 10) Are incubated. To conduct a study of cholesterol efflux, cells were incubated for 24 hours with 50 μg / ml cholesterol in medium supplemented with 2 mg / ml bovine albumin (BSA, Fraction V) excluding calf serum in the medium described above. It is preloaded with cholesterol.

2. Study of Cholesterol Spill

24-well fibroblasts pre-loaded with cholesterol in the plate adhesion is 1,2- ³ H- cholesterol EMMEM10 medium with 1 μCi / ㎖ (50 Ci / mmol; Dupont; Wilmington, Delaware, USA) for 48 hours in the Incubate. About 100,000 counts per minute are obtained in one well or 1000 counts per minute and per μg of intracellular protein. Cells are washed three times in EMMEM / BSA medium and before the efflux caused by transfection of the gene and the addition of 10 μg / ml proteoliposome containing apoA-I in EMMEM / BSA medium begins. Incubate for 24 hours. These proteoliposomes are prepared by sonication of phosphatidylcholine and purified human apoA-I (Jonas, 1986). Cell transfection is performed by calcium phosphate precipitation technique (Sambrook et al., 1989). After the effluent (usually 20 hours), the medium is collected and centrifuged (1000 g, 5 minutes) and radioactivity is measured with a liquid scintillation counter. Intracellular residual radioactivity is measured overnight after extraction of fat in isopropanol. The% runoff is calculated by dividing the radioactivity measured in the supernatant by the sum of the radioactivity measured in the supernatant and the cell extract. Internal standards are prepared by transfecting marker genes and incubating for 24 hours in EMMEM / BSA medium containing apoA-I and excluding proteoliposomes. The intracellular cholesterol efflux of normal fibroblasts transfected with regulatory genes reached 6 ± 2%, whereas less than 1% were obtained from fibroblasts suffering from Tangier disease and also transfected with regulatory genes. On the other hand, transfecting fibroblasts suffering from Tangier disease with a plasmid containing complete cDNA or genomic DNA for ABC1 according to the present invention can be used to remove excess cholesterol at cholesterol levels corresponding to normal fibroblasts. Can make the cell's capacity recoverable.

Example 8: Isolation and Characterization of Genomic Fragments of Human ABC1 Gene

An about 3 kb fragment of human ABC1 cDNA can be obtained from a cDNA clone named “pf 10” containing the original ATP-binding domain of ABC1, which cDNA clone is described in Luciani et al. (1994).

The cDNA fragments obtained by digesting the pf10 clone with the restriction endonuclease EcoRI are isolated on agarose gels after electrophoresis and then dedoxygenated according to the manufacturer's instructions (Boehringer Mannheim, kit sold by reference 1 585 614). It is labeled with nin.

Labeled cDNA fragments are used to screen the Lawrence Livermore National Labs (LLNL) cosmid library of chromosome 9 immobilized on a Nylon ^™ filter.

Six positive clones were identified. Single colonies and probes are hybridized for these six cosmids.

Representative clones were isolated from each of these colonies.

LLNLC 131J087 Q2 (named cos3a) and LLNLc 131O1165 Q2 (named cos 6f) were analyzed in detail.

The cos3a clone was subcloned in a Gen3zf (-) vector in the form of an ECoRI fragment and sequenced at both ends using Big Dye Terminator technique in an ABI377 type sequencer (Applied Biosystem, Perkin Elmer).

Clones containing separate inserts (determined after sequencing the ends of various inserts or determined by their size) that are too long to be fully sequenced by hybridizing the sequences and primers of the vector are transposon insertions. It is pre-analyzed by sequencing with primers specific for technology and transposons ("GPS" system sold by New England Biolabs).

In this way the gene sequence corresponding to the human ABC1 gene was isolated and characterized. These sequences are compared to those of human and mouse identified by reference in a database that allows for determination of intron-exon junctions.

Primers for amplifying a patient's DNA are designed from non-repetitive sequences of the intron DNA of the ABC1 gene, and in this way the base-amplified fragments necessary to form secondary structures in the amplification and splicing steps of the intron-exon junctions. Will be included.

The patient's genomic DNA can be amplified using the hybridization conditions described above and the amplification cycle conditions recommended by the manufacturer and with the help of primers using Qiagen's Star Taq kit or Supertaq kit.

The amplified PCR product is then purified using a kit sold by Qiagen, and sequenced by the Big Dye Terminator method in an ABI377 sequencer.

Example 9: Measurement of Polymorphism / mutation in ABC1 Gene

Detection of polymorphisms or mutations in the gene sequence of the ABC1 gene or in the sequence of transcripts can be performed according to various protocols. Preferred method is direct sequencing.

For patients capable of producing mRNA, the preferred method is to prepare cDNA and sequence it directly. For patients where only DNA is available, and for transcripts whose structure corresponding to a gene is unknown or partially known, it is necessary to accurately determine its intron-exon structure and the gene sequence of the corresponding gene. This thus separates, for example, genomic DNA BAC or cosmid clone (s) corresponding to the transcript studied according to the method described in Example 8 and sequenced the insert of the corresponding clone (s). And determination of the intron-exon structure through comparison of the obtained genomic DNA and cDNA sequence.

Techniques for detecting mutations by direct sequencing include comparing the gene sequence of the ABC1 gene obtained from homozygotes of the disease or from at least 8 individuals (4 subjects to the investigated pathology, 4 subjects not). consist of. Sequence diversity contributes to polymorphism. All of the modified amino acid sequences of the wild type protein can be mutations that can affect the function of the protein. It should be considered more specifically in the co-separation studies of mutations and in disease studies (genotype-phenotype correlations) in genealogy or in case / control studies for the analysis of idiopathic cases.

Example 10 Identification of Causal Genes in Diseases Associated with Cholesterol Reverse Transport Deficiency by Cause Mutations or Transcriptional Differences

Of the mutations identified according to the methods described in Example 9, everything associated with the phenotype of the disease may be causative. The validity of these results is obtained by sequencing the genes in all affected individuals and their relatives, whose DNA is available.

Furthermore, according to the method described in Example 1, Northern blotting or RT-PCR analysis using RNA specific to an individual with or without disease allows for detection of significant variations in gene expression levels. This is especially true in the absence of gene transcription.

Example 11: Identification of allele polymorphism in ABC1 gene

Primers for amplifying a patient's DNA are designed from the non-repetitive sequence of the intron DNA of the ABC1 gene, and in this way the bases necessary to form secondary structures during amplification and RNA splicing of the intron-exon junctions are amplified fragments. It is included in.

Various primer pairs were developed specifically as shown in Table 4. DNA results from the 7 families, including cases of Tangier disease, or from FHD disease can be found in Table 5.

The patient's genomic DNA can be amplified using primers using the Qiagen's Star Taq kit or Supertaq kit described above and using hybridization conditions and amplification cycle conditions recommended by the manufacturer.

The amplified PCR product is then purified using a kit sold by Qiagen, and its sequence is determined by Big Dye Terminator method in an ABI377 sequencer (Applied Biosystems, Perkin Elmer).

Example 12 Preparation of a Recombinant Vector Comprising Nucleic Acids Encoding ABC1 Protein

I. Synthesis of Nucleic Acids Encoding Human ABC1 Protein

Total RNA (500 ng) isolated from human cells (ie placental tissue, Clontech, Palo Alto, Calif., Or THP1 cells) can be used as a source for cDNA synthesis of the human ABC1 gene. Methods of reverse transcription of mRNA into cDNA are well known to those skilled in the art. For example, one can use the "Superscript one step RT-PCR" system (Life Technologies, Gaithersburg, MD).

Oligonucleotides specific for ABC1 cDNA can be used for this purpose. In particular, two oligonucleotides (0.25 μM) specific for ABC1, including one of 1) and 2), can be used to isolate nucleic acids encoding the ABC1 protein. [1] The 1-184 nucleotide region of SEQ ID NO: 69 This sequence and the complement of SEQ ID NO: 69, 6968-9741 nucleotide region included SEQ ID NO: 2) the sequence containing the 1-297 nucleotide region of SEQ ID NO: 70 and the complement contained in the 7081-9854 nucleotide region of SEQ ID NO: 70 order].

These nucleotide primers can be synthesized by phosphoramidite method in an ABI 394 type DNA synthesizer (Applied Biosystem, Foster City, Calif.).

50 ng of human ABC1 cDNA is used as a template and 0.25 μM of ABC1 specific oligonucleotide primers containing a site recognized by restriction enzyme Not1 (5'-GCGGCCGC-3 ') at its 5', By secondary amplification in the presence of 200 μM of dideoxynucleotides dATP, dCTP, dTTP, dGTP and Pyrococcus furiosus DNA synthase, respectively, sites recognized by restriction enzyme NotI were inserted into the recombinant vector. In order to attack the ABC1 cDNA region, it can be incorporated into amplified ABC1 cDNA (Stratagene, Inc. La Jolla, CA, USA).

The PCR reaction is carried out in a thermocycler for PCR over 30 cycles, each cycle being denatured at 95 ° C. for 1 minute, regenerated at 50 ° C. for 1 minute and amplified at 72 ° C. for 2 minutes. (Cetus Perkin Elmer, Norwalk, Connecticut, USA).

II. Cloning cDNA of the Human ABC1 Gene into an Expression Vector

Human ABC1 cDNA inserts are NotI restriction sites of expression vectors, e.g. pCMV vectors containing cytomegalovirus (CMV) early promoter and enhancer sequences and SV40 polyadenylation signals (Beg et al., 1990; Applebaum-Boden). , 1996), can be cloned to produce an expression vector named pABC1.

The sequence of the cloned cDNA was prepared in the reaction set "ABI Prism Big Dye Terminater Cycle Sequencing ready" (Applied Biosystems, Foster City, CA) in an ABI 310 type capillary sequence analyzer (Applied Biosystems, Foster City, CA). Can be determined by sequencing on two strands using.

III. Preparation of Recombinant Adenovirus Vectors Containing the cDNA of the Human ABC1 Gene

Modification of the A-expression vector pCMV-β

Beta-galactosidase cDNA of the expression vector pCMV-β (Clontech, Gene Bank Accession No.UO2451, Palo Alto, CA, USA) was digested with restriction endonuclease NotI and multiple cloning sites (3 'from 5' end) In the terminal direction it has the following sites: NotI, AscI, RsrII, AvrII, SwaI, and NotI), and is cloned in the region of the NotI restriction site. The sequence of this cloning site is:

5'-CGGCCGCGGCGCGCCCGGACCGCCTAGGATTTAAATCGCGGCCCGCG-3 '(SEQ ID NO: 66)

DNA fragments between the EcoRI and SanI sites of the modified expression vector pCMV can be isolated and cloned into the modified XbaI sites of the shuttle vector pXCXII (McKinnon et al., 1982; McGrory et al., 1988).

Variation of B-shuttle vector pXCXII

Multiple cloning sites comprising XbaI, EcoRI, SfiI, PmeI, NheI, SrfI, PacI, SalI, XbaI restriction sites in the 5 'to 3' end direction:

5'-GCTCTAGAATTCGGCCTCCGTGGCCGTTTAAACGCTAGCGCCCGGGCTTAATTAAGTCGACTCT

AGAGC-3 '(SEQ ID NO: 67)

It can be inserted at the level of the XbaI site (nucleotide at position 3329) of the pXCXII vector (McKinnon et al., 1982; McGrory et al., 1989).

The EcoRI-SalI DNA fragment isolated from the modified pCMV-β vector containing the CMV promoter / enhancer, the donor, acceptor splicing site of FV 40 and the polyadenylation signal of FV40 were then followed by pCMV- It can be cloned into the EcoRI-Sal region of the modified shuttle vector pXCX, designated 11.

C. Preparation of Shuttle Vector pAD12-ABC1

Human ABC1 cDNA can be obtained by RT-PCR reaction and cloned at the NotI site level with pCMV-12 vector as described above, resulting in the acquisition of pCMV-ABC1 vector.

D. Preparation of ABC1 Recombinant Adenovirus

ABC1-rldV recombinant adenovirus comprising human ABC1 cDNA can be prepared according to the techniques described by McGrory et al. (1988).

Briefly, the pAD12-ABC1 vector is cotransfected with the tGM17 vector according to the technique of Chen and Okayama (1987).

As such, the pAD12-luciferase vector is prepared with the pJM17 vector and cotransfected.

Recombinant adenoviruses are identified by PCR amplification and undergo two purification cycles before large-scale amplification in human embryonic kidney cell line HEK 293 (American Type Culture Collection, Rockville, MD).

Infected cells are collected 48-72 hours after infection with adenovirus vectors and undergo 5 freeze thaw lysis cycles.

The crude lysate was extracted with the help of Freon (Halocarbone 113, Matheson product, Scocus, NJ), and precipitated twice in cesium chloride supplied with 0.2% rat albumin (Sigma Chemical Co., St. Louis, MO). Is strongly dialyzed against a buffer consisting of 150 nM NaCl, 10 mM Hepes, pH 7.4, 5 mM KCl, 1 mM MgCl ₂ , 1 mM CaCl ₂ .

Recombinant adenoviruses are stored at −70 ° C. and applied to animals or titrated before being incubated with the cells in culture.

Absence of wild-type contaminating adenovirus is determined by screening with the aid of PCR amplification using oligonucleotide primers located in the structural part of the missing region.

Ⅳ. Demonstration of Human ABC1 cDNA Expression

Polyclonal antibodies specific for human ABC1 polypeptides are prepared by injecting synthetic polypeptide fragments (all or part of the amino acid sequence of SEQ ID NO: 71 described above) derived from ABC1 protein into rabbits or chickens as described above can do. These polyclonal antibodies are used to detect and / or quantify expression of human ABC1 genes in cell and animal models using immunoblotting and / or immunodetection.

The biological activity of ABC1 can be monitored by quantifying the cholesterol flux induced by apoA-I using cells transfected with pCMV-ABCI vectors loaded with cholesterol (Remaley et al., 1997).

In vitro expression of human ABC1 cDNA in cells

Fibroblasts from HEK 293 strains and COS-7 strains (American Tissue Culture Collection, Bethesta, Md.) And primary cultures from tangeria or from patients with low-alpha lipoproteinemia. Is transfected with pCMV-ABC1 expression vector (5-25 μg) using Lipofectamine (BRL, Gaithersburg, MD) or via coprecipitation with the help of calcium chloride (Chen et al. ., 1987).

These cells can also be infected with the pABC-AdV vector (infection index, MOI = 10).

Expression of human ABC1 can be monitored by immunoblotting and quantitating the outflow of cholesterol induced by apoA-1 using transfected and / or infected cells.

Complementary use of fibroblasts of these patients with gene defects in patients with tangeria and low-alpha lipoproteinemia can be identified by detecting the expression of the normal ABC1 gene, which establishes the functional significance of this receptor. Make it possible

Ⅵ. In vivo expression of the ABC1 gene in various animals

A suitable volume (100-300 μl) of medium containing purified recombinant adenovirus (pABC1-AdV or pLucif-AdV) containing 10 ^{8-10 9} soluble plaque-forming units (pfu) was transferred to mice (C57BL / 6, Inject intravenous Saphenous intravenously (in both control mice and transgenic or knockout mouse models) on day 0 of the experiment.

Assessing the in vivo role of ABC1 protein in the metabolism of lipoproteins can be attributed to the total cholesterol, triglycerides, phospholipids, Free cholesterol (Sigma and Wako Chemicals, Richmond, Va.), Cholesterol-HDL (CIBA-Corning, Oberlin, Ohio), and apofatty proteins AI, A-II, E, B (Foger et al., 1997). This is done by measuring the amount.

To evaluate the effect of ABC1 on the metabolism of HDL and LDL and cholesterol release into the liver, apoA-I-HDL, CE-HDL and apoB-LDL, CE- after 5 days of rLucif-AdV and rABC1-AdV vectors Epidemiological studies are performed with radiolabeled products such as LDL.

The expression effect of ABC1 in the development of atherosclerosis can be assessed by quantifying the average surface area of aortic lesions in apoE of mice after application of the rABC1-AdV vector.

Furthermore, according to the teachings of Vaisman (1995) and Hoeg (1996), constructs containing human ABC1 cDNAs under the control of endogenous promoters such as ABC1, CMV or apoE can be used for transgenic mice overexpressing the ABC1 gene. Rabbits can be made.

In the kinetics of plasma fat, lipoproteins, apolipoproteins, and determination of the long-term effects of the expression of ABC1 in atherosclerosis can be performed as described above.

Example 13: Use of Vesicles for Screening agonists and Antagonists of ABC1 Protein

The basis of this screening experiment is the reconstitution of a membrane contained in ABC1 protein and containing a substrate such as cholesterol or phospholipids. ABC1 protein can be activated or inhibited by the addition of the molecule. The outflow of the substrate through the channel formed by the ABC1 protein is then detected.

a) reconstitution of membrane containing ABC1 protein and labeled fat substrate

Various strategies can be used to make these membranes. Methods of using organic solvents, sonication, ie using mechanical tools such as "French presses", or using freeze-thaw cycles or surfactants (cholate, chaps, chapso). al., 1995)

More specifically, a substrate such as a lipid a phospholipid, cholesterol or a cholesterol ester, cholesterol, ³ H-, ¹²⁵ I- cholesterol or ^three radioactive substrates, fluorescent substrates with NBD such as H- phosphatidylcholine, or pyrene (Molecular Probe; http: // www.probes.com), and lipid substrates such as egg phosphatidylcholine (1 mM) are dried over pellets in a glass flask. Sodium cholate and ABC1 protein are mixed in this flask to a molar to molar ratio of 0.3. It is vortex-mixed for 5 minutes and incubated at 25 ° C. for 30 minutes before dialysis against physiological saline buffer. Proteoliposomes produced by this protocol are monitored via turbidimetry to confirm that they are well prepared.

b) capture of proteoliposomes on solid surfaces

This step can be carried out by incorporating integrin type binding proteins. In this protocol, capture by antibodies against ABC1 protein and which has been adsorbed on 96 or 384-well plates is used.

Solutions containing these antibodies at a concentration of 100 μg / I are taken up by incubating at 4 ° C. overnight in multi-well plates. After washing the plates are saturated with 1 mg / ml bovine albumin and incubated at 37 ° C. for 2 hours. The whole solution is then washed and incubated at 37 ° C. for 2 hours with proteoliposomes containing ABC1.

c) binding of the molecule

This step is carried out by incubating the product at 37 ° C. for 1 hour.

d) determination of activity or inhibition of ABC1 protein

If the substrate is fluorescent, the fluorescence of the supernatant is indicative of the activity of the product to induce the transport of fat out of the proteoliposomes. Alternatively, the use of the Confocal system gives information on the amount of substrate inside and outside the proteoliposome. If the substrate is radioactive, CytoStar-type plates with scintillation liquid bottoms can be used to identify the substrate still remaining in the proteoliposomes.

Example 14 Use of Anion Transport to Screen Agonist and Antagonist Molecules of ABC1 Protein

The principle of this experiment is based on the feature that the ABC1 protein has an anion for transport during activation.

a) Macrophages of the THP-1 strain, monocytes of human cells are models of differentiated macrophages. Cells are cultured in 48-multi well plates with a density of 2 × 10 ⁵ cells per well in RPMI 1640 medium fed with 10% fetal calf serum. Fibroblasts from patients with Tangier's disease can be used as a negative control because their ABC1 protein is not functioning. Other negative controls can be obtained by adding anti-ABC1 antibodies.

b) Cells using anion transport deficient cells or treated with anion channel inhibitors (Verapamil type, inhibitors of P-glycoprotein or tetraethylammonium, potassium channel inhibitors) are also available.

c) For practical experiments, cells were then placed in Earles's modified salt solution (ESS) medium, preloaded with 1 mL of KI in ESS medium at 1 μmol / L (0.1 μCi / mL NaI 125) for 30 minutes at 37 ° C. Washed. The product is then added to extracellular medium. The cells are then washed with ESS medium.

d) The amount of iodide in the medium is detected every minute for 11 minutes. The first two points correspond to the base runoff. At the end of the culture, the medium is harvested and the amount of iodine remaining in the cells is measured by subsequent lysis of cells in 1 mole NaOH.

e) The total amount of radioactivity at time zero is equal to the sum of the radioactivity found in the supernatant and the residual intracellular radioactivity. The runoff curve can be obtained by plotting the percentage of radioactivity released into the medium as a function of time.

Example 15 Use of THP-1 Macrophages Expressing IL-1 Beta for Screening agonist and Antagonist Molecules of ABC1 Protein

The principle of this experiment is based on that any substrate that modulates the activity of the ABC1 protein will affect the synthesis of IL-1 beta.

a) Macrophage, mononuclear leukemia human cells of the THP-1 lineage are models of differentiated macrophages. Cells are cultured in multi-well plates with a density of 2105 cells per well in RPMI 1640 medium fed with 10% fetal calf serum.

b) For the actual experiment, cells are then washed and placed in RPMI 1640 medium containing 1 μg / ml of purified human albumin fraction 4.

c) The product is added to extracellular medium. At the same time, cells are incubated for 30 minutes in the presence of 5 mmol / L of ATP and then activated by adding 1 μg / ml of lipopolysaccharide (LPS) for at least 3 hours.

d) The concentrations of IL-1 beta, regulatory IL-1 alpha, tumor necrosis factor alpha (TNF alpha), IL-6 are determined by ELISA kits according to the manufacturer's instructions (R & D System; human IL-1 beta chemiluminescence ELISA reference QLB00). Mutations in the mRNA of IL-1 beta that do not appear to be diseased can be assessed by Northern blot techniques using the corresponding probes.

Example 16: ABC1 Mediated Phospholipids and Cholesterol Outflow

I.-cultured cells

Human Hela Tet-off cells (Clontech, Palo Alto, CA, USA) contained 10% fetal calf serum, 2 mM glutamine, 100 IU / ml penicillin, 100 μg / ml streptomycin (EMEM10), 250 μg / ml G418 This Dulbecco's Modified Minimum Essential Medium (DMEM) (GIBRO BRL, Rockville, MD) is grown. Cell lines stably expressing human ABC1-GFP fusion proteins were co-transfected with a pTR2 plasmid (Clontech, Palo Alto, Calif.) Containing a cDNA of the fusion protein and a pHygro encoding a hygromycin resistance marker. Obtained. About 2 weeks after selection with 1 μg / ml of hygromycin, cells evaluated by fluorescence microscopy positive for GFP are cloned and expanded.

II. Cholesterol Spill Analysis

Cholesterol release analysis should be performed essentially as described by Oram et al. (1986) and Rothblat et al. (1986).

Adherent cholesterol-loaded fibroblasts grown in 24-well plates were 48 in EMEM 10 containing 1 μCi / mL of 1,2-3H-cholesterol (50 Ci / mmol) (Dupont, Wilmington, Delaware, USA). Incubate for hours. Typically this labeling protocol produces about 100,000 CPM / well or 1000C PM / μg protein. Cells are washed three times in EMEM / BSA and the presence or absence of 10 μg / ml of cholesterol receptors (ie apoA-I, apoA-II, apoA-IV, apoC-I, apoC-II, apoC-III, apoE ₃ ) EMEM / BSA medium underneath is added and incubated at 37 ° C. for 24 hours prior to the outflow of cholesterol. After the effluent (18 hours), the medium is collected and centrifuged (10,000 x g, 5 minutes), and the fractions of the medium are measured for radioactivity with a liquid scintillation counter. Residual radioactivity counts of cell fractions are determined overnight after extraction through isopropanol. The percent effluent is determined by dividing the radioactivity counts in the effluent medium by the sum of the radioactivity counts in the medium and cells. Unless indicated, EMEM / BSA medium is used as a blank and the results from the blank are subtracted from the radioactivity obtained in the presence of cholesterol receptors.

The results shown in FIG. 4 show that the addition of various apolipoproteins AI, A-II, A-IV, CI, C-II, C-III, E ₃ significantly increases cholesterol outflow in cells transfected with ABC1. The full-length ABC1 protein according to the present invention therefore promotes cholesterol outflow mediated by various apolipoproteins AI, A-II, A-IV, CI, C-II, C-III, E ₃ It can be done.

III. Phospholipid Runoff Analysis

Phospholipid runoff analysis is performed essentially as described by Mendez et al. (1994).

Choline-containing phospholipids were adherent cholesterol-loaded fibroblasts grown on 24-well plates with EMEM 10 medium containing 5 μCi / ml of methyl-3H choline chloride (84 Ci / mmol (Amersham, Arlington Heights, Ill.) Labeled by incubating for 24 hours After 1 hour pre-culture in EMEM / BSA, phospholipid receptors (ie apoA-I, apoA-II, apoA-IV, apoC-I, apoC-II, apoC-III, apoE) ₃ ) Cells are washed three times with EMEM / BSA prior to incubation with EMEM / BSA medium in the presence or absence of 10 μg / ml Normally, this labeling protocol is about 500,000 CPM / well or 5000 CPM / μg protein. After the effluent (18 hours), the medium is collected and centrifuged (10,000 x g, 5 min), the aliquots of the supernatant are extracted with chloroform: methanol (2: 1) and the radioactivity of the organic phase is flashed with a scintillation counter. Remaining counts in intracellular fractions were extracted for 1 hour of hexane: isopropanol (3: 2). The extracts measured with isopropanol overnight.

The% efflux is determined by dividing the radioactivity count in the effluent medium by the sum of the radioactivity counts of the effluent medium and the cell fraction. Unless indicated, EMEM / BSA medium is used as a blank and the results from the blank are subtracted from the radioactivity obtained in the presence of phospholipid receptors.

The results in FIG. 5 clearly demonstrate that addition of various apolipoproteins AI, A-II, A-IV, CI, C-II, C-III, E ₃ significantly increases cholesterol outflow in ABC1 transfected cells. Therefore, the full-length ABC1 protein according to the present invention is shown to be involved in phospholipid efflux mediated by various apolipoproteins AI, A-II, A-IV, CI, C-II, C-III, E ₃ .

Ⅳ. Lipoprotein, Apofatty Protein Vesicle Manufacture

HDL (d = 1.063-1.021 g / ml) is separable from human plasma via density gradient ultracentrifugation as described by Shumaker et al.

Apofatty proteins are purified from human plasma by column chromatography as described by Brewer et al. (1986) and can be measured via SDS-polyacrylamide gel electrophoresis and amino terminal sequencing to determine 99% purity. have. Apo-I reconstitution of phosphatidylcholine vesicles and egg yolk phosphatidylcholine with a ratio of 1: 2.5 (W: W) is performed by sonication (previously described by Jonas et al. (1986)).

The results in FIG. 6 show that apo-I and HDL mediate cholesterol outflow in cells transfected with ABC1 in whole and in part, respectively. It can also be seen that apoA-I also mediates the outflow of phospholipids from ABC1 transfected cells. However, phosphatidylcholine (pc) does not mediate cholesterol outflow in ABC1 transfected cells.

Combined ApoA-I and ApoA-II with V-ABC1

ApoA-I was iodine treated with isotope ¹²⁵ iodide by iodide monochloride to give specific activity of 2 × 10 6 cpm / μg. Adherent fibroblasts grown in 24-well plates are incubated with iodine treated apoA-I for 3 hours at 37 ° C. in the presence and absence of 50-fold excess of apolipoprotein AI and A-II fractions isolated from HDL. . The cells are washed three times rapidly with EMEM / BSA at 4 ° C. After lysis of the cell fractions with 0.1 M NaOH and 0.1% SDS, bound iodine treated ligands are determined by gamma counting.

Reference

The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing specification and the accompanying drawings. Such modifications also fall within the scope of the appended claims.

Various publications are cited herein, the disclosures of which are incorporated by reference in their entirety.

Claims (111)

An isolated nucleic acid comprising any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence. a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) nucleotides 1-242 of SEQ ID NO: 53, or at least 8 consecutive nucleotides of the polynucleotide sequence of the complementary polynucleotide sequence. a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) an isolated nucleic acid comprising at least 80% nucleotide identity with a nucleic acid comprising nucleotides 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence. The method of claim 3 wherein the nucleic acid is a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) an isolated nucleic acid comprising 85%, 90%, 95%, or 98% nucleotide identity with a nucleic acid comprising the nucleotides 1-242, or the complementary polynucleotide sequence of SEQ ID NO: 53. a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) an isolated nucleic acid which hybridizes under high stringency conditions with a nucleic acid comprising nucleotides 1-242 of SEQ ID NO: 53, or a complementary polynucleotide sequence. An isolated nucleic acid comprising a polynucleotide sequence represented by any one of SEQ ID NOs: 1, 4-65, 68-70, 72-88, 103, 109-118, and 137, or a complementary polynucleotide sequence. An isolated nucleic acid comprising the nucleotides 1-244 of SEQ ID NO: 69 or the nucleotides 1-357 of SEQ ID NO: 70, or the complementary polynucleotide sequence. An isolated nucleic acid comprising nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or at least eight consecutive nucleotides of the complementary polynucleotide sequence. An isolated nucleic acid comprising at least 80% nucleotide identity with nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or complementary polynucleotide sequences. The isolated nucleic acid of claim 9, wherein the nucleic acid comprises 85%, 90%, 95%, or 98% nucleotide identity with the nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or the complementary polynucleotide sequence. . An isolated nucleic acid that hybridizes under strict conditions with nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or complementary polynucleotide sequences. A nucleotide probe or primer may comprise a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleotide probe or primer specific for the ABC1 gene comprising nucleotides 1-242 of SEQ ID NO: 53, or at least 15 consecutive nucleotides of the polynucleotide sequence of the complementary polynucleotide sequence. A nucleotide probe or primer specific for the ABC1 gene, wherein the nucleotide probe or primer comprises nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or at least 15 consecutive nucleotides of the complementary polynucleotide sequence. A nucleotide probe or primer specific for the ABC1 gene, wherein the nucleotide probe or primer comprises any one of SEQ ID NOs: 119-136, 138, and 141-152, or a complementary polynucleotide sequence. a) in the presence of the reagents required for the amplification reaction, the first nucleotide primer hybridizes at position 5 'of the nucleic acid region and the second nucleotide primer is contacted with two nucleotide primers which hybridize at position 3' of the nucleic acid region. next; b) A method for amplifying a nucleic acid region according to claim 1, comprising detecting the amplified nucleic acid region. The method of claim 15, wherein the two nucleotide primers are A) a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleotide primer comprising at least 15 contiguous nucleotides of the nucleotides 1-242 of SEQ ID NO: 53, or the polynucleotide sequence of the complementary polynucleotide sequence, B) a nucleotide primer comprising at least 15 consecutive nucleotides of nucleotides 1-244 of SEQ ID NO: 69 or nucleotides 1-357 of SEQ ID NO: 70, or a nucleic acid having a complementary sequence, and C) A method for amplifying a nucleic acid region selected from the group consisting of nucleotide primers comprising a polynucleotide sequence of any one of SEQ ID NOs: 119-136, 138, and 141-152, or a nucleic acid having a complementary sequence. a) two nucleotide primers whose hybridization sites are located on the 5 'and 3' sides of the nucleic acid region, respectively, b) An amplification kit of nucleic acid according to claim 1, which contains a reagent for amplification reaction. 18. The method of claim 17, wherein the two nucleotide primers are A) a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleotide primer comprising at least 15 contiguous nucleotides of the nucleotides 1-242 of SEQ ID NO: 53, or the polynucleotide sequence of the complementary polynucleotide sequence, B) a nucleotide primer comprising at least 15 contiguous nucleotides comprising a nucleotide 1-244 of SEQ ID NO: 69 or a nucleotide 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, and C) a kit selected from the group consisting of a polynucleotide sequence of any one of SEQ ID NOs: 119-136, 138, and 141-152, or a nucleotide primer comprising a complementary polynucleotide sequence. 13. The nucleotide probe or primer of claim 12, wherein the nucleotide probe or primer comprises a marker compound. The nucleotide probe or primer of claim 13, wherein the nucleotide probe or primer comprises a marker compound. The nucleotide probe or primer of claim 14, wherein the nucleotide probe or primer comprises a marker compound. A) 1) a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleotide probe comprising at least 15 consecutive nucleotides of nucleotide 1-242 of SEQ ID NO: 53, or a polynucleotide sequence of complementary polynucleotide sequence, 2) a nucleotide primer comprising at least 15 nucleotides of nucleotide 1-244 of SEQ ID NO: 69 or 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, and 3) contacting the nucleic acid with a nucleotide probe selected from the group consisting of a polynucleotide sequence of any one of SEQ ID NOs: 119-136, 138, and 141-152, or a nucleotide probe comprising a complementary polynucleotide sequence, B) A method for detecting a nucleic acid according to claim 1, comprising detecting the complex formed between the nucleic acid and the probe. The method of claim 22, wherein the probe is immobilized on a support. A) 1) a) any one of SEQ ID NOs: 1, 4-8, 11-16, 18-26, 28-35, 37-52, 54-65, 68, and 137, or a complementary polynucleotide sequence; b) the nucleotide 3154-3200 or complementary polynucleotide sequence of SEQ ID NO: 9; c) nucleotides 1-242 or complementary polynucleotide sequence of SEQ ID NO: 10; d) nucleotides 1-1851 of SEQ ID NO: 17; Or complementary polynucleotide sequences; e) nucleotide 152-198, or complementary polynucleotide sequence of SEQ ID NO: 27; f) the nucleotide 1-1657, or complementary polynucleotide sequence of SEQ ID NO: 36; Or g) a nucleotide probe comprising at least 15 consecutive nucleotides of nucleotide 1-242 of SEQ ID NO: 53, or a polynucleotide sequence of complementary polynucleotide sequence, 2) a nucleotide primer comprising at least 15 nucleotides of nucleotide 1-244 of SEQ ID NO: 69 or 1-357 of SEQ ID NO: 70, or a complementary polynucleotide sequence, and 3) a nucleotide probe selected from the group consisting of any one of SEQ ID NOs: 119-136, 138, and 141-152, or a nucleotide probe comprising a complementary polynucleotide sequence, and optionally B) A kit for detecting a nucleic acid according to claim 1, which comprises a reagent necessary for a hybridization reaction. The kit of claim 24, wherein the probe is immobilized on a support. A recombinant vector comprising the nucleic acid according to claim 1. 27. The vector of claim 26, wherein the vector is adenovirus. A recombinant vector comprising the nucleic acid according to claim 6. 29. The vector of claim 28, wherein the vector is adenovirus. Recombinant vector comprising a nucleic acid according to claim 7. 31. The vector of claim 30, wherein the vector is adenovirus. Recombinant host cell comprising the nucleic acid according to claim 1. A recombinant host cell comprising the recombinant vector of claim 26. Recombinant host cell comprising the nucleic acid according to claim 6. A recombinant host cell comprising the recombinant vector according to claim 28. Recombinant host cell comprising the nucleic acid according to claim 7. A recombinant host cell comprising the recombinant vector according to claim 30. An isolated nucleic acid encoding a polypeptide comprising the amino acid sequence of SEQ ID 71. An isolated nucleic acid encoding a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71. A recombinant vector comprising the nucleic acid according to claim 38. A recombinant vector comprising the nucleic acid according to claim 39. A recombinant host cell comprising the nucleic acid according to claim 38. A recombinant host cell comprising the nucleic acid according to claim 39. A recombinant host cell comprising the recombinant vector according to claim 40. A recombinant host cell comprising the recombinant vector according to claim 41. a) a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, b) a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71, c) polypeptide fragments or variants of the polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, wherein the polypeptide fragments or variants comprise amino acids 1-60 of SEQ ID NO: 71, and d) an isolated polypeptide selected from the group consisting of polypeptides homologous to a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71. An antibody against an isolated polypeptide according to claim 46. 48. The antibody of claim 47, wherein the antibody comprises a detectable compound. a) contacting the polypeptide with an antibody according to claim 47; b) detecting the antigen / antibody complex formed between the polypeptide and the antibody. a) the antibody according to claim 47; And b) A diagnostic kit for detecting a polypeptide, comprising a reagent allowing detection of an antigen / antibody complex formed between the polypeptide and an antibody. A pharmaceutical composition comprising the nucleic acid according to claim 1 and a physiologically suitable excipient. A pharmaceutical composition comprising the nucleic acid according to claim 6 and a physiologically suitable excipient. A pharmaceutical composition comprising the nucleic acid according to claim 7 and a physiologically suitable excipient. A pharmaceutical composition comprising the nucleic acid according to claim 38 and a physiologically suitable excipient. A pharmaceutical composition comprising the nucleic acid according to claim 39 and a physiologically suitable excipient. A pharmaceutical composition comprising the recombinant vector according to claim 26 and a physiologically suitable excipient. A pharmaceutical composition comprising the recombinant vector according to claim 28 and a physiologically suitable excipient. A pharmaceutical composition comprising the recombinant vector according to claim 30 and a physiologically suitable excipient. A pharmaceutical composition comprising the recombinant vector according to claim 40 and a physiologically suitable excipient. A pharmaceutical composition comprising the recombinant vector according to claim 41 and a physiologically suitable excipient. Use of the nucleic acid according to claim 1 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of the nucleic acid according to claim 6 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of a nucleic acid according to claim 7 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of a nucleic acid according to claim 38 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of the nucleic acid according to claim 39 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of the recombinant vector according to claim 26 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of the recombinant vector according to claim 28 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of the recombinant vector according to claim 30 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for the treatment of a subject with cholesterol reverse transport dysfunction. Use of the recombinant vector according to claim 40 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of the recombinant vector according to claim 41 for the preparation of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction. Use of an isolated ABC1 polypeptide comprising amino acid sequence of SEQ ID NO: 71 or amino acids 1-60 of SEQ ID NO: 71 for the manufacture of a medicament for the prevention of various forms of atherosclerosis or more specifically for treating a subject suffering from cholesterol reverse transport dysfunction . A pharmaceutical composition comprising a polypeptide comprising the amino acid sequence of SEQ ID NO: 71 and a physiologically suitable excipient. A pharmaceutical composition comprising a polypeptide comprising amino acids 1-60 of SEQ ID NO: 71 and a physiologically suitable excipient. A pharmaceutical composition comprising a polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102, and a physiologically suitable excipient. Use of an isolated ABC1 polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 71 and 89-102 for the screening of the active ingredient for the prevention or treatment of diseases resulting from cholesterol reverse transport dysfunction. Use of an ABC1 polypeptide expressing recombinant host cell comprising the amino acid sequences of SEQ ID NOs: 71 and 89-102 for screening for active ingredients for the prevention or treatment of diseases resulting from cholesterol reverse transport dysfunction. a) preparing a membrane vesicle comprising a lipid substrate comprising an ABC1 polypeptide and a detectable marker; b) incubating the vesicle obtained in step a) with an agonist or antagonist candidate compound; c) qualitatively and / or quantitatively measuring release of a lipid substrate comprising a detectable marker; d) comparing the release of the labeled lipid substrate by the membrane vesicles not previously cultured with the agonist or antagonist candidate compound and the release of the lipid substrate as measured in step b). A method of screening for a compound, an agonist of ABC1 polypeptide, or an antagonist. a) incubating ABC1 polypeptide expressing cells with an anion labeled with a detectable marker; b) washing the cells of step a) to remove excess labeled anions that did not penetrate into the cells; c) incubating the cells obtained in step b) with an agonist or antagonist candidate compound for ABC1 polypeptide; d) measuring the outflow of the labeled anion from the cell; e) a compound that is active in cholesterol metabolism, comprising comparing the outflow of the labeling anion as measured by cells that have not been previously cultured with the agonist or antagonist candidate compound and the outflow of the labeling anion as measured in step d), A method of screening agonists or antagonists of ABC1 polypeptide. a) culturing cells of human monocyte lineage with purified human albumin in a suitable culture medium; b) culturing the cells of step a) simultaneously with a compound that stimulates production of IL-1 beta and an agonist or antagonist candidate compound; c) incubating the cells obtained in step b) with an appropriate concentration of ATP; d) measuring IL-1 beta released into the cell culture supernatant by the cells obtained in step c); e) activating cholesterol metabolism comprising comparing the agonist or antagonist candidate compound with IL-1 beta released into the culture supernatant of cells not previously cultured with the released IL-1 beta obtained in step d). To screen a compound, agonist or antagonist of ABC1 polypeptide. A graft comprising the recombinant host cell of claim 32. Graft comprising a recombinant host cell according to claim 34. A graft comprising the recombinant host cell of claim 36. a) SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or complementary nucleotide sequences thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or their complementary nucleotide sequences, c) of SEQ ID NO: 1 Nucleotide 11498-11754, or its complementary nucleotide sequence, d) nucleotides 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotides 7971-9741 of SEQ ID NO: 69, f) nucleotides 1-223, SEQ ID NO: 70, Or its complementary nucleotide sequence, g) the nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) the nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) the nucleotide 296-2894 of SEQ ID NO: 36 , Or its complementary nucleotide sequence, and j) the nucleotide 490-5352 of SEQ ID NO: 17, or any complementary nucleotide sequence thereof An isolated nucleic acid comprising. a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c) sequence Nucleotide 11498-11754 of No. 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) nucleotide 1 of SEQ ID NO: 70 -223, or its complementary nucleotide sequence, g) the nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) the nucleotides 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) the nucleotide of SEQ ID NO: 36 296-2894, or its complementary nucleotide sequence, and j) the nucleotide 490-5352 of SEQ ID NO: 17, or its complementary nucleotide sequence An isolated nucleic acid comprising at least 8 consecutive nucleotides of the nucleotide sequence. a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c) sequence Nucleotide 11498-11754 of No. 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) nucleotide 1 of SEQ ID NO: 70 -223, or its complementary nucleotide sequence, g) the nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) the nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) the nucleotide of SEQ ID NO: 36 296-2894, or its complementary nucleotide sequence, and j) the nucleotide 490-5352 of SEQ ID NO: 17, or its complementary nucleotide sequence Nucleic acid comprising the isolated nucleic acid comprising at least 80% nucleotide identity. The nucleic acid of claim 85, wherein the nucleic acid is a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or Its complementary nucleotide sequence, c) the nucleotide 11498-11754 of SEQ ID NO: 1, or its complementary nucleotide sequence, d) the nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) the nucleotide 7971-9741 of SEQ ID NO: 69, f) nucleotides 1-223 of SEQ ID NO: 70, or its complementary nucleotide sequence, g) nucleotide 8084-9854, or its complementary nucleotide sequence, of SEQ ID NO: 70, h) nucleotides 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence i) nucleotide 296-2894 of SEQ ID NO: 36, or its complementary nucleotide sequence, and j) nucleotide 490-5352 of SEQ ID NO: 17, or Nucleic acid material containing a nucleotide sequence beams and 85%, 90%, 95%, or an isolated nucleic acid containing a 98% nucleotide identity. a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c) sequence Nucleotide 11498-11754 of No. 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) nucleotide 1 of SEQ ID NO: 70 -223, or its complementary nucleotide sequence, g) the nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) the nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) the nucleotide of SEQ ID NO: 36 296-2894, or its complementary nucleotide sequence, and j) the nucleotide 490-5352 of SEQ ID NO: 17, or its complementary nucleotide sequence An isolated nucleic acid which hybridizes under high stringency conditions with a nucleic acid comprising. a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c) sequence Nucleotide 11498-11754 of No. 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) nucleotide 1 of SEQ ID NO: 70 -223, or its complementary nucleotide sequence, g) the nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) the nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) the nucleotide of SEQ ID NO: 36 296-2894, or its complementary nucleotide sequence, and j) the nucleotide 490-5352 of SEQ ID NO: 17, or its complementary nucleotide sequence An isolated nucleic acid comprising a labeled nucleotide sequence. The nucleotide probe or primer comprises a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide thereof Sequence c) nucleotide 11498-11754 of SEQ ID NO: 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) Nucleotide 1-223 of No. 70, or its complementary nucleotide sequence, g) nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) Nucleotides 296-2894 of SEQ ID NO: 36, or their complementary nucleotide sequences, and j) nucleotides 490-5352 of SEQ ID NO: 17 Or a nucleotide probe or primer specific for ABC1 gene, comprising at least 15 consecutive nucleotides of the nucleotide sequence of its complementary nucleotide sequence. 90. The nucleotide probe or primer of claim 89, wherein the nucleotide probe or primer comprises a marker compound. a) in the presence of the reagents required for the amplification reaction, the first nucleotide primer hybridizes at position 5 'of the nucleic acid region and the second nucleotide primer is contacted with two nucleotide primers which hybridize at position 3' of the nucleic acid region. next; b) A method for amplifying a nucleic acid region according to claim 83, comprising detecting the amplified nucleic acid region. 92. The method of claim 91, wherein the two nucleotide primers are a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1 , Or its complementary nucleotide sequence, c) the nucleotide 11498-11754 of SEQ ID NO: 1, or its complementary nucleotide sequence, d) the nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) the nucleotide 7971-SEQ ID NO: 69 9741, f) nucleotides 1-223 of SEQ ID NO: 70, or its complementary nucleotide sequence, g) nucleotide 8084-9854, or its complementary nucleotide sequence, of SEQ ID NO: 70, h) nucleotides 696-951 of SEQ ID NO: 40, or its complement Nucleotide sequence, i) nucleotides 296-2894 of SEQ ID NO: 36, or its complementary nucleotide sequence, and j) nucleotides of SEQ ID NO: 17 A method for amplifying a nucleic acid region selected from the group consisting of nucleotide primers comprising at least 15 contiguous nucleotides of the nucleotide sequence of id 490-5352, or a complementary nucleotide sequence thereof. Kit a) two nucleotide primers whose hybridization positions are located at 5 'and 3' of the nucleic acid region, respectively, and optionally b) Amplification kit of nucleic acid according to claim 83, comprising a reagent for amplification reaction. 95. The nucleotide of claim 93 wherein the two nucleotide primers are a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1 , Or its complementary nucleotide sequence, c) the nucleotide 11498-11754 of SEQ ID NO: 1, or its complementary nucleotide sequence, d) the nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) the nucleotide 7971-SEQ ID NO: 69 9741, f) nucleotides 1-223 of SEQ ID NO: 70, or its complementary nucleotide sequence, g) nucleotide 8084-9854, or its complementary nucleotide sequence, of SEQ ID NO: 70, h) nucleotides 696-951 of SEQ ID NO: 40, or its complement Nucleotide sequence, i) nucleotides 296-2894 of SEQ ID NO: 36, or its complementary nucleotide sequence, and j) nucleotides of SEQ ID NO: 17 A kit selected from the group consisting of nucleotide primers comprising at least 15 contiguous nucleotides of the nucleotide sequence of id 490-5352, or a complementary nucleotide sequence thereof. A) a nucleic acid is selected from a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or its complementary nucleotide sequence, b) the nucleotides 1-387 of SEQ ID NO: 1, or its complementary nucleotide sequence c) nucleotide 11498-11754 of SEQ ID NO: 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) SEQ ID NO: Nucleotide 1-223 of 70, or its complementary nucleotide sequence, g) nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) Nucleotide 296-2894 of SEQ ID NO: 36, or its complementary nucleotide sequence, and j) nucleotide 490-5352 of SEQ ID NO: 17, or its complementary nucleotide thereof Brought into contact with a nucleotide probe selected from the group at least consisting of a nucleotide probe comprising a nucleotide sequence of 15 consecutive nucleotides of the sequence following de, B) A method for detecting a nucleic acid according to claim 83, comprising detecting a complex formed between a nucleic acid and a probe. 96. The method of claim 95, wherein the probe is immobilized on a support. Kit A) a) any one of SEQ ID NOs: 1, 17, 36, 37, 38, 40, 69, and 70, or a complementary nucleotide sequence thereof, b) nucleotides 1-387 of SEQ ID NO: 1, or a complementary nucleotide sequence thereof, c ) Nucleotide 11498-11754 of SEQ ID NO: 1, or its complementary nucleotide sequence, d) nucleotide 1-110 of SEQ ID NO: 69, or its complementary nucleotide sequence, e) nucleotide 7971-9741 of SEQ ID NO: 69, f) of SEQ ID NO: 70 Nucleotides 1-223, or its complementary nucleotide sequence, g) the nucleotide 8084-9854 of SEQ ID NO: 70, or its complementary nucleotide sequence, h) the nucleotide 696-951 of SEQ ID NO: 40, or its complementary nucleotide sequence, i) SEQ ID NO: 36 Nucleotide 296-2894, or its complementary nucleotide sequence, and j) nucleotide 490-5352 of SEQ ID NO: 17, or its complementary nucleotide sequence Oligonucleotide probe is selected from the group of nucleotides, at least consisting of a nucleotide probe comprising 15 contiguous nucleotides of the sequence, and optionally B) A nucleic acid detection kit according to claim 83 comprising a reagent required for a hybridization reaction. 98. The kit of claim 97, wherein the probe is immobilized on the support. 89. A recombinant vector comprising the nucleic acid according to claim 83 or 88. 107. The vector of claim 99, wherein the vector is adenovirus. 89. A recombinant host cell comprising the nucleic acid according to claim 83 or 88. A recombinant host cell comprising the recombinant vector of claim 99. An isolated nucleic acid of a sequence selected from SEQ ID NO: 69 or 70 encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 71. A recombinant vector comprising a nucleic acid according to claim 103. A recombinant host cell comprising the nucleic acid according to claim 103. A recombinant host cell comprising the recombinant vector of claim 104. 98. A pharmaceutical composition comprising the nucleic acid according to any one of claims 83, 88 and 103 and a physiologically suitable excipient. 105. A pharmaceutical composition comprising a recombinant vector according to claim 104 and a physiologically suitable excipient. Use of the nucleic acid according to any one of claims 83, 88 and 103 for the preparation of various forms of atherosclerosis or more specifically for the treatment of a subject suffering from cholesterol reverse transport dysfunction. Use of a recombinant vector according to claim 104 for the prevention of various types of atherosclerosis or more specifically for the preparation of a medicament for the treatment of a subject suffering from cholesterol reverse transport dysfunction. 106. A graft comprising the recombinant host cell of claim 106.