EP1242435A2

EP1242435A2 - Medicaments for treatment of respiratory syncytial virus infections

Info

Publication number: EP1242435A2
Application number: EP00971557A
Authority: EP
Inventors: Rajneesh Malhotra; Michael Bird
Original assignee: Glaxo Group Ltd
Current assignee: Glaxo Group Ltd
Priority date: 1999-10-21
Filing date: 2000-10-23
Publication date: 2002-09-25
Also published as: GB9924990D0; AU1039601A; JP2003512384A; WO2001029054A2; WO2001029054A3

Abstract

Use of a product that (i) antagonises the binding of respiratory syncytial virus (RSV) G-protein to annexin II or to L-selectin, or (ii) causes a decrease in cell surface levels of annexin II or L-selectin, in the manufacture of a medicament for use in preventing or treating infection by RSV.

Description

MEDICAMENTS FOR TREATMENT OF RESPIRATORY SYNCYTIAL VIRUS INFECTIONS

Field of the Invention The present invention relates to the prevention and treatment of respiratory syncytial virus infection.

Background of the Invention

Respiratory syncytial virus (herein after referred to as RSV) is the single most important respiratory pathogen in infancy and early childhood. In particular children with congenital heart defects, bronchopulmonary dysplasia, premature infants and infants with immune deficiency diseases are at a high risk of RSV infection, which can result in significant morbidity and often death. Approximately 40% of primary RSV infections will show lower respiratory tract involvement which may require hospitalisation. In addition to young children, adults and children under immunosuppression during bone marrow or solid organ transplantations are also at high risk of developing severe pneumonia if infected with RSV. RSV also causes severe lower respiratory tract disease in the elderly, and those living in nursing homes, in particular, are subject to extensive epidemics of RSV infection every year. Until recently therapy for RSV infection was limited to supportive measures such as hydration, supplementary oxygen and assisted ventilation. Since 1986 ribavirin, the first synthetic, non-interferon-inducing, broad spectrum antiviral nucleoside has been licensed for the treatment of RSV infection in a number of countries. The potential teratogenicity to health care workers exposed to aerosolised ribavirin and poor cost effectiveness of the intervention have led the American Academy of Paediatrics to recommend that ribavirin may be considered for high-risk groups, for example infants who are severely ill and who are at high risk of morbidity and mortality.

Clinical trials with a humanised antibody MEDI-493 have shown that a reduction in hospitalisation, the length of stay in hospital and the length of stay in intensive care was achieved. Administration of the antibody provides only a prophylatic result, and does not extend to the treatment of established infections or symptoms. Limited routes of administration of this drug are available as it must be administered intramuscularly. It is also expensive to manufacture and produce. There is a need for an effective treatment for RSV infection which is easy to administer, cost effective, and has the potential for therapeutic use for the treatment of established infections and symptoms and prophylaxis.

Summary of the Invention

We have now shown that annexin II acts as a receptor for RSV on epithelial cells and that L-selectin acts as a receptor for RSV on leucocytes. We have also found that the compounds of formula (II) and (III) disclosed in International Patent Application Publication Number WO97/01335, incorporated herein by reference, are useful in the treatment of RSV infection. Specifically l,6-- i_-[3-(3-carboxymethylphenyl)-4-(2-α-D- mannopyranosyloxy)phenyl]hexane is particularly useful in the treatment of RSV infection. The compounds of formula (II) and (III) in WO97/01335 are disclosed for treating diseases such as adult respiratory distress syndrome (ARDS), Crohn's diseases, septic shock, traumatic shock, multi-organ failure, autoimmune diseases, asthma, inflammatory bowel disease, psoriasis, rheumatoid arthritis, reperfusion injuries that occur following heart attacks, strokes, organ transplants and cancer. There is no disclosure in WO97/01335 of the use of the compounds for the treatment of viral infections, in particular there is no teaching that the compounds would be useful in the treatment of RSV infection.

Accordingly, the present invention provides a product that (i) antagonises the binding of respiratory syncytial virus (RSV) G-protein to annexin II or to L-selectin, or (ii) causes a decrease in the cell surface levels of annexin II or L-selectin for use in a - method of preventing or treating infection by RSV.

The invention also provides a method of identifying a product which can prevent or treat RSV infection, which method comprises:

(a) contacting a candidate substance with annexin II or a derivative thereof or with L-selectin or a derivative thereof, and determining whether the substance binds thereto; or (b) providing a candidate substance to annexin II or a derivative thereof, and RSV G-protein or a derivative thereof, under conditions in which in the absence of the candidate substance the said annexin II or derivative thereof would bind to the said RSV G-protein or derivative thereof, and determining whether the candidate substance antagonises the binding between the said annexin II or derivative thereof and the said RSV G- protein or derivative thereof; or

(c) providing a candidate substance to L-selectin or a derivative thereof and RSV G-protein or a derivative thereof under conditions in which in the absence of the candidate substance the said L-selectin or derivative thereof would bind to the said RSV G-protein or derivative thereof, and determining whether the candidate substance antagonises the binding between the said L-selectin or derivative thereof and the said RSV G- protein or derivative thereof; the said binding of the substance in (a) or the said antagonising of binding in (b) or (c) indicating that the candidate substance can prevent or treat RSV infection.

In addition the invention provides a method of identifying a product which can prevent or treat RSV infection, which method comprises testing whether a candidate substance is capable of causing a decrease in the cell surface levels of annexin II or a derivative thereof or of or L-selectin or a derivative thereof, thereby determining whether the candidate substance can prevent or treat RSV infection.

Brief Description of the Drawings

Figure 1 shows the effect of complex carbohydrates on RSV infectivity. Hep2 cells (200μl/well; 5x10⁵ cells/ml) were added to microtitre plate wells and the plate was incubated overnight at 37°C. Serial dilutions of mannan (lOOμl/well; final maximum concentration 500μg/ml, final minimum concentration 0.05μg/ml) or fucoidan (lOOμl/well; final maximum concentration 500μg/ml, final minimum concentration 0.05 μg/ml) were mixed with 0.4 ml of RSV stock (1 x 10⁷ ffu/ml) and 50μl of each sample was added to the Hep2 cell monolayer. Fucoidan caused a concentration-dependent inhibition in RSV infectivity of Hep2 cells, whereas mannan did not inhibit the infectivity. Values are the means of two separate experiments, with each experiment done in triplicates.

Figure 2a shows the structure of compound A.

Figure 2b shows the effect of compound A and soluble selectin on RSV infectivity. Serial dilutions of L-selectin-ZZ (lOOμl/well; final maximum concentration 15 μg/ml, final minimum concentration 0.015μg/ml) or E-selectin-ZZ (lOOμl/well; concentration range 0.05 - 50μg/ml) or compound A (lOOμl/well; concentration range 0.08 - 800μg/ml) were mixed with 0.4 ml of RSV stock (1 x 10⁷ ffu/ml) and 50μl of each sample was added to the Hep2 cell monolayer. L-selectin-ZZ and the L-selectin inhibitor reduced the RSV infectivity, whereas E-selectin-ZZ had no effect. Values are the means of two separate experiments, with each experiment done in triplicates.

Figure 3 shows the binding of L-selectin to RSV G-protein L-selectin-ZZ (50μl; lOμg/ml) in the presence or absence of antibodies (50μl; 20μg/ml) or fucoidan (50μl; 50ug/ml) and/or 2mM Ca²⁺ -ion or 5mM EDTA was added to RSV G-protein coated wells. L-selectin-ZZ bound to RSV G-protein in a Ca²⁺-dependent manner and the binding was inhibited by fucoidan and an anti-L-selectin antibody.

Figure 4 shows the effect of enzymatic treatment on binding of L-selectin-ZZ to its ligands. Immunoaffinity purified G-protein and Factor H were incubated with sialidase, mannosidase or serial dilutions of heparinase. Microtitre plate wells were coated with enzyme-treated and non-treated G-protein.

A. Binding of L-selectin was not reduced by the pre-treatment of G-protein with sialidase (unshaded), mannosidase (cross-hatched) or incubation buffer (shaded).

B. Pre-treatment of G-protein with heparinase reduced the binding of L-selectin to G-protein. The reduction on binding of L-selectin to

G-protein was dependent on the concentration of heparinase used in the preincubation buffer. At a given concentration heparinase I (unshaded) was more effective than heparinase III (shaded) in removing the L-selectin binding site from G-protein. Figure 5 shows the effect of TQ1 on RSV infectivity of Hep2 cells. Different concentrations [100 μg/ml (shaded); 50μg/ml (not shaded)] of anti-L- selectin antibodies, anti-P-selectin antibodies or isotype control antibodies were mixed with RSV stock (1 x 10⁷ ffu/ml) and 50μl of each sample was added to the Hep2 cell monolayer. Surprisingly TQ1 inhibited the RSV infectivity of the Hep2 cells, whereas the other antibodies tested in this assay were without effect. Values are the means of two separate experiments, with each experiment done in triplicates.

Figure 6 shows the binding characteristics of the recombinant annexin II. Microtitre plate wells were coated with G-protein, plasminogen or bovine serum albumin and non-specific binding sites blocked with Tween 20 as described in the Examples. Serial dilutions of annexin II in lOmM Tris/HCl buffer (pH 7.4) containing 150mM NaCl, HRP conjugated anti-HisTag antibody (1 : 1000 dilution) containing 5mM Ca ²⁺ -ion or 5mM EDTA were added to the protein coated wells. (A) The binding of annexin II to RSV G-protein and plasminogen was concentration dependent and (B) inhibited in the presence of EDTA. Figure 7 shows the binding of annexin II to plasminogen and heparin. Microtitre plate wells were coated with heparin (lOOμg/ml; lOOμl) or plasminogen (lOOμg/ml; lOOμl) or RSV particles (lOOμg/ml; lOOμl). Non-specific binding sites were blocked as described in the Examples. Annexin II (lOμg/ml; 50μl) in the presence of serial dilutions of the TQ1 antibody (maximum concentration lOOμg/ml; 50μl) or control antibody (maximum concentration lOOμg/ml; 50μl) or selectin antagonist (maximum final concentration 500μM) in lOmM Tris/HCl buffer (pH 7.4) containing 150mM NaCl, 5mM CaC12 and HRP-conjugated-anti-His antibody (1 :1000 dilution) was added to the protein coated wells. TQ1 inhibits the binding of annexin II to heparin (A) and plasminogen (B) or RSV particles (C), whereas no inhibition of binding was observed in the presence of isotype control antibody. Selectin antagonist (compound A) inhibited the binding of annexin II to plasminogen and heparin.

Figure 8 shows a sequence alignment of the epitope recognised by the LAM 1-3 (residue number 92 and 156 in the L-selectin) and the heparin and plasminogen binding site in annexin II (localised within the C-terminal). The regions of identity and a potential TQ1 epitope are shown by (*). Figure 9 shows the effects of soluble annexin II and selectins on RSV infectivity.

Figure 10 shows the effect of compound A on IL-8 release from virus infected cells.

Brief Description of the Sequences

SEQ ID NO: 1 shows the full length amino acid sequence of human L-selectin. Amino acids 1 to 28 form the signal peptide and amino acids 29 to 38 form the signal peptide. Amino acids 39 to 332 form the extracellular domain seen in the soluble form of L-selectin. Amino acids 333 to 355 form the transmembrane region and amino acids 356 to 372 form the cytoplasmic region. The C-type lectin carbohydrate binding domain is found at amino acids 55 to 155.

SEQ ID NO: 2 shows the full length amino acid sequence of a soluble form of annexin II. A putative heparin / carbohydrate binding site is found at amino acids 240 to 339.

SEQ ID NO: 3 shows the amino acid sequence of RSV G-protein.

SEQ ID NOs: 4 and 5 show the oligonucleotide primers used in the cloning of annexin II.

Detailed Description of the Invention

Any suitable product that antagonises the binding of RSV G-protein to annexin II or to L-selectin or which causes a decrease in cell surface levels of annexin II or L-selectin may be used in the invention.

The product may inhibit or decrease the binding between annexin II and G-protein or between L-selectin and G-protein. The product may be capable of binding to annexin II, L-selectin or RSV G-protein.

The product may or may not antagonise the binding of RSV G-protein to annexin II or L-selectin in a specific or substantially specific manner, so that antagonism of binding of any of these proteins to other proteins, such as ligands (typically natural ligands) of annexin II or L-selectin, may or may not occur. Suitable ligands of L-selectin include sialyl lewis X (sLex), sulphated-sLex, GlyCAM-1, CD34, glycocalyx, PSGL-1 , sulphatides, phosphosphomannan ester, phospholipids, mannose- 6-phosphate, complement factor H, fucoidan or glycosoaminoglycans. Suitable ligands of annexin II include phospholipids, glycosoaminoglycans, plasminogen, human cytomegalovirus, glycoprotein B, tenascin-C or fucoidan. In one embodiment the product binds annexin II and/or L-selectin specifically.

Such a product may or may not inhibit any of the activities of either protein, for example carbohydrate binding or phospholipid binding. The product may bind reversibly or irreversibly to annexin II or L-selectin. A product which binds irreversibly dissociates very slowly from the protein because it would be very tightly bound, either covalently or non-covalently. Reversible binding, in contrast with irreversible binding, is characterised by a rapid dissociation of the annexin II/L-selectin product complex. The product may resemble a natural agent that binds annexin II or L-selectin, optionally excluding RSV G-protein, either in its structure or binding characteristics. In the case where the agent is a polypeptide the product may have homology with the natural agent. The product may bind annexin II or L-selectin at the same site as the agent binds. Such a product is typically able to compete for, antagonise or inhibit the binding of the agent to either protein. The product may bind annexin II or L-selectin at the same site as RSV G-protein binds.

The product may not bind annexin II or L-selectin at a site that overlaps with the site at which the natural agent binds. Such a product may inhibit the binding of the agent to either protein.

The product may be a soluble form of annexin II or of L-selectin. A soluble form of annexin II or L-selectin may be naturally occurring or artificially produced. Typically such a product consists of or consists essentially of a fragment of annexin II or L-selectin, or a homologue of such a fragment. The fragment may comprise additional amino acids at the N or C terminus and thus may for example be in form of a fusion protein. The soluble form may comprise only all or part of the extracellular domain of L-selectin or annexin II and may be produced by enzymatic cleavage of the extracellular domain. Preferably, the soluble form of L-selectin comprises a protein whose sequence is represented by only all or part of the sequence represented by amino acids 39 to 332 of SEQ ID NO: 1 (L-selectin) without including any other amino acid sequence of L-selectin. The soluble form of annexin II is typically a tetramer. A soluble form or mimic of annexin II may antagonise the binding of RSV G-protein to annexin II or to L-selectin and a soluble form or mimic of L-selectin may antagonise the binding of RSV G-protein to annexin II or to L-selectin. The product may or may not cause a change in the structure of annexin II or

L-selectin. In one embodiment the product causes annexin II or L-selectin to change to a form that is less able or unable to bind RSV G-protein. The change may be reversible or irreversible. Typically annexin II or L-selectin only adopts such a changed form when bound to the product. An irreversible change may occur, for example, if either protein is chemically modified or is broken down by the product, for example by the breaking of peptide bonds.

In one embodiment the product antagonises the binding of RSV G-protein to annexin II or L-selectin not by binding annexin II or L-selectin, but by binding RSV G-protein. The product may bind and/or act on RSV G-protein in the same manner as the products described above bind and act upon annexin II or L-selectin. Thus the binding of the product to RSV G-protein is typically specific and may be reversible or irreversible, and may or may not cause a change in the structure of RSV G-protein. Such a product typically resembles the structure and/or binding characteristics of annexin II or L-selectin, and therefore the product may act as a 'mimic' of annexin II or L-selectin (e.g. a polypeptide which has homology with either protein).

The mimic may have been designed (e.g. computationally) to resemble annexin

II or L-selectin in its binding characteristics and/or may have been selected (e.g from a library of substances) based on its ability to bind agents which bind annexin II or

L-selectin. The mimic (which in one embodiment is the soluble form of annexin II or

< L-selectin discussed herein) may comprise a carbohydrate binding (recognition) domain of L-selectin or annexin II. The mimic may comprise at least, only or part of the sequence represented by amino acids 55 to 155 of SEQ ID NO: 1 (L-selectin) or of amino acids 240 to 339 of SEQ ID NO: 2 (annexin II), or homologues of such sequences. In the case where the product is a peptide (e.g. the soluble forms of annexin II or

L-selectin) it typically has a length of at least 20 amino acids for example at least 50, 100, 200, 300, 500, 1000, 2000 or more amino acids.

In one embodiment the product decreases the expression of annexin II or L-selectin or decreases the level of annexin II or L-selectin within the cell or at the cell surface. The product may induce shedding of annexin II or L-selectin from the surface of a cell.

The product may decrease intracellular levels of annexin II or L-selectin, typically by inhibiting the expression of annexin II or L-selectin or increaseing the breakdown of annexin II or L-selectin. Thus such a product causes a decrease in the expression and/or levels of annexin II or L-selectin in a cell when provided to a cell or inside a cell.

A product which inhibits the expression of annexin II or L-selectin may inhibit one or more cellular components that promote the expression of annexin II or L-selectin, or may stimulate one or more cellular components that inhibit the expression of annexin II or L-selectin. Typically these components are specific or substantially specific to the expression of annexin II or L-selectin. The product may bind and/or act on the component in the same manner as the product described above binds and acts upon annexin II or L-selectin. Thus the binding of the product to the component is typically specific and may be reversible or irreversible, and may or may not cause a change in the structure of the component. The component may directly or indirectly promote or inhibit the expression of annexin II or L-selectin.

Cellular components that directly promote expression include the promoter of annexin II or L-selectin, transcription factors that bind or affect expression from the annexin II or L-selectin promoter, an RNA polymerase that can express mRNA from the annexin II or L-selectin gene, nuclear factors that bind to annexin II or L-selectin mRNA and/or transport annexin II or L-selectin mRNA from the nucleus to the cytoplasm, translation factors that contribute to translating the annexin II or L-selectin mRNA to annexin II or L-selectin protein, or factors that bind and/or transport annexin II or L-selectin protein to their cell surface location.

Components that indirectly promote expression include components that are one step removed from the annexin II or L-selectin expression pathway, such as the promoters, transcription factors, polymerases, nuclear factors, translation factors of components that directly promote the expression of annexin II or L-selectin. Components that indirectly promote expression may thus be one, two or more steps removed from the components that directly promote expression of annexin II or L-selectin. 5 Thus the product may inhibit transcription or translation of annexin II or

L-selectin mRNA. Preferably the product is a specific inhibitor of transcription from the annexin II or L-selectin gene, and does not inhibit transcription from other genes. The product may bind to the annexin II or L-selectin gene either (i) 5' to the coding sequence, and/or (ii) to the coding sequence, and/or (iii) 3' to the coding sequence. Thus o the product may bind to the annexin II or L-selectin promoter, and inhibit the initiation of transcription. As discussed above the product may bind and inhibit the action of a protein which is required for transcription from the annexin II or L-selectin gene.

The product may bind to the untranslated or translated regions of the annexin II or L-selectin mRNA. This could prevent the initiation of translation. Alternatively the 5 inhibitor could bind to a protein which associates with the untranslated region and prevent the protein associating with the untranslated region.

Products which are polynucleotides, such as the antisense polynucleotides discussed below, may be chemically modified. This may enhance their resistance to nucleases and may enhance their ability to enter cells. For example, phosphorothioate 0 oligonucleotides may be used. Other deoxynucleotide analogs include methylphosphonates, phosphoramidates, phosphorodithioates, N3'P5'-phosphoramidates and oligoribonucleotide phosphorothioates and their 2'-O-alkyl analogs and 2'-O-methylribonucleotide methylphosphonates.

Alternatively mixed backbone oligonucleotides (MBOs) may be used. MBOs 5 contain segments of phosphothioate oligodeoxynucleotides and appropriately placed segments of modified oligodeoxy- or oligoribonucleotides. MBOs have segments of phosphorothioate linkages and other segments of other modified oligonucleotides, such as methylphosphonate, which is non-ionic, and very resistant to nucleases or 2'-O-alkyloligoribonucleotides. 0 As noted above, the expression of annexin II or L-selectin in a cell may be reduced by the presence in that cell of a product which can bind to the annexin II or L-selectin mRNA. Therefore a polynucleotide which is capable of hybridizing to annexin II or L-selectin mRNA can constitute an appropriate inhibitor of annexin II or L-selectin expression.

The polynucleotide may be antisense to the annexin II or L-selectin mRNA. Such a polynucleotide may be capable of hybridising to annexin II or L-selectin mRNA and may thus inhibit the expression of annexin II or L-selectin by interfering with one or more aspects of annexin II or L-selectin mRNA metabolism including transcription, mRNA processing, mRNA transport from the nucleus, translation or mRNA degradation. The antisense polynucleotide may be DNA, but is typically RNA. The antisense polynucleotide may be provided as single or double stranded polynucleotide. The antisense polynucleotide typically hybridises to the annexin II or L-selectin mRNA to form a duplex (typically an RNA-RNA duplex) which can cause direct inhibition of translation and/or destabilisation of the mRNA. Such a duplex may be susceptible to degradation by nucleases. The antisense polynucleotide may hybridize to all or part of the annexin II or

L-selectin mRNA. Typically the antisense polynucleotide hybridizes to the ribosome binding region or the coding region of the annexin II or L-selectin mRNA. The polynucleotide may be complementary to all of or a region of the annexin II or L-selectin mRNA. For example, the polynucleotide may be the exact complement of all or a part of annexin II or L-selectin mRNA. However, absolute complementarity is not required and polynucleotides which have sufficient complementarity to form a duplex having a melting temperature of greater than 20°C, 30°C or 40°C under physiological conditions are particularly suitable for use in the present invention. The polynucleotide may be a polynucleotide which hybridises to the annexin II or L-selectin mRNA under conditions of medium to high stringency such as 0.03M sodium chloride and 0.003M sodium citrate at from about 50 to about 60 degrees centigrade. Polynucleotides which are homologous to each other generally hybridise to each other under such conditions.

In one preferred embodiment the antisense polynucleotide sequence is complementary to the entire coding sequence of the mRNA and to the 50 nucleotides of the mRNA immediately 5' of the coding sequence. However, the polynucleotide may hybridise to all or part of the 5'- or 3 '-untranslated region of the mRNA. The polynucleotide will typically be from 6 to 40 nucleotides in length. Preferably it will be from 12 to 20 nucleotides in length. The polynucleotides may be at least 40, for example at least 60 or at least 80, nucleotides in length and up to 100, 200, 300, 400, 500, 1000, 2000 or 3000 or more nucleotides in length. In one embodiment the product is capable of selectively binding annexin II or

L-selectin mRNA and inactivating it, for example the product may be a ribozyme.

The invention may be carried out by administering a substance which provides a product with any of the above properties in vivo. Such a substance is also included in the term 'productø In one embodiment the substance provides the product in a tissue- specific manner only in a cell susceptible to RSV infection, such as in an epithelial cell, leucocyte, or endothelial cell.

Typically the substance is an inactive or precursor form of the product which can be processed in vivo to provide the product. Thus the substance may comprise the product associated, covalently or non-covalently, with a carrier. The substance can typically be modified or broken down to provide the product. As discussed below the substance may, for example, be a polynucleotide which is processed, for example transcribed and/or translated to provide a product as discussed above.

The invention provides use of compounds of formula (II) and (III) for the manufacture of a medicament for the treatment of respiratory syncytical virus. Compounds of formula (II) are given below:

wherein X is selected from the group consisting of

-CN, -(CH₂)„CO₂H, - (CH₂)„CONHOH, -O(CH₂)_ιnCO₂H,

-O(CH₂)_mCONHOH, -(CH₂)_nCONHNH₂, -(CH₂)„COZ, -(CH₂)„Z,

-CH(CO₂H)(CH₂)_mCO₂H, -(CH₂)_nO(CH₂)_mCO₂H, -CONH(CH₂)„,CO₂H, -CH(OZ)(CO₂H), -CH(Z)(CO₂H), -(CH₂),,SO₃H, -(^₂)^0₃0,0,,

-NH(CH₂),_nCO₂H, -CONH(CHR₃)CO₂H, (l-H-tetrazolyl-5-alkyl-), and -OH; For divalent structures, Y is -(CH₂)_r,

-CO(CH₂)_fCO-, -(CH₂)_fO(CH₂)_r, -CO(CH₂)_fO(CH₂)_tCO-,

-(CH₂)₈S(O)_b(CH₂)_fS(O)_b(CH₂)_g-, -CO(CH₂)_i!S(O)_b(CH₂)₍S(O)_b(CH₂)_ECO-, -( CH₂)_fV(CH₂)_r,

-(CH₂)_fCOVCO(CH₂)_r, CO(CH₂),COVCO(CH₂)_fCO-,

-CO(CH₂)_fV(CH₂)_fCO-, -CONH(CH₂)_fNHCO-, CO(CH₂)_fW(CH₂)_fCO-,

-(CH₂)_fWSW(CFI₂)_r,

-(CH₂)_fCONH(CH₂)_fNHCO(CH₂)_r, -(CH₂)_fCOW(CH₂)_fWCO(CH₂)_r, or - CH₂(CH₂)_fW(CH₂),CH₂- where V is -N[(CH₂)_q]₂N- and q is independently 2 to 4, and

W is aryl or heteroaryl;

For trivalent structures, Y is:

and T is selected from the group consisting of -(CH₂)_r,

-CO(CH₂)_r, -(CH₂)_gS(O)_b(CH₂)_r, and -CO(CH₂)_gS(O)_b(CH₂)_r) where the carbonyl group is positioned contiguous to the biphenyl unit; R, and R₂ are independently selected from the group consisting of hydrogen, alkyl, halogen, -OZ, -NO₂, -(CH₂)_nCO₂H, -NH₂ and -NHZ;

R₃ is selected from the group consisting of hydrogen, alkyl, aralkyl, hydroxyalkyl, aminoalkyl, alkyl carboxylic acid and alkyl carboxamide; f is 1 to 16, g is 0 to 6, n is 0 to 6, m is 1 to 6, p is 0 to 6, b is 0 to 2, Z is alkyl, aryl, or aralkyl, and D, and D₂ are independently hydrogen or alkyl, and the pharmaceutically acceptable salts, esters, amides and prodrugs thereof.

Preferably the compound used is compound of formula (III):

where X is -COOH, -(CH₂)_nCOOH or -O(CH₂)_nCOOH and Y is -(CH₂)_n-, -(CH₂)_nW(CH₂)_n-, -(CH₂)_nWOW(CH₂)_n-,-(CH₂)„S(CH₂)_nS(CH₂)_n-, -CO(CH₂)„CO-, or - (CH₂)_nCOW(CH₂)_nWCO(CH₂)_n- where W is aryl or heteroaryl, and n is 0 to 6, and the pharmaceutically acceptable salts, esters, amides and prodrugs thereof. Preferably Y is -(CH₂)_f or

More preferably X is 3-CH₂CO₂H and Y is -(CH₂)_f or -CH₂(CH₂)_fW(CH₂)_fCH_2. Particular compounds for use in the invention are: l,7-_ w-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]heptane, l,6-όw-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]hexane, l,5-- /_s'-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]pentane, l,4--?w-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]butane, N,N'-όw-[4-(3-(3-carboxymethylphenyl)-4-(α-D-mannopyranosyloxy)phenyl])butan-l- yl]-4,4'-trimethylenedipiperidine, S,S'-_w-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)-3-phenylprop-l- yl]-l,3-dithiopropane, l,7-/ w-[3-(3-carboxymethylphenyl)-4-(2- -D-mannopyranosyloxy)phenyl]-l,7-_ w- oxoheptane, l,6-άw-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]-l,6-/bt5- oxohexane, l,5-6z^'_ -[3-(3-carboxymethylphenyl)-4-(2- -D-mannopyranosyloxy)phenyl]-l,5-Z. -5'- oxopentane, l,4- 7«'-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]-l,4-- t- - oxobutane,

1 ,3 ,5 -tris- [3 -(3 -carboxymethylphenyl)-4-(2-α-D- mannopyranosyloxy)phenylmethyl]benzene, and l,3,5-trw-[4-[3-(3-carboxymethylphenyl)-4-(α-D-mannopyranosyloxy)phenyl]-4-oxo-2- thiobutyljbenzene, or pharmaceutically acceptable salts, esters, amides, and prodrugs thereof.

More preferably the compound for use in the manufacture of a medicament for the treatment of RSV infection is l,6-_ w-[3-(3-carboxymethylphenyl)-4-(2-α-D- mannopyranosyloxy)phenyl]hexane or pharmaceutically acceptable salts, esters, amides, and prodrugs thereof. Although we do not wish to be bound by theory, it is speculated that the compounds of formula (II) and (III) bind to glycoprotein receptors on the cell surface and block adhesion or fusion of RSV to the cell.

As used herein, the term "alkyl" shall mean a monovalent straight chain or branched chain group of 1 to 12 carbon atoms including, but not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl and the like.

The term "lower alkyl" shall mean any alkyl group having from one to six carbon atoms.

The term "halogen" shall mean any atom selected from the group consisting of chlorine, fluorine, bromine, and iodine. The term "alkoxy" shall mean an alkyl group attached to a molecule through an oxygen atom including, but not limited to, methoxy, ethoxy, isopropoxy, n-butoxy, sec- butoxy, isobutoxy, tert-butoxy and the like.

The term "alkylamino" shall mean groups having the structure -NH-(alkyl), or - N-(alkyl)₂, including, for example, methylamino, ethylamino, isopropylamino and the like.

The term "aryl" shall mean carbocyclic aromatic groups and heteroaromatic groups including, but not limited to, phenyl, 1 or 2-naphthyl, fluorenyl, (1,2)- dihydronaphthyl, indenyl, indanyl, thienyl, benzothienyl, thienopyridyl and the like.

The term "aralkyl" (also called arylalkyl) shall mean an aryl group appended to an alkyl group including, but not limited to, benzyl, 1 and 2-naphthylmethyl, halobenzyl, alkoxybenzyl, hydroxybenzyl, aminobenzyl, nitrobenzyl, guanidinobenzyl, fluorenylmethyl, phenylmethyl(benzyl), 1-phenylethyl, 2-phenylethyl, 1 -naphthylethyl and the like.

The term "hydroxyalkyl" shall mean -OH appended to an alkyl group. The term "aminoalkyl" shall mean a group having the structure -NR_xR_y appended to an alkyl group. The groups R_x and R_y are independently selected from, for example, hydrogen, alkyl and aryl.

The term "alkyl carboxylic acid" shall mean a carboxyl group (-CO₂H) appended to an alkyl group. The term "alkyl carboxamide" shall mean a group having the formula -CONRJR_y appended to an alkyl group where R_x and R_y are as defined above under aminoalkyl.

The term "pharmaceutically acceptable salts, esters, amides and prodrugs" as used herein refers to those carboxylate salts, amino acid addition salts, esters, amides and prodrugs of the compounds of the present invention which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of patients without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, and effective for their intended use, as well as the zwitterionic forms, where possible, of the compounds of the invention. The term "salts" refers to the relatively non-toxic, inorganic and organic acid addition salts of the compounds of the present invention. These salts can be prepared in situ during the final isolation and purification of the compounds or by separately reacting the purified compound in its free form with a suitable organic or inorganic acid or base and isolating the salt thus formed. Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, tosylate, citrate, maleate, furmarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactiobionate, laurylsulphonate salts and the like. These may include cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium and the like, as well as nontoxic ammonium, quaternary ammonium and amine cations including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. (See, for example S. M. Berge, et al., "Pharmaceutical Salts," J. Pharm. Sci., 66: 1-19 (1977), which is incorporated herein by reference).

Examples of pharmaceutically acceptable, non-toxic esters of the compounds of this invention include C, to C₆ alkyl esters wherein the alkyl group is a straight or branched chain. Acceptable esters also include C₅ to C₇ cycloalkyl esters as well as arylalkyl esters such as, but not limited to benzyl. C, to C₄ alkyl esters are preferred. Also included are amino acid esters. As used herein amino acid means one of the twenty amino acids commonly found in plant and animal proteins, and which are listed in any basic organic or biochemistry textbook, for example, Stryer, "Biochemistry", Third Edition, page 21. Esters of the compounds of the present invention may be prepared according to conventional methods.

Examples of pharmaceutically acceptable, non-toxic amides of compounds of this invention include amides derived from ammonia, primary C_t to C₆ alkyl amines and secondary C, to C₆ dialkyl amines wherein the alkyl groups are straight or branched chain. In the case of secondary amines the amine may also be in the form of a 5 or 6 membered heterocycle containing one nitrogen atom. Amides derived from ammonia, C, to C₃ alkyl primary amides and C, to C₂ dialkyl secondary amides are preferred. Amides of the compounds of the invention may be prepared according to conventional methods. The term "prodrug" refers to compounds that are transformed in vivo to yield to the parent compound of the above formula, for example by hydrolysis in blood. A thorough discussion is provided in T. Higuchi and V. Stella, "Pro-drugs as Novel Delivery Systems", Vol 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, both of which are incorporated herein by reference. Thus there is provided a further aspect of the invention there is provided a method of treatment of a mammal, including a human, with a RSV infection, comprising administering an effective amount of a compound of formula (II) or (III).

There is also provided in a further aspect use of a compound of formula (II) or (III) for the treatment of a RSV infection. It will be appreciated by those skilled in the art that reference herein to treatment extends to prophylaxis as well as the treatment of established infections or symptoms.

The compounds of formula (II) and (III) may be formulated as a pharmaceutical formulation or composition as described in WO97/01335 including but not limited to compositions suitable for parental administration, inhaled, intranasal administration, or oral administration.

Preferably the compounds of formula (II) and (III) will be formulated for oral, inhaled, intranasal administration or intravenous administration

Preferably the formulations will be suitable for administration by aerosol or by using a nebuliser. The amount of a compound of formula (II) or (III) required for use in treatment will vary not only with the particular compound selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient. In general however a suitable dose will be in the range of from about 0.1 to 750 mg/kg of bodyweight per day, preferably in the range of 0.5 to 50 mg/kg/day. The desired dose may be presented in a single dose or as divided doses administered at appropriate intervals, for example as two, three, four or more sub-doses per day.

The compounds of formula (II) and (III) are prepared as described in WO97/01335 incorporated herein by reference.

A product which antagonises the binding of RSV G-protein to annexin II or L-selectin or which causes a decrease in cell surface levels of annexin II or L-selectin can be used to treat or prevent RSV infection. As mentioned above the invention provides a method of identifying such a product, which may have any of the characteristics discussed above. Thus the product may be identified by determining whether a candidate substance has such antagonising properties or has such effects on the cell surface levels of either protein and optionally by further determining whether the candidate substance has any of the other properties mentioned above.

The method of determining whether the product causes antagonism of binding may be based on determining whether the candidate substance binds annexin II or L-selectin, or whether the candidate substance inhibits the binding between G-protein and annexin II or selectin. Thus the invention provides a method of identifying a product which can prevent or treat RSV infection, which method comprises:

(a) contacting a candidate substance with annexin II or L-selectin and determining whether the substance binds to annexin II or L-selectin;

(b) providing a candidate substance to annexin II and RSV G-protein under conditions in which in the absence of the candidate substance annexin II would bind to RSV G-protein, and determining whether the candidate substance antagonises the binding between annexin II and RSV G- protein; or

(c) providing a candidate substance to L-selectin and RSV G-protein under conditions in which in the absence of the candidate substance the L-selectin would bind to RSV G-protein, and determining whether the candidate substance antagonises the binding between L-selectin and RSV G-protein; wherein the annexin II or selectin in (a), (b) or (c) is not present on the surface of a cell or is expressed recombinantly on the surface of a cell, the binding of the substance to annexin or L-selectin in (a) or the antagonising of binding in (b) or (c) indicating that the candidate substance can prevent or treat RSV infection.

Any suitable binding assay format can be used in (a), such as any of the formats discussed below.

As mentioned above, in the method the annexin II or L-selectin is either not present on the surface of a cell or is expressed recombinantly on the surface of a cell. Thus either protein may be expressed on a cell which does not naturally express annexin II or L-selectin or on the surface of a cell which has been engineered to express altered levels (typically increased levels) of the protein. Thus the cell on which annexin II or L- selectin is expressed may comprise a recombinant vector from which the protein is expressed. The cell may be a eukaryotic cell, such as a mammalian cell, such as a primate

(e.g. human) or rodent (e.g. mouse or rat) cell. The cell may be a prokaryotic cell, such as a bacterial cell. The cell may be an epithelial cell or a leukocyte. The annexin II or L-selectin may be in the form of a cell extract (e.g. a partially purified extract), such as of any of the cells mentioned herein. The terms 'annexin IF, 'L-selectin' and 'RSV G-protein' include, as well as the naturally occurring forms of these proteins (such as of any of the species mentioned herein), derivatives of these proteins. Typically such derivatives are homologues of these proteins (including homologues of fragments of the proteins). A derivative may be a soluble form of annexin II or L-selectin such as those mentioned herein. A derivative will have some or all of the relevant binding activity of the natural annexin II, L-selectin and/or RSV G-protein. A derivative may comprise the carbohydrate binding sites of amino acids 55 to 155 of SEQ ID NO: 1 (L-selectin) or amino acids 240 to 339 of SEQ ID NO: 2 (annexin II) or portions or homologous of these sequences.

L-selectin, annexin II and RSV G-protein for use in the method can be obtained by known techniques. The full length amino acid sequences of these proteins are provided herein in SEQ ID No's, 1 , 2 and 3 respectively. This sequence information can be used by the skilled man to produce annexin II, L-selectin or RSV G-protein using routine methods. It can also be used in connection with the methods of the present invention to provide fragments or derivatives of these proteins which are therapeutic products for RSV infection.

In the method of the invention the annexin II, L-selectin and/or RSV G-protein is generally in a suitable buffer, which includes any suitable biological buffer that can provide buffering capability at a pH conducive to the binding requirements of the annexin II, L-selectin and/or RSV G-protein. The annexin II, L-selectin and/or RSV G- protein may be in conditions, including temperatures, which are similar to intracellular conditions. Methods which determine whether a candidate substance is able to inhibit the binding of annexin II or L-selectin with RSV G-protein may comprise providing annexin II, L-selectin and/or RSV G-protein to a candidate substance and determining whether binding occurs, for example by measuring the amount of the annexin II or L- selectin which binds RSV G-protein or the amount of the candidate substance which binds the annexin II, L-selectin or the RSV G-protein. The binding may be determined by measuring a characteristic of the candidate substance, annexin II, L-selectin or RSV G-protein that changes upon binding, such as spectroscopic changes.

The assay format may be a 'band shift' system. This involves determining whether a candidate substance advances or retards annexin II, L-selectin or RSV G- protein on gel electrophoresis relative to the annexin II, L-selectin or RSV G-protein in the absence of the compound.

The method may be a competitive binding method. This determines whether the candidate is able to inhibit the binding of RSV G-protein to annexin II or L-selectin. Such a method may comprise

(i) incubating the candidate substance with RSV G-protein and labelled annexin II, (ii) determining the amount of labelled annexin II that is bound to the RSV G- protein, and (iii) comparing the amount of bound labelled annexin II determined in step (ii) with the amount of annexin II that binds to the RSV G-protein in the absence of the candidate substance, wherein any reduction in the binding of the labelled annexin II in the presence of the candidate substance compared to the binding in the absence of the candidate substance shows that the candidate substance inhibits the binding of annexin II to RSV G-protein and may be suitable for use in preventing or treating RSV infection.

The amount of the labelled annexin II bound to the RSV G-protein may be measured directly or indirectly. A direct measurement may be carried out by removing assay mixture from the RSV a-protein fraction containing the unbound labelled annexin II and measuring the amount of label that is in the RSV G-protein fraction. Alternatively, the amount of labelled annexin II bound to the RSV G-protein could be determined indirectly by measuring the amount of label remaining in the assay solution after removal of the RSV G-protein fraction, which will be inversely related to the amount that has bound to the RSV G-protein.

In other embodiments, the competitive binding assay may comprise the use of labelled L-selectin in the place of labelled annexin II, or labelled RSV G-protein with unlabelled annexin II or L-selectin. The amount of the labelled component bound to the unlabelled component may be measured by the methods described above. Any reduction in the binding of the labelled component in the presence of the candidate substance compared to the binding in the absence of the candidate substance shows that the candidate substance inhibits the binding of the labelled component to the unlabelled component and may be suitable for use in preventing or treating RSV infection.

In a competitive binding assay system, the unlabelled annexin II, L-selectin or RSV G-protein may be immobilised on a solid support or may be in solution. The use of immobilised annexin II, L-selectin or RSV G-protein has the advantage that, after the binding reaction is complete, the bound annexin II/RSV G-protein or L-selectin/RSV G- protein complex(es) may be separated from the labelled annexin II, L-selectin or RSV G-protein that remains in solution by simply removing the solution away from the solid support. If, on the other hand, the product is not immobilised during the assay but rather is in solution, then it will generally be necessary to devise a means for separating the bound annexin II/RSV G-protein or L-selectin RSV G-protein complex from the uncomplexed labelled annexin II, L-selectin or RSV G-protein before measuring the amount of label. Such separation could be achieved, for example, by precipitating the complex using an antibody to the complex or by using a non-specific precipitation technique.

Suitable labels for use in the methods or assays described herein include radioisotopes, e.g. ¹²⁵1, ³⁵S, ³²P, enzymes, antibodies, polynucleotides and polypeptides such as biotin.

In a further embodiment, the competitive binding assay uses two unlabelled components, one of which is immobilised on a solid support, for example RSV G- protein may be immobilised on a solid support and annexin II may be in solution. After the binding reaction is complete, the bound annexin II/RSV G-protein complexes may be separated from the solution by removing the solution from the solid support. The amount of bound annexin II may then be measured using an antibody specific to annexin II.

The different types of assays mentioned above can be used to measure binding between any two substances mentioned herein. A product that antagonises the binding of RSV G-protein to annexin II or L- selectin is one which produces a measurable reduction in RSV G-protein binding with annexin II or L-selectin in the methods described above. Preferred products are those which reduce RSV G-protein binding with annexin or L-selectin by at least 10%, at least 20%, at least 30%, at least 40% at least 50%, at least 60%, at least 70%, at least 80%, at least 90%), at least 95% or at least 99%> at a concentration of the product of 1 μg ml^'1, lOμg ml^"1, lOOμg ml^'1, 500μg ml^"1, lmg ml^"1, lOmg ml^"1 or lOOmg ml^"1. The percentage inhibition represents the percentage decrease in binding in a comparison of assays in the presence and absence of the test substance. Any combination of the above mentioned degrees of percentage inhibition and concentration of inhibitor may be used to define an inhibitor of the invention, with greater inhibition at lower concentrations being preferred.

The invention also provides a method of identifying a product that causes a decrease in the cell surface levels of annexin II or L-selectin comprising providing a candidate substance to a cell or cell extract and determining whether the candidate substance causes a decrease in levels at the surface of the cell. The cell may be any cell which expresses annexin II or L-selectin such any such cell mentioned herein.

The product may inhibit the expression of annexin II or L-selectin. Thus the invention provides a method of identifying a product that inhibits expression of annexin II or L-selectin comprising providing a candidate substance to one or more components of the expression pathway of annexin II or L-selectin, or functional analogues of these components, and determining whether

(i) the candidate substance binds or inhibits component(s) that promote the expression of annexin II or L-selectin; or (ii) the candidate substance stimulates component(s) that inhibit the expression of annexin II or L-selectin.

The term 'component' includes the natural component or a functional analogue of the component.

Thus the product may be identified by providing a candidate substance to the component and determining whether the candidate substance binds the component. Any suitable binding assay format can be used, such as the formats discussed above. In another embodiment the product is identified by providing a candidate substance to the component under conditions that permit activity of the component, and determining whether the candidate substance inhibits or stimulates the activity of the component.

Typically the component of the cellular expression pathway used in the method is specific or substantially specific to the expression of annexin II or L-selectin.

Typically in the method one or more of the following components are used: an annexin II or L-selectin promoter, transcription factors that bind or affect expression from the annexin II or L-selectin promoter, an RNA polymerase that can express mRNA from the annexin II or L-selectin gene, nuclear factors that bind to annexin II or L-selectin mRNA and/or transport annexin II or L-selectin mRNA from the nucleus to the cytoplasm, translation factors that contribute to translating the annexin II or L-selectin mRNA to annexin II or L-selectin protein, or factors that bind and/or transport annexin II or L-selectin protein to the cell surface.

Functional analogues of any of the above components may be used in the method. The analogues will have some or all of the relevant activity of the natural component. Typically the analogues comprise fragments of the natural components. In the case of components which are polynucleotides or polypeptides the analogues generally have homology with the natural component.

The components may be provided from a cell. Thus the components may be inside a cell, typically a recombinant or natural cell in which the components are recombinantly or naturally expressed. The components may be provided in the form of a cell extract or may be purified, or partially purified, from a cell extract. Typically the components are in or from a human cell, for example one which expresses annexin II or L-selectin. The cell may be a mammalian cell, such as a primate or rodent cell, for example a mouse or rat cell. Cellular components of the annexin II or L-selectin expression pathway are known or can be readily obtained by the skilled person. They can, for example, be purified from cells based on their ability to bind annexin II or L-selectin or annexin II or L-selectin mRNA. Products which inhibit transcription of annexin II or L-selectin can be identified in a method comprising

(i) providing a test construct comprising a first polynucleotide sequence with annexin II or L-selectin promoter activity operably linked to a second polynucleotide sequence to be expressed in the form of mRNA; (ii) contacting a candidate substance with the test construct under conditions that would permit the second polynucleotide sequence to be expressed in the form of mRNA in the absence of the substance; and (iii) determining whether the substance inhibits expression from the construct. Products which inhibit transcription of annexin II or L-selectin mRNA may be also identified in a method comprising

(i) providing a test construct comprising a polynucleotide sequence with annexin II or L-selectin promoter activity operably linked to a coding sequence; (ii) contacting a candidate substance with the test construct under conditions that would permit the polypeptide encoded by the coding sequence to be expressed in the absence of the substance; and (iii) determining whether the substance inhibits expression from the construct. The polynucleotide with annexin II or L-selectin promoter activity may comprise:

(i) the sequence of a human or animal annexin II or L-selectin promoter; (ii) a sequence which has homology with (i); or (iii) a sequence which is a fragment of (i) or (ii). The sequence (i) is generally a mammalian annexin II or L-selectin promoter, such as a primate or a rodent, typically a mouse or rat, annexin II or L-selectin promoter. Generally (i) comprises at least from nucleotides -500 to -1, typically -300 to -1 of the annexin II or L-selectin gene (the numbers being relative to the transcription start site).

Typically the polynucleotide comprises the sequences present in (i) which bind transcription factors or the RNA polymerase, or instead of any of these sequences homologues of the sequences able to bind the same transcription factors and RNA polymerase. Typically such sequences or their homologues are present in the polynucleotide in the same order and/or substantially the same relative spacing as in (i). Generally this method is carried out in conditions which in the absence of the test compound lead to expression of the coding sequence from the nucleic acid. The nucleic acid may also comprise other untranscribed or untranslated regions of the annexin II or L-selectin gene. The coding sequence typically encodes a protein that is able to act as a reporter of expression. The assay may be carried out in a cell which harbours the nucleic acid. The substance may be tested with any other known promoter to test the possibility that the test substance is a general inhibitor of gene expression. Any reporter polypeptide may be used, for example luciferase, GUS or GFP. Luciferase is assayed by detecting chemiluminescence. GUS is assayed by measuring the hydrolysis of a suitable substrate, for example 5-bromo-4-chloro-3-indolyl-β-D- glucoronic acid (X-gluc) or 4-methylumbelliferyl-β-glucuronide (MUG). The hydrolysis of MUG yields a product which can be measured fluorometrically. GFP is quantified by measuring fluorescence at 590nm after excitation at 494nm. These methods are well known to those skilled in the art.

Alternatively the coding sequence may be the annexin II or L-selectin coding sequence itself, or a fragment of this sequence. The expression of the annexin II or L- selectin may be measured by for example, Northern RNA blotting, Western/antibody blotting, RNA in situ hybridization or immunolocalisation.

Products of the invention may be present in a substantially isolated form. It will be understood that the product may be mixed with carriers or diluents which will not interfere with the intended purpose of the product and still be regarded as substantially isolated. A product of the invention may also be in a substantially purified form, in which case it will generally comprise at least 90%, e.g. at least 95%, 98% or 99% of the polypeptide or dry mass of the preparation.

Suitable candidate substances which may be tested in the above methods include antibody products (for example, monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies and CDR-grafted antibodies) which are specific for RSV G-protein, annexin II or L-selectin. Furthermore, combinatorial libraries, defined chemical identities, peptide and peptide mimetics, oligonucleotides and natural product libraries, such as display libraries (e.g. phage display libraries) may also be tested. The candidate substances may be chemical compounds. Batches of the candidate substances may be used in an initial screen of, for example, ten substances per reaction, and the substances of batches which show inhibition tested individually.

A product according to the present invention may be an antibody which is capable of inhibiting the binding between RSV G-protein, annexin II or L-selectin. Antibodies to any of the substances discussed herein can be produced by use of the following methods. An antibody to the substance may be produced by raising antibody in a host animal against the whole substance or an antigenic epitope thereof (hereinafter "the immunogen"). Methods of producing monoclonal and polyclonal antibodies are well-known. The immunogen may comprise RSV G-protein, annexin II or L-selectin (including the derivatives of these proteins mentioned herein).

A method for producing a polyclonal antibody comprises immunising a suitable host animal, for example an experimental animal, with the immunogen and isolating immunoglobulins from the serum. The animal may therefore be inoculated with the immunogen, blood subsequently removed from the animal and the IgG fraction purified.

A method for producing a monoclonal antibody comprises immortalising cells which produce the desired antibody. Hybridoma cells may be produced by fusing spleen cells from an inoculated experimental animal with tumour cells (Kohler and Milstein, Nature 256, 495-497, 1975).

An immortalized cell producing the desired antibody may be selected by a conventional procedure. The hybridomas may be grown in culture or injected intraperitoneally for formation of ascites fluid or into the blood stream of an allogenic host or immunocompromised host. Human antibody may be prepared by in vitro immunisation of human lymphocytes, followed by transformation of the lymphocytes with Epstein-Barr virus.

For the production of both monoclonal and polyclonal antibodies, the experimental animal is suitably a goat, rabbit, rat or mouse. If desired, the immunogen may be administered as a conjugate in which the immunogen is coupled, for example via a side chain of one of the amino acid residues, to a suitable carrier. The carrier molecule is typically a physiologically acceptable carrier. The antibody obtained may be isolated and, if desired, purified.

Antibodies suitable for preventing or treating RSV infection may be identified using a method according to the present invention. A mimic (or derivative) of any of the polypeptides which are discussed herein

(e.g. annexin II or L-selectin) is typically a polypeptide with homology to the original polypeptide. Alternatively, a mimic can be a polypeptide which is not homologous, or can be a non-polypeptide substance. Typically a mimic of a substance binds a specific antibody which is able to bind the substance. Typically a mimic of annexin II has the ability to bind RSV G-protein and a mimic of RSV G-protein has the ability to bind annexin II. The mimic typically has a shape, size, flexibility or electronic configuration which is substantially similar to the original substance. It is typically a derivative of the original substance.

Typically a polypeptide which is homologous to another polypeptide is at least 70%) homologous to the polypeptide, preferably at least 80 or 90% and more preferably at least 95%), 97%o or 99% homologous thereto. Such homology may exist over a region of at least 15, preferably at least 30, for instance at least 40, 60 or 100 or more contiguous amino acids. Methods of measuring polypeptide homology are well known in the art. Such homology may be calculated in the basis of amino acid identity. The UWGCG Package provides the BESTFIT program which can be used to calculate homology (Devereux et al (1984) Nucleic Acids Research 12, p387-395), for example on its default setting.

The homologous polypeptide typically differs by substitution, insertion or deletion, for example from 1 to 5, 6 to 10, or 10 to 20 or more substitutions, deletions or insertions. The substitutions are preferably 'conservative'. These are defined according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

Products found to inhibit the binding between annexin II or L-selectin and RSV G-protein, to inhibit the expression or activity of annexin II or L-selectin or to decrease the levels of annexin II or L-selectin within a cell or at the cell surface in the screening procedures described above may be used to treat or prevent RSV infection. The condition of a patient suffering from RSV can therefore be improved by administration of such a product. A therapeutically effective amount of such a product may be given to a human patient in need thereof.

The formulation of a product for use in preventing or treating RSV infection will depend upon factors such as the nature of the substance identified. Typically the product is formulated for use with a pharmaceutically acceptable carrier or diluent. For example it may be formulated for topical, parenteral, inhaled, intranasal, intravenous, intramuscular, subcutaneous, transdermal or oral administration. Preferably the formulation is suitable for administration by aerosol or by using a nebuliser. A physician will be able to determine the required route of administration for each particular patient. The pharmaceutical carrier or diluent may be, for example, an isotonic solution. The dose of product may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. A suitable dose may however be from 0.1 to 100 mg/kg body weight such as 1 to 40 mg/kg body weight. Again, a physician will be able to determine the required route of administration and dosage for any particular patient.

As discussed above, products of the invention may be expressed from polynucleotides in vivo which may be in the form of a recombinant replicable vector. The polynucleotide generally comprises sequence that encodes the product operably linked to a control sequence capable of providing for the transcription of the polynucleotide. The control sequence may comprise a promoter. The term 'operably linked' refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.

The vector may be for example, a plasmid or virus vector, typically including an origin of replication. The vector may be one which is able to deliver the polynucleotide to a particular cell type, such as any of the cell types mentioned herein which can be infected by RSV.

Polynucleotides may be administered directly as a naked nucleic acid construct. Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents. Example of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam™ and transfectam™).

The following Examples illustrate the invention. The source of reagents is as follows:

The anti-L-selectin monoclonal antibodies used were TQ1 (subtype IgGl; Coulter Immunology, Coulter Corporation, Hialeah, FL 33010), LAM 1-3 and Dreg 56. Horseradish peroxidase (HRP)-conjugated swine-anti-rabbit IgG (Cat. No p217; Lot No 111) was from Dako-Immunoglobulin, Denmark. Mannan and fucoidan were obtained from Sigma, UK. The structure of 1 ,6-_ -?-[3-(3-carboxymefhylphenyl)-4-(2-α-D- mannopyranosyloxy)phenyl]hexane, disodium salt; is shown in Figure 2a. Mannan and fucoidan were obtained from Sigma, UK. Anti His antibody (clone His-1 ; Cat No. H 1029) and corresponding control antibody mouse IgG2a (Cat No. M9144) were both from Sigma (Dorset, U.K.). Anti human annexin II antibody (clone LC148; Cat No. 0590-5066 ) was from Cambridge Bioscience (Cambridge, U.K.), and its corresponding control antibody mouse IgGl from Coulter (Buckinghamshire, U.K. Cat. No. 6602872).

Example 1

Effect of complex carbohydrates on RSV infectivity We have used two different types of complex carbohydrates as potential soluble inhibitors of RSV infectivity: fucoidan which is a polymer of fucose sulphate and is highly negatively charged, and mannan which is a polymer of mannose and is a neutral carbohydrate.

Stocks of the human A2 strain of RSV were grown in monolayers of Hep2 cells (ECACC no 85020207), snap frozen in dry ice and methanol and stored at -70°C. Viral stocks were assayed for infectivity using the fluorescent focus assay as described below and titres expressed as focus forming units per ml (ffu/ml)

RSV was diluted in media (EMEM supplemented with 2% foetal calf serum, 2mM glutamine and antibiotics) to give approximately 1 X 10⁴ ffu/ml. Serial dilutions of the purified lectin (100 μl) or carbohydrate (lOOμl) were added to 0.4 ml of RSV suspension. As a positive control lOOμl of buffer alone was added to a 0.4 ml aliquot of virus. 50 μl of each sample was added to triplicate wells of confluent Hep2 cells in a flat bottomed 96 well plate. Three wells containing medium alone were incubated as a negative control. The plate was incubated at 37 °C for 90 minutes to allow virus to absorb to the cell surface then a further 150 μl of media was added to every well. The plate was incubated for 24 h at 37°C to allow for one full round of virus replication.

The cells were washed with PBS and fixed with 75 % cold acetone (v/v) in PBS. The Hep2 cells monolayers were stained for fluorescent foci by incubation for 30 minutes with 25μl of 1/100 dilution of mouse anti-RSV monoclonal antibody pool (Novacastra Ltd, Newcastle-upon-tyne, UK) in PBS containing 0.1 % (v/v) Tween 20 and 10% (v/v) FCS (PBS/T20). After washing in PBS/T20, wells were incubated with 25μl of a 1/20 dilution of fluorescein-conjugated goat anti-mouse immunoglobulin (Dako). The cells were washed and counter-stained for 10 minutes with 0.1%ι (w/v) naphthalene black in PBS. The numbers of fluorescing cells in each well were counted. The results shown in Figure 1 indicate that fucoidan is a good inhibitor of RSV infectivity. Mannan had no effect on RSV infectivity. These results indicate that the host cell lectin involved in the binding of RSV to Hep2 cells cells has characteristics similar to L-selectin.

To further establish that the RSV receptor on Hep2 cells cells is similar to L- selectin, the RSV infectivity experiment described above was repeated using either soluble L-selectin, soluble E-selectin or a low molecular weight pan-selectin antagonist (Figure 2a) as potential inhibitors of the interaction. The data shown in Figures 2b indicate that at the highest concentration tested (15μg/ml) soluble L-selectin inhibited RSV infectivity by 73%, whereas an even higher concentration of E-selectin (50μg/ml) was without effect. It is noteworthy that fucoidan, which was shown earlier (Figure 1) to block RSV infection, is potent inhibitor of L-selectin but has no effect on E-selectin. Furthermore, the low molecular weight selectin antagonist compound A had potent antiviral activity (IC₅₀ approx. 8μg/ml; 9μM), presumably by blocking the interaction of RSV with the host cells.

Example 2

Binding of L-selectin to RSV G-protein

To establish that L-selectin can directly interact with RSV G-protein, an assay was designed in which purified G-protein was immobilised on microtitre plates. Recombinant human selectin lacking the transmembrane and cytosolic domains but containing C-terminal chimeras with the ZZ-domain of protein A (referred to as 'selectin-ZZ') were expressed and purified by IgG-affinity chromatography by the method described by Malhotra et a , (1997). The ZZ domain binds tightly to human IgG. Microtitre plate wells (Maxisorb, NUNC, Denmark) were coated with immunoaffinity-purified G-protein (5μg/ml; lOOμl) or antibodies (lOOμg/ml; lOOμl) in 50mM-sodium bicarbonate buffer (pH 9.6) at ambient temperature for 16h (Malhotra et al., 1997). Non-specific binding sites were blocked with Tween 20 (l%o v/v) in lOmM Tris/HCl buffer (pH 7.4) for 2h at ambient temperature. L-Selectin-ZZ in the presence or absence of competitor was added to the coated wells in a lOmM Tris/HCl buffer (pH 7.4) containing 2mM CaCl₂ or 2mM EDTA, 0.1% (v/v) Tween 20 and HRP-conjugated IgG (1/500 dilution). The plates were incubated for 2h at ambient temperature. After extensive washing, the amount of bound selectin-ZZ-IgG complex was determined by adding the HRP substrate O-phenylenediamine dihydrochloride (Fast enzyme system; Sigma, cat. no. P-9187). The reaction was stopped after 5 minutes with 3M HC1, and the A490 was measured.

Figure 3 shows that L-selectin binds directly to RSV G-protein. The binding of L-selectin-ZZ to G-protein is Ca²⁺-dependent and is inhibited by fucoidan and an anti-L- selectin antibody, TQ1. These characteristics suggest that G-protein is binding to the carbohydrate-recognition domain (CRD) within L-selectin. On the basis of either direct binding or inhibition experiments, it has been shown that L-selectin is able to bind to sulphated forms of fucosylated, sialylated oligosaccharides, such as sulphated sialyl-Lewis x (sLe^x> NeuAcα2-3,Galβl-4(αl- 3Fuc)GlcNAc) in the presence of CaAions. L-Selectin has also been reported to bind to sulphated polysaccharides, such as heparan sulphate and dextran sulphate, as well as to sulphatides, cardiolipin, and lipopolysaccharide (LPS) (Rosen and Bertozzi (1996); Malhotra and Bird (1997)). To gain further information on the of the polysaccharide needed for the binding of L-selectin to RSV G-protein, we investigated the effect of pre- treatment of purified G-protein with sialidase or heparinase or mannosidase on the binding of L-selectin to immobilised ligands using the method described above. As shown in Figure 4, pre-treatment of G-protein with heparinase (Figure 4B), but not with sialidase or mannosidase (Figure 4A), reduced the binding of L-selectin to G-protein. The reduction in binding of L-selectin to G-protein by heparinase was dependent on the concentration of enzyme used in the preincubation buffer.

Factor H was used as a control for sialidase digestion, since it has been shown previously that sialidase treatment of factor H reduces its binding to L-selectin

(Malhotra et al., 1999). The results presented here indicate that the major interaction between L-selectin and G-protein is mediated by heparin-like structures expressed by G- protein.

Example 3

Effects of anti-L-selectin antibody on RSV infectivity of Hep2 cells Although L-selectin is constitutively expressed on the cell surface of leukocytes, it is not thought to be expressed on epithelial cells or cell lines such as the Hep2 cells cells. Our results indicate that the receptor on Hep2 cells is a lectin distinct to L-selectin but having similar carbohydrate binding properties. To examine whether any of the known anti-L-selectin antibodies could have an effect on RSV infectivity, several antibodies were tested in the RSV in vitro infectivity assay. Figure 5 shows that TQl was the only anti-L-selectin antibody with inhibitory activity, whereas other anti-L- selectin antibodies LAM 1 - 3 and Dreg 56 (results not shown), anti-P-selectin antibody or control antibodies did not show significant inhibition of RSV infectivity. Furthermore, immunostaining of the FIep2 cells with TQl antibody showed the expression of the TQl epitope in Hep2 cells. The expression of the TQl epitope was increased in RSV infected Hep2 cells.

Example 4 Purification of RSV binding molecules from Hep2 cells

Since both fucoidan and an L-selectin specific antibody, TQl, were shown to inhibit RSV infectivity, we used these reagents to isolate and characterise potential RSV binding species from Hep2 cells.

Microtitre plate wells were either coated with fucoidan (500μg/ml; 200μl/well) in lOOmM sodium bicarbonate buffer (pH 9.6), TQl, bovine serum albumin or a control antibody (isotype control). Non-specific binding sites were blocked with lOmM Tris/HCl (pH 7.4) containing 5mM CaCl₂ and 1% Tween 20. Hep2 cells (1X10⁷ cells) were suspended in a lysis buffer of 10ml of lOmM Tris-HCl (pH 7.4) containing 5mM CaCl₂, 1% NP40 and protease inhibitor cocktail (Sigma) for 4h at 4°C. The cell lysate was centrifuged and the supernatant was loaded onto microtitre plate wells coated with fucoidan at 200 μl per well. After extensive washing with lOmM Tris/HCl buffer (pH 7.4) containing 2mM CaCl₂, the material bound to fucoidan was eluted with lOmM Tris/HCl buffer containing lOmM EDTA (pH 7.4). The EDTA-eluted material was concentrated and dialysed against 1 OmM Tris/HCl containing 5 mM CaCl₂ to 1 ml final volume.

One half of the material was further concentrated to 50μl and loaded onto SDS- PAGE (8-16 %> Gel). Two major bands of weight 50kDa and lOOkDa were seen. The protein bands present in the fucoidian-binding fraction, but not present in the control fraction, were excised and further analysed by mass spectroscopy and nano-spray (see below). The remaining concentrated proteins were dialysed against lOmM Tris/HCl buffer (pH 7.4) containing 2mM CaCI₂ and re-incubated overnight with either an anti- annexin II antibody (lOOμg/ml; lOOμl) or anti-L-selectin antibody coated wells, TQl, (lOOμg/ml; lOOμl) or the isotype control antibody (lOOμg/ml; 200μl). The antibody bound material was eluted with SDS-PAGE sample buffer. The eluted proteins were analysed by SDS-PAGE and further characterised as described below. Protein bands of interest were excised from a Coomassie stained gel, reduced, alkylated and digested with trypsin according to the procedure published by Wilm et al (1996). The gel pieces were excised and shrunk by dehydration in acetonitrile. The acetonitrile was removed, and the gel pieces were dried in a vacuum centrifuge. The dried gel pieces were re-swollen in digestion buffer (lOμl) composed 50 niM ammonium bicarbonate (pH 8.5), 5 mM CaCl2, and 12.5 μg/ml trypsin (Boehringer

Mannheim, sequencing grade). Digestion was allowed to proceed overnight at 37°C. Following digestion with trypsin, the several peptides which were obtained were extracted using l OOmM ammonium bicarbonate (2 x 50μl) and acetonitile (2 x 50μl) followed by 5%> formic acid in 50% methanol (2 x 50μl). Each step involved vortexing for 10 min to promote efficient extraction. The samples were then centrifuged before removing the liquid into labelled tubes. The combined extracts from each sample were then dried using a centrifugal evaporator.

The dried extract from the protein digest was redissolved in 5% formic acid containing 5% methanol (10 μl). An aliquot (0.4 μl) was spotted onto a stainless steel target pre-coated with α-cyano-4-hydroxycinnamic acid and nitrocellulose. The target was allowed to air dry before being washed with 1%> aqueous trifluoroacetic acid (TFA)(2 μl). Excess wash solution was blown off and the target dried using compressed air. The MALDI mass spectrum was obtained using a TofSpec SE instrument (Micromass, Manchester, UK) fitted with a 337 nm nitrogen laser. The mass spectrum was calibrated using a matrix-related ion signal (mass/charge (m/z) 1060.10) and a trypsin autolysis peptide (m/z 2163.057). Monoisotopic masses were assigned for each peptide and these were used collectively as a "Peptide Mass Map" (Jensen et al., 1997) to search an in-house non-redundant protein sequence database. This database currently contains more than 200,000 entries and was searched using PeptideSearch™ software (Mann et al., 1993). No restriction was placed on the species of origin of the protein, on its isoelectric point, and a protein mass range from 0 to 300 kDa was allowed.

The remainder of the sample was desalted using a pulled-out glass capillary containing a small amount of POROS R2 resin (PerSeptive Biosystems). Peptides were then eluted directly into the nanospray needle using 1% formic acid in 50%> methanol (2 μl). A PE-Sciex API III IonsprayTM _mass spectrometer (PE-Sciex, Thornhill, ON, Canada) fitted with a nanoES source (Wilm and Mann., 1996) was used to acquire tandem MS/MS mass spectra for several peptides. In MS/MS mode the first quadrupole is used to select the precursor ion which is then passed into a collision cell where fragmentation is induced by collision with argon gas molecules. The energy of collision is typically between 30 - 60 eV depending on the mass and charge of the precursor ion. Ions formed by the cleavage of backbone bonds are designated a, b, c, if the charge is retained on the N-terminal fragment and x, y, z if the charge resides on the C-terminal fragment (nomenclature according to Mann et al., 1993). High mass product ions, (observed by scanning the third quadrupole above the m/z value for the doubly or triply charged precursor ion) are often part of a series of y" ions (Bonner and Shushan., 1995). A partial amino acid sequence can be determined from the pattern of y" ions. This, together with the masses bracketing the sequence forms a Peptide Sequence Tag (Mann and Wilm., 1995), which was used to confirm the identity of the peptide, and hence the protein. The DE-MALDI spectrum data from 16 peptides from 50 kDa protein and 10 peptides from 100 kDa protein showed 100%) match with annexin II and nucleolin respectively. From this analysis and further sequencing of the peptides using nanospray technique, it was confirmed that the protein with an apparent Mr of 50kDa is the human annexin II and lOOKDa protein is nucleolin.

Example 5 Expression of annexin II and the TQl epitope on Hep2 cells

Expression of annexin II on Hep2 cells was established using an anti-annexin II antibody, and cell surface expression was established by confocal analysis of the expression pattern. Slides of RSV infected Hep2 cells and control Hep2 cells were rinsed with phosphate buffered saline and fixed by incubating in 4%> paraformaldehyde for 15 minutes. The slides were washed with phosphate buffered saline and stored at 4°C until required.

The immunocytochemistry was performed by incubating the RSV-infected and control FIep2 cells slides with specific antibodies to annexin II, L-selectin (TQl) or with control antibody in phosphate buffered saline. After extensive wash, the slides were treated with FITC- or horse radish peroxidase (HRP)- conjugated secondary antibody. The HRP-conjugated slides were developed using specific substrate for the enzyme and counterstained and examined under light microscope. The fluorescent-labelled cells were mountanted with Vectashield-containing propidium iodide, and examined using fluorescence microscopy.

RSV infected cells had higher expression of annexin II than the non-infected cells. This expression pattern is similar to that observed with the anti-L-selectin antibody TQ 1. Isotype control antibody or other anti-L-selectin antibodies showed no staining of the Hep2 cells, indicating that TQl is recognising an epitope on FIep2 cells, which is distinct from that present in L-selectin. The confocal microscopy indicated that the expression of annexin II in the infected cells is predominantly associated with the cell surface.

Example 6 Cloning, expression and binding characteristics of annexin II

To further establish the binding characteristics of annexin II to RSV G-protein we initiated cloning and expression of annexin II by the method described by Flajjar et al (1996). Briefly, Image clones constituting full-length cDNA annexin II were obtained from Hinxton Hall (Cambridge, U.K.) and amplified by PCR using Pfu polymerase and 26-mer oligonucleotide forward and reverse primers. Primers were 5'- GGTCGGGATCCGTCTACTACTGTTCACGA-3 'and 5 ^'- AAAAACTCGAGGTCATCTCCACCACA -3' corresponding to bases 52-66 and 1052-1066 in the annexin II sequence respectively. A 5' Bam HI and a X Xho I restriction sites were introduced in the construct, while eliminating the mammalian initiation (ATG) and stop (TGA) codons. The modified insert was purified from agarose gel slices using a Qiagen kit (California, USA), and was ligated into pET21b(+) plasmid, which contains the His-Tag (Novagen, Wisconsin, USA). Restriction digestion and sequencing of the pET vector & insert showed that the annexin II sequence had been inserted correctly and had no sequence errors. The plasmid was used to transform BLR DE3 Escherichia coll The bacteria were propagated to 0.6 O.D.₆₀₀ in a 100 ml of Luria-Bertani medium containing 50 μg/ml carbenicilin. Protein expression was induced by adding 1 mM isopropyl-β-D-thiogalactopyranoside to the culture medium and incubating the cells for 3 h at 37°C. The cell suspension was centrifuged at 7500 rpm (SA-600 rotor. The pellet was resuspended in ice-cold 20 mM Tris-HCl pH 8.0 buffer containing 100 mM NaCl, 2 mM PMSF and 2 mM benzamidine (Sonication buffer). The cell suspension was sonicated with four bursts of 30 seconds . The supernatant was treated with DNase (5 μg/ml) and RNase (10 μg/ml) for 15 minutes at room temperature followed by centrifugation at 12,000g for 15 min. at 4°C. The supernatant was incubated at 20°C for 30 minutes on a rocking bed mixer, with 1 ml of Talon cobalt-based affinity resin (Clontech, Hampshire, U.K.), preequilibrated with sonication buffer. The resin was loaded to a 1 ml column and washed sequentially with sonication buffer followed by sonication buffer containing 10 mM imidazole until the effluent reached A₂₈o <0.01. The recombinant protein was eluted in sonication buffer containing 100 mM imidazole. The eluted protein was dialysed against PBS overnight and the purified protein was analysed on SDS-PAGE, 8-16% Tris-glycine (Novex). In another set of experiments the purified protein was separated on SDS-PAGE and blotted onto nitrocellulose filters. The blots were then treated with antibodies to annexin II, His-tag and relevant controls.

The expression of the construct was under the control of an IPTG-induced promoter and solubilisation of IPTG-induced bacteria (transformed with the annexin II construct) produced a band of the expected molecular weight (approx. 40 kDa). No corresponding band was seen in non-induced bacteria. Western blots, using antibodies to annexin II or to the His-tag, identified a band of the correct molecular weight in the induced bacteria only (data not shown). Annexin II was purified on a Talon cobalt affinity column. To demonstrate that the recombinant annexin II was functionally active, we characterised the binding of annexin II to a known ligand plasminogen. Microtitre plate wells (Maxisorb, NUNC, Denmark) were coated with G-protein, plasminogen or bovine serum albumin and non-specific binding sites blocked with Tween 20 as described in Example 2. Serial dilutions of annexin II-His were added to the coated wells in a lOmM Tris/HCl buffer (pH 7.4) containing 150mM CaCl_2. HRP-anti-His antibody (1 : 1000 dilution) containing 5mM Ca2+ -ion or 5mM EDTA. The plates were incubated for 2h at ambient temperature. After extensive washing, the amount of bound annexin II- HisTag-HRP complex was determined by adding the HRP substrate O- phenylenediamine dihydrochloride (Fast enzyme system; Sigma, cat. no. P-9187). The reaction was stopped after 5 minutes with 3M HC1, and the A490 was measured.

Figure 6 shows that annexin II bound to plasminogen and the binding was dependent on Ca²⁺ - ions. These results indicate that the recombinant annexin II is functionally active. Figure 6 also shows that annexin II binds to the RSV G-protein in a concentration- and Ca ⁺ -ion dependent manner. It was shown above that Hep2 cells express both the TQl epitope and an epitope for an annexin II antibody epitope and that the TQl antibody inhibits RSV infectivity of Hep2 cells. Therefore for annexin II to act as a receptor for RSV, it is necessary to show that TQl cross reacts with annexin II and inhibits binding of annexin II to its ligands. Recombinant annexin II was separated on SDS-PAGE and blotted onto nitrocellulose filters. The blots were treated with either an anti-annexin II antibody, TQl or an isotype control antibody. The bound primary antibodies were detected with HRP-conjugated anti-mouse IgG. The anti-annexin II antibody and TQl recognised an epitope on annexin II, whereas isotype control antibody did not react with the annexin II.

The results shown in Figure 7 establish that TQl inhibits the binding of annexin II to heparin (Figure 7a), plasminogen (Figure 7b) and RSV G-protein (Figure 7c). Finally, Figure 7d shows that the selectin antagonist compound A inhibits annexin II binding to plasminogen and heparin.

Example 7

Effects of soluble annexin II and selectins on RSV infectivity Serial dilutions of L-selectin-ZZ (lOOμl/well; final maximum concentration

15 μg/ml, final minimum concentration 0.015μg/ml) or E-selectin-ZZ (l OOμl/well; final maximum concentration 50μg/ml, final minimum concentration 0.05 μg/ml) or compound A (lOOμl/well; final maximum concentration 800μg/ml, final minimum concentration 0.08 μg/ml) or Annexin II-Histag (lOOμl/well; final maximum concentration 70μg/ml, final minimum concentration 7 μg/ml) were mixed with 0.4 ml of RSV stock (1 x 107 ffu/ml) and 50μl of each sample was added to the Hep2c cell monolayer. Viral infectivity was determined by fluorescent focus assay. L-selectin-ZZ, Annexin II-Histag and an inhibitor for L-selectin-carbohydrate interaction reduced the RSV infectivity, whereas E-selectin-ZZ had no effect the binding. Values are the means of two experiments, with each experiment done in triplicates.

Example 8 In vitro evaluation of compound A: Binding assay

Hep2c cells ECACC No. 85020207 (200μl/well; 5x10⁵ cells/ml) were added to the microtitre plate wells and the plate was incubated overnight at 37 °C. Serial dilutions of compound A (l,6- .w-[3-(3-carboxymethylphenyl)-4-(2-α-D- mannopyranosyloxy)phenyl]hexane, disodium salt; lOOμl/well; final maximum concentration 800 μg/ml, final minimum concentration 0.08 μg/ml) were mixed with 0.4 ml of RSV stock (1 x 10⁷ ffu ml) and 50μl of each sample was added to the Hep2c cells monolayer and viral infectivity was determined as described below. Viral stocks were assayed for infectivity using the fluorescent focus assay as described below and titres expressed as focus forming units per ml (ffu/ml)

Fluorescent focus assay RSV A2 was diluted in media ( Eagles Minimal Essential Medium (EMEM)) supplemented with 2%> foetal calf serum, 2mM glutamine and antibiotics) to give approximately 1 X 10⁴ ffu/ml. Serial dilutions of compound A (lOOμl) were added to 0.4 ml of RSV suspension. As a positive control lOOμl of buffer alone was added to a 0.4 ml aliquot of virus. 50 μl of each sample was added to triplicate wells of confluent Hep2c cells in a flat bottomed 96 well plate. Three wells containing medium alone were incubated as a negative control.

The plate was incubated at 37 °C for 90 minutes to allow virus to absorb to the cells surface then a further 150 μl of media was added to every well. The plate was incubated for 24 hours at 37°C to allow for one full round of virus replication. The cells were washed with PBS and fixed with 75 % cold acetone (v/v) in PBS. The Hep2c cells monolayers were stained for fluorescent foci by incubation for 30 minutes with 25μιl of 1/100 dilution of mouse anti-RSV monoclonal antibody pool in PBS containing 0.1 % (v/v) Tween 20 and 10% (v/v) FCS (PBS/T20) (foetal calf serum/phosphate buttered saline/Tween 20). After washing in PBS/T20 the wells were incubated with 25μl of a 1/20 dilution of fluorescein conjugated goat anti-mouse immunoglobulin. The cells were washed and counter-stained for 10 minutes with 0.1 % (w/v) napthalene black in PBS. The numbers of fluorescing cells in each well were counted.

Values are the means of triplicate experimental points. SD represents standard deviation.

Example 9

Effect on cytokine IL-8 release from virus infected A549 cells

A549 cells (an epithelial cell line) were seeded at approx. 5 x 10⁵ (in DMEM+FCS) in culture dishes and grown to confluence (approx. 3 days) in 24 well plates (1ml cell suspension / well). The culture medium was replaced with serum free medium (DMEM + 0.1%) BSA) twenty-four hours prior to start of the experiment. A suspension of RSV (to give M.O.I, value of 0.1) was added simultaneously with compound A (30μM-300μM) or vehicle. Cells were incubated at 37 °C for 1 hour, then washed twice with PBS. Finally PBS was replaced by DMEM + BSA containing an appropriate concentration of compound A or vehicle. At various time intervals after infection (0.48 and 72 hrs) culture medium was removed from the wells and centrifuged (400xg, 4mins, room temperature) to pellet out the A549 cells. The supernatant was frozen at -20°C until assaying for IL8 (R & D Elisa kit).

The results are shown in Figure 10 and are expressed relative to the biomass (total viable cells) present in each well. To determine the biomass of the adhered A549 cells, methylene blue (500μl per well) was added to the cells and incubated for 40mins at room temperature. Excess of methylene blue was removed by washing the cells twice with PBS. After drying, cells were solubilised and released methylene blue was measured using a spectrophotometer (OD 620nm). Methelene blue is a dye, which stains the viable cells. Therefore amount of dye per well gives an estimate value for the biomass or viable cells. Figure 10 shows that RSV-mediated release of IL-8 from A549 cells was time dependent and was inhibited strongly by compound A.

Example 10 In vivo evaluation of compound A

48 female Balb/c mice (average weight 20g) were divided into 6 groups of 8. Four hours prior to infection the groups of mice were given the following treatments;

All intranasal inoculations were administered under light ether anaesthesia. At time 0, all animals were infected with 1 x 10⁵ ffu of RSV (stock KV 11/4/97 diluted 1/5 in PBS and 50μl given intranasally). At +4 hours post-infection, therapy doses were repeated. Therapy doses were repeated twice daily for a further 3 days (8 doses per animal in total). Animals were sacrificed on day 4 days post-infection. Lungs were removed into media, weighed and then homogenized. Lung homogenates were centrifugated and supematants were assayed for virus using the fluorescence assay described previously.

The results shown in the table were calculated as the log₁₀ of virus yield (ffu of per gram lung tissue) and then expressed as a percentage of virus titre in the presence of compound A to that of the virus control (PBS treated group). Treatment group is highly significantly less than the control Treatment group is significantly less than the control

These results demonstrate that the intranasal administration of compound A to mice infected with RSV reduces viral titres by up to 96%> after 4 days. The compound has greater efficacy than ribavirin administered ip at 100 mg/Kg.

Discussion

The interaction between L-selectin and G-protein was not sialidase dependent, indicating that the carbohydrates involved in this interaction between RSV and L- selectin are structurally different from sialyl-Lewis x (sLe^x> NeuAcα2-3,Galβ 1 -4( l- 3Fuc)GlcNAc). On the other hand, L-selectin binding to G-protein was inhibited by the pre-treatment of G-protein with heparinases I and III. Therefore we conclude that heparin-like structures play a significant role in the interaction of RSV with its receptor on host cells. L-Selectin is constitutively expressed on the cell surface of leukocytes, therefore, L-selectin could act as a receptor for RSV on leukocytes, and one could speculate that such an interaction could have pro-inflammatory consequences.

For example, L-selectin is established as a signalling molecule involved in leukocyte activation. The cross-linking of cell surface L-selectin by anti-L-selectin antibodies or L-selectin ligands (such as sulphatides, fucoidan, GlyCAM 1) increases the expression of TNF-α and interleukin-8 mRNA and the activation of β2 integrins. Thus the binding of RSV to leukocyte L-selectin could induce activation and release of pro-inflammatory cytokine from leukocytes. In this case, an L-selectin inhibitor could block the interaction of RSV with leukocyte L-selectin and elicit an anti-inflammatory effect.

In the above experiment solid phase immobilised fucoidan was used as an affinity matrix to isolate potential RSV binding species from Hep2 cells. Two proteins of molecular weights 50 kDa and 100 KDa were found to bind fucoidan. These proteins were identified as annexin II and nucleolin. We have shown that Hep2 cells express annexin II and that the expression of annexin II is increased after RSV infection. Soluble annexin II was also shown to inhibit RSV infectivity of Hep2 cells, indicating that soluble annexin II can compete with the RSV binding site on the Hep2 cells. Furthermore, we have shown that the recombinant annexin II binds to RSV G-protein, heparin and plasminogen through a similar or closely associated site. It was shown that the anti-L-selectin antibody TQl surprisingly blocked RSV infection of Hep2 cells. The current work demonstrates that TQl cross-reacts with annexin II.

We have also shown that TQl inhibits the binding of both L-selectin and annexin II to RSV G-protein, which indicates that the TQl epitope is contained within the RSV binding site. The TQl epitope in L-selectin lies within the same region as that recognised by the LAM 1-3 antibody, namely between residues 92 and 156 in L-selectin. On the other hand the heparin- and plasminogen-binding site in annexin II is localised within the C-terminal region. Alignment of the sequence for the plasminogen binding region from annexin II and TQl epitope from L-selectin is shown in Figure 7. It is interesting to note that within these sequences there are certain regions with a high degree of homology and one of these regions could be the TQl epitope. Future work with specific deletion mutants should establish an epitope for TQl on both of these molecules. Further evidence that RSV bind to L-selectin and annexin II through a common site comes from the observation that a known L-selectin antagonist, not only inhibits RSV infectivity but also inhibits annexin II binding to its ligands, plasminogen and heparin.

References

1. Malhotra, R., Ward, M., Sim, R. B. and Bird, M. I (1999) Biochem. J.

341, 61-69. 2. Hajjar, K. A., Jacovina, A. T. and Chacko, J. (1994) J. Biol. Chem.

269, 21 191-21197.

3. Wilm, M., Shevchenko, A., Houthaeve, T., Breit, S., Schweigerer, L., Fotsis, T., and Mann, M (1996) Notwre 379, 466-469

4. Jenson, O.Ν., Podtelejnikov, AN. and Mann, M. (1997) Anal Chem. 69, 4741-4750.

5. Mam , M., Hojrup, P., and Roepstorff, P. (1993) Biol. Mass Spectrom. 22, 338-345

6. Wilm, M., and Mann M. (1996) Anal. Chem. 68, 1-87.

7. Bonner, R., and Shushan, B. (1995) Rapid Commun. Mass Spectrom. 9, 1067-1076

8. Mann, M., and Wilm, M. (1995) Trends Biochem. Sci. 20, 219-224

9. Malhotra, R, Taylor, Ν.R, and Bird, M.I. (1997) Biochem J 314, 297-303

Claims

CLAIM

1. Use of a product that (i) antagonises the binding of respiratory syncytial virus (RSV) G-protein to annexin II or to L-selectin, or (ii) causes a decrease in cell surface levels of annexin II or L-selectin, in the manufacture of a medicament for use in preventing or treating infection by RSV.

2. Use according to claim 1, wherein the product is a soluble form of annexin II or of L-selectin.

3. Use according to claim 2, wherein the soluble form of annexin II or L-selectin comprises at least the extracellular domain.

4. Use according to claim 1 , wherein the product is a compound of formula (II):

wherein X is selected from: -CN, -(CH₂)_nCO₂H, - (CH₂)_nCONHOH, -O(CH₂)_mCO₂H, -O(CH₂)_mCONHOH, -(CH₂)_nCONHNH₂, -(CH₂)_nCOZ, -(CH₂)_nZ. -CH(CO₂H)(CH₂)_mCO₂H, -(CH₂)_nO(CH₂)_mCO₂H, -CONH(CH₂)_mCO₂H, -CH(OZ)(CO₂H), -CH(Z)(CO₂H), -(CH₂)_nSO₃H, -(CH₂)_nPO₃D,D₂, -NH(CH₂)_mCO₂H, -CONH(CHR₃)CO₂H, (l-H-tetrazolyl-5-alkyl-), and -OH; for divalent structures, Y is -(CH₂)_r, -CO(CH₂)_fCO-, -(CH₂)_fO(CH₂)_r, -CO(CH₂)_fO(CH₂)_fCO-, -(CH₂)_gS(O)_b(CH₂)_fS(O)_b(CH₂)_g-,

-CO(CH₂)_BS(O)_b(CH₂)_fS(O)_b(CH₂)_gCO-, -( CH₂)_fV(CH₂)_r,

-(CH₂)_fCOVCO(CH₂)_r, CO(CH₂)₁COVCO(CH₂)_fCO-,

-CO(CH₂)N(CH₂)_fCO-, -CONH(CH₂)_fNHCO-, CO(CH₂)_fW(CH₂)_fCO-, -(CH₂)_fWSW(CH₂)_r>

-(CH₂)_fCONH(CH₂)_fNHCO(CH₂)_r, -(CH₂)₍COW(CH₂)_fWCO(CH₂)_r, or

- CH₂(CH₂)_fW(CH₂)₍CH₂- where V is -N[(CH₂)_q]₂N- and q is independently 2 to 4, and

W is aryl or heteroaryl; for trivalent structures, Y is:

and T is selected from -(CH₂)_r,

-CO(CH₂)_Γ, -(CH₂)_gS(O)_b(CH₂)r. and -CO(CH₂)_gS(O)_b(CH₂)_r, where the carbonyl group is positioned continguous to the biphenyl unit;

R, and R₂ are independently selected from hydrogen, alkyl, halogen, -OZ, -NO₂, -(CH₂)_nCO₂H, -NH₂ and -NHZ;

R₃ is selected from the group consisting of hydrogen, alkyl, aralkyl, hydroxyalkyl, aminoalkyl, alkyl carboxylic acid and alkyl carboxamide; f is 1 to 16, g is 0 to 6, n is 0 to 6, m is 1 to 6, p is 0 to 6, b is 0 to 2, Z is alkyl, aryl, or aralkyl, and D, and D₂ are independently hydrogen or alkyl; or a pharmaceutically acceptable salt, ester, amide or prodrug thereof.

5. Use according to claim 4, wherein the compound of formula (II) is a compound of formula (III):

wherein X is -COOH, -(CH₂)_nCOOH or -O(CH₂)_nCOOH and Y is -(CH₂)_n-,

-(CH₂)_nW(CH₂)_n-, -(CH₂)_nWOW(CH₂)_n-,-(CH₂)_nS(CH₂)_nS(CH₂)_n-, -CO(CH₂)_nCO- or

-(CH₂)_nCOW(CH₂)_nWCO(CH₂)_n- wherein W is aryl or heteroaryl and n is 0 to 6.

6. Use according to claim 5 wherein Y is -(CH₂)_f or

-CH₂(CH₂)_fW(CH₂)_fCH₂-.

7. Use according to claim 5 or 6 wherein X is 3 -CH₂CO₂H and Y is -(CH₂)_f or -CH₂(CH₂)_fW(CH₂)_fCH₂

8. Use according to claim 1, wherein the product is selected from: l,7-6w-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]heptane, l,6-- /_>-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]hexane, 1 ,5-άw-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]pentane, l,4-Z7W-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]butane,

N,N'-_ /5^,-[4-(3-(3-carboxymethylphenyl)-4-(α-D-mannopyranosyloxy)phenyl])butan-l- yl]-4,4'-trimethylenedipiperidine,

S,S'-_7»'-[3-(3-carboxymethylphenyl)-4-(2- -D-mannopyranosyloxy)-3-phenylprop-l- yl]-l,3-dithiopropane, l,7-/7.5'-[3-(3-carboxymethylphenyl)-4-(2- -D-mannopyranosyloxy)phenyl]-l,7- .z_9- oxoheptane, l,6-/7w-[3-(3-carboxymethylphenyl)-4-(2- -D-mannopyranosyloxy)phenyl]-l,6- .w- oxohexane, l,5-/3/_>-[3-(3-carboxymethylphenyl)-4-(2-a-D-mannopyranosyloxy)phenyl]-l,5-6/5'- oxopentane, l,4--7/-9-[3-(3-carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]-l,4-ό/_?- oxobutane, l ,3,5-t -[3-(3-carboxymethylphenyl)-4-(2-α-D- mannopyranosyloxy)phenylmethyl]benzene, and

1,3,5 -tris- [4- [3 -(3 -carboxymethy lphenyl)-4-(α-D-mannopyranosy loxy)pheny 1] -4-oxo-2- thiobutyljbenzene; and pharmaceutically acceptable salts, esters, amides and prodrugs thereof.

9. Use according to claim 1, wherein the product is l,6-to-[3-(3- carboxymethylphenyl)-4-(2-α-D-mannopyranosyloxy)phenyl]hexane or a pharmaceutically acceptable salt, ester, amide and a prodrug thereof.

10. A method of identifying a product which can prevent or treat RSV infection, which method comprises:

(a) contacting a candidate substance with annexin II or a derivative thereof or with L-selectin or a derivative thereof, and determining whether the substance binds thereto; or

(b) providing a candidate substance to annexin II or a derivative thereof, and RSV G-protein or a derivative thereof, under conditions in which in the absence of the candidate substance the said annexin II or derivative thereof would bind to the said RSV G-protein or derivative thereof, and determining whether the candidate substance antagonises the binding between the said annexin II or derivative thereof and the said RSV G- protein or derivative thereof; or

11. A method according to claim 10, in which (a), (b) or (c) are carried out in a cell-free system.

12. A method according to claim 10, in which the said annexin II or derivative thereof or the said L-selectin or derivative thereof is provided recombinantly expressed on the surface of a cell.

13. A method according to any one of claims 10 to 12, in which binding is measured using a competitive binding system.

14. A method of identifying a product which can prevent or treat RSV infection, which method comprises testing whether a candidate substance is capable of causing a decrease in the cell surface levels of annexin II or a derivative thereof or of L-selectin or a derivative thereof, therby determining whether the candidate substance can prevent or treat RSV infection.

15. A method according to any one of the claims 10 to 14 which further comprises synthesising the substance which has been identified as being a product which can prevent or treat RSV infection.

16. A substance identified by the method of any one of claims 10 to 14 or synthesised by the method of claim 15.

17. Use of a substance as claimed in claim 16 in the manufacture of a medicament for preventing or treating infection by RSV.

18. A method of preventing or treating RSV infection in a subject, comprising administering to the subject a product as defined in any one of claims 1 to 9 or a substance as claimed in claim 16.

19. A method of preventing or treating RSV infection in a subject, comprising carrying out the method of any one of claims 10 to 14 and administering to the subject the substance thus identified.