WO2009030087A1

WO2009030087A1 - Functions and uses of phosphatidylethanolamine binding protein 4

Info

Publication number: WO2009030087A1
Application number: PCT/CN2007/070627
Authority: WO
Inventors: Xiaojian Wang; Nan Li; Xuetao Cao
Original assignee: Zhejiang University
Priority date: 2007-09-05
Filing date: 2007-09-05
Publication date: 2009-03-12

Abstract

The present invention provides uses of phosphatidylethanolamine binding protein 4 (PEBP4) or its coding sequence for manufacturing the compositions which inhibit cell apoptosis. The polypeptide of the present invention is a new molecule that binds to phosphatidylethanolamine, plays a role in signal transduction, and possesses the function of resisting cell apoptosis.

Description

Function and use of novel human phosphatidylethanolamine binding protein PEBP4

The present invention is in the field of biotechnology and medicine, and in particular, the present invention relates to the use of phosphat idylethanolamine b inding prote in 4 (PEBP4) or its coding sequence [| in inhibiting apoptosis. Background technique

PEBP family proteins are a class of soluble cytosolic proteins that specifically bind to phospholipids such as phosphatidylethanolamine (PE), and all members of this family contain conserved regions that bind to PE. The PEBP family has a wide range of sources and is highly conservative in evolution. From flowering plants such as tirrhinum and A bidopsis thai i ana, parasites such as Plasmodium falciparium, nematode worms such as Onchocerca volvulus and Toxocara can is Yeast such as Saccharomyces cere visiae, insects such as insects (/3⁄4 5·(3⁄4α ? ·3)

The presence of PEBP protein was discovered until merkey animals such as cattle, monkeys, chickens, sheep, mice, rats and humans. The PEBP protein has a wide range of distribution, but is highly expressed mainly in the highly growing regions of the cells (testis, developing brain, inflorescence dividing tissues of flowering plants). Only mPEBP2 and mPEBP3 are only expressed in adult testicular tissue.

The functions of PEBP family proteins are diverse. The PEBP protein in flowering plants is mainly involved in morphogenesis and individual occurrence (flowering signal and dividing tissue growth). For example, three plant proteins such as CEN, TFL1 and SP are related to flowering of snapdragon, rat ear grass and tomato, CEN and TFL-1. Mutations can induce normal, undefined flowering to determine flowering, while SP in tomato is involved in regulating the regeneration cycle of plant dividing tissues. Drosophila 0PB is capable of binding odor molecules and is an effector molecule that binds to odorants; Agl6 of P. sinensis is a major antigen in the serum of patients infected with P. sinensis, Agl6 and TcSL-2 of Plasmodium, Plasmodium PfPEBP may be part of the cell surface secreted protein, involved in protecting worms from host immune responses; yeast TFS 1 is able to inhibit CDC25 mutants; bovine brain PEBP binds to multiple nucleotides involved in signal transduction pathways, The presence of small G proteins, combined with GTP and GDP.

Human PEBP activates a heterotrimeric G-protein-dependent signal transduction pathway by promoting GDP/GTP exchange, and G-protein coupled receptors such as human μ opioid receptors, human somatostatin receptor-mediated signal transduction The guides all involve humans. PEBP 1 in human and rat, mouse is a precursor protein of hippocampal cholinergic neurostimulating peptide (HCNP). This peptide can stimulate acetylcholine synthesis and cholinergic activity in rat neurons after release from the apical end of PEBP 1. . In fibroblasts, PEBP1 (also known as the raf kinase inhibitor protein RKIP) is able to inhibit raf kinase activity and mitogen-activated protein (MAP) kinase signaling by inactivating raf-1 and ME1. mPEBP2 can bind to B-Raf and MEK, and the expression pattern is similar. It is reported that spermatogenesis and post-testicular sperm maturation can occur during MAPK pathway activation. mPEBP2 may therefore regulate MAPK pathway by specific regulation. The fine process plays a regulatory role. PEBP has recently been found to be a new class of serine protease inhibitors that inhibit serine protease activity in neural tissues. Due to its specific binding to phospholipids (especially PE), binding to G protein, and its distribution in highly cell-grown regions, PEBP family proteins are likely involved in membrane structure modification during cell growth, in membrane biosynthesis, Membrane fluidity and functional domain play an important role in the formation of membrane-separating antigens; or as messenger molecules between cell membranes and cytoplasm involved in signal transduction.

Because of the important regulatory role of PEBP family proteins in the signal pathway and cell membrane state changes during cell growth, it has important theoretical exploration significance and broad clinical application prospects. It is currently immunology, cell and molecular biology and oncology. Hot topics in other fields. Summary of the invention

It is an object of the present invention to provide a human phosphatidylethanolamine binding protein, PEBP4 protein or a coding sequence thereof, for use in inhibiting apoptosis.

In a first aspect of the invention, there is provided a use of a human phosphatidylethanolamine binding polypeptide, PEBP4, or a coding sequence thereof, for use in the preparation of a composition for inhibiting apoptosis.

In one embodiment of the invention, the PEBP4 polypeptide is selected from the group consisting of

(a) a polypeptide of the amino acid sequence of SEQ ID NO: 2;

(b) a polypeptide derived from (a) having the amino acid sequence of SEQ ID NO: 2 formed by substitution, deletion or addition of one or more amino acid residues, and having a function of inhibiting apoptosis;

( _C ) a fusion protein of a PEBP4 polypeptide, which has a function of inhibiting apoptosis.

In another embodiment of the invention, the coding sequence is selected from the group consisting of:

(i) the nucleotide sequence shown at positions 66-746 of SEQ ID NO: 1;

(11) The nucleotide sequence shown by the 1-874 position in SEQ ID NO: 1.

In another embodiment of the invention, the composition is a pharmaceutical composition.

In another embodiment of the invention, the composition is for use in treating or ameliorating a disease or condition associated with apoptosis. The disease or condition includes: stroke, myocardial infarction, Alzheimer's disease, Parkinson's disease, AIDS, retinal degenerative disease, hematopoietic system disease, anti-drug, or aging.

In another embodiment of the invention, the composition comprises a pharmaceutically acceptable carrier, diluent or excipient, and from 0.001 to 99.99% by weight of a human PEBP4 polypeptide or a coding sequence thereof, to the composition The total weight is based on the basis.

In another embodiment of the invention, the cell is selected from the group consisting of MCF-7 cells and L929 cells. In another embodiment of the invention, the apoptosis is caused by an inducer of apoptosis.

In a preferred embodiment, the inducer of apoptosis is TNFα.

In another embodiment of the invention, it is also used to prepare a kit or reagent for detecting breast cancer. In a second aspect of the invention, there is provided an in vitro screening of a human phosphatidylethanolamine binding polypeptide, ie, ΡΕΒΡ4 A method of an agonist or inhibitor, the method comprising:

(a) providing a test group and a control group, wherein the control group is a cell culture system expressing a PEBP4 polypeptide or a cell culture system supplemented with a PEBP4 polypeptide, and the test group is a PEBP4 polypeptide to which a test substance is added. a cell culture system, or a cell culture system to which a test substance and a PEBP4 polypeptide are added;

(b) contacting the inducer of apoptosis with the cell culture system;

(c) determining the apoptotic rate of the cells in the test group and comparing with the apoptosis rate of the cells of the control group;

Wherein, the apoptosis rate of the cells in the test group is increased compared with the control group, indicating that the test substance is an inhibitor of the potential PEBP4 polypeptide;

Among them, the apoptosis rate of the cells in the test group was decreased as compared with the control group, indicating that the test substance was an agonist of the latent PEBP4 polypeptide.

In a preferred embodiment, the inducer of apoptosis is TNF a .

In another preferred embodiment, the cell culture system is a culture system of MCF-7 cells or L929 cells. In another embodiment of the present invention, when the method is used to screen for an inhibitor of PEBP4, in step (b), the apoptosis rate of the cells in the test group and the apoptosis of the positive control group are further included. The ratio was compared, and the positive control group was a cell culture system to which an anti-PEBP4 antibody, an antisense nucleotide, or an interfering RNA was added.

In a preferred embodiment, the inhibitor of PEBP4 screened according to the method of the present invention is used for the preparation of a medicament for treating cancer, preferably breast cancer. In other aspects of the invention, there is also provided the use of a human phosphatidylethanolamine binding polypeptide or a coding sequence thereof for the preparation of a kit or reagent for detecting breast cancer.

In another preferred embodiment, the reagent is an antibody, a primer, or a probe.

The present invention also provides the use of an antibody against human phosphatidylethanolamine-binding polypeptide, PEBP4, for the preparation of a breast cancer diagnostic kit.

The invention also provides a kit for diagnosing breast cancer, the kit comprising:

(a) a container and an antibody against PELP4 which is an anti-human phosphatidylethanolamine-binding polypeptide located in the container or a nucleotide sequence which specifically binds to the coding sequence of PEBP4, or a detection plate carrying the antibody or nucleotide sequence; b) Instruction manual.

The invention also provides the use of a human phosphatidylethanolamine binding polypeptide, PEBP4, or a coding sequence thereof, for use as a marker for breast cancer. In one embodiment, the PEBP4 polypeptide is highly expressed in breast cancer tissue but not in normal breast tissue.

The invention also provides the use of a human phosphatidylethanolamine binding polypeptide, an inhibitor of PEBP4, for use in the preparation of a pharmaceutical composition for the treatment of breast cancer. In a preferred embodiment, the inhibitor of PEBP4 is selected from the group consisting of: an anti-PEBP4 antibody, an antisense nucleotide, or an interfering RNA. Other aspects of the invention will be apparent to those skilled in the art from this disclosure. DRAWINGS

The following drawings are used to illustrate the specific embodiments of the invention and are not intended to limit the scope of the invention as defined by the appended claims.

Figure 1 shows the analysis of specific binding of purified anti-PEBP4 protein antibody to PEBP4.

Figure 2 shows the tissue distribution of the human PEBP4 protein immunohistochemistry shown in the present invention. The results suggest that PEBP4 protein is selectively highly expressed in breast cancer tissues. Figures 2a and 2b show human breast cancer tissues; Figures 2c and 2d show normal human breast tissue.

Figure 3 shows the Western blot analysis of the expression of PEBP4 protein in L929 cells transfected with eukaryotic recombinant expression vector of human PEBP4.

Figure 4 shows the analysis of RNA interference in human PEBP4 protein expression in MCF-7 breast cancer cells. 4A is a Western blot analysis; and FIG. 4B is an RT-PCR analysis.

Figure 5 shows the effect of human PEBP4 protein overexpression on TNF a-induced apoptosis in L929 cells. The results suggest that overexpression of PEBP4 protein inhibits TNF a-induced apoptosis in L929 cells.

Figure 6 shows the effect of down-regulation of human PEBP4 protein on TNF-induced apoptosis in MCF-7 breast cancer cells. The results suggest that down-regulation of PEBP4 protein can promote TNF a-induced MCF-7 cell apoptosis, making MCF-7 cells more sensitive to TNF a-induced apoptosis. detailed description

The present inventors conducted extensive and in-depth research on the effect of human phosphatidylethanolamine-binding protein 4 SP PEBP4 protein obtained from a gene library of a human dendritic cell cDNA library on apoptosis, and confirmed from various aspects through various experiments. The PEBP4 polypeptide has a function of inhibiting apoptosis and can be used for preparing a composition for inhibiting apoptosis, thereby completing the present invention.

Specifically, the association between PEBP family proteins and apoptosis and its role in apoptosis have not been reported so far. The present inventors have unexpectedly found that the polypeptide has an inhibitory effect on apoptosis by studying the effect of PEBP4 on apoptosis. Thus, a new use of the PEBP4 polypeptide or its coding sequence, i.e., a composition for inhibiting apoptosis, has been discovered.

Although the present invention is not limited by any theory, it is presumed that the PE and phosphatidylserine present in the inner side of the membrane are eversion due to the disappearance of membrane phospholipid asymmetry due to the early stage of apoptosis: Sexual binding to PE may prevent PE valgus, inhibit the loss of membrane phospholipid asymmetry, and thus inhibit membrane morphology changes such as cell membrane disruption and disintegration caused by apoptosis, which may delay the progression of apoptosis.

Furthermore, the inventors have unexpectedly discovered that PEBP4 protein is selectively highly expressed in breast cancer tissues. It is not expressed in normal breast tissue, suggesting that PEBP4 can be used as a tumor marker for breast cancer. The inventors also found through experiments that L929 cells overexpressing PEBP4 protein significantly resisted TNFα-induced apoptosis. In MCF-7 breast cancer cells with high expression of human ΡΕΒΡ4 protein, downregulation of ΡΕΒΡ4 expression promoted TNFα-induced apoptosis. The high expression of ΡΕΒΡ4 in breast cancer tissues and the down-regulation of ΡΕΒΡ4 expression enhanced the sensitivity of breast cancer cells to TNF-induced apoptosis, suggesting that PEBP4 is likely to be a target for the treatment of breast cancer.

Thus, the PEBP4 polypeptide or its coding sequence can be used as a tumor marker or drug target for breast cancer to diagnose and treat breast cancer by means of immunology, biochemistry or molecular biology. Thus, in another aspect, the invention also provides the use of a PEBP4 protein or a coding sequence thereof for the diagnosis and treatment of breast cancer.

Therefore, human PEBP4 protein or its related inhibitors and agonists can provide new immunodiagnostic and targeted therapeutic approaches for the treatment of diseases such as tumors, inflammation, nervous system and cardiovascular diseases, and thus have great application prospects.

The PEBP4 protein of the present invention is selectively highly expressed in breast cancer tissues. From the above results, it can be speculated that PEBP4 may play an important role in the development of the brain, which may regulate a variety of physiological and pathological activities, and may play an important role in anti-infective, anti-inflammatory, anti-tumor, nerve growth repair, immune function regulation, etc. The field of immunodiagnosis and immunotherapy has important development and application value. Studies have shown that PEBP family proteins are associated with a variety of life activities. Therefore, it is important to study and develop a new human phosphatidylethanolamine binding protein PEBP4 for diagnostic and therapeutic purposes.

PEBP4 protein or peptide

In the present invention, the terms "PEBP4 protein", "PEBP4 polypeptide" or "human phosphatidylethanolamine binding protein 4" are used interchangeably and refer to a protein or polypeptide having the PEBP4 amino acid sequence (SEQ ID NO: 2), which is conservative. A variant polypeptide, an active fragment thereof, or an active derivative thereof.

Preferably, the "PEBP4 polypeptide" is selected from the group consisting of:

(a) a polypeptide of the amino acid sequence of SEQ ID NO: 2;

(b) A polypeptide derived from (a) which is formed by substitution, deletion or addition of the amino acid sequence of SEQ ID NO: 2 with one or more amino acid residues and which has an apoptosis inhibiting function.

As can be seen from the above definition, the term "PEBP4 protein" encompasses a variant form of the sequence of SEQ ID NO: 2 which has the same function as the human PEBP4 protein. These variants include, but are not limited to, a number (usually 1-50, preferably 1-30, more preferably 1-20, optimally 1-10) amino acid deletions, insertions And/or substitution, and addition of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and/or N-terminus. For example, in the art, when substituted with amino acids of similar or similar properties, usually Does not change the function of the protein. As another example, the addition of one or more amino acids at the C-terminus and/or N-terminus will generally not alter the function of the protein. The term also encompasses active fragments and active derivatives of the human PEBP4 protein.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridize to human PEBP4 DNA under high or low stringency conditions And a polypeptide or protein obtained using an antiserum against an anti-human PEBP4 polypeptide. The invention also provides other polypeptides, such as fusion proteins comprising a human PEBP4 polypeptide or a fragment thereof. In addition to the nearly full length polypeptide, the present invention also encompasses soluble fragments of the human PEBP4 polypeptide. Typically, the fragment has at least about 10 contiguous amino acids of the human PEBP4 polypeptide sequence, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, optimally at least about 100 consecutive amino acids.

As used herein, the terms "fragment" and "derivative" refer to a polypeptide that substantially retains the same biological function or activity of the native human PEBP4 protein of the invention. The polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues It may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a mature polypeptide and another compound (such as a compound that extends the half-life of the polypeptide, for example a polypeptide formed by fusion of a polyethylene glycol) or (iv) an additional amino acid sequence fused to the polypeptide sequence (eg, a leader or secretion sequence or a sequence or proprotein sequence used to purify the polypeptide, or A fusion protein for the formation of an antigenic IgG fragment). These fragments, derivatives and analogs are within the purview of those skilled in the art in light of the teachings herein.

As used herein, "isolated" means that the substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). For example, the polynucleotides and polypeptides in the natural state in living cells are not isolated and purified, but the same polynucleotide or polypeptide is separated and purified, such as from other substances existing in the natural state. of.

As used herein, "isolated PEBP4 protein or polypeptide" means that the PEBP4 polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. Those skilled in the art will be able to purify the PEBP4 protein using standard protein purification techniques. A substantially pure polypeptide produces a single major band on a non-reducing polyacrylamide gel.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product, either a chemically synthesized product, or produced by recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect, and mammalian cells). The polypeptide of the invention may be glycosylated, or may be non-glycosylated, depending on the host used in the recombinant production protocol. Polypeptides of the invention may also or may not include an initial methionine residue.

The polypeptides of the invention can also be used in conjunction with proteins of molecular weights such as BSA to form polypeptide conjugates. Typically, the conjugate consists of a polypeptide, a crosslinker, and BSA, wherein the crosslinker is preferably glutaraldehyde, EDAC. Polynucleotide encoding a PEBP4 protein or polypeptide The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. For human PEBP4, the coding region sequence encoding the mature polypeptide may be identical to the coding region sequence shown in SEQ ID NO: 1, or may be a degenerate variant. As used herein, a "degenerate variant" in the present invention refers to a nucleic acid sequence which encodes a protein having SEQ ID NO: 2 but differs from the coding region sequence set forth in SEQ ID NO: 1.

The term "polynucleotide encoding a PEBP4 protein or polypeptide" and "PEBP4 polypeptide coding sequence" are used interchangeably and may include a polynucleotide encoding PEBP4 or a polynucleoside further comprising additional coding and/or non-coding sequences. acid. In one embodiment, the polynucleotide is isolated from a human dendritic cell cDNA library, the sequence of which is set forth in SEQ ID NO: 1, which comprises a polynucleotide sequence of 874 bases in length. The open reading frame is located at positions 65-749 and encodes a human PEBP4 protein (SEQ ID NO: 2) of 227 amino acids in length.

The present invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of polypeptides or polypeptides having the same amino acid sequence as the present invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide encoded thereby. .

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity. The human PEBP4 full-length sequence of the present invention or a fragment thereof can be usually obtained by a PCR amplification method, a recombinant method or a synthetic method. For PCR amplification, primers can be designed in accordance with the disclosed nucleotide sequences, particularly open reading frame sequences, and can be prepared using commercially available cDNA libraries or conventional methods known to those skilled in the art. The library is used as a template to amplify the relevant sequences. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then the amplified fragments are spliced together in the correct order.

Once the relevant sequences have been obtained, the recombination method can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it to a cell, and then isolating the relevant sequence from the proliferated host cell by conventional methods. In addition, synthetic sequences can be used to synthesize related sequences, especially when the fragment length is short. Usually, a long sequence of fragments can be obtained by first synthesizing a plurality of small fragments and then connecting them.

At present, it has been possible to obtain a DNA sequence encoding the protein of the present invention (or a fragment thereof, or a derivative thereof) completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (e.g., vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

The invention also relates to vectors comprising the polynucleotides of the invention, and host cells genetically engineered using the vector of the invention or the PEBP4 protein coding sequence, and methods of producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the present invention can be used to express or produce recombinant PEBP4 polypeptides by conventional recombinant DNA techniques. Generally there are the following steps:

(1) using the polynucleotide (or variant;) encoding the PEBP4 polypeptide of the present invention, or using the polynucleotide Recombinant expression vector transforms or transduces a suitable host cell;

(2) a host cell cultured in a suitable medium;

(3) Separating and purifying proteins from the culture medium or cells.

An agonist or inhibitor of PEBP4 polypeptide

The invention also relates to agonists or inhibitors of PEBP4 polypeptides.

As used herein, an inhibitor of a PEBP4 polypeptide refers to a substance that is capable of combating, inhibiting or reducing the activity or expression of a PEBP4 polypeptide. Common inhibitors include antibodies, antisense nucleotides, interfering RNA (RNAi), certain natural extracts or compounds.

As used herein, an agonist of a PEBP4 polypeptide refers to a substance that is capable of increasing, or promoting, the activity or expression of a PEBP4 polypeptide. Common promoters include PEBP4 fusion proteins, certain natural extracts or compounds, and the like.

In the present invention, an agonist or inhibitor of the PEBP4 polypeptide can be screened by an in vitro screening method. In one embodiment, the method includes:

(b) contacting the inducer of apoptosis with the cell culture system;

Wherein, the apoptosis rate of the cells in the test group is increased compared with the control group, indicating that the test substance is an inhibitor of a potential PEBP4 polypeptide; wherein, in the test group, the apoptosis of the cells is compared with the control group. A decrease in the rate indicates that the test substance is an agonist of the potential PEBP4 polypeptide. . Pharmaceutical composition

The invention also provides a pharmaceutical composition comprising a safe therapeutically effective amount (eg, 0.001 to 99% by weight) of a PEBP4 polypeptide of the invention or a polynucleotide encoding the same (or an agonist, or inhibitor thereof) And a pharmaceutically acceptable carrier or excipient. In a preferred embodiment of the invention, the human PEBP4 polypeptide is present in an amount of from 0.001 to 99.9% by weight, preferably from 0.01 to 95% by weight, more preferably from 0.1 to 90% by weight, most preferably from 0.5 to 80% by weight.

The term "effective amount" as used herein refers to an amount of a therapeutic agent that treats, alleviates or prevents a target disease or condition, or an amount that exhibits a detectable therapeutic or prophylactic effect. The precise effective amount for a subject will depend on the size and health of the subject, the nature and extent of the condition, and the combination of therapeutic and/or therapeutic agents selected for administration. Therefore, it is useless to specify an accurate effective amount in advance. However, for a given condition, routine experimentation can be used to determine the effective amount that the clinician can judge.

For the purpose of the present invention, an effective dose is about 0.01 mg/kg to 50 mg/kg, respectively. Preferably, the polypeptide of the invention, its agonist, or an inhibitor thereof, is from 0.05 mg/kg to 10 mg/kg body weight. Furthermore, the active substances of the invention may also be used together with other therapeutic agents.

The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of a therapeutic agent. The term refers to pharmaceutical carriers which do not themselves induce the production of antibodies harmful to the individual receiving the composition and which are not excessively toxic after administration. These vectors are well known to those of ordinary skill in the art. A full discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., N. J. 1991). Such carriers include, but are not limited to, saline, buffer, dextrose, water, glycerol, ethanol, adjuvants, or combinations thereof.

The pharmaceutically acceptable carrier in the compositions of the present invention may contain liquids such as water, saline, glycerol and ethanol. In addition, auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like may also be present in these carriers.

The composition of the present invention may contain, in addition to the PEBP4 polypeptide or the coding sequence or its agonist as an active ingredient, an additional active substance for inhibiting apoptosis for treating or alleviating the disease or sign associated with apoptosis. Shapes, including but not limited to: stroke, myocardial infarction, Alzheimer's disease, Parkinson's disease, AIDS, retinal degenerative disease, hematopoietic disease, anti-drug, or aging. Preferably, the additional active substance is selected from the group consisting of: rasagiline, neurotrophic factor, midodyl, cyclosporine VIII, N-acetylcysteine, glutathione, nerve cell growth factor, Sphingosine 1 -phosphate or a combination thereof.

The invention also provides compositions comprising a PEBP4 polypeptide or an inhibitor of a coding sequence. The composition can be used to treat and alleviate diseases associated with apoptosis, such as cancer (preferably breast cancer). In addition to the inhibitor, the composition may also contain additional active substances that promote apoptosis, including but not limited to: epi-ethylidene, 5-fluorouracil, cisplatin, vincristine, or combinations thereof. Mode of administration

The pharmaceutical preparation should be matched to the mode of administration. The pharmaceutical composition of the present invention can be prepared into an injection form, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as tablets and capsules can be prepared by conventional methods. Pharmaceutical compositions such as injections, solutions, tablets and capsules are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount, for example from about 1 microgram per kilogram body weight to about 5 milligrams per kilogram body weight per day.

The pharmaceutical composition of the present invention can be administered orally, subcutaneously, intradermally, intravenously or the like. The therapeutic dosage regimen can be a single dose regimen or a multiple dose regimen.

When a pharmaceutical composition is used, a safe and effective amount of a PEBP4 polypeptide, an agonist thereof, or an inhibitor thereof, is administered to a mammal, especially a human. Specific doses should also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled physician. Further, the PEBP4 polypeptide of the present invention, an agonist thereof, or an inhibitor thereof may be used alone for inhibiting apoptosis, and may be used in combination with other substances. Advantages of the invention

The main advantages of the invention are:

(a) A novel use of a PEBP4 polypeptide or a polynucleotide encoding the same, which is effective for inhibiting apoptosis and is used for the treatment of various apoptosis-related diseases;

(b) The PEBP4 polypeptide or its encoding polynucleotide as a pharmaceutical composition may be used alone or in combination with other polypeptides, polynucleotides, or in combination with other drugs and therapeutic means for the treatment of apoptosis-related diseases;

(c) PEBP4 polypeptide is highly expressed in breast cancer cells and can be used as a marker or therapeutic target for breast cancer for the diagnosis and treatment of breast cancer. Example

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conditions described in conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer. The suggested conditions. Percentages and parts are by weight unless otherwise stated. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the present invention. Example 1 : Cloning of human PEBP4 cDNA

Human bone marrow stromal cells were extracted from total RNA using Trizol reagent (Life Technologies). The poly(A) mRNA is then isolated from total RNA. After poly(A) m NA was reverse transcribed to form a cDNA, the cDNA fragment was inserted into the vector cloning site by SuperScriptll cloning kit (Life Technologies), and DH5oc bacteria were transformed to form a cDNA plasmid library. The sequence of the 5' end of the randomly selected clone was determined by the dideoxy method. Comparing the determined cDNA sequence with the existing public DNA sequence database revealed that the DNA sequence of one cDNA clone was a new full-length cDNA. The DNA sequence contained in the new clone was bidirectionally determined by synthesizing a series of primers. Computer analysis indicated that the full-length cDNA contained in the clone was a new cDNA sequence (shown as SEQ ID NO: 1) encoding a new protein (as shown in SEQ ID NO: 2). This protein was named human phosphatidylethanolamine binding protein PEBP4, and its coding gene was named human phosphatidylethanolamine binding protein PEBP4 gene.

The sequence SEQ ID NO: 1 is 874 bp in length and comprises a 64 bp 5' non-coding region and a 125 bp 3' non-coding region encoding a polypeptide of 227 amino acids. The molecular weight of the unglycosylated mature molecule is theoretically calculated to be about 25 kD. It belongs to the phosphatidylethanolamine binding protein family of molecules. Example 2: Cloning of the coding sequence of human PEBP4 protein by RT-PCR

Extracted using Trizol reagent of total human marrow stromal cells in an RNA, total _RNA β cells taken 5μ 1μ _β 01 ₁₂ and igo-dT - ₁₈ were mixed and reverse transcription. The reverse transcription system was 20 μl, and after the reaction was completed, 80 μl dd 3⁄40 was added for dilution.

The primers used for PC amplification of PEBP4 were as follows, with β-act in as a positive control:

Sense primer 5, - CATGGGTTGGACAATGAGGC- 3 ' (SEQ ID NO: 3),

Antisense primer 5, - TCTAGCAGGCAGCTATCTCC-3 ' (SEQ ID NO: 4).

The PC reaction volume was 50 μl, which contained the reverse transcription template 10μ1, 0.5 mM primer, 0.2 mM dNTP and lU rTaq DNA polymerase (Takara), and the amplification parameters were 95 ° C for 15 seconds, 57 ° C for 30 seconds, At 72 ° C for 30 seconds, after 28 cycles, the PCR product was initially confirmed by 1. 5% agarose gel electrophoresis. The result of DNA sequence analysis revealed that the DNA sequence of the PCR product was identical to that of 64-750 shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human PEBP4

Northern blotting was performed as follows: The filter to be tested was placed in 10 ml of a pre-warmed hybridization solution at 68 ° C, pre-hybridized in a hybridization oven (Bellco) at 68 ° C for 30 minutes; the labeled cDNA probe was 95 Denture at 100 °C for 2 to 5 minutes, add rapidly to the ice and add the hybridization solution (final concentration of cDNA probe is 2~10ng/ml or l~2 X 10 ⁶ cpm/ml), mix well, at 68° C hybridization for 2 hours. After the end of the hybridization, the filter was rinsed several times with 2xSSC, 0.05% SDS at room temperature, followed by shaking for 30 to 40 minutes, during which the lotion was changed several times. Subsequently, it was washed with 0. lxSSC, 0.1% SDS at 50 ° C for 20 to 40 minutes. Finally, the filter is wrapped in plastic wrap, at -70. C exposed X-ray film for 24 to 48 hours.

Northern blot results showed that human PEBP4 is highly expressed in the thyroid, skeletal muscle, myocardium and brain-specific expression, especially in the brain. Example 4: Prokaryotic expression of human PEBP4 protein

In this example, using the full-length plasmid DNA of Example 1 as a template, amplification was carried out using PCR oligonucleotide primers at the 5' and 3' ends of the sequence as follows, and human PEBP4 DNA was obtained as an insert.

The reagents used in the PCR reaction are

5, end primer sequence: 5, - GCGAATTCTGGGTTGGACAAT GAGGCTG-3, (SEQ ID NO: 5). 3, end primer sequence: 5 '-TCGAATTC CTAGCAGGCAGCTATC TCC-3' (SEQ ID NO: 6). The obtained PCR product was purified, digested with EcoR I and then recombined with the expression vector plasmid pGEX-2T (Pharmacia) according to a conventional method and transformed into competent E. coli DH5a, and the clone was picked. The positive clone was identified by EcoR I digestion. The positive clone was identified by BamH I digestion, and the product was analyzed by 0.8% agarose gel electrophoresis. After purification, it was purified and sequenced (ABI's Model 377 Sequencer, BigDye Terminator Kit, PE). It was confirmed by sequencing that the complete PEBP4 coding sequence has been inserted. 5 mM, adding 100 mM IPTG to 0. I mM I. mM I. I mM I mM I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I After induction at 30 ° C for 2-6 hr, 5,000 g 4 ° C centrifugation lOmin to remove the supernatant, placed on ice with 50ml IxPBS (0. 14M NaCl, 2. 7 mM C1, 10. ImM Na ₂ HP0 ₄ , 1. 8mM H ₂ P0 ₄ , pH 7. 3) Resuspend, ultrasonic (Β· Braun Labsonic U) was crushed and then added with 20% Triton X-100 to 1% for 30 minutes, then centrifuged at 12,000g for 10 minutes at 4°C. 0. 8μηι filter after filtration, after 1ml 50% glutathione Sepharose 4B column, IxPBS is fully washed, add 500ul glutathione elution buffer (10 mM glutathione, 50 mM Tris-HCl , pH 8. 0) The eluate was collected after standing at room temperature for 30 minutes, and eluted 2-3 times repeatedly to obtain a human PEBP4-GST fusion protein.

The PEBP4 protein was obtained by excision of GST by thrombin (Sigma) and the molecular weight was about 25 kD.

The N-amino acid sequence analysis by Edams hydrolysis confirmed that the N-terminal sequence was identical to the N-terminal sequence shown in SEQ ID NO: 2. Example 5: Production of anti-human PEBP4 antibody

The human PEBP4 recombinant protein obtained in Example 4 was used to immunize an animal to produce an antibody, as described below. The recombinant molecules are separated by chromatography and used. Separation can also be carried out by SDS-PAGE gel electrophoresis, and the electrophoresis band is excised from the gel and emulsified with an equal volume of complete Freund's adjuvant. Mice were intraperitoneally injected with 50-100 μg/0.2 ml of the emulsified protein. After 14 days, mice were intraperitoneally injected with a dose of 50-100 μg/0.2 ml with the same antigen emulsified with incomplete Freund's adjuvant to boost the immunization. A booster immunization is performed every 14 days, at least three times. The specific reactivity of the obtained antiserum was evaluated by its ability to precipitate the translation product of the human PEBP4 gene in vitro. As a result, it was found that the antibody specifically binds to the protein of the present invention (Fig. 1). Example 6: Immunohistochemical analysis of human PEBP4 protein expression

Normal breast tissue and breast cancer specimens were obtained from the Department of Pathology of the First Affiliated Hospital of Zhejiang University, 4% paraformaldehyde was fixed for 18-24 hr, paraffin-embedded, and the sections and stains were treated according to conventional procedures. Color development was carried out according to the avidin-biotin peroxidase complex (ABC) method using a Vectastain El ite ABC kit (Vector). The simple procedure is as follows: firstly, after the slices are dried, they are fixed with acetone at room temperature for 10 min, and completely dried and dehydrated in air; then the peroxidase blocker is used for 5 min at room temperature to eliminate endogenous peroxidase. Interference with the results. The anti-PEBP4 antibody (1:100) obtained in Example 5 was then diluted with the primary antibody dilution in the kit and incubated with the sections for 2 hr at 4 °C. After washing with PBST (PBS containing 0.1% Tween 20), the HRP-conjugated secondary antibody solution was added dropwise, and allowed to stand at room temperature for 30 min. After washing, it was incubated with ABC El ite reagent for 30 min at room temperature, and washed with PBS. Observed under the microscope. Immunohistochemistry results showed that breast cancer tissues highly expressed PEBP4 protein. In the normal breast tissue and breast cancer tissues detected, 6 normal breast tissues did not express PEBP4 protein, but 6 breast cancer tissues highly expressed PEBP4 protein (Fig. 2). Example 7: Construction of human PEBP4 eukaryotic expression vector and eukaryotic gene transfection

The primer sequences used in the PC reaction are:

The 5' primer sequence is -

5 ' - CA GAA TTC ATG GGT TGG ACA ATG AGG C -3, (SEQ ID NO: 7) The 3' primer sequence is -

5 ' - T CAA GCT TGA GCA GGC AGC TAT CTC CG -3, (SEQ ID NO: 8) The obtained PCR product was purified and digested with EcoR I-Hind III and then eukaryotic expression vector plasmid pcDNA3.1/myc -His (-) B dnvitrogen) Recombined and transformed into competent E. coli DH5a by conventional methods, picking positive clones, identifying and purifying and sequencing (ABI's Model 377 Sequencer, BigDye Terminator Kit, PE) . It was confirmed by sequencing that the complete PEBP4 coding sequence has been inserted.

The PEBP4 eukaryotic expression plasmid DNA was transfected into TNFoc-sensitive rat L929 cells with liposome Lipof ectAMINE reagent (Invitrogen), and the pcDNA3.1 plasmid vector was used as an irrelevant control. Follow the instructions. The main steps are as follows: The plasmid DNA to be transfected is mixed with the liposome LipofectAMINE in a certain ratio and allowed to react at room temperature for 45 minutes; 60-80% confluent is grown in MCF-7 cells of 6-well cell culture plate, using 0PTI- After washing twice with MEM serum-free medium (Inv itrogen), the plasmid DNA-liposome mixture was added, cultured at 37 ° C 5% CO _{2 for} 6-8 hours, and an equal volume of normal medium containing 20% serum was added. Fresh culture medium was replaced after 6 hours of incubation. Transient expression was collected 48 hours after transfection and subjected to Western blot analysis to detect transfection effects. Example 8: Western blot detection

L929 cells transiently transfected with expression of PEBP4 protein in Example 7 were treated with 20 ng/ml TNFoc (Shanghai Saida) for 20 hr, and then lysed with cell lysate (Cell Signaling). The supernatant was centrifuged at 4 ° C for 13,000 rpm x lOmin, and protein quantification was performed using a BCA protein assay kit (PIERCE). The protein samples were subjected to SDS-PAGE, followed by transfer to a nitrocellulose membrane (Schleicher & Schuell) at a constant voltage of 100 V at 4 ° C, stained with Ponceau and labeled with size and orientation. Block for 2 hours at room temperature (5% TBST solution of skimmed milk powder), dilute the primary antibody with blocking solution, and incubate for 1 hour at room temperature. TBST (0. 05% Tween 20 in TBS solution) was washed for 15 minutes, 3 times, and the secondary antibody was diluted with blocking solution and incubated for 2 hours at room temperature. Wash TBST for 15 minutes, 3 times, wash with TBS (10 mM Tris-HCl, pH 8.0, 150 mM NaCl) for 15 minutes, then add The chemiluminescent substrate (Pierce) was applied for 1 min and quickly sealed and auto-developed. The primary antibody used for Western blot detection was the anti-PEBP4 antibody obtained in Example 5. The secondary antibody was HRP-labeled anti-rabbit IgG (Cell Signaling).

The results showed that the expression product of human PEBP4 was detected in cells transfected with human PEBP4 eukaryotic expression vector 48 hours after transfection, and the molecular weight was 28 KD (including the 3 kD myc-his tag sequence, (Fig. 3). Example 9: RNA interference analysis of human PEBP4

21-nt long PEBP4 interfering RNA (siRNA) oligonucleotide (Prol igo) was synthesized in vitro, and the primer used was - sense strand 5, -GGA AAA GUC AUC UCU CUC CTT (SEQ ID NO: 9)

Antisense strand 5, -GGA GAG AGA UGA CUU UUC CTT (SEQ ID NO: 10).

PEBP4 Mutant Control siRNA Oligonucleotide:

Sense chain 5, -GGA AAA UCU ACU CUC UCU CTT (SEQ ID NO: 11)

Antisense strand 5, -GGA GAG AGU AGA CUU UUC CTT (SEQ ID NO: 12).

The annealing procedure for siRNA was as follows: Annealing buffer (100 mM potassium acetate, 30 mM HEPES-K0H, pH 7.4, 2 mM magnesium acetate) and 21-nt NAs (20 μΜ) were incubated at 90 ° C for 1 min and then 37 ° C Incubate for 1 hr.

siRNA transfection of eukaryotic cells was performed using Oligofectamine reagent (Inv itrogen) to interfere with the expression of PEBP4 protein in human breast cancer cell MCF-7 cells. The main steps are as follows: The siRNA to be transfected is diluted with serum-free 0pt i-MEM (Invitrogen), mixed with Oligofectamine in a certain ratio, and allowed to react at room temperature for 20 minutes; grown in 6-well cell culture plate or 10 mm culture dish to be transferred. The cells were cultured to 60-80% confluence, washed twice with Opt i-MEM serum-free medium, and then added to normal medium in the manner of conventional cultured cells. The RNA-liposome mixture was dropped, cultured at 37 ° C 5% CO _{2 for} 48 hours, and the cells were collected for T-PC and Western blot analysis.

By RT-PCR and Western blotting, the results showed that PEBP4 NA interference successfully inhibited the expression of human PEBP4 mRNA and protein in human breast cancer cell MCF-7 cells, while 21nt RNA mutation control on PEBP4 mRNA and protein Expression has no effect (Figure 4). Example 10: Detection of apoptosis induced by TNFoc

L929 cells overexpressing PEBP4 protein in Example 7, and MCF-7 cells in Example 9 which were down-regulated by RNA interference leading to PEBP4 protein expression were treated with 20 ng/ml TNFoc (Shanghai Saida) for 20 hr, and then treated. The cells were suspended in 50 μl of the staining solution, and added to Ιμΐ AnnexinV (ApoAlert Annexin V Apoptosis Detection Kit, Becton Dickinson) for 10 minutes, and then added with 0.5 μl PI (propidium iodide) for 5 minutes. Flow cytometry (Becton Dickinson) was used to detect apoptosis. The results of flow cytometry were analyzed or superimposed using CellQuest software. The results showed that PEBP4 significantly inhibited TNF a-induced apoptosis of L929 cells in L929 cells overexpressing PEBP4 protein. In the case of 20 ng/ml TNFa, the blank cell group, the empty vector control group, and the PEBP4 group apoptotic cells (Annexin V positive cells) were 64.49%, 69.30%, and 30.21%, respectively (Fig. 5).

After down-regulation of PEBP4 protein expression, MCF-7 cells were more sensitive to TNF-induced apoptosis (Fig. 6). In the case of 20 ng/ml TNF a, there were no siRNA group, mutation control group and PEBP4 RNA interference group. 30. 06%, 32. 17% and 70.41%. Example 11: Preparation of PEBP4 polypeptide injection

According to a conventional mixing method, 1 mg of PEBP4 polypeptide and 200 ml of physiological saline for injection were placed in an injection solution, and the mixture was dispensed in a 10 ml vial.

Using the method of testing the apoptotic rate in Example 10, comparing the test group administered with the composition with the control group given the same volume of physiological saline for apoptosis of L929 cells and MCF-7 cells down-regulated by PEBP4 protein expression by RNA interference. influences. The results indicate that the composition of the present invention inhibits apoptosis of cells in vitro as compared to the control. Example 12: In vitro screening of PEBP4 inhibitors and agonists

The MCF-7 cells and L929 cells of Example 10 were separately treated with the test substance and the control at a concentration of 0.1 mg/ml, respectively, and their effects on the apoptosis rate were tested according to the method described in Example 10. Wherein: Test substance 1 is the anti-PEBP4 antibody prepared in Example 5; Test substance 2 is the PEBP4 interfering RNA prepared in Example 9; Test substance 3 is the PEBP4-GST fusion protein prepared in Example 4; Volume of normal saline.

The results showed that Test 1 and Test 2 increased the apoptotic rate of MCF-7 cells and L929 cells compared to the control group, indicating that the two test substances are potential inhibitors of PEBP4 polypeptide; The apoptotic rate of MCF-7 cells and L929 cells was increased, indicating that test substance 3 is an agonist of the potential PEBP4 polypeptide. All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the the In addition, it is to be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims

Rights request

A use of a human phosphatidylethanolamine-binding polypeptide, PEBP4 or a coding sequence thereof, for use in the preparation of a composition for inhibiting apoptosis.

2. The use according to claim 1, wherein the PEBP4 polypeptide is selected from the group consisting of:

(a) a polypeptide of the amino acid sequence of SEQ ID NO: 2;

(b) a polypeptide derived from (a) which is formed by substitution, deletion or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO: 2, and which has a function of inhibiting apoptosis;

(c) a fusion protein of a PEBP4 polypeptide, which has a function of inhibiting apoptosis.

3. The use according to claim 1, wherein the coding sequence is selected from the group consisting of:

(i) the nucleotide sequence shown at positions 66-746 of SEQ ID NO: 1;

(ii) the nucleotide sequence shown by the 1-874 position in SEQ ID NO: 1.

4. Use according to claim 1 wherein the composition is a pharmaceutical composition.

5. The use according to claim 1, wherein the composition comprises a pharmaceutically acceptable carrier, diluent or excipient, and 0.001 to 99.99% by weight of a human PEBP4 polypeptide or a coding sequence thereof, Based on the total weight of the composition.

6. The use according to claim 1, wherein the cells are selected from the group consisting of MCF-7 cells and L929 cells.

7. The use according to claim 1, wherein the apoptosis is caused by an inducer of apoptosis.

8. The use according to claim 1, further comprising preparing a kit or reagent for detecting breast cancer.

9. A method of screening a human phosphatidylethanolamine binding polypeptide, i.e., an agonist or inhibitor of PEBP4, in vitro, wherein the method comprises:

(b) contacting the inducer of apoptosis with the cell culture system;

Wherein, compared with the control group, the apoptosis rate of the cells in the test group is increased, indicating that the test substance It is an inhibitor of a potential PEBP4 polypeptide; wherein, the apoptosis rate of the cells in the test group is decreased compared to the control group, indicating that the test substance is an agonist of the potential PEBP4 polypeptide.

10. The method according to claim 9, wherein when the method is used to screen an inhibitor of PEBP4, in step (b), the apoptosis rate of the cells in the test group is also positive. The apoptotic rate of the control group was compared, and the positive control group was a cell culture system to which an anti-PEBP4 antibody, an antisense nucleotide, or an interfering RNA was added.