EP1230361A2 - G protein-coupled receptors expressed in human brain - Google Patents

G protein-coupled receptors expressed in human brain

Info

Publication number
EP1230361A2
EP1230361A2 EP00978278A EP00978278A EP1230361A2 EP 1230361 A2 EP1230361 A2 EP 1230361A2 EP 00978278 A EP00978278 A EP 00978278A EP 00978278 A EP00978278 A EP 00978278A EP 1230361 A2 EP1230361 A2 EP 1230361A2
Authority
EP
European Patent Office
Prior art keywords
transmembrane receptor
polypeptide
seq
sequence
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00978278A
Other languages
German (de)
French (fr)
Inventor
Gabriel Vogeli
Linda S. Wood
Kalpana Merchant
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Pharmacia and Upjohn Co LLC
Original Assignee
Pharmacia and Upjohn Co
Upjohn Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pharmacia and Upjohn Co, Upjohn Co filed Critical Pharmacia and Upjohn Co
Publication of EP1230361A2 publication Critical patent/EP1230361A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH

Definitions

  • the present invention relates generally to the fields of genetics and cellular and molecular biology. More particularly, the invention relates to a novel G protein-coupled seven transmembrane receptor polynucleotide and polypeptide sequences that are expressed in the brain.
  • the G protein-coupled receptors form a vast superfamily of cell surface receptors which are characterized by an amino-terminal extracellular domain, a carboxyl-terminal intracellular domain, and a serpentine structure that passes through the cell membrane seven times. Hence, such receptors are sometimes also refe ⁇ ed to as seven transmembrane (7TM) receptors. These seven transmembrane domains define three extracellular loops and three intracellular loops, in addition to the amino- and carboxyl-terminal domains.
  • the extracellular portions of the receptor have a role in recognizing and binding one or more extracellular binding partners (ligands), whereas the intracellular portions have a role in recognizing and communicating with downstream effector molecules.
  • the G protein-coupled receptors bind a variety of ligands including calcium ions, hormones, chemokines, neuropeptides, neurotransmitters, nucleotides, lipids, odorants, and even photons, and are important in the normal (and sometimes the aberrant) function of many cell types.
  • ligands including calcium ions, hormones, chemokines, neuropeptides, neurotransmitters, nucleotides, lipids, odorants, and even photons.
  • G-protein guanine-nucleotide-binding regulatory protein
  • the G protein transmits a signal to an effector molecule within the cell, by either stimulating or inhibiting the activity of that effector molecule.
  • effector molecules include adenylate cyclase, phospholipases, and ion channels.
  • Adenylate cyclase and phospholipases are enzymes that are involved in the production ofthe second messenger molecules cAMP, inositol triphosphate and diacyglycerol. It is through this sequence of events that an extracellular ligand stimuli exerts intracellular changes through a G protein-coupled receptor. Each such receptor has its own characteristic primary structure, expression pattern, ligand-binding profile, and intracellular effector system.
  • G protein-coupled receptors Because ofthe vital role of G protein-coupled receptors in the communication between cells and their environment, such receptors are attractive targets for therapeutic intervention, and many drugs have been registered which are directed towards activating or antagonizing such receptors.
  • the identification of agonists or antagonists may be sought specifically for enhancing or inhibiting the action ofthe ligand.
  • G protein-coupled receptors have roles in disease pathogenesis (e.g., certain chemokine receptors that act as HIV co-receptors and may have a role in AIDS pathogenesis), and are attractive targets for therapeutic intervention even in the absence of knowledge ofthe natural hgand of the receptor Other receptors are attractive targets for therapeutic intervention by virtue of their expression pattern in tissues or cell types that are attractive targets foi therapeutic intervention. Examples of this latter category of receptors include receptors expressed in immune cells, for targeting to enhance immune responses to fight pathogens or cancer or inhibit autoimmune lesponses, and receptors expressed in the brain or other neurons, for targeting to treat schizophrenia, depression, bipolar disease, or other neurological disorders.
  • This latter category of receptor is also useful as a marker for identifying and/or purifying (e g., via fluorescence activated cell sorting) cellular subtypes that express the receptor.
  • G protein receptors from the central nervous system (CNS) are known. A need exists for identifying the existence and structure of such G protein-coupled receptors.
  • the present invention addresses one or more ofthe needs identified above in that it provides purified polynucleotides encoding heretofore unknown G protein-coupled receptors (GPCR); constructs and recombinant host cells incorporating the polynucleotides; GPCR polypeptides encoded by the polynucleotides; antibodies to the polypeptides; and methods of making and using all of the foregoing.
  • GPCR G protein-coupled receptors
  • the GPCR polypeptides descnbed herein are expressed in the brain, providing a therapeutic indication for GPCR polypeptides and binding partners to treat diseases associated with this tissue.
  • the invention provides purified and isolated GPCR seven transmembrane receptor polypeptides comp ⁇ sing any one of the amino acid sequences set forth in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20, or a fragment thereof composing an epitope specific to the seven transmembrane receptor.
  • epitope specific to is meant a portion ofthe receptor that is recognizable by an antibody that is specific for that seven transmembrane receptor, as defined in detail below.
  • One prefe ⁇ ed embodiment comprises a purified and isolated polypeptide designated CON193, comprising the complete amino acid sequence set forth in SEQ ID NO: 2.
  • Glu Asp Thr Gin Leu Trp lie Ser Phe Pro Phe Cys Ser Met Tyr Val
  • Phe Trp Phe His Leu Lys Asp lie Gly Phe Asp Glu Cys Leu Val Gin 90 95 100 atg ttc ttc ate cac ace ttc aca ggg atg gag tct ggg gtg ctt atg 510
  • Another preferred embodiment comprises a purified and isolated polypeptide designated CON166, comprising the complete amino acid sequence set forth in SEQ ID NO: 4. This amino acid sequence was deduced from a polynucleotide sequence encoding CON166 (SEQ ID NO: 3), as set forth below: atg gat gaa aca gga aat ctg aca gta tct tct gcc aca tgc cat gac 48
  • Still another preferred embodiment comprises a purified and isolated polypeptide designated CON103, comprising the complete amino acid sequence set forth in SEQ ID NO: 6.
  • This amino acid sequence was deduced from a polynucleotide sequence encoding CON103 (SEQ ID NO: 5), as set forth below: ggggcctact tcaccgtgta cccggacttg ggaccatcac agacttcaga accatcagga 60 acctgggagc aactgaaagc tgaactacag tgggctttca gacacagc aggctgcgga 120 geacaaatag gaetggttcc ctccaggcca ecageagggc ggtggaggtc tteactgact 180 ccctgcctac ctctcaggac aatgtcctttt tggctccaca gtcct
  • This amino acid sequence was deduced from a polynucleotide sequence encoding CON203 (SEQ ID NO: 7), as set forth below: ttgaatttag gtgacactat agaagagcta tgacgtcgca tgcacgcgta cgtaagctcg 60 gaattcggct egagctgaae taatgactge egceataaga agacagagag aactgagtat 120 cctcccaaag gtgacactgg aagca atg aac ace aca gtg atg caa ggc ttc 172
  • ttt ttg gca gca act aac att tgt atg gat ccc tta ata tac ata 1036 Leu Phe Leu Ala Ala Thr Asn He Cys Met Asp Pro Leu He Tyr He 285 290 295 ttc tta tgt aaa aaa ttc aca gaa aag eta cca tgt atg caa ggg aga 1084 Phe Leu Cys Lys Lys Phe Thr Glu Lys Leu Pro Cys Met Gin Gly Arg
  • This amino acid sequence was deduced from a polynucleotide sequence encoding CON198 (SEQ ID NO: 9), as set forth below: atg atg gtg gat ccc aat ggc aat gaa tec agt get aca tac ttc ate 48 Met Met Val Asp Pro Asn Gly Asn Glu Ser Ser Ala Thr Tyr Phe He 1 5 10 15 eta ata ggc etc cct ggt ta gaa gag get cag ttc tgg ttg gcc ttc 96 Leu He Gly Leu Pro Gly Leu Glu Glu Ala Gin Phe Trp Leu Ala Phe 20 25 30 cca ttg tgc tec etc tac ctt att get gtg eta ggt aac ttg aca ate 144 Pro Leu Cys Ser Leu Tyr Leu He Ala Val Leu Gly As
  • SEQ ID NO: 10 contains methionine residues at positions 1 and 2. Translation ofthe relevant mRNA sequences may occur beginning from either or both methionines, which can be determined for a particular cell source by purifying expressed CON 198 protein and performing amino-terminal sequencing thereon. CON 198 polypeptides beginning at either Met, or Met 2 of SEQ ID NO: 10 are intended a polypeptides ofthe invention.
  • Another preferred embodiment comprises a purified and isolated polypeptide designated CON 197, comprising the complete amino acid sequence set forth in SEQ TD NO: 12. This amino acid sequence was deduced from a polynucleotide sequence encoding CON197 (SEQ ID NO: 11), as set forth below:
  • CON202 a purified and isolated polypeptide designated CON202, comprising the complete amino acid sequence set forth in SEQ ID NO: 14. This amino acid sequence was deduced from a polynucleotide sequence encoding CON202 (SEQ ID NO: 13), as set forth below:
  • Still another preferred embodiment comprises a purified and isolated polypeptide designated CON222, comprising the complete amino acid sequence set forth in SEQ ID NO: 16. This amino acid sequence was deduced from a polynucleotide sequence encoding CON222 (SEQ ID NO: 15), as set forth below:
  • Another preferred embodiment comprises a purified and isolated polypeptide designated CON215, comprising the complete amino acid sequence set forth in SEQ ID NO: 18.
  • This amino acid sequence was deduced from a polynucleotide sequence encoding CON215 (SEQ ID NO: 17), as set forth below: atg ggg ttc aac ttg acg ctt gca aaa tta cca aat aac gag ctg cac 48 Met Gly Phe Asn Leu Thr Leu Ala Lys Leu Pro Asn Asn Glu Leu His 1 5 10 15 ggc caa gag agt cac aat tea ggc aac agg age gac ggg cca gga aag 96 Gly Gin Glu Ser His Asn Ser Gly Asn Arg Ser Asp Gly Pro Gly Lys 20 25 30 aac ace ace ctt cac aat gaa tt
  • Trp He Phe Phe His He Arg Asn Lys Thr Ser Phe He Phe Tyr Leu 65 70 75 80 aaa aac ata gtg gtt gca gac etc ata atg acg ctg aca ttt cca ttt 288
  • CON217 Another preferred embodiment comprises a purified and isolated polypeptide designated CON217, comprising the complete amino acid sequence set forth in SEQ ID NO: 20. This amino acid sequence was deduced from a polynucleotide sequence encoding CON217 (SEQ ID NO: 19), as set forth below: -41 C ATGGCATCCC CAGCCTAGCT CCCAATCCCA CTTTGGCACG
  • SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 provide for particular human sequences
  • the invention is intended to include within its scope other human allelic variants; non-human mammalian forms of GPCR polypeptides, and other vertebrate forms of GPCR polypeptides.
  • extracellular epitopes are particularly useful for generating and screening for antibodies and other binding compounds that bind to receptors such as GPCR polypeptides.
  • the invention provides a purified and isolated polypeptide comprising at least one extracellular domain of a GPCR polypeptide ofthe invention.
  • extracellular domain is it meant the amino terminal extracellular domain or an extracellular loop that spans two membrane domains.
  • a purified and isolated polypeptide composing the N-termmal extiacclluldi domain of GPCR polypeptides of the invention is highly preferred
  • picfe ⁇ ed is a put i fied and isolated polypeptide comptising a GPCR seven transmcmbiane receptoi fragment selected from the gioup consisting of the N-termmal extiacellular domain of GPCR polypeptides of the invention, tiansmcmbia ⁇ e domains of GPCR polypeptides of the invention, extracellular loops connecting transmembrane domains of GPCR polypeptides of the invention, intiacellulai loops connecting transmembrane domains of GPCR polypeptides of the invention, the C-terminal cytoplasmic domain of GPCR polypeptides, and fusions thereof
  • Such fragments may be continuous portions of the native receptor
  • knowledge ofthe GPCR gene and protein sequences as provided herein permits recombming of various domains that are not contiguous in the
  • the invention provides purified and isolated polynucleotides (e g , cDNA, genomic DNA, synthetic DNA, RNA, or combinations thereof, single or double stranded) that comprise a nucleotide sequence encoding an ammo acid sequence of the polypeptides of the invention
  • Another embodiment provides a purified and isolated polynucleotide encoding the amino acid sequence of the polypeptide ofthe invention fused to a heterologous tag ammo acid sequence
  • Such polynucleotides are useful for recombinantly expressing the receptor and also for detecting expression ofthe receptor in cells (e g , using Northern hybridization and in situ hybridization assays, and Western studies)
  • Polynucleotides encoding polypeptides ofthe invention also are useful to design antisense and other molecules for the suppression of GPCR polypeptides expression in a cultured cell or animal (for therapeutic purposes or to provide a model for diseases characterized by aberrant
  • GPCR polypeptide expiession Such polynucleotides are also useful to design antisense and other molecules for the suppression of GPCR polypeptide expression in a cultuied cell or tissue or in an animal, for therapeutic purposes or to provide a model for diseases characterized by aberrant GPCR polypeptide expression
  • polynucleotides ofthe invention are entire isolated chromosomes of native host cells
  • a preferred polynucleotide set forth in any one of the SEQ ID NOS 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, and 19 co ⁇ esponds to a naluially occu ⁇ in GPCR sec ⁇ ience It will be appreciated that numeious othci sequences exist that also encode GPCR polypeptides having the amino acid sequence set out in SEQ ID NOS 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 due to the well-known degeneracy ofthe univeisal genetic code All such sequences lepresent polynucleotides of the invention
  • the invention also provides a purified and isolated polynucleotide comp ⁇ sing a nucleotide sequence that encodes a mammalian seven transmembi ane receptor, wherein the polynucleotide hybridizes to a nucleotide sequence set forth in any one of SEQ ID NOS 1 , 3, 5, 7, 9, 1 1, 13, 15, 17, or 19 or the non-coding strand complementary thereto, under the following hybridization conditions
  • a highly prefe ⁇ ed polynucleotide ofthe invention comprises the sequence set forth in SEQ XD NO 1, which comp ⁇ ses a human CON193 encoding DNA sequence ntggttgttg gaccattaaa atgcattatg gaatttttaa aagttggggg agagggagac 60 agtaaaata acctatattt tctcttgtttttttttttttttttttttttttttt aactctagga aagcccagac 120 aaattttgag ctatttcata acctaccaga cttatcatgc taacactgaaaaaaacagac 180 ctaataccag cttcatttat tctgaatgga gtcccaggac tggaagacac acaactc
  • SEQ ID NO: 1 which represent the portion of SEQ ID NO: 1 that encodes CON 193 amino acids.
  • Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 3, which comprises a human CON166 encoding DNA sequence: atggatgaaa caggaaatct gacagtatct tctgccacat gccatgacac tattgatgac 60 ttccgcaatc aagtgtattc caccttgtac tctatgatct ctgttgtagg cttctttggc 120 aatggctttg tgctctatgt cctcataaaa acctatcaca agaagtcagc cttccaagta 180 tacatgatta atttagcagt agcagatcta ctttgtgtgt gcacactgcc tctccgtgtgtg 240 gtctattatg tt
  • the final three nucleotides of this sequence represent a stop codon.
  • Still another highly preferred polynucleotide ofthe invention comprises the sequence set forth in SEQ ID NO: 5, which comprises a human
  • nucleotide comprising nucleotides 691-1842 of SEQ ID NO: 5, which represent the portion of SEQ ID NO: 5 that encodes CON103 amino acids.
  • Nucleotides 1843-1845 represent a stop codon.
  • Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 7, which comprises a CON203-encoding DNA sequence: ttgaatttag gtgacactat agaagagcta tgacgtcgca tgcacgcgta cgtaagctcg 60 gaattcggct egagctgaae taatgactge egceataaga agacagagag aactgagtat 120 cctcccaaag gtgacactgg aagcaatgaa caccacagtg atgcaaggct tcaacagatc 180 tgagcggtgc cccagagaca ctcggatagt acagctggta ttcccagccc tacacacagt 240 ggtttcttg accggcatcc t
  • polynucleotide comprising nucleotides 146-1 144 of SEQ ID NO: 7, which represent the portion of SEQ D NO: 7 that encodes CON203 amino acids. Nucleotides 1145-1147 represent a stop codon.
  • Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 9, which comprises a human CONl 98 encoding DNA sequence:
  • Thc last three nucleotides of this sequence represent a stop codon.
  • a highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ TD NO: 1 1 , which comprises a human CON 197 encoding DNA sequence: ATGGAAAGCG AGAACAGAAG AGTGATAAGA GAATTCATCC TCCTTGGTCT GACCCAGTCT 60
  • GTCCTCATCC TCCGCTTGCC TTTTTGTGGC CCAAACCAGC TGGACAACTT CTTCTGTGAT 540
  • the last three nucleotides of this sequence represent a stop codon.
  • Another highly prefe ⁇ ed polynucleotide ofthe invention comprises the sequence set forth in SEQ ID NO: 13, which comprises a human CON202 encoding DNA sequence: 1 TGCTTCCCCA TAAGGTAACA GCTTTGTTAG CNCTGTCTGA CATCATTGCT
  • polynucleotide comprising nucleotides 266-1375 of SEQ ID NO: 13, which represent the portion of SEQ ID NO: 13 that encodes CON202 amino acids.
  • Nucleotides 1376-1378 represent a stop codon.
  • Another highly prefe ⁇ ed polynucleotide ofthe invention comprises the sequence set forth in SEQ ID NO: 15, which comprises a human CON222 encoding DNA sequence: 1 ATGTTTAGAC CTCTTGTGAA TCTCTCTCAC ATATATTTTA AGAAATTCCA
  • the last three nucleotides of this sequence represent a stop codon.
  • polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID NO: 17, which comprises a human CON215 en
  • SEQ ID NO: 17 set forth below, which represent the portion of SEQ ID NO: 17 that encodes CON215 amino acids (the last three nucleotides represent a stop codon).
  • Another prefe ⁇ ed polynucleotide ofthe invention comprises the portion ofthe sequence set forth in SEQ ID NO: 19 which comprises a human CON217 encoding DNA sequence:
  • the last three nucleotides of this sequence represent a stop codon.
  • the invention also includes polynucleotides differing from the sequences set forth in SEQ TD NOS: 1, 3, 5, 7, 9, 1 1 , 13, 15, 17 and 19 and from their complementary strand by at least one nucleotide.
  • the invention provides vectors comprising a polynucleotide ofthe invention. Such vectors are useful, e g., for amplifying the polynucleotides in host cells to create useful quantities thereof.
  • the vector is an expression vector wherein the polynucleotide ofthe invention is operatively linked to a polynucleotide comprising an expression control sequence. Such vectors are useful for recombinant production of polypeptides of the invention.
  • the invention provides host cells that are transformed or transfected (stably or transiently) with a polynucleotide ofthe invention or vectors ofthe invention.
  • host cells are useful for amplifying the polynucleotides and also for expressing the GPCR seven transmembrane receptor polypeptides or fragments thereof encoded by the polynucleotides.
  • host cells are useful in assays as described herein.
  • the invention provides a method for producing a seven transmembrane receptor polypeptide (or fragment thereof) of the invention comprising the steps of growing a host cell ofthe invention in a nutrient medium and isolating the polypeptide or variant thereof from the cell or the medium. Since the GPCR polypeptides are seven transmembrane receptors, it will be appreciated that, for some applications, such as certain activity assays, the preferable isolation may involve isolation of cell membranes containing the polypeptide embedded therein, whereas for other applications a more complete isolation may be preferable.
  • the invention provides antibodies that are specific for the GPCR seven transmembrane receptors of the invention.
  • Antibody spccificity is descnbcd in greater detail below
  • antibodies that can be generated fio polypeptides that have picviously been descnbcd in the hteraluie and that are capable of fortuitously ctoss-icacting with the GPCR polypeptides of the invention e g , due to the fortuitous existence of a similai epitope in both polypeptides
  • aie considered "cross-ieactive" antibodies
  • Such cioss- rcactive antibodies are not antibodies that are "specific" for the GPCR polypeptides
  • the deteimination of whether an antibody is specific for a GPCR polypeptide or is cross-reactive with another known receptor is made using Western blotting assays or several othei assays well known in the literature For identifying cells that express GPCR polypeptides and also for
  • the invention provides monoclonal antibodies Hybndomas that produce such antibodies also are intended as aspects of the invention
  • the invention provides a humanized antibody
  • Humanized antibodies are useful for in vivo therapeutic indications
  • the invention provides a cell-free composition comp ⁇ sing polyclonal antibodies, wherem at least one ofthe antibodies is an antibody of the invention specific for a GPCR polypeptide of the present invention
  • Antisera isolated from an animal is an exemplary composition, as is a composition comprising an antibody fraction of an antisera that has been resuspended in water or in another diluent, excipient, or earner
  • the invention provides anti-idiotypic antibodies specific for an antibody that is specific for a GPCR polypeptide of the present invention
  • the invention provides a polypeptide comprising a fragment of a GPCR-specific antibody, wherein the fragment and the polypeptide bind to a GPCR seven ti ansmembt ane i eccptor of the present invention
  • the invention piovidcs polypeptides that are single chain antibodies and CDR-giafted antibodies
  • compositions composing polypeptides, polynucleotides, or antibodies of he invention that have been formulated with, e g , a phaimaceutically acceptable ca ⁇ ier
  • the invention also provides methods of using antibodies of the invention
  • the invention provides a method for modulating ligand binding of a GPCR seven transmembrane receptor ofthe present invention comprising the step of contacting the seven transmembrane receptor with an antibody specific for the seven transmembrane receptor, under conditions wherein the antibody binds the receptor
  • GPCR polypeptides are expressed in the brain, providing an indication that abe ⁇ ant GPCR polypeptide signaling activity may co ⁇ elate with one or more neurological disorders
  • the invention also provides a method for treating a neurological disorder comp ⁇ sing the step of admmiste ⁇ ng to a mammal in need of such treatment an amount of an antibody-like polypeptide ofthe invention that is sufficient to modulate ligand binding of a GPCR seven transmembrane receptor ofthe present invention in neurons ofthe mammal.
  • the invention provides genetic screening procedures that entail analyzing a person's genome — in particular their alleles for GPCR's of the invention — to determine whether the individual possesses a genetic characteristic found in other individuals that are considered to be
  • the invention provides a method for determining a potential for developing a disorder affecting the brain in a human subject comprising the steps of analyzing the coding sequence of one or more GPCR genes from the human subject; and determining development potential for the disorder in said human subject from the analyzing step.
  • the invention provides a method of screening a human subject to diagnose a disorder affecting the brain or genetic predisposition therefor, comprising the steps of: (a) assaying nucleic acid of a human subject to determine a presence or an absence of a mutation altering the amino acid sequence, expression, or biological activity of at least one seven transmembrane receptor that is expressed in the brain, wherein the seven transmembrane receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8,
  • the nucleic acid co ⁇ esponds to the gene encoding the seven transmembrane receptor; and (b) diagnosing the disorder or predisposition from the presence or absence of said mutation, wherein the presence of a mutation altering the amino acid sequence, expression, or biological activity of allele in the nucleic acid co ⁇ elates with an increased risk of developing the disorder.
  • the seven transmembrane receptor is CON202 comprising an amino acid sequence set forth in SEQ ID NO: 14, or an allelic variant thereof, and the disease is schizophrenia.
  • human subject is meant any human being, human embryo, or human fetus. It will be apparent that methods of the present invention will be of particular interest to individuals that have themselves been diagnosed with a disorder affecting the brain or have relatives that have been diagnosed with a disorder affecting the brain.
  • screening for an increased risk dete ⁇ nination of whether a genetic variation exists in the human subject that co ⁇ elates with a greater likelihood of developing a disorder affecting the brain than exists for the human population as a vvhole, or for a relevant racial or ethnic human sub-population to which the individual belongs. Both positive and negative determinations (i.e., detemiinations that a genetic predisposition marker is present or is absent) are intended to fall within the scope of screening methods ofthe invention.
  • the presence of a mutation altering the sequence or expression of at least one CON202 seven transmembrane receptor allele in the nucleic acid is co ⁇ elated with an increased risk of developing schizophrenia, whereas the absence of such a mutation is reported as a negative dete ⁇ nination.
  • the "assaying" step of the invention may involve any techniques available for analyzing nucleic acid to determine its characteristics, including but not limited to well-known techniques such as single-strand confonnation polymorphism analysis (SSCP) [Orita et al, Proc Natl. Acad. Sci. USA, 86: 2766-2770 (1989)]; heteroduplex analysis [White et al, Genomics, 12: 301-306 (1992)]; denaturing gradient gel electrophoresis analysis [Fischer et al, Proc. Natl. Acad. Sci.
  • SSCP single-strand confonnation polymorphism analysis
  • the assaying step comprises at least one procedure selected from the group consisting of: (a) determining a nucleotide sequence of at least one codon of at least one CON202 allele of the human subject; (b) performing a hybridization assay to determine whether nucleic acid from the human subject has a nuclcotide sequence identical to or different from one or more leference sequences, (c) pci foi mmg a polynucleotide migration assay to determine whethci nucleic acid fiom the human subject has a nucleotide sequence identical to 01 different from one or moie refcicnce sequences, and (d) performing a restriction endonuclease digestion to determine whethei nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences
  • the assaying involves sequencing of nucleic acid to determine nucleotide sequence thereof, using any available sequencing technique [See, e g , Sanger et al , Proc Natl Acad Sci (USA), 74 5463-5467 (1977) (dideoxy chain termination method); Mirzabekov, TIBTECH, 12: 27-32 (1994)
  • the analysis may entail sequencing of the entire seven transmembrane receptor gene genomic DNA sequence, or portions thereof; or sequencing ofthe entire seven transmembrane receptor coding sequence or portions thereof. In some circumstances, the analysis may involve a determination of whether an individual possesses a particular allehc variant, in which case sequencing of only a small portion of nucleic acid — enough to determine the sequence of a particular codon characterizing the allehc variant — is sufficient.
  • This approach is approp ⁇ ate, for example, when assaying to determine whether one family member inherited the same allehc variant that has been previously characterized for another family member, or, more generally, whether a person's genome contains an allelic variant that has been previously characte ⁇ zed and co ⁇ elated with a mental disorder having a heritable component.
  • the assaying step comprises performing a hybridization assay to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference scquences
  • the hybridization involves a detct mination of whether nucleic acid denved from the human subject will hybridize with one oi mote oligonucleotides, wheiein the oligonucleotides have nucleotide sequences that correspond identically to a portion of the GPCR gene sequence taught herein, such as the CON202 coding sequence set forth in SEQ ID NO 14, or that coi respond identically except for one mismatch
  • the hybridization conditions are selected to differentiate between perfect sequence complementarity and imperfect matches differing by one or more bases
  • Such hybridization experiments theieby can provide single nucleotide polymo ⁇ hism sequence information about the nucleic acid from the human subject, by virtue of knowing the sequences of the oligonucleo
  • a polynucleotide migration assay e g
  • a polyacrylamide electrophoresis gel or in a capillary electrophoresis system
  • Nucleic acid de ⁇ ved from the human subject is subjected to gel electrophoresis, usually adjacent to (or co-loaded with) one or more reference nucleic acids, such as reference GPCR-encoding sequences having a coding sequence identical to all or a portion of SEQ XD NO.
  • nucleic acid from the human subject and the reference sequence(s) are subjected to similar chemical or enzymatic treatments and then electrophoresed under conditions whereby the polynucleotides will show a differential migration pattern, unless they contain identical sequences [See generally Ausubel et al (eds ), Current Protocols in Molecular Biology, New York John Wiley & Sons, Inc (1987-1999), and Sambrook et al , (eds ), Molecular Cloning, A Laboratory Manual, Cold Sp ⁇ ng Harbor, New York Cold Spring Harbor
  • nucleic acid of a human subject is intended to include nucleic acid obtained directly from the human subject (e g , DNA or RNA obtained from a biological sample such as a blood, tissue, or other cell or fluid sample), and also nucleic acid de ⁇ ved from nucleic acid obtained directly from the human subject
  • a biological sample such as a blood, tissue, or other cell or fluid sample
  • nucleic acid de ⁇ ved from nucleic acid obtained directly from the human subject By way of non-hmitmg examples, well known procedures exist for creating cDNA that is complementary to RNA derived from a biological sample from a human subject, and for ampli fying (e.g., via polymerase chain reaction (PCR)) DNA or RNA derived from a biological sample obtained from a human subject. Any such derived polynucleotide which retains relevant nucleotide sequence information of the human subject's own DNA/RNA is intended to fall within the definition of "nucleic acid of a human subject" for the pu ⁇ oses
  • mutation includes addition, deletion, and/or substitution of one or more nucleotides in the GPCR gene sequence (e.g., as compared to the seven transmembrane receptor-encoding sequences set forth in SEQ XD NO: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, or 19) and other polymo ⁇ hisms that occur in introns (where introns exist) and that are identifiable via sequencing, restriction fragment length polymo ⁇ hism, or other techniques.
  • the various activity examples provided herein permit dete ⁇ nination of whether a mutation modulates activity of the relevant receptor in the presence or absence of various test substances.
  • the invention provides methods of screening a person's genotype with respect to GPCR's ofthe invention, and co ⁇ elating such genotypes with diagnoses for disease or with predisposition for disease (for genetic counseling).
  • the invention provides a method of screening for a CON202 hereditary schizophrenia genotype in a human patient, comprising the steps of: (a) providing a biological sample comprising nucleic acid from the patient, the nucleic acid including sequences co ⁇ esponding to said patient's CON202 alleles; (b) analyzing the nucleic acid for the presence of a mutation or mutations; (c) determining a CON202 genotype from the analyzing step; and (d) co ⁇ elating the presence of a mutation in a CON202 allele with a hereditary schizophrenia genotype.
  • the biological sample is a cell sample containing human cells that contain genomic DNA ofthe human subject.
  • the analyzing can be performed analogously to the assaying described in preceding paragraphs.
  • the analyzing comprises sequencing a portion of the nucleic acid (e.g., DNA or RNA), the portion comprising at least one codon ofthe CON202 alleles.
  • the invention also may be practiced by assaying protein of a human subject to determine the presence or absence of an amino acid sequence variation in GPCR protein from the human subject.
  • Such protein analyses may be performed, e.g., by fragmenting GPCR protein via chemical or enzymatic methods and sequencing the resultant peptides; or by Western analyses using an antibody having specificity for a particular allelic variant of the GPCR.
  • the invention also provides materials that are useful for performing methods of the invention.
  • the present invention provides oligonucleotides useful as probes in the many analyzing techniques described above.
  • such oligonucleotide probes comprise 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides that have a sequence that is identical, or exactly complementary, to a portion of a human GPCR gene sequence taught herein (or allelic variant thereof), or that is identical or exactly complementary except for one nucleotide substitution.
  • the oligonucleotides have a sequence that co ⁇ esponds in the foregoing manner to a human GPCR coding sequence taught herein, and in particular, the coding sequences set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19.
  • an oligonucleotide probe ofthe invention is purified and isolated.
  • the oligonucleotide probe is labeled, e.g., with a radioisotope, chromophore, or fluorophore.
  • the probe is covalently attached to a solid support. [See generally Ausubel et al. And Sambrook et al, supra.]
  • kits comprising reagents that are useful for practicing methods ofthe invention.
  • the invention provides a kit for screening a human subject to diagnose schizophrenia or a genetic predisposition therefor, comprising, in association: (a) an oligonucleotide useful as a probe for identifying polymorphisms in a human CON202 seven transmembrane receptor gene, the oligonucleotide comprising 6-50 nucleotides that have a sequence that is identical or exactly complementary to a portion of a human
  • CON202 gene sequence or CON202 coding sequence except for one sequence ch ffercnce selected fiom the group consisting of a nucleotide addition, a nucleotide deletion, 01 nucleotide substitution, and (b) a media packaged with the oligonucleotide containing information identifying polymoiphisms identifyable with the piobe that co ⁇ elate with schizophrenia or a genetic predisposition therefoi
  • lnfoimation-containing media include printed paper package inserts oi packaging labels, and magnetic and optical storage media that are readable by computers oi machines used by practitioners who perform genetic screening and counseling services The practitioner uses the information provided in the media to co ⁇ elate the results ofthe analysis with the oligonucleotide with a diagnosis Tn a prefe ⁇ ed variation, the oligonucleotide is labeled
  • the invention provides methods of identifying those allehc vanants of GPCR's ofthe invention that co ⁇ elate with mental disorders
  • the invention provides a method of identifying a seven transmembrane allehc variant that co ⁇ elates with a mental disorder, comprising steps of (a) providing a biological sample comprising nucleic acid from a human patient diagnosed with a mental disorder, or from the patient's genetic progenitors or progeny, (b) analyzing the nucleic acid for the presence of a mutation or mutations in at least one seven transmembrane receptor that is expressed in the brain, wherein the at least one seven transmembrane receptor comp ⁇ ses an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, or an allehc va ⁇ ant thereof, and wherein the nucleic acid includes sequence co ⁇ esponding to the gene or genes encoding the at least one seven transmembrane receptor, (c) determining a genotype for the patient
  • the invention provides a punfied polynucleotide compnsing a nucleotide sequence encoding a CON202 seven transmembrane receptor protein of a human that is affected with schizophrenia, wherein said polynucleotide hybridizes to the complement of SEQ ID NO 13 under the following hyb ⁇ dization conditions: (a) hybndization for 16 hours at 42°C in a hybndization solution comp ⁇ sing 50% formamide, 1% SDS, 1 M NaCl , 10% dextran sulfate and (b) washing 2 times for 30 minutes at 60°C in a wash solution comprising O.lx SSC and 1% SDS, and wherein the polynucleotide encodes a CON202 amino acid sequence that differs from SEQ ID NO 14 at at least one residue
  • An examplary assay for using the allelic variants is a method for identifying a modulator of CON202 biological activity, comprising the steps of: (a) contacting
  • CON202 biological activity in the presence versus absence of the putative modulator
  • the invention provides for a method of diagnosing schizophrenia or a susceptibility to schizophrenia comprising the steps of: determining the presence or amount of expression of CON202 polypeptide as set out as SEQ ID NO: 14 or the polypeptide encoded by the nucleic acid molecule having
  • the invention also provides for a method of treating schizophrenia comprising the step of administering to a human diagnosed with schizophrenia an amount of a modulator of CON202 receptor activity sufficient to modulate CON202 receptor activity or CON202 ligand binding in said human.
  • the invention also provides assays to identify compounds that bind GPCR seven transmembrane receptors.
  • One such assay comprises the steps of: (a) contacting a composition comprising one ofthe GPCR seven transmembrane receptor polypeptides ofthe invention with a compound suspected of binding a GPCR polypeptide ofthe invention; and (b) measuring binding between the compound and the GPCR polypeptide.
  • the composition comprises a cell expressing a GPCR polypeptide ofthe invention on its surface.
  • GPCR polypeptide of the invention or cell membranes comprising a GPCR polypeptide of the invention are employed.
  • the binding may be measured directly, e.g., using a labeled compound, or may be measured indirectly by several techniques, including measuring intracellular signaling of a GPCR polypeptide ofthe invention induced by the compound (or measuring changes in the level of GPCR polypeptide signaling).
  • the invention also provides a method for identifying a modulator of binding between a GPCR seven transmembrane receptor of the invention and a GPCR polypeptide binding partner, comprising the steps of: (a) contacting a GPCR polypeptide binding partner and a composition comprising one ofthe GPCR seven transmembrane receptors of the invention in the presence and in the absence of a putative modulator compound; (b) detecting binding between the binding partner and the GPCR polypeptide of the invention; and (c) identifying a putative modulator compound in view of decreased or increased binding between the binding partner and the GPCR polypeptide in the presence of the putative modulator, as compared to binding in the absence of the putative modulator.
  • GPCR polypeptide binding partners that stimulate GPCR seven transmembrane receptors ofthe present invention are useful as agonists in disease states characterized by insufficient GPCR polypeptide signaling (e.g., as a result of insufficient expression of active GPCR polypeptide ligand).
  • GPCR polypeptide binding partners that block ligand-mediated GPCR polypeptide signaling are useful as
  • GPCR polypeptide antagonists to treat disease states characterized by excessive GPCR polypeptide signaling.
  • the invention includes, as an additional aspect, all embodiments of the invention na ⁇ ower in scope in any way than the variations specifically mentioned above.
  • the applicant(s) invented the full scope of the claims appended hereto, the claims appended hereto are not intended to encompass within their scope the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicants by a Patent Office or other entity or individual, the applicant(s) reserve the ight to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.
  • the present invention provides purified and isolated polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, both single and double stranded, including splice variants thereof) encoding human G protein-coupled receptors refe ⁇ ed to herein as GPCR polypeptides.
  • DNA polynucleotides ofthe invention include genomic DNA, cDNA, and DNA that has been chemically synthesized in whole or in part.
  • “Synthesized” as used herein and understood in the art refers to polynucleotides produced by purely chemical, as opposed to enzymatic, methods. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and “partially” synthesized DNAs embrace those wherein only portions ofthe resulting DNA were produced by chemical means.
  • Genomic DNA ofthe invention comprises the protein coding region for a polypeptide of the invention and is also intended to include allelic variants thereof. It is widely understood that, for many genes, genomic DNA is transcribed into RNA transcripts that undergo one or more splicing events wherein intron (i.e., non-coding regions) ofthe transcripts are removed, or "spliced out.” RNA transcripts that can be spliced by alternative mechanisms, and therefore be subject to removal of different RNA sequences but still encode a GPCR polypeptide ofthe present invention, are refe ⁇ ed to in the art as splice variants which are embraced by the invention. Splice variants comprehended by the invention therefore are encoded by the same original genomic DNA sequences but arise from distinct mRNA transcripts.
  • Allelic variants are modified forms of a wild type gene sequence, the modification lesulting from recombination din ing chromosomal segregation 01 exposure to conditions which give use to genetic mutation Alle c vanants, like wild type genes, arc natuially occu ⁇ ing sequences (as opposed to non-natuially occu ⁇ ing va ⁇ ants which a ⁇ se horn in viti o manipulation)
  • the invention also comprehends cDNA that is obtained thiough reverse transcription of an RNA polynucleotide encoding a GPCR of the present invention (conventionally followed by second strand synthesis of a complementary strand to provide a double-stranded DNA)
  • a preferred DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 1 , wherem nucleotides 157 to 1122 represent the CON 193 coding sequence, with termination codon (su ⁇ ounded by upstream and downstream untranslated sequences)
  • Another prefe ⁇ ed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 3, wherein nucleotides 1 to 1014 represent the CONl 66 coding sequence and stop codon
  • Still another prefe ⁇ ed DNA sequence encoding a human GPCR polypeptide is set out in SEQ TD NO 5, wherein nucleotides 691 to 1845 represent the CON 103 coding sequence with stop codon (su ⁇ ounded by upstream and downstream untranslated sequences)
  • Another prefe ⁇ ed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 7, wherem nucleotides 146 to 1147 represent the CON203 coding sequence with stop codon (su ⁇ ounded
  • a prefe ⁇ ed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO: 19, wherein nucleotides 42 to 1 157 represent the CON217 coding sequence (surrounded by upstream and downstream untranslated sequences).
  • the foregoing sequences without their termination codons also comprise prefe ⁇ ed sequences.
  • the prefe ⁇ ed DNA ofthe invention comprises a double stranded molecule, for example the molecule having any one ofthe sequences set forth in SEQ ID NOS: 1, 3, 5, 7, 9, 1 1,
  • Non-coding strand or “complement” having a sequence deducible from the sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19 according to Watson- Crick base pairing rules for DNA.
  • the invention further embraces species, preferably mammalian, homologs ofthe human GPCR DNAs. Species homologs, sometimes refe ⁇ ed to as
  • orthologs in general, share at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homoiogy with human DNA ofthe invention.
  • Percent sequence "homoiogy” with respect to polynucleotides of the invention is defined herein as the percentage of nucleotide bases in the candidate sequence that are identical to nucleotides in the GPCR sequence set forth in any one of SEQ ID NOS: 1, 3, 5, 7, 9, X X, 13, 15, 17, or 19 after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity.
  • the polynucleotide sequence information provided by the invention makes possible large scale expression ofthe encoded polypeptide by techniques well known and routinely practiced in the art.
  • Polynucleotides ofthe invention also permit ldentification and isolation of polynucleotides encoding related GPCR polypeptides, such as human allehc va ⁇ ants and species homologs, by well known techniques including Southern and/or Northern hybridization, and polymerase chain reaction (PCR)
  • related polynucleotides include human and non-human genomic sequences, including allehc variants, as well as polynucleotides encoding polypeptides homologous to GPCR polypeptides and structurally related the polypeptides sharing one or more biological, immunological, and/or physical properties of the GPCR polypeptides
  • Non-human species genes encoding proteins homologous to GPCR polypeptides can also be identified by Southern and/or PCR analysis and are useful in animal models for GPCR-related disorders Knowledge ofthe sequence of a human
  • GPCR DNA also makes possible, through use of Southern hybridization or polymerase chain reaction (PCR), the identification of genomic DNA sequences encoding GPCR expression control regulatory sequences such as promoters, operators, enhancers, repressers, and the like
  • Polynucleotides ofthe invention are also useful in hybridization assays to detect the capacity of cells to express GPCR polypeptides.
  • Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alterat ⁇ on(s) in a GPCR locus that underlies a disease state or states, which information is useful both for diagnosis and for selection of therapeutic strategies
  • the disclosure herein of full length polynucleotides encoding GPCR polypeptides ofthe present invention makes readily available to the worker of ordinary skill m the art every possible fragment ofthe full length polynucleotides
  • the invention therefore provides fragments of GPCR-encodmg polynucleotides comprising at least 14-15, and preferably at least 18, 20, 25, 50, or 75 consecutive nucleotides of a polynucleotide encoding GPCR polypeptides
  • fragment polynucleotides of the invention compnse sequences unique to the GPCR-encoding polynucleotide sequence, and therefore hybndize under highly stnngent or moderately st ⁇ ngent conditions only (i e
  • Exemplary highly stnngent hybridization conditions are as follows hybndization at 42°C in a hybndization solution compnsing 50% formamide, 1%
  • Expression constructs wherein GPCR-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided.
  • Expression control DNA sequences include promoters, enhancers, and operators, and are generally selected based on the expression systems in which the expression constmct is to be utilized. Prefe ⁇ ed promoter and enhancer sequences are generally selected for the ability to increase gene expression, while operator sequences are generally selected for the ability to regulate gene expression.
  • Expression constructs of the invention may also include sequences encoding one or more selectable markers that permit identification of host cells bearing the construct. Expression constructs may also include sequences that facilitate, and preferably promote, homologous recombination in a host cell. Prefe ⁇ ed consfructs of the invention also include sequences necessary for replication in a host cell.
  • Expression constructs are preferably utilized for production of an encoded protein, but also may be utilized simply to amplify GPCR-encoding polynucleotide sequences.
  • host cells including prokaryotic and eukaryotic cells, comprising a polynucleotide ofthe invention (or vector ofthe invention) in a manner which permits expression ofthe encoded GPCR polypeptide.
  • Polynucleotides ofthe invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector.
  • Methods for introducing DNA into the host cell well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with ca ⁇ iers such as liposomes, micelles, ghost cells, and protoplasts.
  • Expression systems of the invention include bacterial, yeast, fungal, plant, insect, invertebrate, and mammalian cells systems.
  • Host cells ofthe invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with GPCR polypeptides.
  • Host cells of the invention are also useful in methods for large scale production of GPCR polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide pioducts aie isolated from the cells or from the medium in which the cells are grown by purification methods known in the art, e g conventional chiomatogiaphic methods including lmmunoaffinity chromatography, rcceptoi affinity chromatography, hydrophobic interaction chromatography, lectin affinity chromatography, size exclusion filtration, cation or anion exchange chromatography, high pressure liquid chiomatography (HPLC), reverse phase HPLC, and the like
  • Still other methods of purification include those wherem the desired protein is expressed and purified as a fusion protein having a specific tag, label, or chelating moiety that is recognized by a specific binding partner or agent
  • the pu ⁇ fied protein can be cleaved to yield the desired protein, or be left as an intact fusion protein Cleavage of the fusion component may produce
  • GPCR DNA sequences allows for modification of cells to permit, or increase, expression of endogenous GPCR Cells can be modified (e g , by homologous recombination) to provide increased expression by replacing, in whole or in part, the naturally occu ⁇ ing GPCR promoter with all or part of a heterologous promoter so that the cells express GPCR polypeptides at higher levels
  • the heterologous promoter is inserted in such a manner that it is operatively linked to endogenous GPCR polypeptide encoding sequences [See, for example, PCT
  • amphfiable marker DNA e g , ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase
  • DNA may be inserted along with the heterologous promoter DNA If linked to the GPCR coding sequence, amplification ofthe marker DNA by standard selection methods results in co-amplification ofthe GPCR coding sequences in the cells
  • the DNA sequence information provided by the present invention also makes possible the development through, e g homologous recombination or
  • Fragment anti-sense molecules ofthe invention include those which specifically recognize and hybridize to GPCR RNA (as dete ⁇ uined by sequence comparison of DNA encoding GPCR polypeptides to DNA encoding other known molecules). Identification of sequences unique to GPCR-encoding polynucleotides, can be deduced through use of any publicly available sequence database, and/or through use of commercially available sequence comparison programs. The uniqueness of selected sequences in an entire genome can be further verified by hybridization analyses. After identification ofthe desired sequences, isolation through restriction digestion or amplification using any of the various polymerase chain reaction techniques well known in the art can be performed. Antisense polynucleotides are particularly relevant to regulating expression of GPCR polypeptides by those cells expressing GPCR mRNA.
  • Antisense nucleic acids preferably 10 to 20 base pair oligonucleotides capable of specifically binding to GPCR expression control sequences or GPCR RNA are introduced into cells (e.g., by a viral vector or colloidal dispersion system such as a liposome).
  • the antisense nucleic acid binds to the GPCR target nucleotide sequence in the cell and prevents transcription or translation ofthe target sequence.
  • Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention.
  • the antisense oligonucleotides may be further modified by poly-L-lysine, transfe ⁇ in polylysine, or cholesterol moieties at their 5' end.
  • GPCR polypeptide expression at either the transcriptional or translational level is useful to general cellular and/or animal models for diseases characterized by abe ⁇ ant expression. Suppression of GPCR polypeptide expression at either the transcriptional or translational level is useful to generate ccllular animal models for diseases characte ⁇ zed by aberrant GPCR polypeptide expiession
  • the GPCR polynucleotide and polypeptide sequences taught in the piesent invention facilitate the design of novel transcription factois for modulating GPCR polypeptide expression in native cells and animals, and cells transformed or tiansfected with GPCR polynucleotides
  • the Cys 2 -H ⁇ s 2 zinc finger proteins which bind DNA via their zinc finger domains, have been shown to be amenable to structural changes that lead to the recognition ol different target sequences
  • These artificial zinc finger proteins recognize specific target sites with high affinity and low dissociation constants, and are able to act as gene switches to modulate gene expression
  • Knowledge ofthe particular GPCR target sequence ofthe present invention facilitates the engineering of zinc finger proteins specific for the target sequence using known methods such as a combination of structure-based modeling and screening of phage display libraries [Segal et al , Proc Natl Acad Sci USA 96 2758-2763 (1999), Liu et al , Proc Nad Acad Sci USA 94 5525-30 (1997),
  • Each zinc finger domain usually recognizes three or more base pairs Since a recognition sequence of 18 base pairs is generally sufficient in length to render it unique in any known genome, a zinc finger protein consisting of 6 tandem repeats of zmc fingers would be expected to ensure specificity for a particular sequence [Segal et al , Proc Natl Acad Sci USA 96 2758-2763 (1999)]
  • the artificial zinc finger repeats designed based on GPCR polynucleotide sequences, are fused to activation or repression domains to promote or suppress GPCR polypeptides expression [Liu et al , Proc Natl Acad Sci USA 94 5525-30 (1997)]
  • the zinc finger domains can be fused to the TATA box-bind g factor (TBP) with varying lengths of linker region between the zinc finger peptide and the TBP to create either
  • Engineered zinc finger proteins can also be designed to bind RNA sequences for use in therapeutics as alternatives to antisense or catalytic RNA methods [McColl et al, Proc Natl Acad Sci USA 96:9521-6 (1999); Wu et al, Proc Natl Acad Sci USA 92:344-348 (1995)].
  • the present invention contemplates methods of designing such transcription factors based on the gene sequence of the invention, as well as customized zinc finger proteins, that are useful to modulate GPCR polypeptide expression in cells (native or transformed) whose genetic complement includes these sequences.
  • the invention also provides purified and isolated mammalian GPCR polypeptides encoded by a polynucleotide ofthe invention. Presently prefe ⁇ ed is a human GPCR polypeptide comprising the amino acid sequence set out in any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20.
  • the invention also embraces polypeptides that have at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least
  • Percent amino acid sequence "identity" with respect to the prefe ⁇ ed polypeptide ofthe invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in a GPCR polypeptide sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part ofthe sequence identity.
  • Percent sequence "homoiogy” with respect to the prefe ⁇ ed polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in a GPCR sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part ofthe sequence identity.
  • percent homoiogy is calculated as the percentage of amino acid residues in the smaller of two sequences which align with identical amino acid residue in the sequence being compared, when four gaps in a length of 100 amino acids may be introduced to maximize alignment [Dayhoff, in Atlas of Protein Sequence and Structure, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C. (1972), incorporated herein by reference].
  • Polypeptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. Glycosylated and non-glycosylated forms of GPCR polypeptides are embraced.
  • the invention also embraces variant (or analog) GPCR polypeptides.
  • insertion variants are provided wherein one or more amino acid residues supplement a GPCR amino acid sequence. Insertions may be located at either or both termini ofthe protein, or may be positioned within internal regions of the GPCR amino acid sequence. Insertional variants with additional residues at either or both termini can include for example, fusion proteins and proteins including amino acid tags or labels.
  • Insertion variants include GPCR polypeptides wherein one or more amino acid residues are added to a GPCR amino acid sequence, or to a biologically active fragment thereof.
  • Variant products ofthe invention also include mature GPCR polypeptide products, i.e., GPCR polypeptide products wherein leader or signal sequences are removed, with additional amino terminal residues.
  • the additional amino terminal residues may be derived from another protein, or may include one or more residues that are not identifiable as being derived from a specific proteins.
  • GPCR polypeptide products with an additional methionine residue at position -1 are contemplated, as are variants with additional methionine and lysine residues at positions -2 and -1 (Met "2 -Lys " '-GPCR).
  • Variants of GPCR polypeptide with additional Met, Met-Lys, Lys residues (or one or more basic residues in general) are particularly useful for enhanced recombinant protein production in bacterial host cell.
  • the invention also embraces GPCR polypeptide variants having additional amino acid residues which result from use of specific expression systems.
  • GST glutathione-S-transferase
  • Insertional variants also include fusion proteins wherein the amino and/or carboxy termini of a GPCR polypeptide is fused to another polypeptide.
  • the invention provides deletion variants wherein one or more amino acid residues in a GPCR polypeptide are removed. Deletions can be effected at one or both termini of the GPCR polypeptide, or with removal of one or more residues within the GPCR amino acid sequence. Deletion variants, therefore, include all fragments of a GPCR polypeptide.
  • the invention also embraces polypeptide fragments ofthe sequence set out in SEQ ID NO: 2 wherein the fragments maintain biological (e.g., ligand binding and/or intracellular signaling) or immunological properties of a GPCR polypeptide.
  • Fragments comprising at least 5, 10, 15, 20, 25, 30, 35, or 40 consecutive amino acids of SEQ ID NO: 2 are comprehended by the invention.
  • Prefe ⁇ ed polypeptide fragments display antigenic properties unique to or specific for human GPCR and its allelic and species homologs.
  • Fragments ofthe invention having the desired biological and immunological properties can be prepared by any ofthe methods well known and routinely practiced in the art.
  • the invention provides substitution variants of GPCR polypeptides.
  • Substitution variants include those polypeptides wherein one or more amino acid residues of a GPCR polypeptide are removed and replaced with alternative residues.
  • the substitutions are conservative in nature, however, the invention embraces substitutions that are also non-conservative. Conservative substitutions for this pu ⁇ ose may be defined as set out in Tables A, B, or C below.
  • Variant polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure.
  • a conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties.
  • Exemplary conservative substitutions are set out in Table A (from WO 97/09433, page 10, published March 13, 1997 (PCT/GB96/02197, filed 9/6/96), immediately below.
  • GPCR polypeptide variants that display ligand binding properties of native GPCR polypeptides and are expressed at higher levels, and variants that provide for constitutive active receptor are particularly useful in assays of the invention. Such variants also are useful in cellular and animal models for diseases characterized by aberrant GPCR polypeptide expression/activity.
  • polypeptides of the invention is intended to include polypeptides bearing modifications other than insertion, deletion, or substitution of amino acid residues.
  • the modifications may be covalent in nature, and include for example, chemical bonding with polymers, lipids, other organic, and inorganic moieties.
  • Such derivatives may be prepared to increase circulating half-life of a polypeptide, or may be designed to improve targeting capacity for the polypeptide to desired cells, tissues, or organs.
  • the invention further embraces GPCR polypeptides that have been covalently modified to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.
  • compositions comprising purified polypeptides ofthe invention.
  • Prefe ⁇ ed compositions comprise, in addition to the polypeptide ofthe invention, a pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used.
  • Exemplary diluents include, but are not limited to, water, saline solutions, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, glycerol, calcium phosphate, mineral oil, and cocoa butter.
  • antibodies e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bifunctional/bispecific antibodies, humanized antibodies, human antibodies, and complementary determining region (CDR)-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide ofthe invention) specific for GPCR polypeptides ofthe invention or fragments thereof.
  • CDR complementary determining region
  • Prefe ⁇ ed antibodies of the invention are human antibodies which can be produced and identified according to methods described in WO93/11236, published June 20, 1993, which is inco ⁇ orated herein by reference in its entirety.
  • Antibody fragments, including Fab, Fab ' , F(ab ' ) 2 , and F v are also provided by the invention.
  • variable regions of the antibodies of the invention recognize and bind GPCR polypeptides exclusively (i.e., able to distinguish GPCR polypeptides from other known GPCR polypeptides by virtue of measurable differences in binding affinity, despite the possible existence of localized sequence identity, homoiogy, or similarity between GPCR polypeptides and such polypeptides).
  • specific antibodies may also interact with other proteins (for example, S aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region ofthe molecule.
  • Non-human antibodies may be humanized by any methods known in the art.
  • the non-human CDRs are inserted into a human antibody or consensus antibody framework sequence. Further changes can then be introduced into the antibody framework to modulate affinity or immunogenicity.
  • Antibodies ofthe invention are useful for, for example, therapeutic pu ⁇ oses (by modulating activity of GPCR polypeptides), diagnostic pu ⁇ oses to detect or quantitate GPCR polypeptides, as well as purification of GPCR polypeptides.
  • Kits comprising an antibody ofthe invention for any ofthe pu ⁇ oses described herein are also comprehended.
  • a kit ofthe invention also includes a control antigen for which the antibody is immunospecific.
  • binding molecules including natural ligands and synthetic compounds, can be identified or developed using isolated or recombinant GPCR polypeptide products, GPCR polypeptide variants, or preferably, cells expressing such products. Binding partners are useful for purifying GPCR polypeptide products and dctection 01 quantification of GPCR polypeptide pioducts in fluid and tissue samples using known immunological proceedingsuies Binding molecules are also manifestly useful in modulating (i e , blocking, inhibiting or stimulating) biological activities of GPCR polypeptides, especially those activities involved in signal transduction
  • the DNA and amino acid sequence information provided by the present invention also makes possible identification of binding partner compounds with which a GPCR polypeptide or polynucleotide will interact Methods to identify binding partner compounds include solution assays, in vitro assays wherem GPCR polypeptides are immobilized, and cell based assays Identification of binding partner compounds of GPCR polypeptides provides candidates for therapeutic or prophylactic intervention in pathologies associated with GPCR polypeptide normal and
  • the invention includes several assay systems for identifying GPCR polypeptide binding partners
  • methods ofthe invention comprise the steps of (a) contacting a GPCR polypeptide with one or more candidate binding partner compounds and (b) identifying the compounds that bind to the GPCR polypeptide Identification ofthe compounds that bind the GPCR polypeptide can be achieved by isolating the GPCR polypeptide/binding partner complex, and separating the GPCR polypeptide from the binding partner compound. An additional step of characte ⁇ zmg the physical, biological, and/or biochemical properties ofthe binding partner compound is also comprehended in another embodiment ofthe invention.
  • the GPCR polypeptide/binding partner complex is isolated using a antibody lmmunospecific for either the GPCR polypeptide or the candidate binding partner compound
  • either the GPCR polypeptide or the candidate binding partner compound comprises a label or tag that facilitates its isolation
  • methods of the invention to identify binding partner compounds include a step of isolating the GPCR polypeptide/binding partner complex through interaction with the label or tag
  • An exemplary tag of this type is a poly-histidine sequence, generally around six histidine residues, that permits isolation of a compound so
  • the invention provides a method comprising the steps of (a) contacting an immobili/ed GPCR polypeptide with a candidate binding partner compound and (b) detecting binding of the candidate compound to GPCR polypeptide
  • the candidate binding partner compound is immobilized and binding of GPCR polypeptide is detected
  • Immobilization is accomplished using any of the methods well known in the art, including covalent bonding to a support, a bead, or a chromatographic resm, as well as non-covalent, high affinity interaction such as antibody binding, or use of stieptavidin/biotin binding wherein the immobilized compound includes a biotin moiety
  • Detection of binding can be accomplished (l) using a radioactive label on the compound that is not immobilized, (n) using a fluorescent label on the non- lmmobihzed compound, (in) using an antibody lmmunospecific for the non- immobilized compound, (IV) using a label on the
  • the invention also provides cell-based assays to identify binding partner compounds of a GPCR polypeptide
  • the invention provides a method composing the steps of contacting a GPCR polypeptide expressed on the surface of a cell with a candidate binding partner compound and detecting binding ofthe candidate binding partner compound to the GPCR polypeptide
  • the detection comp ⁇ ses detecting a calcium flux or other physiological cellular events caused by the binding ofthe molecule
  • Agents that modulate (i e , increase, decrease, or block) GPCR polypeptide activity or expression may be identified by incubating a putative modulator with a cell expressing a GPCR polypeptide or polynucleotide and determining the effect ofthe putative modulator on GPCR polypeptide activity or expression
  • the selectivity of a compound that modulates the activity of GPCR polypeptides can be evaluated by comparing its effects on GPCR polypeptides to its effect on other G coupled-protein receptor compounds
  • Selective modulators may include, for example, antibodies and other proteins,
  • Methods o the invention to identify modulators include variations on any of the methods described above to identify binding partner compounds, the variations including techniques wherein a binding partner compound has been identified and the binding assay is carried out in the presence and absence of a candidate modulator.
  • a modulator is identified in those instances where binding between the GPCR polypeptide and the binding partner compound changes in the presence of the candidate modulator compared to binding in the absence of the candidate modulator compound.
  • a modulator that increases binding between the GPCR polypeptide and the binding partner compound is described as an enhancer or activator, and a modulator that decreases binding between the GPCR polypeptide and the binding partner compound is described as an inhibitor.
  • the invention also comprehends high throughput screening (HTS) assays to identify compounds that interact with or inhibit biological activity (i.e., inhibit enzymatic activity, binding activity, etc.) of a GPCR polypeptide.
  • HTS assays permit screening of large numbers of compounds in an efficient manner.
  • HTS systems are contemplated to investigate GPCR receptor-ligand interaction.
  • HTS assays are designed to identify "hits” or “lead compounds” having the desired property, from which modifications can be designed to improve the desired property. Chemical modification ofthe "hit” or “lead compound” is often based on an identifiable structure/activity relationship between the "hit” and the GPCR polypeptide.
  • GPCR polypeptide-related human disease states The invention comprehends gene therapy to restore activity to treat those disease states. Delivery of a functional GPCR gene to appropriate cells is effected ex vivo, in situ, or in vivo by use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus), or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments).
  • viral vectors e.g., adenovirus, adeno-associated virus, or a retrovirus
  • physical DNA transfer methods e.g., liposomes or chemical treatments.
  • GPCR polypeptides of the invention in other human disease states, preventing the expression of or inhibiting the activity of GPCR polypeptides ofthe invention will be useful in treating the disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of GPCR polypeptides of the invention.
  • hicyte and Genbank expressed sequence tag (EST) databases were searched with the NCBI program Blastall using either the transmembrane VI region of known dopamine receptors (leading to the identification of CON193, CONl 66, CONl 03 and CON 203) or all known GPCR's except olfactory and opsin receptors (leading to the identification of CON 198, CONl 97, CON202, CON222, CON215) as query sequences, to find patterns suggestive of novel G protein-coupled receptors. Positive hits from the find-pattern program were further analyzed with the GCG program BLAST to determine which ones were the most likely candidates to encode a GPCR, using the standard (default) alignment produced by BLAST as a guide.
  • Each ABI cycle sequencing reaction contained about 0.5 ⁇ g of plasmid DNA. Cycle-sequencing was perfonned using an initial denaturation at 98°C for 1 minute, followed by 50 cycles using the following parameters: 98°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 60°C for 4 minutes. Temperature cycles and times were controlled by a
  • A.2 Screening of a Genomic Phage Library to Obtain a Full-Length GPCR Clone The PCR technique was used to prepare a genomic fragment for use as a probe specific for the genomic CONl 93 Clone. Based on the complete sequence of Clone 3091220H1, two oligonucleotide primers were designed: Primer LW1282: 5'- TAATACCTGCACTGCCCAC-3' (SEQ ID NO: 21 ; see nucleotides 876-894 of SEQ ID NO: 1 ) and Primer LW 1283: 5'-TCTTTCCTTCTCTTCTCACTCC-3' (SEQ ID NO: 22 see nucleotides 1 137-1 158 of SEQ ID NO: l ). These primers were designed to amplify a 283 base-pair fragment of genomic DNA containing a portion of the CON 193 coding region found in Clone 3091220H 1 (assuming the absence of introns in this region).
  • a suitable human genomic library constructed in EMBL3 SP6/T7 (Clontech Laboratories) was amplified to provide the materials required for screening.
  • Two microliters of the human genomic library (approximately 10 8 plaque- forming units per milliliter; Clontech Laboratories, catalog number HL1067J) were added to 6 ml of an overnight culture of K802 cells (Clontech Laboratories), and 250 ⁇ l aliquots were distributed into each of 24 tubes. The tubes were incubated at 37°C for 15 minutes, and then 7 ml of 0.8% agarose (i.e., top agarose) at 50°C were added to each tube.
  • 0.8% agarose i.e., top agarose
  • SM phage buffer 0.1 M NaCl, 8.1 ⁇ M MgSO 4 » 7H 2 O, 50 mM Tris-HCl (pH 7.5), and 0.0001 % gelatin
  • top agarose slurries containing phage were then placed in individual 50 ml centrifuge tubes.
  • PCR polymerase chain reaction
  • Each PCR reaction was done in a 20 ⁇ l reaction volume containing 8.84 ⁇ l H 2 O, 2 ⁇ l 10X PCR buffer ⁇ (Perkin-Elmer), 2 ⁇ l 25 mM MgCl 2 , 0.8 ⁇ l dNTP mixture (dATP, dCTP, dGTP, dCTP, each at 10 mM), 0.12 ⁇ l primer LW1282 (approximately 1 ⁇ g ⁇ l), 0.12 ⁇ l primer LW1283 (approximately 1 ⁇ g/ ⁇ l), 0.12 ⁇ l AmpliTaq Gold polymerase (5 Units/ ⁇ l, with "Units" as defined by the supplier, Perkin-Elmer) and 2 ⁇ l of phage from one ofthe 24 stock tubes.
  • the PCR reaction involved 1 cycle at 95 °C for 10 minutes and 80°C for 20 minutes, followed by 22 cycles at 95°C for 30 seconds, 72-51 °C for 2 minutes (72°C for this stage of the second cycle, with a decrease of one degree for this stage in each succeeding cycle), 72°C for one minute, followed by 30 cycles at 95°C for 15 seconds, 50°C for 30 seconds, and 72°C for one minute.
  • the contents from each reaction tube were loaded onto a 2% agarose gel and electrophoresed adjacent to known size standards to screen for PCR products of the expected size, indicative of a clone containing the 283 bp portion of Clone 3091220H1 amplified by the two selected primers.
  • a positive signal i.e., a fragment of the expected size
  • a 5 ⁇ l phage aliquot was used to establish a set of five serial dilutions (1/100, v/v) that were plated and incubated in the same manner as described for the amplification ofthe phage library.
  • BA85 nitrocellulose filters (Schleicher & Schuell) were placed on top of each of the plates for 1 hour to adsorb phage from the plaques that had formed in the top agarose during incubation. Each filter was then gently removed, placed phage side up in an individual petri dish, and covered with 4 ml of SM buffer for 15 minutes to elute the phage.
  • SM containing eluted phage was removed from each plate and used to set up a PCR reaction as described above.
  • the plate containing the most dilute phage solution to yield a PCR product ofthe expected size was then subdivided using the following procedure.
  • a BA85 filter was placed on the top agar of the plate and the medium with applied filter was physically divided into 24 sections. After one hour to allow phage adso ⁇ tion to the 24 filters, each filter was removed and separately incubated in
  • the purified CONl 93 genomic phage DNA was sequenced using the ABI PRISM 1 M 310 Genetic Analyzer (Perkin-Elmer/ Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM rM BigDye' M Terminator Cycle Sequencing Ready Reaction Kit.
  • the cycle-sequencing reaction contained 18 ⁇ l of H 2 O, 16 ⁇ l of BigDye IM Terminator mix, 3 ⁇ l of genomic phage DNA (0.26 ⁇ g/ ⁇ l), and 3 ⁇ l primer (25 ng/ ⁇ l).
  • the reaction was performed in a Perkin-Elmer 9600 fhermocycler at 95°C for 5 minutes, followed by 75 cycles of 95°C for 30 seconds, 55°C for 20 seconds, and 60°C for 4 minutes.
  • the final subclone was also sequenced using the ABI PRISM I M 310 Genetic Analyzer.
  • the cycle-sequencing reaction contained 6 ⁇ l of H 2 O, 8 ⁇ l of BigDye I M Terminator mix, 5 ⁇ l of miniprep clone DNA (0.1 ⁇ g/ ⁇ l), and 1 ⁇ l primer (25 ng/ ⁇ l).
  • the reaction was performed in a Perkin-Elmer 9600 thermocycler at 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes.
  • the product ofthe PCR reaction was purified using CentriflexTM gel filtration cartridges, dried under vacuum, and dissolved in 16 ⁇ l of Template Suppression Reagent (PE- Applied Biosystems). The samples were then incubated at 95°C for 5 minutes and placed in the 310 Genetic Analyzer.
  • the first PCR primer designated Primer LW1373, has the sequence 5'-GCATAAGCTTATGCTA-
  • ACACTGAATAAAACAG-3' (SEQ XD NO: 23), nucleotides 11-32 of which co ⁇ espond to nucleotides 157- 178 of SEQ ID NO: 1.
  • the second PCR primer is Primer LW1374, which has the sequence 5'-GCATCTCGAGTCACA- TGCTGTAGGATTTGG-3' (SEQ ID NO: 24, nucleotides 1 1-30 of which correspond to the complement of nucleotides 1 102-1 121 of SEQ ID NO: 1.
  • primers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessarily complementary to the desired target.
  • PCR was performed in a 50 ⁇ l reaction containing 35 ⁇ l H 2 O, 5 ⁇ l 10X TT buffer (140 mM ammonium sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4), 5 ⁇ l 15 mM MgSO 4 , 2 ⁇ l dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM),
  • the contents from the PCR reaction were loaded onto a 2% agarose gel, fractionated and electroeluted.
  • the DNA band of expected size was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge.
  • the eluted DNA was precipitated with ethanol and resuspended in 6 ⁇ l H 2 O for ligation.
  • the PCR-amplified DNA fragment containing the CONl 93 coding region was cloned into pCR2.1 using a protocol standard in the art.
  • the ligation reaction consisted of 6 ⁇ l of CONl 93 DNA, 1 ⁇ l 10X ligation buffer, 2 ⁇ l pCR2.1 (25 ng/ ⁇ l, Invitrogen), and 1 ⁇ l T4 DNA ligase (Invitrogen).
  • the reaction mixture was incubated overnight at 14°C and the reaction was then stopped by heating at 65 °C for 10 minutes. Two microliters of the ligation reaction were transformed into One Shot cells (Invitrogen) and plated onto ampicillin plates.
  • a single colony containing an insert was used to inoculate a 5 ml culture of LB medium.
  • the culture was grown for 18 hours and the plasmid DNA was purified using the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation ofthe sequence, pCR-CON193 was identified, and a 50 ml culture of LB medium was inoculated and recombinant plasmid DNA was purified using a Qiagen Plasmid Midi Kit to yield purified pCR-CON 193.
  • the database searching identified clone 2553280H1 in the lncyte database as an interesting candidate sequence.
  • the 2553280H1 clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer and the ABI PRISM I Ready Dye-Deoxy Terminator kit with Taq FSTM polymerase as described above for CON 193 in Example 1A.1. From the sequence it was deduced that clone
  • 2553280H1 contained 349 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR co ⁇ esponding to the sixth and seventh transmembrane regions (6TM and 7TM).
  • clone 2553280H1 contained 1.2 kb ofthe 3' untranslated sequence of that GPCR. Refe ⁇ ing to SEQ XD NO: 3, the nucleotide sequence of Clone 2553280H1 co ⁇ esponds to nucleotides 663 to 1,014 of what was eventually determined to be the complete sequence of a novel seven- transmembrane receptor that was designated CONl 66. A database search with this partial sequence showed a 44% match to an activated T cell-specific G protein- coupled receptor. B2. Screening of a Genomic Phage Library to Obtain a
  • PCR technique was used to prepare a genomic fragment for use as a probe specific for the genomic CONl 66 clone. Based on the complete sequence of clone 2553280H1, two oligonucleotide primers were designed: Primer LW1278: 5'- ACCGCTGCCTTTTTAGTC-3' (SEQ ID NO: 28; see nucleotides 715 to 732 of SEQ
  • These primers were designed to amplify a 259 base-pair fragment of genomic DNA containing a portion ofthe CONl 66 coding region found in clone 2553280H1 (assuming the absence of introns in this region).
  • PCR Polymerase chain reaction
  • the PCR reaction involved 1 cycle at 95°C for 10 minutes and 80°C for 20 minutes, followed by 12 cycles at 95°C for 30 seconds, 72-61 °C for 2 minutes (72°C for this stage ofthe second cycle, with a decrease of one degree for this stage in each succeeding cycle), 72°C for 30 seconds, followed by 30 cycles at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.
  • ABI PRISM I M 310 Genetic Analyzer which uses advanced capillary electrophoresis technology and the ABI PRISMTM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit as described above for CONl 93 in Example 1 A.2. These efforts resulted in the determination ofthe CON166 polynucleotide sequence set forth in SEQ ID NO: 3 and the deduced amino acid sequence ofthe encoded CON166 polypeptide which is set forth in SEQ ID NO: 4.
  • the first PCR primer designated Primer LW1405, has the sequence
  • primers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessarily complementary to the desired target.
  • the second PCR primer is Primer LW1406, which has the sequence 5'- AAGCATAACTATACTTTACATATTTCTTC-3' (SEQ TD NO: 30, nucleotides 9-29 of which co ⁇ espond to the reverse complement of nucleotides 994-1014 of SEQ ID NO: 3).
  • PCR was performed in a 50 ⁇ l reaction containing 34 ⁇ l H 2 O, 5 ⁇ l 10X
  • TT buffer 140 mM ammonium sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4
  • 5 ⁇ l 15 mM MgSO 4 2 ⁇ l dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM)
  • 3 ⁇ l genomic phage DNA (0.25 ⁇ g/ ⁇ l), 0.3 ⁇ l Primer LW1405 (1 ⁇ g/ ⁇ l), 0.3 ⁇ l Primer LW1406 (1 ⁇ g/ ⁇ l), 0.4 ⁇ l High Fidelity Taq polymerase (Boehringer Mannheim).
  • the PCR reaction was started with 1 cycle of 94°C for 2 minutes; followed by 25 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1.3 minutes.
  • the contents from the PCR reaction were loaded onto a 2% agarose gel and fractionated.
  • the DNA band of expected size (1,031 bp) was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microfuge.
  • the eluted DNA was precipitated with ethanol and resuspended in 6 ⁇ l H 2 O for ligation.
  • the PCR-amplified DNA fragment containing the CON 166 coding region was cloned into pCR2.1 to generate pCR-CONl 66 using a protocol standard in the art.
  • the ligation reaction was ca ⁇ ied out as described for CON 193 in
  • the resulting plasmid DNA was purified using the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation of the sequence, a 50 ml culture of LB medium was inoculated with the transformed One Shot cells, cultured, and processed using a Qiagen Plasmid Midi Kit to yield purified pCR-CON166.
  • the database searching identified clone 1581220H1 in the Incyte database as an interesting candidate sequence.
  • the 1581220H1 clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer and the ABI
  • clone 1581220H1 contained 454 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR co ⁇ esponding to the sixth and seventh transmembrane regions (6TM and 7TM).
  • clone 1581220H1 contained 454 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR co ⁇ esponding to the sixth and seventh transmembrane regions (6TM and 7TM).
  • clone 1581220H1 contained 454 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR co ⁇ esponding to the sixth and seventh transmembrane regions (6TM and 7TM).
  • clone 1581220H1 contained 454 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR co ⁇ esponding to
  • PCR technique was used to prepare a genomic fragment for use as a probe specific for the genomic CONl 03 clone. Based on the complete sequence of clone 1581220H1, two oligonucleotide primers were designed: Primer LW1280: 5'-
  • TCTGCACACAGCTCTTCCATGG-3' (SEQ ID NO: 32; see nucleotides 1568-1589 of SEQ TD NO: 5) and Primer LW1281 : 5'-TCCCTTGTCCAGTTGGTTGAGG-3'
  • the PCR reaction involved 1 cycle at 95°C for 10 minutes and 80°C for 20 minutes, followed by 12 cycles at 95°C for 30 seconds, 72-61°C for 2 minutes (72°C for this stage ofthe second cycle, with a decrease of one degree for this stage in each succeeding cycle), 72°C for one minute, followed by 30 cycles at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.
  • each reaction tube was loaded onto a 2% agarose gel and electrophoresed adjacent to known size standards to screen for PCR products ofthe expected size of 380 bp, indicative of a clone containing the portion of clone 1581220H1 amplified by the two selected primers.
  • a positive signal i.e., a fragment ofthe expected size
  • the CON 103 clone was sequenced using the ABI PRIS I 3 10 Genetic Analyzer
  • the cycle-sequencing reaction contained 6 ⁇ l ol H 2 O, 8 ⁇ l of BigDye 1 ⁇ Teiminator mix, 5 ⁇ l of miniprep clone DNA (0 1 ⁇ g/ ⁇ l), and 1 ⁇ l primer (25 ng/ ⁇ l)
  • the reaction was performed m a Perkin-Elmet 9600 the ⁇ nocycler at 25 cycles ol 96°C for 10 seconds, 50°C for 10 seconds, and 60°C foi 4 minutes
  • the product of the PCR reaction was purified using Cent ⁇ flexTM gel filtiation cartridges, dried under vacuum, and dissolved in 16 ⁇ l of Template Suppiession Reagent (PE- Apphed Biosystems) The samples were then incubated at 95°C for 5 minutes and placed in the 310 Genetic Analyzer
  • PCR was performed in a 50 ⁇ l reaction containing 22 6 ⁇ l H 2 O, 5 ⁇ l 10X TT buffer (140 mM ammonium sulfate, 0 1% gelatin, 0 6 M T ⁇ s-tocine, pH 8 4), 5 ⁇ l 15 mM MgSO 4 , 10 ⁇ l rapid dye (Oogene), 2 ⁇ l dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM), 0 5 ⁇ l genomic phage DNA (0 97 ⁇ g/ ⁇ l), 0 3 ⁇ l Primer LW1385 (1 ⁇ g/ ⁇ l), 0 3 ⁇ l Pomer LW1386 (1 ⁇ g/ ⁇ l), and 0 4 ⁇ l High Fidelity
  • Taq polymerase Boeh nger Mannheim The PCR reaction was started with 1 cycle of 94°C for 2 minutes, followed by 12 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 .3 minutes.
  • the contents from the PCR reaction were loaded onto a 2% agarose gel and fractionated.
  • the DNA band of expected size (1 ,212 bp) was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge.
  • the eluted DNA was precipitated with ethanol and resuspended in 6 ⁇ l H 2 O for ligation.
  • the PCR-amplified DNA fragment containing the CON 103 coding region was cloned into pCR2.1 using a protocol standard in the art.
  • the ligation reaction was ca ⁇ ied out as described above for CONl 93 in Example 1 A.3.
  • the resulting plasmid DNA was purified using the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation of the sequence, pCR- CON103 was identified, and a 50 ml culture of LB medium was inoculated, cultured, and processed using a Qiagen Plasmid Midi Kit to yield purified pCR-CON103.
  • the database searching identified clone 3210396H1 in the Incyte database as an interesting candidate sequence.
  • the 3210396H1 clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer and the ABI
  • nucleotides 984 to 1,002 of SEQ ID NO: 7 for the reverse complement of nucleotides 9-29 of SEQ ID NO: 36
  • SEQ TD NO: 37 see nucleotides 1- 19 of SEQ ID NO: 7 which co ⁇ espond to nucleotides 11-29 of SEQ ID NO: 37.
  • primers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessarily complementary to the desired target. These primers were designed to amplify a 1,020 base-pair fragment of clone 3210396H1 containing the complete coding region of CON203.
  • PCR was perfo ⁇ ned in a 50 ⁇ l reaction containing 34 ⁇ l H 2 O, 5 ⁇ l 10X TT buffer (140 mM ammonium sulfate, 0.1 % gelatin, 0.6 M Tris-tricine, pH 8.4), 5 ⁇ l
  • the contents from the PCR reaction were loaded onto a 1.2% agarose gel and fractionated.
  • the DNA band of expected size (1,020 bp) was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge.
  • the eluted DNA was precipitated with ethanol and resuspended in 6 ⁇ l H 2 O for ligation.
  • the PCR-amplified DNA fragment containing the CON203 coding region was cloned into pCR2.1 using a standard protocol and the Original TA Cloning Kit (Invitrogen). Ligation reactions were ca ⁇ ied out as described above for CON 193 in Example 1 A.3. The resulting plasmid DNA was purified using the Concert Rapid
  • Plasmid Miniprep System GibcoBRL
  • pCR-C203 was identified, and a 50 ml culture of LB medium was inoculated, cultured, and processed using a Qiagen Plasmid Midi Kit to yield purified pCR-C203.
  • the CON203 clone was sequenced using the ABI PRISMTM 310
  • the cycle-sequencing reaction contained 6 ⁇ l of H 2 O, 8 ⁇ l of BigDye I M Terminator mix, 5 ⁇ l of miniprep clone DNA (0.1 ⁇ g/ ⁇ l), and 1 ⁇ l primer (25 ng/ ⁇ l).
  • the reaction was perfo ⁇ ued in a Perkin-Elmer 9600 the ⁇ nocycler using the following conditions: 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes.
  • the product of the PCR reaction was purified using CentriflexTM gel filtration cartridges, dried under vacuum, and dissolved in 16 ⁇ l of Template Suppression Reagent (PE-Applied Biosystems). The samples were then incubated at 95°C for 5 minutes and placed in the 310 Genetic Analyzer.
  • the method involves modification of a sequence during PCR amplification, for which PCR primers LW1387 (5'- GAGAAATATTTTTCTAAAAAAACCTGTTTTTTTGCAAAAACGG-3'; SEQ ID NO: 38) and LW1388 (5'-CCGTTTTTGCAAAAACAGGTTTTTTTAGAAAA- ATATTTCTC-3'; SEQ XD NO: 39) were used.
  • the PCR reaction contained 40 ⁇ l H 2 O, 5 ⁇ l 10X proprietary Reaction Buffer (Stratagene), 1 ⁇ l pCR-C203 (0.125 ⁇ g/ ⁇ l) mini-prep DNA, 1 ⁇ l dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM), 1 ⁇ l Pfu DNA polymerase (2.5 Units/ ⁇ l), 1 ⁇ l LW1387 (125 ng/ ⁇ l) and 1 ⁇ l LW1388 (125 ng/ 1).
  • the cycle conditions were 95°C for 30 seconds, followed by 12 cycles at 95°C for 30 seconds, 55°C for 1 minute, and 68°C for 12 minutes.
  • the database searching identified Clone 3359808HI in the Incyte database as an interesting candidate sequence.
  • the 3359808HI clone was obtained and sequenced using standard techniques. From the sequence it was deduced that Clone 3359808HI contained the entire coding region for a previously unidentified GPCR, which was designated "CONl 98.”
  • the DNA and deduced amino acid sequences for CON198 are set forth in SEQ XD NOS: 9 and 10, respectively.
  • a database search with this CONl 98 DNA sequence showed a 61% match to the rat putative GPCR designated RAlc [Raming et. al, Recept Channels, 6: 141-151 (1998)] and 46% identity to an olfactory receptor.
  • RAlc Randoming et. al, Recept Channels, 6: 141-151 (1998)
  • CON 198 coding sequence underlined
  • the second, Primer LW1327, from 5' to 3' (S ⁇ Q ID NO: 43): GCATCTCGAGCCTAGGGCTCTGAAGCG. includes sequence complementary to the 3' end ofthe CON 198 coding sequence (underlined), preceded by a XhoX restriction site sequence useful for subsequent cloning and expression work.
  • the PCR was performed in a 50 ⁇ l reaction containing 34 ⁇ l H 2 O, 5 ⁇ l of 10X TT buffer (140 mM Ammonium Sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4), 5 ⁇ l of 15 mM MgSO 4 , 2 ⁇ l of 10 mM dNTPs (dATP, dCTP, dTTP, dGTP), 2 ⁇ l of Clone 3359808H1 mini-prep DNA (approx. 0.125 ⁇ g/ ⁇ l), 0.3 ⁇ l of Primer LW1326 (1 ⁇ g/ ⁇ l), 0.3 ⁇ l of Primer LW1327 (1 ⁇ g/ ⁇ l), and 0.5 ⁇ l of High Fidelity
  • Taq polymerase Boehringer Mannheim. The PCR reaction was started with 1 cycle of 94°C for 2 minutes, followed by 12 cycles at 94°C for 30 seconds. 55°C for 30 seconds, and 72°C foi 1 minute
  • the resulting plasmid DNA was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CON 198 insert Sequencing ofthe subcloned CON 198 construct revealed that the PCR amplification had introduced a mutation (relative to the sequence of the original clone) at the nucleotide co ⁇ esponding to position 204 of SEQ ID NO- 9 A site-directed mutagenesis expe ⁇ ment was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) to repair the mutation
  • primer LW1416 (SEQ ID NO- 45) contained the sequence
  • the PCR reaction contained 40 ⁇ l of H 2 O, 5 ⁇ l of lOx Reaction buffer, 1 ⁇ l of mmi-prep DNA (approx 0 125 ⁇ g/ ⁇ l) from the CON198-pCR2 1 clone (as template), 1 ⁇ l of primer LW1415 (125 ng/ ⁇ l), 1 ⁇ l of primer LW1416 (125 ng/ ⁇ l), 1 ⁇ l of 10 mM dNTPs, 1 ⁇ l Pfu DNA polymerase.
  • the PCR cycle conditions were as follows initial denaturation at 95°C for 30 seconds, then 14 cycles at 95°C for 30 seconds, 55°C annealing for 1 minute, and 68°C extension for 12 minutes Thereafter, the reaction tube was placed on ice for 2 minutes After PCR, 1 ⁇ l of Dpi ⁇ was added and the tube incubated at 37°C for one hour to digest the methylated parental DNA template.
  • One microliter of the _D ?/;I-treated DNA was transformed into Epicurian coli XLl-Blue supercompetent cells and the entire insert was re-sequenced. The resequencing confirmed that position 204 of SEQ ID NO: 9 had been successfully reverted to a guanine nucleotide.
  • the E. coli transformant was used to inoculate a 50 ml culture of LB medium. The culture was grown for 16 hours at 37°C, and centrifuged into a cell pellet. Plasmid DNA was purified from the pellet using a Qiagen Plasmid Midi Kit and again sequenced to confirm successful cloning ofthe CONl 98 insert, using an ABI377 fluorescence-based sequencer and the ABI
  • the database searching identified Clone 866390H1 in the Incyte database as an interesting candidate sequence.
  • the 866390H1 clone was obtained and sequenced using standard techniques. From the sequence it was deduced that Clone 866390H1 contained the entire coding region for a previously unidentified GPCR, which was designated "CON197.”
  • CONl 97 are set forth in SEQ ID NOs: 11 and 12, respectively.
  • a database search with this CONl 97 DNA sequence showed a 42% match to an olfactory receptor.
  • F.2 Subcloning of the Coding Region of CONl 97 via PCR
  • GATCCTCGAGTCAGGCTATGTGCTTATTAAACACC includes sequcncc complementary to the 3' end ol the CON 197 coding sequence (underlined), pieceded by a Xhol restriction site sequence useful fot subsequent cloning and expression work
  • the PCR was performed in a 50 ⁇ l reaction containing 24 ⁇ l H 2 O, 10 ⁇ l Rapid Dye Loading buffer (Origene) 5 ⁇ l 10X TT buffer (140 mM Ammonium
  • the purified PCR fragment containing the CONl 97 coding sequence was ligated into a commercial vector using Invitrogen's Onginal TA Cloning Kit
  • the resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CONl 97 insert
  • the database searching identified Clone Number 1305513H1 in the Incyte database as an interesting candidate sequence.
  • the 1305513H 1 clone was obtained and sequenced using an ABI377 fluorescence-based sequencer (Perkin
  • a human genomic phage library was selected as a source from which to attempt to clone the CON202 gene.
  • the genomic library was amplified as described above for CON193 in Example 1A.2. This genomic library was screened by PCR using the primers: GV599
  • the PCR reaction consisted of 1 cycle at 95°C for 10 minutes; then 17 cycles at 95°C for 20 seconds, 72°C for 2 minutes decreasing 1°C each cycle, 72"C for 30 seconds followed by 30 cycles at 95°C for 20 seconds, 55°C for 30 seconds, and 72"C for 30 seconds.
  • PCR products were visualized on a 2% agarose gel.
  • five microliters from each original phage culture tube were used to amplify the CON202 genomic phage DNA as described above for CON 193 in Example 1 A.2.
  • the genomic DNA from the single phage isolate was sequenced with the ABI PRISMTM 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISMTM Big DyeTM Terminator Cycle Sequencing Ready Reaction Kit.
  • the cycle-sequencing reaction contained 20 ml of H 2 O, 16 ml of BigDyeTM Terminator Mix, 1 ml of genomic phage
  • Perkin-Elmer 9600 thermocycler at 95°C for 5 minutes, followed by 99 cycles of 95°C for 30 seconds, 55°C for 20 seconds and 60°C for 4 minutes.
  • the product was purified using a CentriflexTM gel filtration cartridge, dried under a vacuum, then dissolved in 16 ml of Template Suppression Reagent. The samples were heated at
  • PCR reaction was started with 1 cycle of 94°C for 2 minutes; followed by 12 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 .3 minutes.
  • the contents from the PCR reaction were loaded onto a 2.1 % agarose gel and electrophoresed.
  • the DNA band of expected size (1.1 kb) was excised from the gel, placed on a GenElute Agarose spin column (Supelco), and spun for 10 minutes at maximum speed in a microfuge.
  • the eluted DNA was ethanol-precipitated and resuspended in 6 ⁇ l of H 2 O for ligation.
  • the cycle-sequencing reaction contained 6 ml of H2O, 8 ml of BigDyeTM Terminator mix, 5 ml miniprep DNA (0.1 mg/ml), and 1 ml primer (25 ng/ml).
  • the reaction was performed in a Perkin-Elmer 9600 thermocycler at 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes.
  • the product was purified using CentriflexTM gel filtration cartridges, dried under vacuum, then dissolved in 16 ml of Template Suppression Reagent.
  • Incyte sequence is a consensus sequence derived by compiling multiple, shorter contiguous (apparently overlapping) partial sequences from cDNA clones. A single clone known to contain the complete consensus sequence was not available from Incyte.
  • the following experiments were performed to clone a piece of human DNA which co ⁇ esponds to the region ofthe theoretical Incyte Sequence Number 2488822CB that was deduced to encode a heretofore undescribed GPCR.
  • the human DNA and protein that was eventually isolated is refe ⁇ ed to herein as CON222.
  • PCR primers were designed based on the 5' and 3' ends ofthe open reading frame that was identified in the Incyte Sequence Number 2488822CB1.
  • the first primer designated as LW1440, has the sequence
  • the second primer designated LW1441 has the sequence 5 ⁇ ACAGTCATGAATAGGAATTGAG3' (SEQ XD NO: 61) which is the reverse complement of nucleotides 1173 to 1191 of SEQ ID NO: 15 (underlined).
  • PCR was performed in a 50 ml reaction containing 22.1 ml H 2 O, 10 ml Rapid Dye Loading Buffer (Origene), 5 ml 1 Ox TT buffer (140 mM Ammonium Sulfate, 0.1%o gelatin, 0.6 M Tris-tricine pH 8.4), 5 ml 15 mM MgSO 4 , 2 ml 10 mM dNTP's (dATP, dCTP, dGTP, dTTP), 5 ml human genomic DNA (0.03 mg/ml) (Clontech, Cat# 6550-1), 0.3 ml of Primer LW1440 (1 mg/ml) (SEQ XD NO: 59), 0.3 ml of LW1441 (1 mg/ml) (SEQ XD NO: 60), 0.4 ml High Fidelity Taq polymerase (Boehringer Mannheim).
  • the PCR reaction was started with 1 cycle of 94°C for 2 minutes followed by 10 cycles at 94°C for 30 seconds, 55°C for 2 minutres, 72°C for 2 minutes then 25 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minutes.
  • the PCR reaction was loaded onto a 1.2% agarose gel. The resulting band was not 1.2 kB in length as expected, indicating that this method was unsuccessful in identi fying an appropriate clone from the selected Clontech genomic DNA library containing the coding region of CON222.
  • a human genomic DNA phage library was selected as an alternate source from which to attempt to clone the CON222 gene. Internal primers were designed to attempt to isolate from a genomic library a single phage which expresses the complete coding region. The procedure was ca ⁇ ied out as described above for CONl 93 in Example 1A.2.
  • 5OCCATTCTGTCCACAGAAG3' (SEQ ID NO: 58; see nucleotides 391 to 410 of SEQ XD NO: 15) and Primer LW1443: 5TCAGTTGCTGTTATGGCAC3' (SEQ ID NO: 59; see reverse complement of nucleotides 744 to 761 of SEQ TD NO: 15).
  • These primers were designed based on the deduced coding region of Incyte Sequence Number 2488822CB1, to amplify a 370 bp fragment (co ⁇ esponding to nucleotides
  • the 50 ⁇ l PCR reactions each contained 32 ⁇ l of H 2 O, 5 ⁇ l of lOx PCR gold buffer (PE Applied Biosystems), 5 ⁇ l of 25 mM MgCl 2 , 2 ⁇ l of 10 mM dNTP's (dATP, dCTP, dGTP, dTTP), 0.3 ⁇ l of primer LW1442 (1 ⁇ g/ml), 0.3 ⁇ l of primer LW1443 (1 ⁇ g/ml), 0.4 ⁇ l AmpliTaq Gold polymerase (5 U/ ⁇ l, with "Units" defined by the supplier; PE Applied Biosystems) and 5 ⁇ l of phage isolated human genomic DNA (0.03 ⁇ g/ ⁇ l).
  • the PCR reaction consisted of 1 cycle at 95°C for 10 minutes, then 17 cycles at 95°C for 20 seconds and 72 ⁇ C for 2 minutes decreasing 1 degree each cycle, and 72°C for 1 minute, followed by 30 cycles at 95°C for 20 seconds, 55°C for 30 seconds, and 72°C for 1 minute. An aliquot ofthe PCR reaction was loaded onto a
  • the DNA band was excised from the gel, placed on GenElute Agarose spin columns (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge.
  • the eluted DNA was ethanol-precipitated and resuspended in 10 ⁇ l of H,0 and 5 ⁇ l was used to sequence the PCR band.
  • the PCR fragment was sequenced with an ABI PRISMTM 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISMTM BigDyeTM Terminator Cycle Sequencing Ready
  • Each cycle-sequencing reaction contained 6 ml of H 2 O, 8 ml of BigDye Terminator mix, 5 ml PCR fragment DNA (0.2 mg/ml), and 1 ml Primer LW1442 (25 ng/ml) and Primer LW1443 (25 ng/ml).
  • the reaction was performed in a Perkin- Elmer 9600 thermocycler with 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60 U C for 4 minutes.
  • the product was purified using CentriflexTM gel Reagent (PE
  • sequence analysis determined that there is an intron in the middle of the 5th transmembrane-spanning domain between nucleotides 673 and 674 in SEQ ID NO: 15. This intron was responsible for the unexpectedly large PCR fragment.
  • the 50 ⁇ l PCR reaction contained 37.4 ⁇ l of H 2 O, 5 ⁇ l of lOx cDNA PCR buffer (Clontech), 1 ⁇ l of 10 mM dNTP's (dATP, dCTP, dTTP, dGTP), 5 ⁇ l of Marathon-Ready Fetal Brain cDNA (Clontech), 0.3 ⁇ l of Primer LW1440 (1 ⁇ g/ ⁇ l),
  • PCR reaction was started with 1 cycle of 94°C for 1 minute, followed by 30 cycles at 94°C for 30 seconds, 50°C for 30 seconds, and 68°C for 3 minutes. The contents from the PCR reaction were loaded onto a 1.2% agarose gel and electrophoresed.
  • the DNA band of expected size (1 .2 kb) was excised from the gel, placed on a GenElute Agarose spin column (Supelco), and spun for 10 minutes at maximum speed in a microfuge The eluted DNA was cthanol-piecipitated and resuspended in 6 ⁇ l H 2 O foi ligation H.4 Subcloning of Coding Region of CON222 via PCR After a cDNA containing the full length CON222 open reading frame was obtained, the coding region of CON222 was then subcloned into a more useful vector as follows
  • Example 1 A 3 The resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CON222 insert
  • the subcloned insert in pCR2 1 was sequenced using the ABI PRISMTM 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary technology and the ABI PRISM TM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit Each cycle-sequence reaction contained 6 ml of H 2 O, 8 ml of BigDyeTM Terminator mix, 5 ml mmi-prep DNA (0 1 mg/ml), and 1 ml of primer (25 ng/ml) and was performed in a Perkin-Elmer 9600 thermocycler with 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes.
  • ABI PRISMTM 310 Genetic Analyzer PE Applied Biosystems
  • ABI PRISM TM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit Each cycle-sequence reaction contained 6 ml of H 2 O, 8 ml of BigDyeTM Terminator mix, 5
  • the product was purified using a CentnflexTM gel filtration cartndge, vacuum dried and dissolved in 16 ml of Template Suppression Reagent (PE Applied Biosystems) The samples were heated at 95°C for 5 minutes then placed in the 310 Genetic Analyzer
  • the database searching identified Clone 1452259H1 in the Incyte database as an interesting candidate sequence.
  • the sequence from 1452259H1 clone was used to search the Incyte fill-length database and matched the entry 1650519CB 1.
  • Incyte Clone 2796157H1 probably contained the full-length coding region. Sequence analysis of Incyte Clone 2796157H1 indicated that it contains the entire coding region for a previously unidentified GPCR, which was designated "CON215", along with 12 nucleotides of 5' untranslated region, 63 nucleotides of 3' untranslated region and a poly A + tail.
  • CON215" The DNA and deduced amino acid sequences for CON215 are set forth in SEQ TD NOS: 17 and 18, respectively. A database search with this CON215 sequence showed a 47% match to the human probable G protein-coupled receptor K1A0001.
  • the Incyte Clone 2796157H1 was sequenced using the ABI PRISMTM 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISMTM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit as described above for CON222 in ExamplelH.4.
  • the Incyte database search identified EST 3700658H1 as an interesting candidate sequence.
  • the EST sequence No. 3700658H1 was used to search the Incyte full length database.
  • This search identified Incyte clone No. 3356166H1 as a clone that potentially contained a full length GPCR co ⁇ esponding to the selected EST.
  • the 3356166H1 clone was obtained from Incyte and sequenced using an ABI377 fluorescence-based sequencer ( and the ABI PRISMTM Ready Dye-Deoxy Terminator kit with Taq FS I M polymerase as described above for CON193 in Example 1A.1.
  • PCR primers were designed based on the 5' and 3' ends ofthe open reading frame that was identified in the Incyte Clone No. 3356166H1.
  • the first primer designated as LW1448, has the sequence 5 ⁇ AGCGGTACCATGTTAGCCAACAGCTCCTC3' (SEQ ID NO: 66) which co ⁇ esponds to nucleotides 42 to 62 of SEQ ID NO: 19
  • the second primer designated LW1449, has the sequence 5 ⁇ AGCTCTAGATCAGAGGGCGGAATCCTGG3' (SEQ ID NO: 67) which is the reverse complement of nucleotides 1 142 to 1160 of SEQ TD NO: 20 (underlined).
  • the primers also include recognition sequences (bold) for the restriction enzymes Kpnl and Xbal, respectively.
  • PCR was performed in a 50 ml reaction containing 32.5 ml of H 2 O, 5 ml of lOx Pfx Amplification buffer (GibcoBRL), 5 ml of lOx PCR Enhancer solution (GibcoBRL), 1.5 ml of 50 mM MgSO 4 , 2 ml of 10 mM dNTP's (dATP, dCTP, dGTP, dTTP), 3 ml 3356166H1 mini-prep DNA (0.125 mg/ml obtained with the Concert Rapid Plasmid Miniprep System; GibcoBRL), 0.3 ml of Primer LW1448 (1 mg/ml)
  • the ligation reaction was ca ⁇ ied out as described above for CON 193 in Example 1A.3.
  • the resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confi ⁇ n that the plasmid contained the CON217 insert and to confinn that no e ⁇ ors were introduced during PCR amplification.
  • the resulting construct was denoted as pCR-CON217.
  • the final subclone was sequenced using the ABI PRISMTM 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISMTM Terminator Cycle Sequencing Ready Reaction Kit as described above for CON222 in Example 1H.4.
  • CON193 The DNA and deduced amino acid sequence for CONl 93 are set forth in SEQ ID NOS: 1 and 2, respectively. Beginning with the initiation codon (methionine), the CON 193 genomic Clone contains an open reading frame of 963 nucleotides encoding 321 amino acids, followed by a stop codon. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput.
  • CONl 93 was shown to contain seven transmembrane-spanning domains co ⁇ esponding to residues 30-49 (1TM), 61-81 (2TM), 103-122 (3TM), 146-165 (4TM), 199-222 (5TM), 243-262 (6TM), and 270-295 (7TM) of SEQ XD NO: 2. These transmembrane domains define first ("N-terminal,” residues 1-29), second ("first EC loop,” residues 82-102), third (“second EC loop,” residues 166-198), and fourth ("third EC loop,” residues 263-269) extracellular domains, as well as first
  • first IC loop residues 50-60
  • second IC loop residues 123-145
  • third residues 223-242
  • fourth residues 296-321
  • CON193 polynucleotide sequence was compared to sequences of known genes. CON193 is 45% identical and 72% similar to the mouse olfactory receptor gene S19 [see Malnic et al., Cell 96:713-723 (1999)]. This level of sequence similarity suggests that CON 193 is a novel GPCR.
  • the CON 193 cDNA clone (SEQ XD NO: l) was deposited with the
  • CONl 66 The DNA and deduced amino acid sequence for CONl 66 are set forth in SEQ ID NOS: 3 and 4, respectively. Beginning with the initiation codon (methionine), the CONl 66 genomic clone contains an open reading frame of 1,011 nucleotides encoding 337 amino acids, followed by a stop codon. Using a
  • CON166 was shown to contain seven transmembrane- spanning domains co ⁇ esponding to the following residues presented in SEQ ID NO: 4: 1TM (30-49), 2TM (59-79), 3TM (99-119), 4TM (141-161), 5TM (191 -215), 6TM (231 -251 ), and 7TM (277-296) .
  • transmembrane domains define first ("N- terminal,” residues 1-29), second ("first EC loop,” residues 80-98), third ("second EC loop,” residues 162-190), and fourth ("third EC loop,” residues 252-276), extracellular domains as well as first ("first IC loop,” residues 50-58), second ("second IC loop,” residues 120-140), third ("third IC loop,” residues 216-230), and fourth ("C-terminal,” residues 297-337) intracellular domains.
  • CON 166 amino acid sequence (SEQ TD NO:2) reveals that this GPCR contains an FRC sequence following the third transmembrane domain (3TM), which is typically occupied by a consensus DRY sequence in other GPCRs; a PLLY sequence is also found in the seventh transmembrane domain (7TM).
  • CON 166 polynucleotide sequence was compared to sequences of known genes. CON 166 is 44% identical and 62% similar to a T-cell-specific G protein-coupled receptor o ⁇ Gallus gallus found in the TREMBL database (Accession No. L06109). This level of sequence similarity suggests that CONl 66 is a novel GPCR.
  • the CON166 cDNA clone (SEQ ID NO:3) was deposited with the
  • CONl 03 The DNA and deduced amino acid sequence for CONl 03 are set forth in SEQ ID NOS: 5 and 6, respectively. Beginning with the initiation codon (methionine), the CONl 03 genomic clone contains an open reading frame of 1 ,152 nucleotides encoding 384 amino acids, followed by a stop codon and a short open reading frame (SEQ ID NO: 5). Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl.
  • CON103 was shown to contain seven transmembrane-spanning domains co ⁇ esponding to the following residues in SEQ ID NO: 6: 54-77 (1TM), 89-108 (2TM), 134-149 (3TM), 167-188 (4TM), 216-240 (5TM), 258-283 (6TM), and 301-320 (7TM).
  • transmembrane domains define first ("N-terminal,” residues 1-53), second ("first EC loop,” residues 109-133), third (“second EC loop,” residues 189-215), and fourth ("third EC loop,” residues 284-300) extracellular domains, as well as first ("first IC loop,” residues 78-88), second ("second IC loop,” residues 150-166), third ("third IC loop,” residues 241-257), and fourth ("C-terminal,” residues 321-384) intracellular domains.
  • CON 103 amino acid sequence SEQ ID NO: 6
  • CON 103 polynucleotide sequence was compared to sequences of known genes. CON 103 is 36% identical to GPR31 (GenBank Accession
  • the CON 103 cDNA clone (SEQ ID NO:5) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000.
  • the clone was given accession no. B- 30247.
  • CON203 The DNA and deduced amino acid sequence for CON203 are set forth in SEQ TD NOS: 7 and 8, respectively. Beginning with the initiation codon (methionine), the CON203 genomic clone contains an open reading frame of 999 nucleotides encoding 333 amino acids, followed by a stop codon. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl Biosci., 5: 527-
  • CON203 was shown to contain seven transmembrane-spanning domains co ⁇ esponding to the following residues of SEQ TD NO: 7: nucleotides 29-53 (1TM), 63-82 (2TM), 97-118 (3TM), 136-160 (4TM), 189-211 (5TM), 232-252 (6TM), and 281-300 (7TM). These transmembrane domains define first ("N-terminal,” residues 1-28), second ("first EC loop,” residues 83-96), third ("second EC loop,” residues
  • CON203 amino acid sequence SEQ XD NO: 8
  • CON203 amino acid sequence SEQ XD NO: 8
  • this GPCR contains a DRF sequence following the third transmembrane domain (3TM), which is typically occupied by a consensus DRY sequence in other GPCRs; CON203 also exhibited a PLIY sequence in the seventh transmembrane domain (7TM).
  • CON203 polynucleotide sequence was compared to sequences of known genes. CON203 is 33% identical to a platelet activating receptor (GenBank Accession No. AF002986. This level of sequence similarity suggests that
  • CON203 is a novel GPCR.
  • the CON203 cDNA clone (SEQ ID NO: 7) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000.
  • the clone was given accession no. B-
  • the DNA and deduced amino acid sequence for CONl 98 are set forth in SEQ TJD NO: 9 and 10 respectively. Beginning with the initiator methionine, the
  • CON198 genomic clone contains an open reading frame of 954 nucleotides encoding 318 amino acids, followed by a stop codon. It will be appreciated that residue 2 of SEQ ID NO: 10 also is a methionine. Amino-terminal sequencing of purified native or recombinant CON 198 protein will provide an indication as to which methionine acts as an initiator codon in vivo. Using a FORTRAN computer program called
  • CONl 98 contains a DRY sequence following the third transmembrane domain (TM3), a feature that is conserved in most GPCR.
  • TM3 transmembrane domain
  • the CON 198 cDNA clone (SEQ ID NO 9) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Ag ⁇ cultuic 1815 North University Street, Peo ⁇ a, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000 The clone was given accession no B- 30252
  • CON197 The DNA and deduced amino acid sequence for CON 197 are set forth in SEQ ID NO 1 1 and 12, respectively Beginning with the initiator methionine, the CONl 97 genomic clone contains an open reading frame of 921 nucleotides encoding 307 ammo acids, followed by a stop codon Using a FORTRAN computer program called "tmtrest all" [Parodi et al , Comput Appl Biosci , 5 527-535 (1994)], CON197 was deduced to contain seven transmembrane-spanning domains co ⁇ esponding to residues 23-47 (TM1), 58-78 (TM2), 99-120 (TM3), 142-164 (TM4), 195-219 (TM5), 237-258 (TM6), and 270-289 (TM7) of SEQ TD NO 12 These transmembrane domains define first ("N-terminal” residues 1-22), second (“first EC loop "residues 79- 98), third ("
  • CONl 97 contains a DRY sequence following the third transmembrane domain (TM3), a feature that is conserved in most GPCR
  • TM3 third transmembrane domain
  • the CONl 97 cDNA clone (SEQ ID NO 11) was deposited with the National Center for Ag ⁇ cultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peo ⁇ a, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000 The clone was given accession no B-
  • CON202 The DNA and deduced amino acid sequence foi this phage insert, termed "CON202", are set forth in SEQ ID NO 13 and 14, respectively
  • CON202 open leading fiame begins with the mitiatoi methionine and spans 1 1 10 nucleotides which encode 370 amino acids, followed by a stop codon Since this gene was isolated from genomic DNA and there aie no apparent interruptions in the sequence, it is likely that CON202 contains no introns within the coding legion
  • the full length clone of CON202 contained seven transmembrane-spanning domains co ⁇ esponding to residues, 24 to 46 (TM 1 ) , 57 to 77 (TM2), 96 to 1 17 (TM3), 135 to 159,(TM4)
  • TMV comprises 184 to 202 (TM5)
  • transmembrane domains define first ("N-termmal,” residues 1-23), second ("first EC loop,” residues 78-95), third ("second EC loop,” residues 160-183), and fourth ("third EC loop,” residues 309-315) extracellular domains as well as first ("first IC loop,” residues 47-56), second ("second IC loop,” residues 118-134), third ("third IC loop,” residues 203-285), and fourth ("C-terminal,” residues 340-370) intracellular domains
  • the CON202 cDNA clone (SEQ ID NO 13) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peona, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000 The clone was given accession no B- 30253
  • CON222 coding region deduced the DNA and amino acid sequence set forth in SEQ TD NO 15 and 16, respectively
  • the open reading frame that is depicted in SEQ XD NO 16 begins with an initiator codon and spans 1188 nucleotides which encode 396 ammo acids, followed by a stop codon
  • the full length clone of CON222 contains seven transmembrane- spanning domains co ⁇ esponding to residues 42-65 (TM1) 79-103, (TM2), 125-156, (TM3), 167-188 (TM4), 217-241 (TM5), 268-290 (TM6), 301-320 (TM7) of SEQ ID NO: 16.
  • TM2 is followed by a FRC sequence and TM7 contains a PILY sequence within.
  • These transmembrane domains define first ("N-terminal,” residues 1 -41 ), second ("first EC loop,” residues 104-124), third ("second EC loop,” residues 189- 216), and fourth ("third EC loop,” residues 291 -300) extracellular domains as well as first (“first IC loop,” residues 66-78), second ("second IC loop,” residues 157-166), third ("third IC loop,” residues 242-267), and fourth ("C-te ⁇ ninal,” residues 321-396) intracellular domains.
  • a search of the public database indicated that CON222 is about 35% identical to a unique GPCR found in the nervous system of Lymnaea stagnalis.
  • the CON222 cDNA clone (SEQ ID NO: 15) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30257.
  • CON215 The DNA and deduced amino acid sequence for CON215 are set forth in SEQ ID NO: 17 and 18, respectively. Beginning with the initiator methionine, the CON215 genomic clone contains an open reading frame of 1074 nucleotides encoding
  • CON215 was deduced to contain seven transmembrane-spanning domains co ⁇ esponding to residues 42-66 (TM1), 81-99 (TM2), 116-137 (TM3), 156-180 (TM4), 210-234 (TM5), 256-275 (TM6), and 308-328 (TM7) of SEQ XD NO: 18.
  • transmembrane domains define first ("N-terminal,” residues 1-41), second ("first EC loop,” residues 100-115), third ("second EC loop,” residues 181-209), and fourth ("third EC loop,” residues 276-307) extracellular domains as well as first ("first IC loop,” residues 67-80), second ("second IC loop,” residues 138-155), third ("third IC loop,” residues 235-255), and fourth ("C-terminal,” residues 329-358) intracellular domains.
  • CON215 contains a DRY sequence following the third transmembrane domain (TM3), a feature that is conserved in most GPCR.
  • CON215 also contains a PIIY sequence within the seventh transmembrane domain (TM7).
  • the CON215 cDNA clone (SEQ ID NO: 17) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30255.
  • the DNA and deduced amino acid sequences of CON217 are set forth as SEQ ID NO: 19 and 20, respectively.
  • the open reading frame that is depicted in SEQ ID NO: 2 begins with an initiator methionine codon and spans 11 16 nucleotides which encode 372 amino acids, followed by a stop codon.
  • the nucleotide sequence consists of 41 bp in the 5' untranslated region and 1323 bp in the 3' untranslated region.
  • CON217 contains seven transmembrane- spanning domains as indicated by the FORTRAN computer program "tmtrest.all” [Parodi et al, Comput. Appl. Biosci., 5: 527-535 (1994)] which co ⁇ esponds to 29-50 (TM1), 57-75 (TM2), 96-117 (TM3), 137-160 (TM4), 188-210 (TM5), 235-258
  • TM6 277-297
  • TM7 contains a PLVY sequence within.
  • first N-terminal
  • second first EC loop
  • third second EC loop
  • third fourth
  • extracellular domains as well as first (“first IC loop,” residues 51-56), second (“second IC loop,” residues 118-136), third (“third IC loop,” residues 21 1 -234), and fourth ("C-terminal,” residues 298-372) intracellular domains.
  • CON217 is about 41 % identical to GPR23 (Genebank Accession No.: U66578) and to a purinergic receptor P2Y9 (Genebank Accession No.: U90322).
  • the CON215 cDNA clone was deposited with the
  • the polynucleotides (SEQ ID NO: 1 , 3, 5, 7, 9, 1 1 , 13, 15 and 17) encoding the GPCR polypeptides of the invention were deposited with the Agricultural Research Service Culture Collection (NRRL) at the National Center Agricultural Utilization Research at the U.S. Department of the Agriculture 1815 North University Street, Peoria, Illinois 61604. These deposits were made in accordance with the Budapest Treaty on the International Recognition ofthe Deposit of Microorganism for the Pu ⁇ oses of Patent Procedures. The table below lists the details of these deposits.
  • NRRL Agricultural Research Service Culture Collection
  • GPCR polynucloetides in mammals, such as the rat, was investigated by in situ hybridization histochemistry. Coronal and sagittal rat brain cryosections (20 ⁇ m thick) were prepared using a Reichert-.lung cryostat. Individual sections were thaw-mounted onto silanized, nuclease-free slides (CEL Associates, Inc., Houston, TX), and stored at -80°C.
  • Sections were processed starting with post-fixation in cold 4% paraformaldehyde, rinsed in cold phosphate-buffered saline (PBS), acetylated using acetic anhydride in triethanolamine buffer, and dehydrated through a series of alcohol washes in 70%, 95%, and 100% alcohol at room temperature. Subsequently, sections were delipidated in chloroform, followed by rehydration through successive exposure to 100% and 95% alcohol at room temperature. Microscope slides containing processed cryosections were allowed to air dry prior to hybridization.
  • PBS cold phosphate-buffered saline
  • a CONl 93 -specific probe was generated using PCR.
  • the probe consisted of a 270 bp fragment containing sequence at the 3' end of CON-193.
  • the primers for PCR amplification were LW 1248 [5'-
  • the CONl 93 Clone in pBluescriptll was linearized with BamRX, which provided a substrate for labeled run-off transcripts (i.e., cRNA riboprobes) using the vector-borne T7 promoter and commercially available T7 RNA polymerase.
  • a probe specific for the antisense strand of CON 193 was also readily prepared using the CONl 93 Clone in pBluescriptll by cleaving the recombinant plasmid with EcoRI to generate a linearized substrate for the production of labeled run-off cRNA transcripts using the T3 promoter and cognate polymerase.
  • the riboprobes were labeled with [ 35 S]-UTP to yield a specific activity of 0.81 x 10 6 cpm/pmol for antisense riboprobes and 0.55 x 10 6 cpm/pmol for sense-strand riboprobes. Both riboprobes were subsequently denatured by incubating at 70°C for 3 minutes and added (2 pmol/ml) to hybridization buffer which contained 50% formamide, 10% dextran, 0.3 NaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, IX Denhardt's Solution, and 10 mM dithiothreitol. Microscope slides containing sequential brain cryosections were independently exposed to 45 ⁇ l of hybridization solution per slide and silanized cover slips were placed over the sections being exposed to hybridization solution. Sections were incubated overnight (15-18 hours) at
  • coverslips were washed off the slides in IX SSC. Slides were subjected to RNase A treatment by incubation in a buffer containing 20 ⁇ g/ml RNase A, 10 mM Tris (pH 8.0), 0.5 M NaCl and 1 mM
  • cryosections were then subjected to three high- stringency washes in 0.1 X SSC at 52°C for 20 minutes each. Following the series of washes, cryosections were dehydrated by consecutive exposure to 70%, 95%, and 100% ammonium acetate in alcohol, followed by air drying and exposure to Kodak BioMax MR-1 film. After 13 days of exposure, the film was developed. Based on these results, brain sections that gave rise to positive hybridization signals were coated with Kodak NTB-2 nuclear track emulsion and the slides were stored in the dark for 32 days The slides were then developed and counterstained with hematoxylin. Emulsion-coated sections were analyzed microscopically to determine the specificity of labeling. The signal was determined to be specific if autoradiographic grains
  • CON 193 in the brain provides an indication that modulators of CON193 activity have utility for treating neuiological disorders, including but not limited to, schizophienia, depression, anxiety, bipolai disease, epilepsy, neuritis, neui asthenia, neuropathy, neuroses, and the like
  • Use of CON 193 modulators, including CON 193 ligands and ant ⁇ -CON 193 antibodies, to treat individuals having such disease states is intended as an aspect of the invention
  • CONl 66-spec ⁇ fie probe was generated using PCR as described above for CONl 93 in Example 3 A (but using CON166-spec ⁇ fic primers)
  • the probe consisted of a 259 bp fragment containing sequence at the 3' end of CON- 166
  • nboprobes (nucleotides 715-974 of SEQ ID NO 1) and containing terminal EcoRI and BamTXX rest ⁇ ction sites
  • the nboprobes were labeled with [ 35 S]-UTP to yield a specific activity of 0.40 x 10 6 cpm/pmol for antisense riboprobes and 0 65 x 10 6 cpm/pmol for sense-strand nboprobes Hybndization with the riboprobes and subsequent washing ofthe slides was earned out as descnbed above for CONl 93 in Example 3 A
  • CON103a and CON103b A cocktail of two CON103-specific antisense oligonucleotide probes (CON103a and CON103b) were used because of the relatively high GC content ofthe CONl 03 coding region.
  • the CON103a sequence (5TTTATTAATATTGGAAGGGACAAACTGGAGAGCACAGAACAT3'; SEQ ID NO: 1
  • Terminal deoxynucleotidyltransferase and [a - 33 P]dATP were used to 3' end-label CONl 03a
  • Microscope slides containing sequential brain cryosections were independently exposed to 45 ⁇ l of hybridization solution (containing the antisense oligonucleotide probes CON103a and CON 103b) per slide and silanized cover slips were placed over the sections being exposed to hybridization solution. Sections were incubated overnight (15-18 hours) at 37°C to allow hybridization to occur.
  • cryosections were dehydrated by consecutive exposure to 70%, 95%, and 100% ethanol (0.3 M ammonium acetate added to 70% and 95% ethanol solutions), followed by air drying and exposure to Kodak BioMax MR-1 film. After 28 days of exposure, the film was developed. Based on these results, brain sections that showed positive hybridization signals were coated with Kodak NTB-2 nuclear track emulsion and the slides were stored in the dark for four months. The slides were then developed and counterstained with hematoxylin.
  • Emulsion-coated sections were analyzed microscopically to determine the specificity of labeling.
  • the signal was determined to be specific if autoradiographic grains (generated by antisense probe hybridization) were present over cell bodies and not trapped between cell bodies.
  • Specific labeling with the antisense probe occu ⁇ ed in all cortical regions, including the piriform cortex and hippocampus.
  • the specificity of labeling was confirmed by microscopic analysis of emulsion-coated cryosections. These sections revealed that the autoradiographic grains resulting from antisense riboprobe in situ hybridizations were distributed over cell bodies rather than trapped between cell bodies.
  • CONl 03 mRNA in the cortical and paralimbic regions ofthe mammalian brain suggests that ligands for this GPCR may be involved in signal transductions important for cellular processes underlying neurological functioning.
  • expression of CON 103 in the brain provides an indication that modulators of CONl 03 activity have utility for treating neurological and neuropsychiatric disorders, including but not limited to, schizophrenia, depression, anxiety, attention deficit disorder (with or without hyperactivity), bipolar disease, epilepsy, migraine, neuritis, neurasthenia, neuropathy, neuroses, obesity,
  • CONl 03 modulators including CON103 ligands and anti-CON103 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
  • CON203-specific cRNA probes were prepared using conventional techniques. Initially, a 293 bp fragment of the CON203 coding region, with a BamHX site and an EcoRI site disposed on opposite ends, was prepared by PCR using primers LW1314 (5'-GCATGAATTCCCACCTTCATCATCTACCTC-3'; S ⁇ Q ID NO: 40) and LW1315 (5'-GCATGGATCCGAAGACCAAAAAGACCCAG-3'; S ⁇ Q ID NO:
  • LW1314 includes an EcoRT site and additional protective residues at its 5' terminus, with the test of the sequence co ⁇ esponding to CON203 coding nucleotides 164- 183, which con cspond to positions 309-328 of SEQ ID NO 7
  • LW1315 includes 5' protective nucleotides and a Bamtil site, with the rest of the sequence co ⁇ esponding to the complement of CON203 coding nucleotides 438-456, which co ⁇ espond to positions 583-601 of SEQ ID NO 7
  • the PCR-amphfied fragment was then digested with Bamtil and EcoRI and ligated into the co ⁇ esponding sites of pBluescript II to yield pCon203 BS
  • the recombinant clone was then linearized either with BamtiX or EcoRI Linearization with BamTXX provided a substrate for in vitro expression of a sense-strand cRNA probe using the vector-borne T7 promoter Di
  • the probe hybridized to CON203 mRNAs in the following regions ofthe bra cortical regions, including the pinform cortex, neost ⁇ atum, lateral olfactory tract, hypothalamic nuclei, bed nucleus ofthe stria terminahs, amygdala, hippocampus, reticular thalamus and other thalamic regions, subthalamic nucleus, and the red nucleus
  • regions ofthe bra cortical regions including the pinform cortex, neost ⁇ atum, lateral olfactory tract, hypothalamic nuclei, bed nucleus ofthe stria terminahs, amygdala, hippocampus, reticular thalamus and other thalamic regions, subthalamic nucleus, and the red nucleus
  • the specificity of labeling was confirmed by microscopic analysis of emulsion-coated cryosections These sections revealed that the autoradiographic grains resulting from antisense nboprobe in situ hybrid
  • CON203 mRNA in the cortical (particularly, motor circuits) and paralimbic regions of the mammalian brain suggests that CON203 and the ligands for this GPCR may be involved in signal transductions important for cellular processes underlying neurological functioning.
  • expression of CON203 in the brain provides an indication that modulators of
  • CON203 activity have utility for treating neurological disorders, including but not limited to, schizophrenia, depression, anxiety, bipolar disease, epilepsy, migraine, attention deficit disorder (with or without hyperactivity), neuritis, neurasthenia, neuropathy, neuroses, Parkinson's disease, dementia, obesity, and the like.
  • CON203 modulators including CON203 ligands and anti-CON203 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
  • Primer LW1308 5 '-GCATGAATTC ACTCACTTCTCATCTCCTTC-3 ' (S ⁇ Q XD NO: 46) and LW1309:5'-GCATGGATCCAATCTCCTTTGTCTTCACTC-3' (S ⁇ Q ID NO: 47)
  • Primer LW1308 contains an EcoRI site (underlined) followed by sequence identical to nucleotides 638-657 of S ⁇ Q XD NO: 9.
  • Primer LW1309 contain a BamTXX site (underlined) followed by sequence complementary to nucleotides 903-884 of S ⁇ Q
  • the amplification product was digested with EcoRI and BamTXX, and then subcloned into an EcoRI- and if ⁇ mHI-digested pBluescript H vector (Stratagene).
  • the 266 amplified and subcloned basepairs co ⁇ espond to nucleotides 638 to 903 of S ⁇ Q ID NO: 9.
  • the subcloned CON198-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments.
  • the construct was linearized with BamtiX, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes.
  • the riboprobes were labeled with 3 S-UTP to yield a specific activity of 0.45 x 10 6 cpm/pmol for antisense and 0.732 x 10 6 cpm/pmol for sense probe.
  • Hybridization with the riboprobes and subsequent washing of the slides was carried out as described above for CON 193 in Example 3A.
  • Specific labeling with the antisense probe showed distribution of CON 198 mRNA in the rat brain in several limbic and paralimbic regions as well as areas thought to be involved in voluntary motor control. Labelled regions included cortical regions, piriform cortex, hypothalamic nuclei (paraventricular nucleus, supraoptic nucleus, suprachiasmatic nucleus), hippocampus, reticular thalmus, substantia nigra-pars compacta (SN-C), ventral tegmental area, and the red nucleus.
  • the specificity of labeling was confirmed by microscopic analysis of emulsion coated sections. These sections revealed that the autoradiographic grains generated by the antisense probe were distributed over cell bodies rather than trapped between cell bodies. Sense probe did not generate specific labeling.
  • CONl 98 mRNA provides a therapeutic indication for natural ligands for CONl 98 as well as modulators of CON198 activity, such as anti-CON198 antibody substances or small molecules that agonize or antagonize ligand-mediated CON 198 signalling.
  • the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, depression, anxiety, bipolar disease, affective disorders, ADHD/ ADD, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzheimer's disease,
  • CONl 98 modulators including CON198 ligands and anti-CON198 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
  • Such modulators are administered by any means effective to safely deliver the modulators to the CON198-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or ca ⁇ ier.
  • Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that correlates with disease severity or treatment efficacy.
  • CON 197 provides a biochemical or behavioral marker that correlates with disease severity or treatment efficacy.
  • a 261 bp fragment of CON 197 containing EcoRI and Bamtil restriction sites was amplified from the full-length clone by PCR, using the primers LW 1306: 5'-GCATGAATTCTTCTACTTCATCATCCTCC-3' (S ⁇ Q ID NO: 50) and LW 1307: 5'-GCATGGATCCAAAGGCCATCACAACAAG-3' (S ⁇ O ID NO: 51).
  • Primer LW 1306 includes sequence identical to nucleotides 100- 1 18 of S ⁇ Q ID NO: 1 1 (underlined), preceded by an EcoRI site.
  • Primer LW1307 includes sequence complementary to nucleotides 361-343 of S ⁇ Q TD NO: 1 1 (underlined), preceded by a Bamtil restriction site. The amplification product was digested with EcoRI and Bamtil, and then subcloned into an EcoRI- and if ⁇ mHI-digested pBluescript II vector
  • the subcloned CON197-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments.
  • the construct was linearized with BamtiX, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes.
  • the riboprobes were labeled with 35 S-UTP to yield a specific activity of 0.51 x 10 6 cpm/pmol for antisense and 0.432 x 10 6 cpm/pmol for sense probe.
  • Hybridization with the riboprobes and subsequent washing ofthe slides was carried out as described above for CONl 93 in Example 3 A.
  • Specific labeling with the antisense probe showed wide spread distribution of CONl 97 mRNA in the rat brain. Labelled regions included neo and allo cortex, piriform cortex, neostriatum, thalamic nuclei, hypothalamic nuclei, hippocampus, amygdala, cerebellum, and the olfactory bulb. The specificity of labeling was confirmed by microscopic analysis of emulsion coated sections. These sections revealed that the autoradiographic grains generated by the antisense probe were distributed over cell bodies rather than trapped between cell bodies. Sense probe did not generate specific labeling.
  • CON 197 mRNA The observed regional distribution of CON 197 mRNA provides a therapeutic indication for natural ligands for CON 197 as well as modulators of
  • CON 197 activity such as anti-CON197 antibody substances or small molecules that agonize or antagonize ligand-mediated CON197 signalling.
  • the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to dementia, schizophrenia, depression, anxiety, bipolar disease, migraine, Parkinson's disease, affective disorders, Alzheimer's disease, senile dementia, attention deficit hyperactivity disorder/attention deficit disorder (ADHD/ADD), epilepsy, neuritis, neurasthenia, neuropathy, neuroses, and the like.
  • Use of CON 197 modulators, including CON 197 ligands and anti-CON197 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
  • modulators are administered by any means effective to safely deliver the modulators to the CON 197- expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or carrier.
  • Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that co ⁇ elates with disease severity or treatment efficacy.
  • a 272 bp fragment of CON202 containing EcoRI and BamHI restriction sites was amplified from the full-length clone by PCR, using the primers LW1310 GCATGAATTCGCAGAAGAAGGCTATTGG (SEQ ID NO: 56) and
  • LW1311 GCATGGATCCGCAGTAAAGAAGGGTTGTG (SEQ ID NO: 57).
  • the amplification product was digested withJEcoRI and BamHI, and then subcloned into a pBluescript II vector (Strategene) that was digested with EcoRI and BamHI.
  • the 272 amplified and subcloned basepairs co ⁇ espond to nucleotides 1065 to 1336 of SEQ ID NO: 13.
  • the subcloned CON202-Bluescript constiiict was used to generate strand-specific probes for the in situ hybridization experiments.
  • the construct was linearized with BamHI, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes.
  • the riboprobes were labeled with 5 S-UTP to yield a specific activity of 4.7 x 10 5 cpm/pmol for antisense and 4.3 x lO 3 cpm/pmol for sense piobe Hybndization with the ⁇ bopiobcs and subsequent washing of the slides was earned out as described above foi CON 193 in Example 3A
  • CON202 mRNA provides a therapeutic indication for natural ligands for CON202 as well as modulators of CON202 activity, such as ant ⁇ -CON202 antibody substances or small molecules that agomze or antagonize hgand-mediated CON202 signaling
  • the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuntis, neurasthenia, neuropathy, neuroses, Alzheimer's disease, Parkinson's disease, migraine, senile dementia and the like
  • Use of CON202 modulators, including CON202 ligands and ant ⁇ -CON202 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention
  • Such modulators are administered by any means effective to safely deliver the modulators to the CON202-express ⁇ ng cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable
  • a 264 bp fragment of CON222 containing EcoRI and BamHI restriction sites was amplified from the full-length clone by PCR, using the primers LW1472 (5OCAT ⁇ ATTCTGCCATGTCAATCATTTCTCTC3', SEQ XD NO 62, EcoRI site is underlined) and LW1473 (5'GCATGGATCCGTTCTGCATTTTCC-
  • the amplification product was digested with EcoRI and BamHI, and then subcloned into a predigested pBluescript H vector (Stratagene).
  • the 264 ampli fied and subcloned basepairs correspond to nucleotides 237 to 500 of SEQ ID NO: 15.
  • the subcloned CON222-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments.
  • the construct was linearized with BamHI, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes.
  • the riboprobes were labeled with 35 S-UTP to yield a specific activity of 4.25 x 10 5 cpm/pmol for antisense and 3.9 x 10 5 cpm/pmol for sense probe.
  • Hybridization with the riboprobes and subsequent washing ofthe slides was ca ⁇ ied out as described above for CON 193 in Example 3 A.
  • Labelled regions included the cortical regions, piriform cortex, striatum, hippocampus, thalamus, hypothalamus, dorsal raphe, and habenula.
  • CON222 mRNA provides a therapeutic indication for natural ligands for CON222 as well as modulators of CON222 activity, such as anti-CON222 antibody substances or small molecules that agonize or antagonize ligand-mediated CON222 signaling.
  • the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzhemeimer's disease, Parkinson's Disease, migraine, senile dementia, and the like.
  • CON222 modulators including CON222 ligands and anti-CON222 antibodies
  • Such modulators are administered by any means effective to safely deliver the modulators to the CON222-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or ca ⁇ ier.
  • Efficacy of treatment can initially be determined in any accepted animal model that provides a - I l l - biochemical or behavioral marker that correlates with disease severity or treatment efficacy.
  • CON215 A 261 bp fragment of CON215 containing EcoRI and BamtiX restriction sites was amplified from the full-length clone by PCR, using the primers LW 141 1 : 5'-GCATGAATTCTGCCAAACATCATCCTGAC-3' (S ⁇ Q ID NO: 64) and LW1412: 5'-GCATGGATCCTACACAGCCACAACAACCC-3' (S ⁇ Q ID NO: 65).
  • Primer LW1411 contains an EcoRI site (underlined) followed by sequence identical to CON215 coding nucleotides 521-537, which correspond to positions 533-
  • Primer LW1412 contain a BamtiX site (underlined) followed by sequence complementary to CON215 coding nucleotides 764-781, which co ⁇ espond to positions 776-793 of S ⁇ Q TD NO: 17.
  • the amplification product was digested with EcoRI and BamtiX, and then subcloned into an EcoRI- and BamtiX- digested pBluescript II vector (Stratagene). The 261 amplified and subcloned basepairs co ⁇ espond to nucleotides 521 to 781 of S ⁇ Q ID NO: 17.
  • the subcloned CON215-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments.
  • the construct was linearized with BamtiX, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes.
  • the riboprobes were labeled with 35 S-UTP to yield a specific activity of 48.03 x 10 6 cpm/pmol for antisense and 48.09 x 10 6 cpm/pmol for sense probe.
  • Hybridization with the riboprobes and subsequent washing ofthe slides was carried out as described above for CONl 93 in Example 3 A. Subsequently, the slides were exposed to Kodak BioMax MR-1 film.
  • CON215 mRNA in the rat brain in limbic endocrine and motor circuits was present in the cortex, hippocampus, and red nucleus. The specificity of labeling was confirmed by microscopic analysis of emulsion coated sections. These sections revealed that the autoradiographic grains generated by the antisense probe were distributed over cell bodies rather than trapped between cell bodies. Sense probe did not generate specific labeling.
  • CON215 mRNA provides a therapeutic indication for natural ligands for CON215 as well as modulators of CON215 activity, such as anti-CON215 antibody substances or small molecules that agonize or antagonize ligand-mediated CON1215 signaling.
  • the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, depression, anxiety, bipolar disease, epilepsy, migraine, attention deficit (with or without hyperactive disorder), neuritis, neuasthenia, neuropathy, neuroses, Parkinson's disease, dementia, obesity, and the like.
  • Use of CON215 modulators, including CON215 ligands and anti-CON215 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
  • modulators are administered by any means effective to safely deliver the modulators to the CON215-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or carrier.
  • Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that co ⁇ elates with disease severity or treatment efficacy.
  • the first oligonucleotide designated 217A, has the sequence 5TAGGTCGGTAGTCAGGACACGGGAGAACAGAACTGTTGGTTGA3' (SEQ TD NO: 68) which is complementary to nucleotides 102 to 60 of SEQ TD NO: 19.
  • the second oligonucleotide designated 217B, has the sequence 5'GCCCCTGTGGCGGTTTAGATCCAGAATGCCCATTTTCTGTTCCATCTAAC CA3' (SEQ ID NO: 69) which co ⁇ esponds to the complement of nucleotides 1530 to 1479 of SEQ ID NO: 17.
  • Both oligonucleotides, 217A and 217B were reconstituted with lx TE buffer to a concentration of 20 pMol/ml and labeled with 3 P-dATP to yield a specific activity of 2.08 x 10° and 1.53 x 10 6 cpm/ml, respectively.
  • Hybridization was ca ⁇ ied out at 37°C overnight as described above for CONl 93 in Example 3 A. Following the hybridizations, the coverslips were washed off the slides with lx SSC for 45 minutes. The slides were then washed for 20 minutes at room temperature in lx SSC followed by three high stringency washes in lx SSC at 65°C. After washing, the slides were dehydrated with 70%, 95%, and
  • CON217 mRNAs Specific labeling with the antisense probe showed wide spread distribution of CON217 mRNA in the rat brain. Labelled regions included the cortex, piriform cortex, hippocampus, cerebellum, medulla, spinal cord, temporal lobe, putamen, substantia nigra and thalamus. The observed regional distribution of CON217 mRNAs provide a therapeutic indication for natural ligands for these G protein-coupled receptors as well as modulators of their activity, such as anti-CON217 antibody substances or small molecules that mimic, agonize or antagonize ligand-mediated CON217 signaling.
  • the expression patterns provide an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzhemeimer's disease, Parkinson's Disease, migraine, senile dementia, and the like.
  • Use of CON217 polypeptide modulators, including CON217 ligands and anti-CON217 polypeptide antibodies, to treat individuals having such disease states is intended as an aspect of the invention.
  • modulators are administered by any means effective to safely deliver the modulators to the GPCR polypeptide-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or ca ⁇ ier.
  • Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that co ⁇ elates with disease severity or treatment efficacy.
  • GPCR polypeptide-encoding polynucleotide is expressed in a suitable host cell using a suitable expression vector, using standard genetic engineering techniques.
  • a GPCR polypeptide-encoding sequences described in Example 1 such as SEQ TD NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17 or 19
  • pzeoSV2 Invitrogen, San Diego, CA
  • CHO African Green Monkey Kidney cells
  • HEK 293, ATCC CRL-1573 Human Kidney cells
  • CON103, CON203, CON198, CON197, CON202, CON222, CON215, or CON217) are selected by growth in the presence of 100 mg/ml zeocin (Stratagene, LaJolla, CA).
  • GPCR polypeptide is purified from the cells using standard chromatographic techniques.
  • antisera is raised against one or more synthetic peptide sequences that co ⁇ espond to portions of the GPCR amino acid sequence, and the antisera is used to affinity purify GPCR polypeptides.
  • the GPCR gene also may be expressed in frame with a tag sequence (e.g., polyhistidine, hemaggluttinin, FLAG) to facilitate purification.
  • tag sequence e.g., polyhistidine, hemaggluttinin, FLAG
  • recombinant GPCR polypeptides (or cells or cell membranes containing such polypeptides) ofthe invention are used as an antigen to generate the antibodies.
  • one or more peptides having amino acid sequences co ⁇ esponding to an immunogenic portion of a GPCR polypeptide e.g., 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19,
  • amino acids are used as antigen.
  • the antigen may be mixed with an adjuvant or linked to a hapten to increase antibody production.
  • a recombinant GPCR polypeptide or synthetic fragment thereof is used to immunize a mouse for generation of monoclonal antibodies (or larger mammal, such as a rabbit, for polyclonal antibodies).
  • monoclonal antibodies or larger mammal, such as a rabbit, for polyclonal antibodies.
  • peptides are conjugated to Keyhole Lympet Hemocyanine
  • the antigen is emulsified with Freund's Complete Adjuvant and injected subcutaneously.
  • additional aliquots of GPCR antigen are emulsified with Freund's Incomplete Adjuvant and injected subcutaneously.
  • a serum sample is taken from the immunized mice and assayed by Western blot to confirm the presence of antibodies that immunoreact with GPCR polypeptide.
  • Serum from the immunized animals may be used as a polyclonal antisera or used to isolate polyclonal antibodies that recognize GPCR polypeptide.
  • mice are sacrificed and their spleen removed for generation of monoclonal antibodies.
  • the spleens are placed in 10 ml serum-free RPMI 1640, and single cell suspensions are formed by grinding the spleens in serum-free RPMI 1640, supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 ⁇ g/ml streptomycin (RPMI) (Gibco, Canada).
  • the cell suspensions are filtered and washed by centrifugation and resuspended in serum-free RPMI.
  • Thymocytes taken from three naive Balb/c mice are prepared in a similar manner and used as a Feeder Layer.
  • NS-1 myeloma cells kept in log phase in RPMI with 10% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, are centrifuged and washed as well.
  • FBS fetal bovine serum
  • spleen cells from the immunized mice are combined with NS-1 cells and centrifuged, and the supernatant is aspirated.
  • the cell pellet is dislodged by tapping the tube, and 2 ml of 37°C PEG 1500 (50% in 75mM Hepes, pH 8.0) (Boehringer Mannheim) is sti ⁇ ed into the pellet, followed by the addition of serum-free RPMI. Thereafter, the cells are centrifuged and resuspended in RPMI containing 15% FBS, 100 ⁇ M sodium hypoxanthine, 0.4 ⁇ M aminopterin, 16 ⁇ M thymidine (HAT) (Gibco), 25 units/ml of 1L-6 (Boehringer
  • GPCR polypeptide-neutralizing antibodies comprise one class of therapeutics useful as antagonists. Following are protocols to improve the utility of anti-GPCR polypeptide monoclonal antibodies as therapeutics in humans, by "humanizing" the monoclonal antibodies to improve their serum half-life and render them less immunogenic in human hosts (i.e., to prevent human antibody response to non-human anti-GPCR polypeptide antibodies).
  • a level of humanization is achieved by generating chimeric antibodies comprising the variable domains of non-human antibody proteins of interest with the constant domains of human antibody molecules.
  • variable domains of GPCR- neutralizing anti-GPCR antibodies are cloned from the genomic DNA of a B-cell hybridoma or from cDNA generated from mRNA isolated from the hybridoma of interest.
  • the V region gene fragments are linked to exons encoding human antibody constant domains, and the resultant construct is expressed in suitable mammalian host cells (e.g., myeloma or CHO cells).
  • variable region gene fragments that encode antigen-binding complementarity determining regions ("CDR") ofthe non-human monoclonal antibody genes are cloned into human antibody sequences.
  • CDR complementarity determining regions
  • the surface of a non-human monoclonal antibody of interest is humanized by altering selected surface residues ofthe non-human antibody, e.g., by site-directed mutagenesis, while retaining all ofthe interior and contacting residues of the non-human antibody.
  • Human GPCR-neutralizing antibodies are generated by phage display techniques such as those described in Aujame et al, Human Antibodies, 8(4):X 55-168
  • antibody variable regions in the form of Fab fragments or linked single chain Fv fragments are fused to the amino terminus of filamentous phage minor coat protein pill. Expression of the fusion protein and inco ⁇ oration thereof into the mature phage coat results in phage particles that present an antibody on their surface and contain the genetic material encoding the antibody.
  • a phage library comprising such constructs is expressed in bacteria, and the library is panned (screened) for GPCR-specific phage-antibodies using labelled or immobilized GPCR polypeptide as antigen-probe.
  • modulators for identifying modulators (agonists and antagonists) of GPCR polypeptide activity
  • modulators that can be identified by these assays include natural ligand compounds of the receptor, synthetic analogs and derivatives of natural ligands, antibodies, antibody fragments, and/or antibody-like compounds de ⁇ ved from natural antibodies or from antibody-like combinato ⁇ al hbranes; and/or synthetic compounds identified through high throughput screening of hbranes, and the like
  • All modulators that bind GPCR polypeptide are useful for identifying GPCR polypeptide in tissue samples (e g , for diagnostic pu ⁇ oses, pathological pu ⁇ oses, and the like)
  • Agonist and antagonist modulators are useful for up-regulating and down-regulating GPCR polypeptide activity, respectively, to treat disease states characterized by abnormal levels of GPCR polypeptide activity
  • GPCR polypeptide binding molecules also may be used to deliver a therapeutic compound or a label to cells that express GPCR polypeptide (e g , by attaching the compound or label to the binding
  • cAMP cyclic adenosine monophosphate
  • the GPCR coding sequence (e.g., a cDNA or intronless genomic DNA) is subcloned into a commercial expression vector, such as pzeoSV2 (Invitrogen, San Diego, CA), and transiently transfected into Chinese Hamster Ovary (CHO) cells using known methods, such as the transfection reagent FuGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
  • the transfected CHO cells are seeded into the 96 well microplates from the FlashPlate ® assay kit, which are coated with solid scintillant to which antisera to cAMP has been bound. For a control, some wells are seeded with wild type (untransfected) CHO cells.
  • cAMP standard solution for use in creating a standard curve.
  • One or more test compounds are added to the cells in each well, with water and/or compound-free media/diluent serving as a control. After treatment, cAMP is allowed to accumulate in the cells for exactly 15 minutes at room temperature. The assay is terminated by the addition of lysis buffer containing [ 125 TJ- labelled cAMP, and the plate is counted using a Packard TopcountTM 96-well microplate scintillation counter. Unlabelled cAMP from the lysed cells (or from standards) competes with the fixed amounts of [ 125 I]-cAMP for antibody bound to the plate.
  • a standard curve is constructed, and cAMP values for the unknowns are obtained by interpolation. Changes in intracellular cAMP level of the cells in response to exposure to a test compound are indicative of GPCR polypeptide modulating activity. Modulators that act as agonists at receptors which couple to the Gs subtype of G-proteins will stimulate production of cAMP, leading to a measurable 3-10 fold increase. Receptor agonists which couple to the Gi/o subtype of G-proteins will inhibit forskolin-stimulated cAMP production, leading to a measurable decrease of 50-100%). Modulators that act as inverse agonists will reverse these effects at receptors that are either constitutively active or activated by known agonists.
  • cells e.g., CHO cells
  • a GPCR expression construct e.g., a construct that encodes the photoprotein apoaequorin.
  • apoaequorin will emit a measurable luminescence that is proportional to the amount of intracellular
  • a GPCR-encoding polynucleotide is subcloned into the commercial expression vector pzeoSV2 (Invitrogen, San Diego, CA) and transiently co-transfected along with a construct that encodes the photoprotein apoaequorin (Molecular Probes, Eugene, OR) into CHO cells using the transfection reagent FuGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
  • the cells are cultured for 24 hours at 37°C in ⁇ MEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% FBS, 2 mM glutamine, 10 U/ml of penicillin and 10 ⁇ g/ml of streptomycin. Subsequently, the media is changed to serum-free ⁇ MEM containing 5 ⁇ M coelenterazine (Molecular Probes, Eugene, OR), and the cells are cultured for two additional hours at 37°C. Cells are then detached from the plate using VERSEN (Gibco/BRL), washed and resuspended at 2 x 10 3 cells/ml in serum-free ⁇ MEM.
  • VERSEN Gibco/BRL
  • Dilutions of candidate GPCR modulator drugs are prepared in serum- free ⁇ MEM and dispensed into wells of an opaque 96-well assay plate, 50 ⁇ l/well.
  • MLX microtiter plate luminometer (Dynex Technologies, Inc., Chantilly, VA). The instrument is programmed to dispense 50 ⁇ l of cell suspension into each well, one well at a time, and immediately read luminescence for 15 seconds. Dose-response curves for the modulator candidates are constructed using the area under the curve for each light signal peak. Data are analyzed with
  • the photoprotein luciferase provides another useful tool for assaying for modulators of GPCR activity.
  • Cells e.g., CHO cells or COS 7 cells
  • a GPCR expression construct e.g., GPCR- encoding sequence in pzeoSV2 (Invitrogen, San Diego, CA)
  • a reporter construct which includes a gene for the luciferase protein downstream from a transcription factor, either cAMP-response element (CRE), AP-1, or NF kappa B.
  • CRE cAMP-response element
  • Agonist binding to receptors coupled to the Gs subtype of G-proteins leads to increases in cAMP, activating the CRE transcription factor and resulting in expression ofthe luciferase gene.
  • Agonist binding to receptors coupled to the Gq subtype of G-protein leads to production of diacylglycerol that activates protein kinase C.
  • the AP-1 or NF kappa B transcription factors are activated which stimulate expression of the luciferase gene.
  • Expression levels of luciferase reflect the activation status ofthe signaling events. [See generally George et al, Journal of Biomolecular Screening, 2(4): 235-40 ( 1997); and Stratowa et al.
  • Luciferase activity may be quantitatively measured using, e.g., luciferase assay reagents that are commercially available from Promega (Madison, Wl).
  • CHO cells are plated in 24-wcll culture dishes at a density of 100,000 cells/well one day prior to transfection and cultured at 37°C in ⁇ MEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% FBS, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin.
  • Cells are transiently co-transfected with both a GPCR expression construct and a reporter construct containing the luciferase gene.
  • the reporter plasmids CRE-luciferase, AP-1 -luciferase and NF kappa B-luciferase may be purchased from Stratagene (LaJolla, CA).
  • Transfections are performed using FuGENE 6 transfection reagent (Boehringer-Mannheim), and the protocol provided in the product insert. Cells transfected with the reporter construct alone are used as a control. Twenty-four hours after transfection, cells are washed once with phosphate buffered saline (PBS) pre-warmed to 37°C. Serum-free ⁇ MEM is then added to the cells either alone
  • Intracellular Calcium Measurement using FLIPR Changes in intracellular calcium levels are another recognized indicator of G protein-coupled receptor activity, and such assays can be employed to evaluate modulators of GPCR activity.
  • CHO cells stably transfected with a GPCR expression vector are plated at a density of 4 x I 0 4 cells/well in Packard black-walled 96-well plates specially designed to isolate fluorescent signal to individual wells.
  • the cells are incubated for 60 minutes at 37°C in modified Dulbecco's PBS (D-PBS) containing 36 mg/L of pyruvate and 1 g/L of glucose with the addition of 1% FBS and one of four calcium indicator dyes (Fluo-3TM AM, Fluo- 4TM AM, Calcium GreenTM- 1 AM, or Oregon GreenTM 488 BAPTA-1 AM) at a concentration of 4 ⁇ M. Plates are washed once with modified D-PBS without 1% FBS and incubated for 10 minutes at 37°C to remove residual dye from the cellular membrane. In addition, a series of washes with modified D-PBS without 1% FBS is performed immediately prior to activation ofthe calcium response.
  • D-PBS modified Dulbecco's PBS
  • Calcium response is initiated by the addition of one or more candidate receptor agonist compounds, calcium ionophore A23187 (10 ⁇ M), or ATP (4 ⁇ M). Fluorescence is measured by Molecular Device's FLIPR with an argon laser, excitation at 488 nm. [See, e.g., Kuntzweiler et al. Drug Development Research,
  • the F-stop for the detector camera was set at 2.5 and the length of exposure was 0.4 milliseconds.
  • Basal fluorescence of cells was measured for 20 seconds prior to addition of agonist, ATP, or A23187, and was subtracted from the response signal.
  • the calcium signal is measured for approximately 200 seconds, taking readings every two seconds.
  • Calcium ionophore and ATP increase the calcium signal 200% above baseline levels.
  • activated o ⁇ han GPCRs increase the calcium signal approximately 10-15% above baseline signal.
  • CHO cells stably expressing a GPCR are seeded into 96- well plates at a density of 5000 cells/well and grown at 37°C in ⁇ MEM supplemented with 10% fetal calf serum. After 48 hours, the cells are rinsed twice with serum-free ⁇ MEM and 80 ⁇ l of fresh ⁇ MEM, or ⁇ MEM containing a known mitogen, is added along with 20 ⁇ l ⁇ MEM containing varying concentrations of one or more test compounds diluted in serum free media. As controls, some wells on each plate receive serum-free media alone, and some receive media containing 10% FBS. Untransfected cells or cells transfected with vector alone also may serve as controls. After culture for 16-18 hours, 1 ⁇ Ci/well of [ 3 H]-thymidine (2
  • Ci/mmol; cpm Ci/mmol; cpm
  • A B x [C7 (D + C)] + G
  • A the percent of serum stimulation
  • B the maximal effect minus baseline
  • C the EC 50
  • D the concentration of the compound
  • G the maximal effect.
  • Parameters B, C and G are determined by Simplex optimization.
  • Antagonists that bind to the receptor are expected to increase [ 3 H]-thymidine inco ⁇ oration into cells, showing up to 80% of the response to serum. Antagonists that bind to the receptor will inhibit the stimulation seen with a known agonist by up to 100%.
  • G protein-coupled receptors signal through intracellular "G proteins” whose activity involves GTP/GDP binding and hydrolysis.
  • Another indicator of GPCR modulator activity is measuring binding of the non-hydrolyzable GTP analog [ 35 S]GTP ⁇ S in the presence and absence of putative modulators. [See, e.g., Kowal, et al, Neuropharmacology, 37: 179-87 (1998).]
  • cells stably transfected with a GPCR expression vector are grown in 10 cm dishes to subconfluence, rinsed once with 5 ml of ice cold Ca 2 7Mg 2+ free PBS, and scraped into 5 ml ofthe same buffer. Cells are pelleted by centrifugation (500 x g, 5 minutes), resuspended in TEE buffer (25 mM
  • Tris 5 mM EDTA, 5 mM EGTA, pH 7.5
  • the cells are homogenized using a dounce (one ml TEE per plate of cells), and centrifuged at 1,000 x g for 5 minutes to remove nuclei and unbroken cells.
  • the homogenate supernatant is centrifuged at 20,000 x g for 20 minutes to isolate the membrane fraction.
  • the membrane pellet is then washed once with TEE and resuspended in binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl,
  • the resuspended membranes can be frozen in liquid nitrogen and stored at -70°C until use.
  • reaction is then stopped by the addition of 1 ml of 10 mM HEPES, and 10 mM MgCl 2 (pH 7.4), at 4°C, and filtration.
  • CHO cells stably transfected with a GPCR- encoding polynucleotide are seeded into 6 well plates at a density of 70,000 cells/well 48 hours prior to the assay.
  • the cells are cultured at 37°C in ⁇ MEM media supplemented with 10% FBS, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin.
  • the cells are serum starved for 1-2 hours prior to the addition of stimulants.
  • the cells are treated with media alone or media containing a putative agonist or phorbal ester-myistoyl acetate (PMA) as a positive control. After treatment, cells are incubated at 37°C for varying times. To stop the reaction, the plates are placed on ice, the media is aspirated, and the cells are rinsed with 1 ml of ice-cold PBS containing 1 mM EDTA.
  • PMA phorbal ester-myistoyl acetate
  • cell lysis buffer (12.5 mM MOPS (pH 7.3), 12.5 mM ⁇ -glycerophosphate, 7.5 mM MgCl 2 , 0.5 mM EGTA, 0.5 mM sodium vanadate, 1 mM benzamidine, 1 mM dithiothreitol, 10 ⁇ g/ml leupeptin, 10 ⁇ g/ml aprotinin, 2 ⁇ g/ml pepstatin A, and 1 ⁇ M okadaic acid) is added to the cells.
  • the cells are scraped from the plates and homogenized by 10 passages through a 23 3/4 gauge needle.
  • the cytosol fraction is prepared by centrifugation at 20,000 x g for 15 minutes.
  • GPCR's also has been observed to potentiate arachidonic acid release in cells, providing yet another useful assay for modulators of the activity of GPCR's ofthe present invention.
  • CHO cells that are stably transfected with a GPCR expression vector are plated in 24-well plates at a density of 15,000 cells/well and grown in ⁇ MEM media supplemented with 10% FBS, 2 mM glutamine, 10 U/ml penicillin and 10 ⁇ g/ml streptomycin for 48 hours at 37°C before use.
  • Candidate modulator compounds are added in 1 ml of the same buffer, either alone or containing 10 ⁇ M ATP (Adenosine 5'-triphosphate) and the cells are incubated at 37°C for 30 minutes. Buffer alone and mock transfected cells are used as controls. Samples (0.5 ml) from each well are counted by liquid scintillation spectroscopy. Agonists which activate the receptor will lead to potentiation ofthe ATP-stimulated release of [ 3 H]-arachidonic acid. This potentiation is blocked by antagonists.
  • ATP Adidenosine 5'-triphosphate
  • CHO cells transfected with a GPCR expression vector are seeded into 12-mm capsule cups (Molecular Devices Co ⁇ .) at 4 x 10 5 cells/cup in ⁇ MEM supplemented with 10%) FBS, 2 mM 1 -glutamine, 10 units/ml penicillin, and 10 ⁇ g/ml streptomycin. The cells are incubated in this media at 37°C in 5% CO 2 for 24 hours. Extracellular acidification rates are measured using a Cytosensor microphysiometer (Molecular Devices Co ⁇ .).
  • the capsule cups are loaded into the sensor chambers of the microphysiometer and the chambers are perfused with running buffer (bicarbonate free ⁇ M EM supplemented with 4 mM 1 -glutamine, 10 units/ml penicillin, 10 ⁇ g/ml streptomycin, 26 mM NaCl) at a flow rate of 1 0 ⁇ l/min.
  • running buffer bicarbonate free ⁇ M EM supplemented with 4 mM 1 -glutamine, 10 units/ml penicillin, 10 ⁇ g/ml streptomycin, 26 mM NaCl
  • Agonists or other agents are diluted into the running buffer and perfused through a second fluid path. During each 60 second pump cycle, the pump is run for 38 seconds and is off for the remaining 22 seconds.
  • the pH of the running buffer in the sensor chamber is recorded during the cycle from 43-58 seconds, and the pump is re-started at 60 seconds to start the next cycle.
  • the rate of acidification of the running buffer during the recording time is calculated by the Cytosoft program. Changes in the rates of acidification are calculated by subtracting the baseline value (the average of 4 rate measurements immediately before addition of modulator candidates) from the highest rate measurement obtained after addition of a modulator candidate.
  • the selected instrument detects 61 mV/pH unit. Modulators that act as agonists at the receptor result in an increase in the rate of extracellular acidification as compared to the rate in the absence of agonist. This response is blocked by modulators which act as antagonists at the receptor.
  • Luciferase Reporter Gene Assays Luciferase reporter gene assays (essentially as described in Example 6) were ca ⁇ ied out to measure signaling activity ofthe GPCR receptors when coupled to Gs, Gi or Gq G-proteins. Activation of Gs coupled receptors results in stimulation of intracellualar cAMP production which leads to activation of the transcription factor cyclic AMP response element (CRE). Therefore activation of Gs coupled receptors can be detected by measuring transcription and translation ofthe reporter gene CRE- luciferase. The level of expression of the CRE reporter gene is dependent on the intracellular level of cAMP. Similarily, activation of Gs, Gi or Gq coupled receptors will result in activation ofthe AP-1 transcription factor.
  • CRE transcription factor cyclic AMP response element
  • CHO 10001 A cells (Gottesman et al, Somatic Cell Genetics 6: 45-61 , 1980) were maintained in Minimal Essential Medium (MEM) supplemented with 10% FBS (Hyclone Laboratories, Inc., Logan, Utah) at 37°C in an atmosphere of 5% CO,. The cells were split 1 :5 twice a week for maintence. Plasmids used in the experiments were propogated in E.coli strain DH5 (Gibco BRL) and purified using the Qiagen Maxi-prep plasmid purification system according to the manufacturer's instructions.
  • MEM Minimal Essential Medium
  • FBS Hyclone Laboratories, Inc., Logan, Utah
  • lxlO 5 CHO cells/well were plated on 24 well culture plates and allowed to adhere overnight. Each well on the plate was transfected with 0.5 ⁇ g of either AP-1 luciferase (Stratagene,, LaJolla, CA) or CRE luciferase plasmid alone or in combination with 0.125 ⁇ g of a GPCR plasmid (GPCR DNA inserted into the pCDNA3 vector form Invitrogen). Cell were transiently transfected with the commercially available transfection reagent FUGENE-6 according the manufacturer's instructions (Boehringer Mannheim, Indianapolis, IN). Twenty- four hours after transfection, the cells were washed in PBS pre-warmed to 37°C.
  • Agonists and antagonists were diluted in pre-warmed serum- free MEM, added to the transfected cells and incubated at 37°C, 5% CO 2 for 5 hours. Subsequently, the cells were washed once in ice cold PBS and lysed with the addition of 100 ⁇ l of lysis buffer (Promega) to each well, fter a 15 minute incubation at room temperature, luciferase reporter gene activation was analyzed with the Luciferase
  • the identified compounds may be useful for predicting endogenous ligands for the GPCR polypeptides, for measuring the physiological effects of GPCR activation in animal models, and for designing therapeutics to modulate GPCR activity to treat disease states.
  • EXAMPLE 8 Chromosomal Localization of GPCR The following example pertains to chromosomal localization of GPCR genes ofthe present invention (e.g., CONl 93, CON166, CON103, CON203, CON198, CON197, CON202, CON222, CON215, or CON217).
  • the chromosomal localization pe ⁇ nits use ofthe GPCR polynucleotide sequences (including fragments thereof) as chromosomal markers to assist with genome mapping and to provide markers for disease states.
  • Chromosomal localization also permits co ⁇ elation of the GPCR's of the invention with disease states in which abe ⁇ ant activity of the GPCR is implicated, especially disease states that have previously linked (or will be linked) with mutations, polymo ⁇ hisms, chromosomal rea ⁇ angements, and other chromosomal changes near the locus of the GPCR gene.
  • LW1332 TCCTACTGTCATGAACCC; SEQ TD NO: 74
  • LW1333 The reverse primer, denoted as LW1333
  • Each reaction contained 25 ng of DNA from a hybrid clone, 60 ng of Primer LW1332, and 60 ng of Primer LW1333 resulting in a final volume of 15 ⁇ l.
  • the PCR reactions were ca ⁇ ied our in a GeneAmp 9700 PCR thermocycler (Perkin Elmer Applied Biosystems) under the following conditions: 94°C for 3 minutes followed by 35 cycles of 94°C for 30 seconds, 52°C for 1 minute, and 72°C for 2 minutes.
  • CON202 Chomosomal localization of the gene encoding CON202 (SEQ ID NO:
  • PCR reactions were ca ⁇ ied out with the Expand Hi-Fi PCR SystemTM according the manufacturer's instructions (Roche Molecular Biochemicals, Indianapolis, IN). Primers, synthesized by Genosys Co ⁇ . (The Woodlands, TX), were designed to generate a 250 base pair fragment of CON202-encoding DNA in the presence of the appropriate genomic DNA.
  • the forward primer denoted as LW1480 (GGTTCTACCTGGACTTATGG; SEQ ID NO: 70), co ⁇ esponded to nuceotides 515 through 534 of SEQ XD NO: 13.
  • the reverse primer denoted as LW1481 (TAATGAATGAGTAAGTGCCC; SEQ ID NO: 71), co ⁇ esponded to the complement of nucleotides 745 through 764 of SEQ ID NO: 13.
  • Each reaction contained 25 ng of DNA from a hybrid clone, 60 ng of Primer LW1480, and 60 ng of Primer LW1481 resulting in a final volume of 15 ⁇ l.
  • the PCR reactions were ca ⁇ ied our in a GeneAmp 9700 PCR thermocycler (Perkin Elmer Applied Biosystems) under the following conditions: 94°C for 3 minutes followed by 35 cycles of 94°C for 30 seconds, 52°C for 1 minute, and 72°C for 2 minutes.
  • the PCR reactions were then analyzed on a 2.0%> agarose gel and stained with ethidium bromide. The lanes were scored for the presence ofthe 250 base pair PCR product.
  • the G3 Hybrid Panal analysis revealed that the CON202 gene (SEQ XD NO: 13) was localized to chromosome 7, most nearly linked to Standford marker SHGC- 12021 with a LOD score of 10.36.
  • the SHGC- 12021 marker lies at position
  • G protein-coupled receptors such as CON202 polypeptide
  • CON202 has the biochemical and functional potential to play a role in the disease process of schizophenia.
  • CON202 is an attractive target for screening for ligands (natural and synthetic) that are useful in modulating cellular processes involved in schizophrenia.
  • the chromosomal localization data (especially coupled with CON202 expression patterns in the brain) identifies CON202 as a candidate for screening healthy and affected (schizophrenia) individuals for CON202 allelic variants, mutations, duplications, rearrangements, and other chromosomal variations that co ⁇ elate with the disesase state. Variations that co ⁇ elate with disease state are useful for diagnosis of disease or disease susceptibility.
  • CON202 const ⁇ icts containing the variations are useful for designing targeted therapeutics for treatment ofthe disease (e.g., by using the assays for modulators described in preceding examples.
  • the EMBL High Throughput Genome database (provided by the European Bioinformics Institute) was searched with GPCR nucleotide sequences to determine chromosomal localization for CON193, CON166, CONl 03, CON203, CONl 98, and CON215 genes. The results are summarized in the table below:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides genes encoding heretofore unknown G protein-coupled receptors, constructs and recombinant host cells incorporating the genes; the GPCR polypeptides encoded by the genes; antibodies to the polypeptides; and methods of making and using all of the foregoing.

Description

G PROTEIN-COUPLED RECEPTORS EXPRESSED IN BRAIN
RELATED APPLICATIONS
This patent application is a continuation-in-part ofthe following U.S. patent applications: Serial No. 09/481,794 filed January 12, 2000; Serial No.
09/454,399 filed December 3, 1999; Serial Nos. 09/429,517, 09/429,555, 09/429,676, 09/429, 695 filed October 28, 1999; and Serial Nos. 09/428,114, 09/428,020, 09/427,859 and 09/427,653 filed October 27, 1999. All these application are incoφorated herein by reference. FIELD OF THE INVENTION
The present invention relates generally to the fields of genetics and cellular and molecular biology. More particularly, the invention relates to a novel G protein-coupled seven transmembrane receptor polynucleotide and polypeptide sequences that are expressed in the brain.
DESCRIPTION OF RELATED ART Humans and other life forms are comprised of living cells. Among the mechanisms through which the cells of an organism communicate with each other and obtain information and stimuli from their environment is through cell membrane receptor molecules expressed on the cell surface. Many such receptors have been identified, characterized, and sometimes classified into major receptor superfamilies based on structural motifs and signal transduction features. Such families include (but are not limited to) ligand-gated ion channel receptors, voltage-dependent ion channel receptors, receptor tyrosine kinases, receptor protein tyrosine phosphatases, and G protein-coupled receptors. The receptors are a first essential link for translating an extracellular signal into a cellular physiological response.
The G protein-coupled receptors (GPCR) form a vast superfamily of cell surface receptors which are characterized by an amino-terminal extracellular domain, a carboxyl-terminal intracellular domain, and a serpentine structure that passes through the cell membrane seven times. Hence, such receptors are sometimes also refeπed to as seven transmembrane (7TM) receptors. These seven transmembrane domains define three extracellular loops and three intracellular loops, in addition to the amino- and carboxyl-terminal domains. The extracellular portions of the receptor have a role in recognizing and binding one or more extracellular binding partners (ligands), whereas the intracellular portions have a role in recognizing and communicating with downstream effector molecules.
The G protein-coupled receptors bind a variety of ligands including calcium ions, hormones, chemokines, neuropeptides, neurotransmitters, nucleotides, lipids, odorants, and even photons, and are important in the normal (and sometimes the aberrant) function of many cell types. [See generally A.D. Strosberg, Ewr. J. Biochem., 196: 1-10 (1991) and S. K. Bohm et al, Biochem J., 322: 1-18 (1997).]
' When a specific ligand binds to its coπesponding receptor, the ligand stimulates the receptor to activate a specific heterotrimeric guanine-nucleotide-binding regulatory protein (G-protein) that is coupled to the intracellular portion ofthe receptor. The G protein in turn transmits a signal to an effector molecule within the cell, by either stimulating or inhibiting the activity of that effector molecule. These effector molecules include adenylate cyclase, phospholipases, and ion channels. Adenylate cyclase and phospholipases are enzymes that are involved in the production ofthe second messenger molecules cAMP, inositol triphosphate and diacyglycerol. It is through this sequence of events that an extracellular ligand stimuli exerts intracellular changes through a G protein-coupled receptor. Each such receptor has its own characteristic primary structure, expression pattern, ligand-binding profile, and intracellular effector system.
Because ofthe vital role of G protein-coupled receptors in the communication between cells and their environment, such receptors are attractive targets for therapeutic intervention, and many drugs have been registered which are directed towards activating or antagonizing such receptors. For receptors having a known ligand, the identification of agonists or antagonists may be sought specifically for enhancing or inhibiting the action ofthe ligand. Some G protein-coupled receptors have roles in disease pathogenesis (e.g., certain chemokine receptors that act as HIV co-receptors and may have a role in AIDS pathogenesis), and are attractive targets for therapeutic intervention even in the absence of knowledge ofthe natural hgand of the receptor Other receptors are attractive targets for therapeutic intervention by virtue of their expression pattern in tissues or cell types that are attractive targets foi therapeutic intervention. Examples of this latter category of receptors include receptors expressed in immune cells, for targeting to enhance immune responses to fight pathogens or cancer or inhibit autoimmune lesponses, and receptors expressed in the brain or other neurons, for targeting to treat schizophrenia, depression, bipolar disease, or other neurological disorders. This latter category of receptor is also useful as a marker for identifying and/or purifying (e g., via fluorescence activated cell sorting) cellular subtypes that express the receptor. Unfortunately, only a limited number of G protein receptors from the central nervous system (CNS) are known. A need exists for identifying the existence and structure of such G protein-coupled receptors.
SUMMARY OF THE INVENTION The present invention addresses one or more ofthe needs identified above in that it provides purified polynucleotides encoding heretofore unknown G protein-coupled receptors (GPCR); constructs and recombinant host cells incorporating the polynucleotides; GPCR polypeptides encoded by the polynucleotides; antibodies to the polypeptides; and methods of making and using all of the foregoing. As set forth in detail herein, the GPCR polypeptides descnbed herein are expressed in the brain, providing a therapeutic indication for GPCR polypeptides and binding partners to treat diseases associated with this tissue.
The invention provides purified and isolated GPCR seven transmembrane receptor polypeptides compπsing any one of the amino acid sequences set forth in SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20, or a fragment thereof composing an epitope specific to the seven transmembrane receptor. By "epitope specific to" is meant a portion ofthe receptor that is recognizable by an antibody that is specific for that seven transmembrane receptor, as defined in detail below. One prefeπed embodiment comprises a purified and isolated polypeptide designated CON193, comprising the complete amino acid sequence set forth in SEQ ID NO: 2. This amino acid sequence was deduced from a polynucleotide sequence encoding CON 193 (SEQ ID NO:l), as set forth below: ntggttgttg gaccattaaa atgcattatg gaatttttaa aagttggggg agagggagac 60 agtaaaaata acctatattt tctcttgttt tttttttttt aactctagga aagcccagac 120 aaattttgag ctatttcata acctaccaga cttatc atg eta aca ctg aat aaa 174
Met Leu Thr Leu Asn Lys 1 5 aca gac eta ata cca get tea ttt att ctg aat gga gtc cca gga ctg 222
Thr Asp Leu lie Pro Ala Ser Phe lie Leu Asn Gly Val Pro Gly Leu 10 15 20 gaa gac aca caa etc tgg att tec ttc cca ttc tgc tct atg tat gtt 270
Glu Asp Thr Gin Leu Trp lie Ser Phe Pro Phe Cys Ser Met Tyr Val
25 30 35 gtg get atg gta ggg aat tgt gga etc etc tac etc att cac tat gag 318 Val Ala Met Val Gly Asn Cys Gly Leu Leu Tyr Leu lie His Tyr Glu 40 45 50 gat gcc ctg cac aaa ccc atg tac tac ttc ttg gcc atg ctt tec ttt 366
Asp Ala Leu His Lys Pro Met Tyr Tyr Phe Leu Ala Met Leu Ser Phe 55 60 65 70 act gac ctt gtt atg tgc tct agt aca ate cct aaa gcc etc tgc ate 414
Thr Asp Leu Val Met Cys Ser Ser Thr lie Pro Lys Ala Leu Cys lie
75 80 85 ttc tgg ttt cat etc aag gac att gga ttt gat gaa tgc ctt gtc cag 462
Phe Trp Phe His Leu Lys Asp lie Gly Phe Asp Glu Cys Leu Val Gin 90 95 100 atg ttc ttc ate cac ace ttc aca ggg atg gag tct ggg gtg ctt atg 510
Met Phe Phe lie His Thr Phe Thr Gly Met Glu Ser Gly Val Leu Met
105 110 115 ctt atg gcc ctg gat cgc tat gtg gcc ate tgc tac ccc tta cgc tat 558 Leu Met Ala Leu Asp Arg Tyr Val Ala lie Cys Tyr Pro Leu Arg Tyr 120 125 130 tea act ate etc ace aat cct gta att gca aag gtt ggg act gcc ace 606
Ser Thr lie Leu Thr Asn Pro Val lie Ala Lys Val Gly Thr Ala Thr
135 140 145 150 ttc ctg aga ggg gta tta etc att att ccc ttt act ttc etc ace aag 654
Phe Leu Arg Gly Val Leu Leu lie lie Pro Phe Thr Phe Leu Thr Lys
155 160 165 cgc ctg ccc tec tgc aga ggc aat ata ctt ccc cat ace tac tgt gac 702
Arg Leu Pro Ser Cys Arg Gly Asn lie Leu Pro His Thr Tyr Cys Asp 170 175 180 cac atg tct gta gcc aaa ttg tec tgt ggt aat gtc aag gtc aat gcc 750 His Met Ser Val Ala Lys Leu Ser Cys Gly Asn Val Lys Val Asn Ala
185 190 195 ate tat ggt ctg atg gtt gcc etc ctg att ggg ggc ttt gac ata ctg 798 lie Tyr Gly Leu Met Val Ala Leu Leu lie Gly Gly Phe Asp He Leu 200 205 210 tgt ate ace ate tec tat ace atg att etc egg gca gtg gtc age etc 846 Cys He Thr He Ser Tyr Thr Met He Leu Arg Ala Val Val Ser Leu 215 220 225 230 tec tea gca gat get egg cag aag gcc ttt aat ace tgc act gcc cac 894 Ser Ser Ala Asp Ala Arg Gin Lys Ala Phe Asn Thr Cys Thr Ala His
235 240 245 att tgt gcc att gtt ttc tec tat act cca get ttc ttc tec ttc ttt 942 He Cys Ala He Val Phe Ser Tyr Thr Pro Ala Phe Phe Ser Phe Phe 250 255 260 tec cac cgc ttt ggg gaa cac ata ate ccc cct tct tgc cac ate att 990 Ser His Arg Phe Gly Glu His He He Pro Pro Ser Cys His He He
265 270 275 gta gcc aat att tat ctg etc eta cca ccc act atg aac cct att gtc 1038 Val Ala Asn He Tyr Leu Leu Leu Pro Pro Thr Met Asn Pro He Val 280 285 290 tat ggg gtg aaa ace aaa cag ata cga gac tgt gtc ata agg ate ctt 1086 Tyr Gly Val Lys Thr Lys Gin He Arg Asp Cys Val He Arg He Leu 295 300 305 310 tea ggt tct aag gat ace aaa tec tac age atg tga atgaacactt 1132 Ser Gly Ser Lys Asp Thr Lys Ser Tyr Ser Met
315 320 geeaggagtg agaagagaag gaaagaatta cttctatttg cctettatgc aggagttcatll92 aaaatctttc tggaagtact gtattgatca caaaatggag tttgntgact ggtgcattc 1252 caataagtac cttgggaatc tnacatcact ggaaggccca ccacatttct ataaat 1308
Another preferred embodiment comprises a purified and isolated polypeptide designated CON166, comprising the complete amino acid sequence set forth in SEQ ID NO: 4. This amino acid sequence was deduced from a polynucleotide sequence encoding CON166 (SEQ ID NO: 3), as set forth below: atg gat gaa aca gga aat ctg aca gta tct tct gcc aca tgc cat gac 48
Met Asp Glu Thr Gly Asn Leu Thr Val Ser Ser Ala Thr Cys His Asp
1 5 10 15 act att gat gac ttc cgc aat caa gtg tat tec ace ttg tac tct atg 96
Thr He Asp Asp Phe Arg Asn Gin Val Tyr Ser Thr Leu Tyr Ser Met 20 25 30 ate tct gtt gta ggc ttc ttt ggc aat ggc ttt gtg etc tat gtc etc 144 He Ser Val Val Gly Phe Phe Gly Asn Gly Phe Val Leu Tyr Val Leu
35 40 45 ata aaa ace tat cac aag aag tea gcc ttc caa gta tac atg att aat 192 He Lys Thr Tyr His Lys Lys Ser Ala Phe Gin Val Tyr Met He Asn 50 55 60 tta gca gta gca gat eta ctt tgt gtg tgc aca ctg cct etc cgt gtg 240 Leu Ala Val Ala Asp Leu Leu Cys Val Cys Thr Leu Pro Leu Arg Val 65 70 75 80 gtc tat tat gtt cac aaa ggc att tgg etc ttt ggt gac ttc ttg tgc 288 Val Tyr Tyr Val His Lys Gly He Trp Leu Phe Gly Asp Phe Leu Cys
85 90 95 cgc etc age ace tat get ttg tat gtc aac etc tat tgt age ate ttc 336 Arg Leu Ser Thr Tyr Ala Leu Tyr Val Asn Leu Tyr Cys Ser He Phe 100 105 110 ttt atg aca gcc atg age ttt ttc egg tgc att gca att gtt ttt cca 384 Phe Met Thr Ala Met Ser Phe Phe Arg Cys He Ala He Val Phe Pro
115 120 125 gtc cag aac att aat ttg gtt aca cag aaa aaa gcc agg ttt gtg tgt 432 Val Gin Asn He Asn Leu Val Thr Gin Lys Lys Ala Arg Phe Val Cys 130 135 140 gta ggt att tgg att ttt gtg att ttg ace agt tct cca ttt eta atg 480 Val Gly He Trp He Phe Val He Leu Thr Ser Ser Pro Phe Leu Met 145 150 155 160 gcc aaa cca caa aaa gat gag aaa aat aat ace aag tgc ttt gag ccc 528 Ala Lys Pro Gin Lys Asp Glu Lys Asn Asn Thr Lys Cys Phe Glu Pro
165 170 175 cca caa gac aat caa act aaa aat cat gtt ttg gtc ttg cat tat gtg 576 Pro Gin Asp Asn Gin Thr Lys Asn His Val Leu Val Leu His Tyr Val 180 185 190 tea ttg ttt gtt ggc ttt ate ate cct ttt gtt att ata att gtc tgt 624 Ser Leu Phe Val Gly Phe He He Pro Phe Val He He He Val Cys
195 200 205 tac aca atg ate att ttg ace tta eta aaa aaa tea atg aaa aaa aat 672 Tyr Thr Met He He Leu Thr Leu Leu Lys Lys Ser Met Lys Lys Asn 210 215 220 ctg tea agt cat aaa aag get ata gga atg ate atg gtc gtg ace get 720 Leu Ser Ser His Lys Lys Ala He Gly Met He Met Val Val Thr Ala 225 230 235 240 gcc ttt tta gtc agt ttc atg cca tat cat att caa cgt ace att cac 768 Ala Phe Leu Val Ser Phe Met Pro Tyr His He Gin Arg Thr He His 245 250 255 ctt cat ttt tta cac aat gaa act aaa ccc tgt gat tct gtc ctt aga 816 Leu His Phe Leu His Asn Glu Thr Lys Pro Cys Asp Ser Val Leu Arg
260 265 270 atg cag aag tec gtg gtc ata ace ttg tct ctg get gca tec aat tgt 864 Met Gin Lys Ser Val Val He Thr Leu Ser Leu Ala Ala Ser Asn Cys 275 280 285 tgc ttt gac cct etc eta tat ttc ttt tct ggg ggt aac ttt agg aaa 912 Cys Phe Asp Pro Leu Leu Tyr Phe Phe Ser Gly Gly Asn Phe Arg Lys 290 295 300 agg ctg tct aca ttt aga aag cat tct ttg tec age gtg act tat gta 960 Arg Leu Ser Thr Phe Arg Lys His Ser Leu Ser Ser Val Thr Tyr Val 305 310 315 320 ccc aga aag aag gcc tct ttg cca gaa aaa gga gaa gaa ata tgt aaa 1008 Pro Arg Lys Lys Ala Ser Leu Pro Glu Lys Gly Glu Glu He Cys Lys 325 330 335 gta tag 1014
Val
Still another preferred embodiment comprises a purified and isolated polypeptide designated CON103, comprising the complete amino acid sequence set forth in SEQ ID NO: 6. This amino acid sequence was deduced from a polynucleotide sequence encoding CON103 (SEQ ID NO: 5), as set forth below: ggggcctact tcaccgtgta cccggacttg ggaccatcac agacttcaga accatcagga 60 acctgggagc aactgaaagc tgaactacag tgggctttca gacacacagc aggctgcgga 120 geacaaatag gaetggttcc ctccaggcca ecageagggc ggtggaggtc tteactgact 180 ccctgcctac ctctcaggac aatgtccttt tggctccaca gtccctgaag ccagagctgg 240 tggggscagg gaggcagcca ccagcctcta tatgtagtgg aggagggggt gtccagggag 300 ggctgcatga teetgagage ccccacctca eccggctgga ctateetccc acttcagggt 360 ttctctgggc ttccatcttg cccctgctga gccctgcttc ctcctctacc agcagcacaa 420 cccccaggct gggctcagag acctcatgtg gtgggatcac tcagtacccc gaggcggagg 480 gaaggaggga gggetgeagg gtteeeettg gcctgcaaae aggaaeacag ggtgtttete 540 agtggctgcg agaatgctga tgaaaacccc aggatgttgt gtcaccgtgg tggccagctg 600 atagtgccaa tcatcccact ttgccctgag cactcctgca ggggtagaag actccagaac 660 cttctctcag gcccatggcc caagcagccc atg gaa ctt cat aac ctg age tct 714
Met Glu Leu His Asn Leu Ser Ser 1 5 cca tct ccc tct etc tec tec tct gtt etc cct ccc tec ttc tct ccc 762 Pro Ser Pro Ser Leu Ser Ser Ser Val Leu Pro Pro Ser Phe Ser Pro
10 15 20 tea ccc tec tct get ccc tct gcc ttt ace act gtg ggg ggg tec tct 810 Ser Pro Ser Ser Ala Pro Ser Ala Phe Thr Thr Val Gly Gly Ser Ser 25 30 35 40 gga ggg ccc tgc cac ccc ace tct tec teg ctg gtg tct gcc ttc ctg 858
Gly Gly Pro Cys His Pro Thr Ser Ser Ser Leu Val Ser Ala Phe Leu
45 50 55 gca cca ate ctg gcc ctg gag ttt gtc ctg ggc ctg gtg ggg aac agt 906 Ala Pro He Leu Ala Leu Glu Phe Val Leu Gly Leu Val Gly Asn Ser
60 65 70 ttg gcc etc ttc ate ttc tgc ate cac acg egg ccc tgg ace tec aac 954
Leu Ala Leu Phe He Phe Cys He His Thr Arg Pro Trp Thr Ser Asn
75 80 85 acg gtg ttc ctg gtc age ctg gtg gcc get gac ttc etc ctg ate age 1002
Thr Val Phe Leu Val Ser Leu Val Ala Ala Asp Phe Leu Leu He Ser
90 95 100 aac ctg ccc etc cgc gtg gac tac tac etc etc cat gag ace tgg cgc 1050
Asn Leu Pro Leu Arg Val Asp Tyr Leu Leu His Glu Thr Trp Arg 105 110 115 120 ttt ggg get get gcc tgc aaa gtc aac etc ttc atg ctg tec ace aac 1098
Phe Gly Ala Ala Ala Cys Lys Val Asn Leu Phe Met Leu Ser Thr Asn
125 130 135 cgc acg gcc age gtt gtc ttc etc aca gcc ate gca etc aac cgc tac 1146 Arg Thr Ala Ser Val Val Phe Leu Thr Ala He Ala Leu Asn Arg Tyr
140 145 150 ctg aag gtg gtg cag ccc cac cac gtg ctg age cgt get tec gtg ggg 1194
Leu Lys Val Val Gin Pro His His Val Leu Ser Arg Ala Ser Val Gly
155 160 165 gca get gcc egg gtg gcc ggg gga etc tgg gtg ggc ate ctg etc etc 1242
Ala Ala Ala Arg Val Ala Gly Gly Leu Trp Val Gly He Leu Leu Leu
170 175 180 aac ggg cac ctg etc ctg age ace ttc tec ggc ccc tec tgc etc age 1290
Asn Gly His Leu Leu Leu Ser Thr Phe Ser Gly Pro Ser Cys Leu Ser 185 190 195 200 tac agg gtg ggc acg aag ccc teg gcc teg etc cgc tgg cac cag gca 1338
Tyr Arg Val Gly Thr Lys Pro Ser Ala Ser Leu Arg Trp His Gin Ala
205 210 215 ctg tac ctg ctg gag ttc ttc ctg cca ctg gcg etc ate etc ttt get 1386 Leu Tyr Leu Leu Glu Phe Phe Leu Pro Leu Ala Leu He Leu Phe Ala
220 225 230 att gtg age att ggg etc ace ate egg aac cgt ggt ctg ggc ggg cag 1434
He Val Ser He Gly Leu Thr He Arg Asn Arg Gly Leu Gly Gly Gin
235 240 245 gca ggc ccg cag agg gcc atg cgt gtg ctg gcc atg gtg gtg gcc gtc 1482
Ala Gly Pro Gin Arg Ala Met Arg Val Leu Ala Met Val Val Ala Val
250 255 260 tac ace ate tgc ttc ttg ccc age ate ate ttt ggc atg get tec atg 1530 Tyr Thr He Cys Phe Leu Pro Ser He He Phe Gly Met Ala Ser Met 265 270 275 280 gtg get ttc tgg ctg tec gcc tgc cga tec ctg gac etc tgc aca cag 1578 Val Ala Phe Trp Leu Ser Ala Cys Arg Ser Leu Asp Leu Cys Thr Gin
285 290 295 etc ttc cat ggc tec ctg gcc ttc ace tac etc aac agt gtc ctg gac 1626 Leu Phe His Gly Ser Leu Ala Phe Thr Tyr Leu Asn Ser Val Leu Asp 300 305 310 ccc gtg etc tac tgc ttc tct age ccc aac ttc etc cac cag age egg 1674 Pro Val Leu Tyr Cys Phe Ser Ser Pro Asn Phe Leu His Gin Ser Arg
315 320 325 gcc ttg ctg ggc etc acg egg ggc egg cag ggc cca gtg age gac gag 1722 Ala Leu Leu Gly Leu Thr Arg Gly Arg Gin Gly Pro Val Ser Asp Glu 330 335 340 age tec tac caa ccc tec agg cag tgg cgc tac egg gag gcc tct agg 1770
Ser Ser Tyr Gin Pro Ser Arg Gin Trp Arg Tyr Arg Glu Ala Ser Arg
345 350 355 360 aag gcg gag gcc ata ggg aag ctg aaa gtg cag ggc gag gtc tct ctg 1818 Lys Ala Glu Ala He Gly Lys Leu Lys Val Gin Gly Glu Val Ser Leu
365 370 375 gaa aag gaa ggc tec tec cag ggc tga gggccagctg cagggctgca 1865 Glu Lys Glu Gly Ser Ser Gin Gly
380 385 gcgctgtggg ggtaagggct geegegctct ggcctggagg gacaaggeea gcacacggtgl925 cctcaaccaa ctggacaagg gatggcggca gaccaggggc caggccaaag cactggcaggl985 actcatgtgg gtggcaggga gagaaaccca cctaggcctc tcagtgtgtc caggatggca2045 ttcccagaat gcaggggaga gcaggatgcc gggtggagga gacaggcaag gtgccgttgg2105 cacaccagct cagacagggg cctgcgcagc tgcaggggac agacgccaat cactgtcaca2165 geagagtcac cttagaaatt ggaeagctgc atgttctgtg etetccagtt tgtcccttcc2225 aatattaata aacttccctt ttaaatatat ttatttgcag accaatatct gtctttaatt2285 ctaacctggg actgtcagta ggcgtcaaag tgagcgcccc agtgaaggaa ccttggagag2345 agtgggagca ttcccagcct tccaggggga ctcgtcttcc agactttgga gcccgcatgt2405 ctgaagcaga ctctttcttg gtag 2429 Another preferred embodiment comprises a purified and isolated polypeptide designated CON203, comprising the complete amino acid sequence set forth in SEQ ID NO: 8. This amino acid sequence was deduced from a polynucleotide sequence encoding CON203 (SEQ ID NO: 7), as set forth below: ttgaatttag gtgacactat agaagagcta tgacgtcgca tgcacgcgta cgtaagctcg 60 gaattcggct egagctgaae taatgactge egceataaga agacagagag aactgagtat 120 cctcccaaag gtgacactgg aagca atg aac ace aca gtg atg caa ggc ttc 172
Met Asn Thr Thr Val Met Gin Gly Phe
1 5 aac aga tct gag egg tgc ccc aga gac act egg ata gta cag ctg gta 220 Asn Arg Ser Glu Arg Cys Pro Arg Asp Thr Arg He Val Gin Leu Val 10 15 20 25 ttc cca gcc etc tac aca gtg gtt ttc ttg ace ggc ate ctg ctg aat 268
Phe Pro Ala Leu Tyr Thr Val Val Phe Leu Thr Gly He Leu Leu Asn
30 35 40 act ttg get ctg tgg gtg ttt gtt cac ate ccc age tec tec ace ttc 316
Thr Leu Ala Leu Trp Val Phe Val His He Pro Ser Ser Ser Thr Phe
45 50 55 ate ate tac etc aaa aac act ttg gtg gcc gac ttg ata atg aca etc 364
He He Tyr Leu Lys Asn Thr Leu Val Ala Asp Leu He Met Thr Leu 60 65 70 atg ctt cct ttc aaa ate etc tct gac tea cac ctg gca ccc tgg cag 412
Met Leu Pro Phe Lys He Leu Ser Asp Ser His Leu Ala Pro Trp Gin
75 80 85 etc aga get ttt gtg tgt cgt ttt tct teg gtg ata ttt tat gag ace 460 Leu Arg Ala Phe Val Cys Arg Phe Ser Ser Val He Phe Tyr Glu Thr
90 95 100 105 atg tat gtg ggc ate gtg ctg tta ggg etc ata gcc ttt gac aga ttc 508
Met Tyr Val Gly He Val Leu Leu Gly Leu He Ala Phe Asp Arg Phe
110 115 120 etc aag ate ate aga cct ttg aga aat att ttt eta aaa aaa cct gtt 556
Leu Lys He He Arg Pro Leu Arg Asn He Phe Leu Lys Lys Pro Val
125 130 135 ttt gca aaa acg gtc tea ate ttc ate tgg gtc ttt ttg gtc ttc ate 604
Phe Ala Lys Thr Val Ser He Phe He Trp Val Phe Leu Val Phe He 140 145 150 tec ctg cca aat atg ate ttg age aac aag gaa gca aca cca teg tct 652
Ser Leu Pro Asn Met He Leu Ser Asn Lys Glu Ala Thr Pro Ser Ser
155 160 165 gtg aaa aag tgt get tec tta aag ggg cct ctg ggg ctg aaa tgg cat 700 Val Lys Lys Cys Ala Ser Leu Lys Gly Pro Leu Gly Leu Lys Trp His
170 175 180 185 caa atg gta aat aac ata tgc cag ttt att ttc tgg act ggt ttt ate 748
Gin Met Val Asn Asn He Cys Gin Phe He Phe Trp Thr Gly Phe He
190 195 200 eta atg ctt gtg ttt tat gtg gtt att gca aaa aaa gta tat gat tct 796
Leu Met Leu Val Phe Tyr Val Val He Ala Lys Lys Val Tyr Asp Ser
205 210 215 tat aga aag tec aaa agt aag gac aga aaa aac aac aaa aag ctg gaa 844 Tyr Arg Lys Ser Lys Ser Lys Asp Arg Lys Asn Asn Lys Lys Leu Glu
220 225 230 ggc aaa gta ttt gtt gtc gtg get gtc ttc ttt gtg tgt ttt get cca 892 Gly Lys Val Phe Val Val Val Ala Val Phe Phe Val Cys Phe Ala Pro 235 240 245 ttt cat ttt gcc aga gtt cca tat act cac agt caa ace aac aat aag 940 Phe His Phe Ala Arg Val Pro Tyr Thr His Ser Gin Thr Asn Asn Lys 250 255 260 265 act gac tgt aga ctg caa aat caa ctg ttt att get aaa gaa aca act 988 Thr Asp Cys Arg Leu Gin Asn Gin Leu Phe He Ala Lys Glu Thr Thr
270 275 280 etc ttt ttg gca gca act aac att tgt atg gat ccc tta ata tac ata 1036 Leu Phe Leu Ala Ala Thr Asn He Cys Met Asp Pro Leu He Tyr He 285 290 295 ttc tta tgt aaa aaa ttc aca gaa aag eta cca tgt atg caa ggg aga 1084 Phe Leu Cys Lys Lys Phe Thr Glu Lys Leu Pro Cys Met Gin Gly Arg
300 305 310 aag ace aca gca tea age caa gaa aat cat age agt cag aca gac aac 1132 Lys Thr Thr Ala Ser Ser Gin Glu Asn His Ser Ser Gin Thr Asp Asn 315 320 325 ata ace tta ggc tga eaactgtaea tagggttaae ttetatttat tgatgagaet 1187 He Thr Leu Gly 330 tccgtagata atgtggaaat caaatttaac caagaaaaaa agattggaac aaatgctctcl247 ttaeatttta tttatcctgg tgtccaggaa aagattatat taaatttaaa tccacatagal307 tctattcata agctgaatga accattacct aagagaatgc aacaggatac caatggccacl367 tagaggcata ttccttcttc tttttttttt gttaaatttc aagagcattc actttacattl427 tggaaagact aaggggaacg gttatcctac aaacctccct tcaacacctt ttacatt 1484 Another preferred embodiment comprises a purified and isolated polypeptide designated CON198, comprising the complete amino acid sequence set forth in SEQ ID NO: 10. This amino acid sequence was deduced from a polynucleotide sequence encoding CON198 (SEQ ID NO: 9), as set forth below: atg atg gtg gat ccc aat ggc aat gaa tec agt get aca tac ttc ate 48 Met Met Val Asp Pro Asn Gly Asn Glu Ser Ser Ala Thr Tyr Phe He 1 5 10 15 eta ata ggc etc cct ggt tta gaa gag get cag ttc tgg ttg gcc ttc 96 Leu He Gly Leu Pro Gly Leu Glu Glu Ala Gin Phe Trp Leu Ala Phe 20 25 30 cca ttg tgc tec etc tac ctt att get gtg eta ggt aac ttg aca ate 144 Pro Leu Cys Ser Leu Tyr Leu He Ala Val Leu Gly Asn Leu Thr He 35 40 45 atc tac att gtg egg act gag cac age ctg cat gag ccc atg tat ata 192
He Tyr He Val Arg Thr Glu His Ser Leu His Glu Pro Met Tyr He
50 55 60 ttt ctt tgc atg ctt tea ggc att gac ate etc ate tec ace tea tec 240
Phe Leu Cys Met Leu Ser Gly He Asp He Leu He Ser Thr Ser Ser
65 70 75 80 atg ccc aaa atg ctg gcc ate ttc tgg ttc aat tec act ace ate cag 288 Met Pro Lys Met Leu Ala He Phe Trp Phe Asn Ser Thr Thr He Gin
85 90 95 ttt gat get tgt ctg eta cag atg ttt gcc ate cac tec tta tct ggc 336
Phe Asp Ala Cys Leu Leu Gin Met Phe Ala He His Ser Leu Ser Gly 100 105 110 atg gaa tec aca gtg ctg ctg gcc atg get ttt gac cgc tat gtg gcc 384
Met Glu Ser Thr Val Leu Leu Ala Met Ala Phe Asp Arg Tyr Val Ala
115 120 125 ate tgt cac cca ctg cgc cat gcc aca gta ctt acg ttg cct cgt gtc 432
He Cys His Pro Leu Arg His Ala Thr Val Leu Thr Leu Pro Arg Val
130 135 140 ace aaa att ggt gtg get get gtg gtg egg ggg get gca ctg atg gca 480
Thr Lys He Gly Val Ala Ala Val Val Arg Gly Ala Ala Leu Met Ala
145 150 155 160 ccc ctt cct gtc ttc ate aag cag ctg ccc ttc tgc cgc tec aat ate 528 Pro Leu Pro Val Phe He Lys Gin Leu Pro Phe Cys Arg Ser Asn He
165 170 175 ctt tec cat tec tac tgc eta cac caa gat gtc atg aag ctg gcc tgt 576
Leu Ser His Ser Tyr Cys Leu His Gin Asp Val Met Lys Leu Ala Cys 180 185 190 gat gat ate egg gtc aat gtc gtc tat ggc ctt ate gtc ate ate tec 624
Asp Asp He Arg Val Asn Val Val Tyr Gly Leu He Val He He Ser
195 200 205 gcc att ggc ctg gac tea ctt etc ate tec ttc tea tat ctg ctt att 672 Ala He Gly Leu Asp Ser Leu Leu He Ser Phe Ser Tyr Leu Leu He 210 215 220 ctt aag act gtg ttg ggc ttg aca cgt gaa gcc cag gcc aag gca ttt 720 Leu Lys Thr Val Leu Gly Leu Thr Arg Glu Ala Gin Ala Lys Ala Phe 225 230 235 240 ggc act tgc gtc tct cat gtg tgt get gtg ttc ata ttc tat gta cct 768 Gly Thr Cys Val Ser His Val Cys Ala Val Phe He Phe Tyr Val Pro
245 250 255 ttc att gga ttg tec atg gtg cat cgc ttt age aag egg cgt gac tct 816 Phe He Gly Leu Ser Met Val His Arg Phe Ser Lys Arg Arg Asp Ser 260 265 270 ccg ctg ccc gtc ate ttg gcc aat ate tat ctg ctg gtt cct cct gtg 864 Pro Leu Pro Val He Leu Ala Asn He Tyr Leu Leu Val Pro Pro Val 275 280 285 etc aac cca att gtc tat gga gtg aag aca aag gag att cga cag cgc 912 Leu Asn Pro He Val Tyr Gly Val Lys Thr Lys Glu He Arg Gin Arg 290 295 300 ate ctt cga ctt ttc cat gtg gcc aca cac get tea gag ccc tag 957
He Leu Arg Leu Phe His Val Ala Thr His Ala Ser Glu Pro 305 310 315
It will be appreciated that SEQ ID NO: 10 contains methionine residues at positions 1 and 2. Translation ofthe relevant mRNA sequences may occur beginning from either or both methionines, which can be determined for a particular cell source by purifying expressed CON 198 protein and performing amino-terminal sequencing thereon. CON 198 polypeptides beginning at either Met, or Met2 of SEQ ID NO: 10 are intended a polypeptides ofthe invention. Another preferred embodiment comprises a purified and isolated polypeptide designated CON 197, comprising the complete amino acid sequence set forth in SEQ TD NO: 12. This amino acid sequence was deduced from a polynucleotide sequence encoding CON197 (SEQ ID NO: 11), as set forth below:
1 ATGGAAAGCGAGAACAGAAGAGTGATAAGAGAATTCATCCTCCTTGGTCTGACCCAGTCTCAAGATATT M E S E N R R V I R E F I L L G L T Q S Q D I
70
CAGCTCCTGGTCTTTGTGCTAGTTTTAATATTCTACTTCATCATCCTCCCTGGAAATTTTCTCATTATT Q L L V F V L V L I F Y F I I L P G N F L I I
139
TTCACCATAAAGTCAGACCCTGGGCTCACAGCCCCCCTCTATTTCTTTCTGGGCAACTTGGCCTTCCTG F T I K S D P G L T A P L Y F F L G N L A F L
208
GATGCATCCTACTCCTTCATTGTGGCTCCCCGGATGTTGGTGGACTTCCTCTCTGCGAAGAAGATAATC D A S Y S F I V A P R M L V D F L S A K K I I 277
TCCTACAGAGGCTGCATCACTCAGCTCTTTTTCTTGCACTTCCTTGGAGGAGGGGAGGGATTACTCCTT S Y R G C I T Q L F F L H F L G G G E G L L L
346 GTTGTGATGGCCTTTGACCGCTACATCGCCATCTGCCGGCCTCTGCACTATCCTACTGTCATGAACCCT V V M A F D R Y I A I C R P L H Y P T V M N P
415
AGAACCTGCTATGCAATGATGTTGGCTCTGTGGCTTGGGGGTTTTGTCCACTCCATTATCCAGGTGGTC R T C Y A M M L A L W L G G F V H S I I Q V V
484
CTCATCCTCCGCTTGCCTTTTTGTGGCCCAAACCAGCTGGACAACTTCTTCTGTGATGTCCCACAGGTC L I L R L P F C G P N Q L D N F F C D V P Q V
553
ATCAAGCTGGCCTGCACCGACACATTTGTGGTGGAGCTTCTGATGGTCTTCAACAGTGGCCTGATGACA I K L A C T D T F V V E L L M V F N S G L M T 622
CTCCTGTGCTTTCTGGGGCTTCTGGCCTCCTATGCAGTCATTCTTTGTCGCATACGAGGGTCTTCTTCT L L C F L G L L A S Y A V I L C R I R G S S S 691
GAGGCAAAAAACAAGGCCATGTCCACGTGCATCACCCATATCATTGTTATATTCTTCATGTTTGGACCT E A K N K A M S T C I T H I I V X F F M F G P 760
GGCATCTTCATCTACACGCGCCCCTTCAGGGCTTTCCCAGCTGACAAGGTGGTTTCTCTCTTCCACACA G I F I Y T R P F R A F P A D K V V S L F H T
829 GTGATTTTTCCTTTGTTGAATCCTGTCATTTATACCCTTCGCAACCAGGAAGTGAAAGCTTCCATGAAA V I F P L L N P V I Y T L R N Q E V K A S M K
898
AAGGTGTTTAATAAGCACATAGCCTGAAAAAGGGCGCAAAAAAAAAAAGAATAAAAATAGACTGTAGAA K V F N K H I A *
967 TTTTTAAAAAAAAAAAAAAAAAAAAAAAA
Another preferred embodiment comprises a purified and isolated polypeptide designated CON202, comprising the complete amino acid sequence set forth in SEQ ID NO: 14. This amino acid sequence was deduced from a polynucleotide sequence encoding CON202 (SEQ ID NO: 13), as set forth below:
1 TGCTTCCCCATAAGGTAACAGCTTTGTTAGCNCTGTCTGACATCATTGCTTGTTNACTTAAGAACTGAT
70 AGGTNTTTTTTTTTTTTTTTTTTCAGATATTCTGATGGCAAAACAAGTGGAAGAAAAGAGGAAGCATGA
139 CTGCAGATCAGATCAGTTCTCTTTGTGGATTATATTTTCAGTAAAATGTATGGATCTATCTTTTCCTTG
208
TTCTTATATCTAGATCATGAGACTTGACTGAGGCTGTATCCTTATCCTCCATCCATCTATGGCGAACTA
M A N Y
277
TAGCCATGCAGCTGACAACATTTTGCAAAATCTCTCGCCTCTAACAGCCTTTCTGAAACTGACTTCCTT S H A A D N I L Q N L S P L T A F L K L T S L 346
GGGTTTCATAATAGGAGTCAGCGTGGTGGGCAACCTCCTGATCTCCATTTTGCTAGTGAAAGATAAGAC G F I I G V S V V G N L L I S I L L V K D K T
415 CTTGCATAGAGCACCTTACTACTTCCTGTTGGATCTTTGCTGTTCAGATATCCTCAGATCTGCAATTTG L H R A P Y Y F L L D L C C S D I L R S A I C
484
TTTCCCATTTGTGTTCAACTCTGTCAAAAATGGTTCTACCTGGACTTATGGGACTCTGACTTGCAAAGT F P F V F N S V K N G S T T Y G T L T C K V
553
GATTGCCTTTCTGGGGGTTTTGTCCTGTTTCCACACTGCTTTCATGCTCTTCTGCATCAGTGTCACCAG I A F L G V L S C F H T A F M L F C I S V T R
622
ATATTTAGCTATCGCCCATCACCGCTTCTATACAAAGAGGCTGACCTTTTGGACGTGTCTGGCTGTGAT Y L A I A H H R F Y T K R L T F T C L A V I 691
CTGTATGGTGTGGACTCTGTCTGTGGCCATGGCATTTCCCCCGGTTTTAGACGTGGGCACTTACTCATT C M V W T L S V A M A F P P V L D V G T Y S F 760
CATTAGGGAGGAAGATCAATGCACCTTCCAACACCGCTCCTTCAGGGCTAATGATTCCTTAGAATTTAT I R E E D Q C T F Q H R S F R A N D S L G F M
829 GCTGCTTCTTGCTCTCATCCTCCTAGCCACACAGCTTGTCTACCTCAAGCTGATATTTTTCGTCCACGA L L L A L I L L A T Q L V Y L K L I F F V H D
898
TCGAAGAAAAATGAAGCCAGTCCAGTTTGTAGCAGCAGTCAGCCAGAACTGGACTTTTCATGGTCCTGG R R K M K P V Q F V A A V S Q N W T F H G P G
967
AGCCAGTGGCCAGGCAGCTGCCAATTGGCTAGCAGGATTTGGAAGGGGTCCCACACCACCCACCTTGCT A S G Q A A A N W L A G F G R G P T P P T L L
1036
GGGCATCAGGCAAAATGCAAACACCACAGGCAGAAGAAGGCTATTGGTCTTAGACGAGTTCAAAATGGA G I R Q N A N T T G R R R L L V L D E F K M E 1105
GAAAAGAATCAGCAGAATGTTCTATATAATGACTTTTCTGTTTCTAACCTTGTGGGGCCCCTACCTGGT K R I S R M F Y I M T F L F L T L G P Y L V
1174
GGCCTGTTATTGGAGAGTTTTTGCAAGAGGGCCTGTAGTACCAGGGGGATTTCTAACAGCTGCTGTCTG A C Y R V F A R G P V V P G G F L T A A V
1243
GATGAGTTTTGCCCAAGCAGGAATCAATCCTTTTGTCTGCATTTTCTCAAACAGGGAGCTGAGGCGCTG M S F A Q A G I N P F V C I F S N R E L R R C
1312 TTTCAGCACAACCCTTCTTTACTGCAGAAAATCCAGGTTACCAAGGGAACCTTACTGTGTTATATGAGG F S T T L L Y C R K S R L P R E P Y C V I
Still another preferred embodiment comprises a purified and isolated polypeptide designated CON222, comprising the complete amino acid sequence set forth in SEQ ID NO: 16. This amino acid sequence was deduced from a polynucleotide sequence encoding CON222 (SEQ ID NO: 15), as set forth below:
1 ATGTTTAGACCTCTTGTGAATCTCTCTCACATATATTTTAAGAAATTCCAGTACTGTGGGTATGCA M F R P L V N L S H I Y F K K F Q Y C G Y A 67 CCACATGTTCGCAGCTGTAAACCAAACACTGATGGAATTTCATCTCTAGAGAATCTCTTGGCAAGC P H V R S C K P N T D G I S S L E N L L A S 133 ATTATTCAGAGAGTATTTGTCTGGGTTGTATCTGCAGTTACCTGCTTTGGAAACATTTTTGTCATT I I Q R V F V V V S A V T C F G N I F V I 199 TGCATGCGACCTTATATCAGGTCTGAGAACAAGCTGTATGCCATGTCAATCATTTCTCTCTGCTGT C M R P Y I R S E N K L Y A M S I I S L C C 265 GCCGACTGCTTAATGGGAATATATTTATTCGTGATCGGAGGCTTTGACCTAAAGTTTCGTGGAGAA A D C L M G I Y L F V I G G F D L K F R G E 331 TACAATAAGCATGCGCAGCTGTGGATGGAGAGTACTCATTGTCAGCTTGTAGGATCTTTGGCCATT
Y N K H A Q L W M E S T H C Q L V G S L A I 397 CTGTCCACAGAAGTATCAGTTTTACTGTTAACATTTCTGACATTGGAAAAATACATCTGCATTGTC
L S T E V S V L L L T F L T L E Y I C I V 463 TATCCTTTTAGATGTGTGAGACCTGGAAAATGCAGAACAATTACAGTTCTGATTCTCATTTGGATT
Y P F R C V R P G K C R T I T V L I L I W I 529 ACTGGTTTTATAGTGGCTTTCATTCCATTGAGCAATAAGGAATTTTTCAAAAACTACTATGGCACC
T G F I V A F I P L S N K E F F K N Y Y G T
595 AATGGAGTATGCTTCCCTCTTCATTCAGAAGATACAGAAAGTATTGGAGCCCAGATTTATTCAGTG N G V C F P L H S E D T E S I G A Q I Y S V
661 GCAATTTTTCTTGGTATTAATTTGGCCGCATTTATCATCATAGTTTTTTCCTATGG.AAGCATGTTT
A I F L G I N L A A F I I I V F Ξ Y G S M F
727 TATAGTGTTCATCAAAGTGCCATAACAGCAACTGAAATACGGAATCAAGTTAAAAAAGAGATGATC
Y S V H Q S A I T A T E I R N Q V K K E M 1 793 CTTGCCAAACGTTTTTTCTTTATAGTATTTACTGATGCATTATGCTGGATACCCATTTTTGTAGTG
L A K R F F F I V F T D A L C W I P I F V V
859 AAATTTCTTTCACTGCTTCAGGTAGAAATACCAGGTACCATAACCTCTTGGGTAGTGATTTTTATT
K F L S L L Q V E I P G T I T S W V V I F I 925 CTGCCCATTAACAGTGCTTTGAACCCAATTCTCTATACTCTGACCACAAGACCATTTAAAGAAATG L P I N S A L N P I L Y T L T T R P F K E M
991 ATTCATCGGTTTTGGTATAACTACAGACAAAGAAAATCTATGGACAGCAAAGGTCAGAAAACATAT
I H R F Y N Y R Q R K S M D S K G Q K T Y 1057 GCTCCATCATTCATCTGGGTGGAAATGTGGCCACTGCAGGAGATGCCACCTGAGTTAATGAAGCCG
A P S F I V E M P L Q E M P P E L M K P 1123 GACCTTTTCACATACCCCTGTGAAATGTCACTGATTTCTCAATCAACGAGACTCAATTCCTATTCA
D L F T Y P C E M S L I S Q S T R L N S Y S 1189 TGA 1191 *
Another preferred embodiment comprises a purified and isolated polypeptide designated CON215, comprising the complete amino acid sequence set forth in SEQ ID NO: 18. This amino acid sequence was deduced from a polynucleotide sequence encoding CON215 (SEQ ID NO: 17), as set forth below: atg ggg ttc aac ttg acg ctt gca aaa tta cca aat aac gag ctg cac 48 Met Gly Phe Asn Leu Thr Leu Ala Lys Leu Pro Asn Asn Glu Leu His 1 5 10 15 ggc caa gag agt cac aat tea ggc aac agg age gac ggg cca gga aag 96 Gly Gin Glu Ser His Asn Ser Gly Asn Arg Ser Asp Gly Pro Gly Lys 20 25 30 aac ace ace ctt cac aat gaa ttt gac aca att gtc ttg cca gtg ctt 144 Asn Thr Thr Leu His Asn Glu Phe Asp Thr He Val Leu Pro Val Leu
35 40 45 tat etc att ata ttt gtg gca age ate ttg ctg aat ggt tta gca gtg 192 Tyr Leu He He Phe Val Ala Ser He Leu Leu Asn Gly Leu Ala Val
50 55 60 tgg ate ttc ttc cac att agg aat aaa ace age ttc ata ttc tat etc 240
Trp He Phe Phe His He Arg Asn Lys Thr Ser Phe He Phe Tyr Leu 65 70 75 80 aaa aac ata gtg gtt gca gac etc ata atg acg ctg aca ttt cca ttt 288
Lys Asn He Val Val Ala Asp Leu He Met Thr Leu Thr Phe Pro Phe 85 90 95 cga ata gtc cat gat gca gga ttt gga cct tgg tac ttc aag ttt att 336 Arg He Val His Asp Ala Gly Phe Gly Pro Trp Tyr Phe Lys Phe He
100 105 110 etc tgc aga tac act tea gtt ttg ttt tat gca aac atg tat act tec 384
Leu Cys Arg Tyr Thr Ser Val Leu Phe Tyr Ala Asn Met Tyr Thr Ser 115 120 125 ate gtg ttc ctt ggg ctg ata age att gat cgc tat ctg aag gtg gtc 432
He Val Phe Leu Gly Leu He Ser He Asp Arg Tyr Leu Lys Val Val
130 135 140 aag cca ttt ggg gac tct egg atg tac age ata ace ttc acg aag gtt 480
Lys Pro Phe Gly Asp Ser Arg Met Tyr Ser He Thr Phe Thr Lys Val 145 150 155 160 tta tct gtt tgt gtt tgg gtg ate atg get gtt ttg tct ttg cca aac 528
Leu Ser Val Cys Val Trp Val He Met Ala Val Leu Ser Leu Pro Asn 165 170 175 ate ate ctg aca aat ggt cag cca aca gag gac aat ate cat gac tgc 576 He He Leu Thr Asn Gly Gin Pro Thr Glu Asp Asn He His Asp Cys
180 185 190 tea aaa ctt aaa agt cct ttg ggg gtc aaa tgg cat acg gca gtc ace 624
Ser Lys Leu Lys Ser Pro Leu Gly Val Lys Trp His Thr Ala Val Thr 195 200 205 tat gtg aac age tgc ttg ttt gtg gcc gtg ctg gtg att ctg ate gga 672
Tyr Val Asn Ser Cys Leu Phe Val Ala Val Leu Val He Leu He Gly
210 215 220 tgt tac ata gcc ata tec agg tac ate cac aaa tec age agg caa ttc 720 Cys Tyr He Ala He Ser Arg Tyr He His Lys Ser Ser Arg Gin Phe 225 230 235 240 ata agt cag tea age cga aag cga aaa cat aac cag age ate agg gtt 768 He Ser Gin Ser Ser Arg Lys Arg Lys His Asn Gin Ser He Arg Val 245 250 255 gtt gtg get gtg ttt ttt ace tgc ttt eta cca tat cac ttg tgc aga 816 Val Val Ala Val Phe Phe Thr Cys Phe Leu Pro Tyr His Leu Cys Arg
260 265 270 att cct ttt act ttt agt cac tta gac agg ctt tta gat gaa tct gca 864 He Pro Phe Thr Phe Ser His Leu Asp Arg Leu Leu Asp Glu Ser Ala 275 280 285
caa aaa ate eta tat tac tgc aaa gaa att aca ctt ttc ttg tct gcg 912 Gin Lys He Leu Tyr Tyr Cys Lys Glu He Thr Leu Phe Leu Ser Ala 290 295 300 tgt aat gtt tgc ctg gat cca ata att tac ttt ttc atg tgt agg tea 960 Cys Asn Val Cys Leu Asp Pro Xle He Tyr Phe Phe Met Cys Arg Ser 305 310 315 320 ttt tea aga agg ctg ttc aaa aaa tea aat ate aga ace agg agt gaa 1008 Phe Ser Arg Arg Leu Phe Lys Lys Ser Asn He Arg Thr Arg Ser Glu 325 330 335 age ate aga tea ctg caa agt gtg aga aga teg gaa gtt etc ata tat 1056 Ser He Arg Ser Leu Gin Ser Val Arg Arg Ser Glu Val Leu He Tyr
340 345 350 tat gat tat act gat gtg tag 1077
Tyr Asp Tyr Thr Asp Val 355
Another preferred embodiment comprises a purified and isolated polypeptide designated CON217, comprising the complete amino acid sequence set forth in SEQ ID NO: 20. This amino acid sequence was deduced from a polynucleotide sequence encoding CON217 (SEQ ID NO: 19), as set forth below: -41 C ATGGCATCCC CAGCCTAGCT CCCAATCCCA CTTTGGCACG
1 ATGTTAGCCAACAGCTCCTCAACCAACAGTTCTGTTCTCCCGTGTCCTGACTACCGACCTACCCAC M L A N S S S T N S S V L P C P D Y R P T H 67 CGCCTGCACTTGGTGGTCTACAGCTTGGTGCTGGCTGCCGGGCTCCCCCTCAACGCGCTAGCCCTC R L H L V V Y S L V L A A G L P L N A L A L 133 TGGGTCTTCCTGCGCGCGCTGCGCGTGCACTCGGTGGTGAGCGTGTACATGTGTAACCTGGCGGCC
W V F L R A L R V H S V V S V Y M C N L A A 199 AGCGACCTGCTCTTCACCCTCTCGCTGCCCGTTCGTCTCTCCTACTACGCACTGCACCACTGGCCC
S D L L F T L S L P V R L S Y Y A L H H P 265 TTCCCCGACCTCCTGTGCCAGACGACGGGCGCCATCTTCCAGATGAACATGTACGGCAGCTGCATC F P D L L C Q T T G A I F Q M N M Y G S C I
331 TTCCTGATGCTCATCAACGTGGACCGCTACGCCGCCATCGTGCACCCGCTGCGACTGCGCCACCTG
F L M L I N V D R Y A A I V H P L R L R H L 397 CGGCGGCCCCGCGTGGCGCGGCTGCTCTGCCTGGGCGTGTGGGCGCTCATCCTGGTGTTTGCCGTG R R P R V A R L L C L G V W A L I L V F A V 463 CCCGCCGCCCGCGTGCACAGGCCCTCGCGTTGCCGCTACCGGGACCTCGAGGTGCGCCTATGCTTC
P A A R V H R P S R C R Y R D L E V R L C F 529 GAGAGCTTCAGCGACGAGCTGTGGAAAGGCAGGCTGCTGCCCCTCGTGCTGCTGGCCGAGGCGCTG
E S F S D E L K G R L L P L V L L A E A L 595 GGCTTCCTGCTGCCCCTGGCGGCGGTGGTCTACTCGTCGGGCCGAGTCTTCTGGACGCTGGCGCGC G F L L P L A A V V Y S S G R V F T L A R
661 CCCGACGCCACGCAGAGCCAGCGGCGGCGGAAGACCGTGCGCCTCCTGCTGGCTAACCTCGTCATC
P D A T Q S Q R R R K T V R L L L A N L V I 727 TTCCTGCTGTGCTTCGTGCCCTACAACAGCACGCTGGCGGTCTACGGGCTGCTGCGGAGCAAGCTG F L L C F V P Y N S T L A V Y G L L R S K 793 GTGGCGGCCAGCGTGCCTGCCCGCGATCGCGTGCGCGGGGTGCTGATGGTGATGGTGCTGCTGGCC
V A A S V P A R D R V R G V L M V M V L L A 859 GGCGCCAACTGCGTGCTGGACCCGCTGGTGTACTACTTTAGCGCCGAGGGCTTCCGCAACACCCTG
G A N C V L D P L V Y Y F S A E G F R N T L 925 CGCGGCCTGGGCACTCCGCACCGGGCCAGGACCTCGGCCACCAΛCGGGACGCGGGCGGCGCTCGCG R G L G T P H R A R T S A T N G T R A A L A 991 CAATCCGAAAGGTCCGCCGTCACCACCGACGCCACCAGGCCGGATGCCGCCAGTCAGGGGCTGCTC
Q S E R S A V T T D A T R P D A A S Q G L L 1057 CGACCCTCCGACTCCCACTCTCTGTCTTCCTTCACACAGTGTCCCCAGGATTCCGCCCTCTGAACA
R P S D S H S L S S F T Q C P Q D S A L *
1123 CACATGCCAT TGCGCTGTCC GTGCCCGACT CCCAACGCCT CTCGTTCTGG GAGGCTTACA 1183 GGGTGTACAC ACAAGAAGGT GGGCTGGGCA CTTGGACCTT TGGGTGGCAA TTCCAGCTTA
1243 GCAACGCAGA AGAGTACAAA GTGTGGAAGC CAGGGCCCAG GGAAGGCAGT GCTGCTGGAA
1303 ATGGCTTCTT TAAACTGTGA GCACGCAGAG CACCCCTTCT CCAGCGGTGG GAAGTGATGC
1363 AGAGAGCCCA CCCGTGCAGA GGGCAGAAGA GGACGAAATG CCTTTGGGTG GGCAGGGCAT
1423 TAAACTGCTA AAAGCTGGTT AGATGGAACA GAAAATGGGC ATTCTGGATC TAAACCGCCA 1483 CAGGGGCCTG AGAGCTGAAG AGCACCAGGT TTGGTGGACA AAGCTACTGA GATGCCTGTT
1543 CATCTGCTGA CTTCTGTCTA GGCTCATGGA TGCCACCCCC TTTCATTTCG GCCTAGGCTT
1603 CCCCTGCTCA CCACTGAGGC CTAATACAAG AGTTCCTATG GACAGAACTA CATTCTTTCT
1663 CGCATAGTGA CTTGTGACAA TTTAGACTTG GCATCCAGCA TGGGATAGTT GGGGCAAGGC
1723 AAAACTAACT TAGAGTTTCC CCCTCAACAA CATCCAAGTC CAAACCCTTT TTAGGTTATC 1783 CTTTCTTCCA TCACATCCCC TTTTCCAGGC CTCCTCCATT TTAGGTCCTT AATATTCTTT
1843 CTTTTTCTCT CTCTCTCGTT TCTCTCTTCT CTCTCCTCTC CTCTCCTCTC TCTTCTCCTC
1903 TTCTCTCTCT CTCCCTCTCT CTCCTTTGTC CAGAGTAAGG ATAAAATTCT TTCTACTAAA
1963 GCACTGGTTC TCAAACTTTT TGGTCTCAGA CCCCACTCTT AGAAATTGAG GATCTCAAAG
2023 AGCTTTGCTT ATATTTTGTT CTTTTGATAC TTACCATACT AGAAATTAAA GCGAATACAT 2083 TTTTAAAATA AATACACATG CACACATTAC ATTAGCCATG GGAGCAATAA TGTCACCACA
2143 CACACTTCAT GAAGCCTCTG GAAAACTCTA CAGTATACTT GTGAGAGAAT GAGAGTGAAA
2203 GGGACAAATA ACATCTGTGT AGCAGTATTA TGAAAATAGC TTGACCTTGT GGACTTCCTC 2263 AGAGGGTTGG TCCCTGGATC ACACTTTGAG AACCATACTT GTCCTGAAGT ATTGGAGTTC
2323 ATGTCTAACT TCTTCCCAGG GCATTATGTA CAGTGCTTTT TATTACTGTG GGGAGAGGGC 2383 AGTGCTAAAT AAATTAATCA CTACTGATAA AAAAAAAAAA AAAAAAAAAA AAAAAAA
Although SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 provide for particular human sequences, the invention is intended to include within its scope other human allelic variants; non-human mammalian forms of GPCR polypeptides, and other vertebrate forms of GPCR polypeptides. It will be appreciated that extracellular epitopes are particularly useful for generating and screening for antibodies and other binding compounds that bind to receptors such as GPCR polypeptides. Thus, in another preferred embodiment, the invention provides a purified and isolated polypeptide comprising at least one extracellular domain of a GPCR polypeptide ofthe invention. By "extracellular domain", is it meant the amino terminal extracellular domain or an extracellular loop that spans two membrane domains. A purified and isolated polypeptide composing the N-termmal extiacclluldi domain of GPCR polypeptides of the invention is highly preferred Also picfeπed is a put i fied and isolated polypeptide comptising a GPCR seven transmcmbiane receptoi fragment selected from the gioup consisting of the N-termmal extiacellular domain of GPCR polypeptides of the invention, tiansmcmbiaπe domains of GPCR polypeptides of the invention, extracellular loops connecting transmembrane domains of GPCR polypeptides of the invention, intiacellulai loops connecting transmembrane domains of GPCR polypeptides of the invention, the C-terminal cytoplasmic domain of GPCR polypeptides, and fusions thereof Such fragments may be continuous portions of the native receptor However, it will also be appreciated that knowledge ofthe GPCR gene and protein sequences as provided herein permits recombming of various domains that are not contiguous in the native protein
In another embodiment, the invention provides purified and isolated polynucleotides (e g , cDNA, genomic DNA, synthetic DNA, RNA, or combinations thereof, single or double stranded) that comprise a nucleotide sequence encoding an ammo acid sequence of the polypeptides of the invention Another embodiment provides a purified and isolated polynucleotide encoding the amino acid sequence of the polypeptide ofthe invention fused to a heterologous tag ammo acid sequence Such polynucleotides are useful for recombinantly expressing the receptor and also for detecting expression ofthe receptor in cells (e g , using Northern hybridization and in situ hybridization assays, and Western studies) Polynucleotides encoding polypeptides ofthe invention also are useful to design antisense and other molecules for the suppression of GPCR polypeptides expression in a cultured cell or animal (for therapeutic purposes or to provide a model for diseases characterized by aberrant
GPCR polypeptide expiession) Such polynucleotides are also useful to design antisense and other molecules for the suppression of GPCR polypeptide expression in a cultuied cell or tissue or in an animal, for therapeutic purposes or to provide a model for diseases characterized by aberrant GPCR polypeptide expression Specifically excluded from the definition of polynucleotides ofthe invention are entire isolated chromosomes of native host cells A preferred polynucleotide set forth in any one of the SEQ ID NOS 1 , 3, 5, 7, 9, 1 1 , 13, 15, 17, and 19 coπesponds to a naluially occuπ in GPCR secμience It will be appreciated that numeious othci sequences exist that also encode GPCR polypeptides having the amino acid sequence set out in SEQ ID NOS 2, 4, 6, 8, 10, 12, 14, 16, 18 and 20 due to the well-known degeneracy ofthe univeisal genetic code All such sequences lepresent polynucleotides of the invention
The invention also provides a purified and isolated polynucleotide compπsing a nucleotide sequence that encodes a mammalian seven transmembi ane receptor, wherein the polynucleotide hybridizes to a nucleotide sequence set forth in any one of SEQ ID NOS 1 , 3, 5, 7, 9, 1 1, 13, 15, 17, or 19 or the non-coding strand complementary thereto, under the following hybridization conditions
(a) hybridization for 16 hours at 42°C in a hybridization solution compπsing 50% formamide, 1% SDS, 1 M NaCl, 10% Dextran sulphate, and
(b) washing 2 times for 30 minutes at 60°C in a wash solution compπsing 0 1% SSC, 1% SDS Polynucleotides that encode a human allehc variant are highly preferred
A highly prefeπed polynucleotide ofthe invention comprises the sequence set forth in SEQ XD NO 1, which compπses a human CON193 encoding DNA sequence ntggttgttg gaccattaaa atgcattatg gaatttttaa aagttggggg agagggagac 60 agtaaaaata acctatattt tctcttgttt tttttttttt aactctagga aagcccagac 120 aaattttgag ctatttcata acctaccaga cttatcatgc taacactgaa taaaacagac 180 ctaataccag cttcatttat tctgaatgga gtcccaggac tggaagacac acaactctgg 240 atttccttcc cattctgctc tatgtatgtt gtggctatgg tagggaattg tggactcctc 300 tacctcattc actatgagga tgccctgcac aaacccatgt actacttctt ggccatgctt 360 tcctttactg accttgttat gtgctctagt acaatcccta aagccctctg catcttctgg 420 tttcatctca aggacattgg atttgatgaa tgccttgtcc agatgttctt catccacacc 480 ttcacaggga tggagtctgg ggtgcttatg cttatggccc tggatcgcta tgtggccatc 540 tgctacccct tacgctattc aactatcctc accaatcctg taattgcaaa ggttgggact 600 gccaccttcc tgagaggggt attactcatt attcccttta ctttcctcac caagcgcctg 660 ccctcctgca gaggcaatat acttccccat acctactgtg accacatgtc tgtagccaaa 720 ttgtcctgtg gtaatgtcaa ggtcaatgcc atctatggtc tgatggttgc cctcctgatt 780 gggggctttg acatactgtg tatcaccatc tcctatacca tgattctccg ggcagtggtc 840 agcctctcct cagcagatgc tcggcagaag gcctttaata cctgcactgc ccacatttgt 900 gccattgttt tctcctatac tccagctttc ttctccttct tttcccaccg ctttggggaa 960 cacataatcc ccccttcttg ccacatcatt gtagccaata tttatctgct cctaccaccc 1020 actatgaacc ctattgtcta tggggtgaaa accaaacaga tacgagactg tgtcataagg 1080 atcctttcag gttctaagga taccaaatcc tacagcatgt gaatgaacac ttgccaggag 1140 tgagaagaga aggaaagaat tacttctatt tgcctcttat gcaggagttc ataaaatctt 1200 tctggaagta ctgtattgat cacaaaatgg agtttgntga ctggtgcatt ctcaataagt 1260 accttgggaa tctnacatca ctggaaggcc caccacattt ctataaat 1308 Also prefeπed is a polynucleotide comprising nucleotides 157-1 1 19 of
SEQ ID NO: 1, which represent the portion of SEQ ID NO: 1 that encodes CON 193 amino acids.
Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 3, which comprises a human CON166 encoding DNA sequence: atggatgaaa caggaaatct gacagtatct tctgccacat gccatgacac tattgatgac 60 ttccgcaatc aagtgtattc caccttgtac tctatgatct ctgttgtagg cttctttggc 120 aatggctttg tgctctatgt cctcataaaa acctatcaca agaagtcagc cttccaagta 180 tacatgatta atttagcagt agcagatcta ctttgtgtgt gcacactgcc tctccgtgtg 240 gtctattatg ttcacaaagg catttggctc tttggtgact tcttgtgccg cctcagcacc 300 tatgctttgt atgtcaacct ctattgtagc atcttcttta tgacagccat gagctttttc 360 cggtgcattg caattgtttt tccagtccag aacattaatt tggttacaca gaaaaaagcc 420 aggtttgtgt gtgtaggtat ttggattttt gtgattttga ccagttctcc atttctaatg 480 gccaaaccac aaaaagatga gaaaaataat accaagtgct ttgagccccc acaagacaat 540 caaactaaaa atcatgtttt ggtcttgcat tatgtgtcat tgtttgttgg ctttatcatc 600 ccttttgtta ttataattgt ctgttacaca atgatcattt tgaccttact aaaaaaatca 660 atgaaaaaaa atctgtcaag tcataaaaag gctataggaa tgatcatggt cgtgaccgct 720 gcctttttag tcagtttcat gccatatcat attcaacgta ccattcacct tcatttttta 780 cacaatgaaa ctaaaccctg tgattctgtc cttagaatgc agaagtccgt ggtcataacc 840 ttgtctctgg ctgcatccaa ttgttgcttt gaccctctcc tatatttctt ttctgggggt 900 aactttagga aaaggctgtc tacatttaga aagcattctt tgtccagcgt gacttatgta 960 cccagaaaga aggcctcttt gccagaaaaa ggagaagaaa tatgtaaagt atag 1014
The final three nucleotides of this sequence represent a stop codon.
Still another highly preferred polynucleotide ofthe invention comprises the sequence set forth in SEQ ID NO: 5, which comprises a human
CON103 encoding DNA sequence: ggggcctact tcaccgtgta cccggacttg ggaccatcac agacttcaga accatcagga 60 acctgggagc aactgaaagc tgaactacag tgggctttca gacacacagc aggctgcgga 120 geacaaatag gaetggttcc ctccaggcca ecageagggc ggtggaggtc tteactgact 180 ccctgcctac ctctcaggac aatgtccttt tggctccaca gtccctgaag ccagagctgg 240 tgggggcagg gaggcagcca ccagcctcta tatgtagtgg aggagggggt gtccagggag 300 ggctgcatga teetgagage ccccacctca eccggctgga ctateetccc acttcagggt 360 ttctctgggc ttccatcttg cccctgctga gccctgcttc ctcctctacc agcagcacaa 420 cccccaggct gggctcagag acctcatgtg gtgggatcac tcagtacccc gaggcggagg 480 gaaggaggga gggetgeagg gtteeeettg gcctgcaaae aggaaeacag ggtgtttete 540 agtggctgcg agaatgctga tgaaaacccc aggatgttgt gtcaccgtgg tggccagctg 600 atagtgccaa tcatcccact ttgccctgag cactcctgca ggggtagaag actccagaac 660 cttctctcag gcccatggcc caagcagccc atg gaa ctt cat aac ctg age tct 714 cca tct ccc tct etc tec tec tct gtt etc cct ccc tec ttc tct ccc 762 tea ccc tec tct get ccc tct gcc ttt ace act gtg ggg ggg tec tct 810 gga ggg ccc tgc cac ccc ace tct tec teg ctg gtg tct gcc ttc ctg 858 gca cca ate ctg gcc ctg gag ttt gtc ctg ggc ctg gtg ggg aac agt 906 ttg gcc etc ttc ate ttc tgc ate cac acg egg ccc tgg ace tec aac 954 acg gtg ttc ctg gtc age ctg gtg gcc get gac ttc etc ctg ate age 1002 aac ctg ccc etc cgc gtg gac tac tac etc etc cat gag ace tgg cgc 1050 ttt ggg get get gcc tgc aaa gtc aac etc ttc atg ctg tec ace aac 1098 cgc acg gcc age gtt gtc ttc etc aca gcc ate gca etc aac cgc tac 1146 ctg aag gtg gtg cag ccc cac cac gtg ctg age cgt get tec gtg ggg 1194 gca get gcc egg gtg gcc ggg gga etc tgg gtg ggc ate ctg etc etc 1242 aac ggg cac ctg etc ctg age ace ttc tec ggc ccc tec tgc etc age 1290 tac agg gtg ggc acg aag ccc teg gcc teg etc cgc tgg cac cag gca 1338 ctg tac ctg ctg gag ttc ttc ctg cca ctg gcg etc ate etc ttt get 1386 att gtg age att ggg etc ace ate egg aac cgt ggt ctg ggc ggg cag 1434 gca ggc ccg cag agg gcc atg cgt gtg ctg gcc atg gtg gtg gcc gtc 1482 tac ace ate tgc ttc ttg ccc age ate ate ttt ggc atg get tec atg 1530 gtg get ttc tgg ctg tec gcc tgc cga tec ctg gac etc tgc aca cag 1578 etc ttc cat ggc tec ctg gcc ttc ace tac etc aac agt gtc ctg gac 1626 ccc gtg etc tac tgc ttc tct age ccc aac ttc etc cac cag age egg 1674 gcc ttg ctg ggc etc acg egg ggc egg cag ggc cca gtg age gac gag 1722 age tec tac caa ccc tec agg cag tgg cgc tac egg gag gcc tct agg 1770 aag gcg gag gcc ata ggg aag ctg aaa gtg cag ggc gag gtc tct ctg 1818 gaa aag gaa ggc tec tec cag ggc tga gggccagctg cagggctgca 1865 gcgctgtggg ggtaagggct geegegctct ggcctggagg gacaaggeea gcacacggtg 1925 cctcaaccaa ctggacaagg gatggcggca gaccaggggc caggccaaag cactggcagg 1985 actcatgtgg gtggcaggga gagaaaccca cctaggcctc tcagtgtgtc caggatggca 2045 ttcccagaat gcaggggaga gcaggatgcc gggtggagga gacaggcaag gtgccgttgg 2105 cacaccagct cagacagggg cctgcgcagc tgcaggggac agacgccaat cactgtcaca 2165 geagagtcac cttagaaatt ggaeagctgc atgttctgtg etetccagtt tgtcccttcc 2225 aatattaata aacttccctt ttaaatatat ttatttgcag accaatatct gtctttaatt 2285 ctaacctggg actgtcagta ggcgtcaaag tgagcgcccc agtgaaggaa ccttggagag 2345 agtgggagca ttcccagcct tccaggggga ctcgtcttcc agactttgga gcccgcatgt 2405 ctgaagcaga ctctttcttg gtag 2429
Also prefeπed is a polynucleotide comprising nucleotides 691-1842 of SEQ ID NO: 5, which represent the portion of SEQ ID NO: 5 that encodes CON103 amino acids. Nucleotides 1843-1845 represent a stop codon.
Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 7, which comprises a CON203-encoding DNA sequence: ttgaatttag gtgacactat agaagagcta tgacgtcgca tgcacgcgta cgtaagctcg 60 gaattcggct egagctgaae taatgactge egceataaga agacagagag aactgagtat 120 cctcccaaag gtgacactgg aagcaatgaa caccacagtg atgcaaggct tcaacagatc 180 tgagcggtgc cccagagaca ctcggatagt acagctggta ttcccagccc tctacacagt 240 ggttttcttg accggcatcc tgctgaatac tttggctctg tgggtgtttg ttcacatccc 300 cagctcctcc accttcatca tctacctcaa aaacactttg gtggccgact tgataatgac 360 actcatgctt cctttcaaaa tcctctctga ctcacacctg gcaccctggc agctcagagc 420 ttttgtgtgt cgtttttctt cggtgatatt ttatgagacc atgtatgtgg gcatcgtgct 480 gttagggctc atagcctttg acagattcct caagatcatc agacctttga gaaatatttt 540 tctaaaaaaa cctgtttttg caaaaacggt ctcaatcttc atctgggtct ttttggtctt 600 catctccctg ccaaatatga tcttgagcaa caaggaagca acaccatcgt ctgtgaaaaa 660 gtgtgcttcc ttaaaggggc ctctggggct gaaatggcat caaatggtaa ataacatatg 720 ccagtttatt ttctggactg gttttatcct aatgcttgtg ttttatgtgg ttattgcaaa 780 aaaagtatat gattcttata gaaagtccaa aagtaaggac agaaaaaaca acaaaaagct 840 ggaaggcaaa gtatttgttg tcgtggctgt cttctttgtg tgttttgctc catttcattt 900 tgccagagtt ccatatactc acagtcaaac caacaataag actgactgta gactgcaaaa 960 tcaactgttt attgctaaag aaacaactct ctttttggca gcaactaaca tttgtatgga 1020 tcccttaata tacatattct tatgtaaaaa attcacagaa aagctaccat gtatgcaagg 1080 gagaaagacc acagcatcaa gccaagaaaa tcatagcagt cagacagaca acataacctt 1140 aggctgacaa ctgtacatag ggttaacttc tatttattga tgagacttcc gtagataatg 1200 tggaaatcaa atttaaccaa gaaaaaaaga ttggaacaaa tgctctctta cattttattt 1260 atcctggtgt ccaggaaaag attatattaa atttaaatcc acatagatct attcataagc 1320 tgaatgaacc attacctaag agaatgcaac aggataccaa tggccactag aggcatattc 1380 cttcttcttt tttttttgtt aaatttcaag agcattcact ttacatttgg aaagactaag 1440 gggaacggtt atcctacaaa cctcccttca acacctttta catt 1484
Also preferred is a polynucleotide comprising nucleotides 146-1 144 of SEQ ID NO: 7, which represent the portion of SEQ D NO: 7 that encodes CON203 amino acids. Nucleotides 1145-1147 represent a stop codon.
Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 9, which comprises a human CONl 98 encoding DNA sequence:
ATGATGGTGG ATCCCAATGG CAATGAATCC AGTGCTACAT ACTTCATCCT AATAGGCCTC 60 CCTGGTTTAG AAGAGGCTCA GTTCTGGTTG GCCTTCCCAT TGTGCTCCCT CTACCTTATT 120
GCTGTGCTAG GTAACTTGAC AATCATCTAC ATTGTGCGGA CTGAGCACAG CCTGCATGAG 180
CCCATGTATA TATTTCTTTG CATGCTTTCA GGCATTGACA TCCTCATCTC CACCTCATCC 240
ATGCCCAAAA TGCTGGCCAT CTTCTGGTTC AATTCCACTA CCATCCAGTT TGATGCTTGT 300
CTGCTACAGA TGTTTGCCAT CCACTCCTTA TCTGGCATGG AATCCACAGT GCTGCTGGCC 360 ATGGCTTTTG ACCGCTATGT GGCCATCTGT CACCCACTGC GCCATGCCAC AGTACTTACG 420
TTGCCTCGTG TCACCAAAAT TGGTGTGGCT GCTGTGGTGC GGGGGGCTGC ACTGATGGCA 480
CCCCTTCCTG TCTTCATCAA GCAGCTGCCC TTCTGCCGCT CCAATATCCT TTCCCATTCC 540
TACTGCCTAC ACCAAGATGT CATGAAGCTG GCCTGTGATG ATATCCGGGT CAATGTCGTC 600
TATGGCCTTA TCGTCATCAT CTCCGCCATT GGCCTGGACT CACTTCTCAT CTCCTTCΪCA 660 TATCTGCTTA TTCTTAAGAC TGTGTTGGGC TTGACACGTG AAGCCCAGGC CAAGGCATTT 720
GGCACTTGCG TCTCTCATGT GTGTGCTGTG TTCATATTCT ATGTACCTTT CATTGGATTG 780
TCCATGGTGC ATCGCTTTAG CAAGCGGCGT GACTCTCCGC TGCCCGTCAT CTTGGCCAAT 840
ATCTATCTGC TGGTTCCTCC TGTGCTCAAC CCAATTGTCT ATGGAGTGAA GACAAAGGAG 900
ATTCGACAGC GCATCCTTCG ACTTTTCCAT GTGGCCACAC ACGCTTCAGA GCCCTAG 957 Thc last three nucleotides of this sequence represent a stop codon.
Still another A highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ TD NO: 1 1 , which comprises a human CON 197 encoding DNA sequence: ATGGAAAGCG AGAACAGAAG AGTGATAAGA GAATTCATCC TCCTTGGTCT GACCCAGTCT 60
CAAGATATTC AGCTCCTGGT CTTTGTGCTA GTTTTAATAT TCTACTTCAT CATCCTCCCT 120
GGAAATTTTC TCATTATTTT CACCATAAAG TCAGACCCTG GGCTCACAGC CCCCCTCTAT 180
TTCTTTCTGG GCAACTTGGC CTTCCTGGAT GCATCCTACT CCTTCATTGT GGCTCCCCGG 240
ATGTTGGTGG ACTTCCTCTC TGCGAAGAAG ATAATCTCCT ACAGAGGCTG CATCACTCAG 300 CTCTTTTTCT TGCACTTCCT TGGAGGAGGG GAGGGATTAC TCCTTGTTGT GATGGCCTTT 360
GACCGCTACA TCGCCATCTG CCGGCCTCTG CACTATCCTA CTGTCATGAA CCCTAGAACC 420
TGCTATGCAA TGATGTTGGC TCTGTGGCTT GGGGGTTTTG TCCACTCCAT TATCCAGGTG 480
GTCCTCATCC TCCGCTTGCC TTTTTGTGGC CCAAACCAGC TGGACAACTT CTTCTGTGAT 540
GTCCCACAGG TCATCAAGCT GGCCTGCACC GACACATTTG TGGTGGAGCT TCTGATGGTC 600 TTCAACAGTG GCCTGATGAC ACTCCTGTGC TTTCTGGGGC TTCTGGCCTC CTATGCAGTC 660
ATTCTTTGTC GCATACGAGG GTCTTCTTCT GAGGCAAAAA ACAAGGCCAT GTCCACGTGC 720
ATCACCCATA TCATTGTTAT ATTCTTCATG TTTGGACCTG GCATCTTCAT CTACACGCGC 780
CCCTTCAGGG CTTTCCCAGC TGACAAGGTG GTTTCTCTCT TCCACACAGT GATTTTTCCT 840
TTGTTGAATC CTGTCATTTA TACCCTTCGC AACCAGGAAG TGAAAGCTTC CATGAAAAAG 900 GTGTTTAATA AGCACATAGC CTGA 924
The last three nucleotides of this sequence represent a stop codon.
Another highly prefeπed polynucleotide ofthe invention comprises the sequence set forth in SEQ ID NO: 13, which comprises a human CON202 encoding DNA sequence: 1 TGCTTCCCCA TAAGGTAACA GCTTTGTTAG CNCTGTCTGA CATCATTGCT
51 TGTT ACTTA AGAACTGATA GGTYTTTTTT TTTTTTTTTT TTCAGATATT
101 CTGATGGCAA AACAAGTGGA AGAAAAGAGG AAGCATGACT GCAGATCAGA
151 TCAGTTCTCT TTGTGGATTA TATTTTCAGT AAAATGTATG GATCTATCTT
201 TTCCTTGTTC TTATATCTAG ATCATGAGAC TTGACTGAGG CTGTATCCTT 251 ATCCTCCATC CATCTATGGC GAACTATAGC CATGCAGCTG ACAACATTTT
301 GCAAAATCTC TCGCCTCTAA CAGCCTTTCT GAAACTGACT TCCTTGGGTT
351 TCATAATAGG AGTCAGCGTG GTGGGCAACC TCCTGATCTC CATTTTGCTA 401 GTGAAAGATA AGACCTTGCA TAGAGCACCT TACTACTTCC TGTTGGATCT
451 TTGCTGTTCA GATATCCTCA GATCTGCAAT TTGTTTCCCA TTTGTGTTCA 501 ACTCTGTCAA AAATGGTTCT ACCTGGACTT ATGGGACTCT GACTTGCAAA
551 GTGATTGCCT TTCTGGGGGT TTTGTCCTGT TTCCACACTG CTTTCATGCT
601 CTTCTGCATC AGTGTCACCA GATATTTAGC TATCGCCCAT CACCGCTTCT
651 ATACAAAGAG GCTGACCTTT TGGACGTGTC TGGCTGTGAT CTGTATGGTG
701 TGGACTCTGT CTGTGGCCAT GGCATTTCCC CCGGTTTTAG ACGTGGGCAC 751 TTACTCATTC ATTAGGGAGG AAGATCAATG CACCTTCCAA CACCGCTCCT
801 TCAGGGCTAA TGATTCCTTA GGATTTATGC TGCTTCTTGC TCTCATCCTC
851 CTAGCCACAC AGCTTGTCTA CCTCAAGCTG ATATTTTTCG TCCACGATCG
901 AAGAAAAATG AAGCCAGTCC AGTTTGTAGC AGCAGTCAGC CAGAACTGGA 951 CTTTTCATGG TCCTGGAGCC AGTGGCCAGG CAGCTGCCAA TTGGCTAGCA
1001 GGATTTGGAA GGGGTCCCAC ACCACCCACC TTGCTGGGCA TCAGGCAAAA
1051 TGCAAACACC ACAGGCAGAA GAAGGCTATT GGTCTTAGAC GAGTTCAAAA
1101 TGGAGAAAAG AATCAGCAGA ATGTTCTATA TAATGACTTT TCTGTTTCTA
1151 ACCTTGTGGG GCCCCTACCT GGTGGCCTGT TATTGGAGAG TTTTTGCAAG 1201 AGGGCCTGTA GTACCAGGGG GATTTCTAAC AGCTGCTGTC TGGATGAGTT
1251 TTGCCCAAGC AGGAATCAAT CCTTTTGTCT GCATTTTCTC AAACAGGGAG
1301 CTGAGGCGCT GTTTCAGCAC AACCCTTCTT TACTGCAGAA AATCCAGGTT 1351 ACCAAGGGAA CCTTACTGTG TTATATGAGG
Also prefeπed is a polynucleotide comprising nucleotides 266-1375 of SEQ ID NO: 13, which represent the portion of SEQ ID NO: 13 that encodes CON202 amino acids.
Nucleotides 1376-1378 represent a stop codon.
Another highly prefeπed polynucleotide ofthe invention comprises the sequence set forth in SEQ ID NO: 15, which comprises a human CON222 encoding DNA sequence: 1 ATGTTTAGAC CTCTTGTGAA TCTCTCTCAC ATATATTTTA AGAAATTCCA
51 GTACTGTGGG TATGCACCAC ATGTTCGCAG CTGTAAACCA AACACTGATG
101 GAATTTCATC TCTAGAGAAT CTCTTGGCAA GCATTATTCA GAGAGTATTT
151 GTCTGGGTTG TATCTGCAGT TACCTGCTTT GGAAACATTT TTGTCATTTG
201 GATGCGACCT TATATCAGGT CTGAGAACAA GCTGTATGCC ATGTCAATCA 251 TTTCTCTCTG CTGTGCCGAC TGCTTAATGG GAATATATTT ATTCGTGATC
301 GGAGGCTTTG ACCTAAAGTT TCGTGGAGAA TACAATAAGC ATGCGCAGCT
351 GTGGATGGAG AGTACTCATT GTCAGCTTGT AGGATCTTTG GCCATTCTGT
401 CCACAGAAGT ATCAGTTTTA CTGTTAACAT TTCTGACATT GGAAAAATAC
451 ATCTGCATTG TCTATCCTTT TAGATGTGTG AGACCTGGAA AATGCAGAAC 501 AATTACAGTT CTGATTCTCA TTTGGATTAC TGGTTTTATA GTGGCTTTCA
551 TTCCATTGAG CAATAAGGAA TTTTTCAAAA ACTACTATGG CACCAATGGA
601 GTATGCTTCC CTCTTCATTC AGAAGATACA GAAAGTATTG GAGCCCAGAT
651 TTATTCAGTG GCAATTTTTC TTGGTATTAA TTTGGCCGCA TTTATCATCA
701 TAGTTTTTTC CTATGGAAGC ATGTTTTATA GTGTTCATCA AAGTGCCATA 751 ACAGCAACTG AAATACGGAA TCAAGTTAAA AAAGAGATGA TCCTTGCCAA
801 ACGTTTTTTC TTTATAGTAT TTACTGATGC ATTATGCTGG ATACCCATTT
851 TTGTAGTGAA ATTTCTTTCA CTGCTTCAGG TAGAAATACC AGGTACCATA
901 ACCTCTTGGG TAGTGATTTT TATTCTGCCC ATTAACAGTG CTTTGAACCC
951 AATTCTCTAT ACTCTGACCA CAAGACCATT TAAAGAAATG ATTCATCGGT 1001 TTTGGTATAA CTACAGACAA AGAAAATCTA TGGACAGCAA AGGTCAGAAA
1051 ACATATGCTC CATCATTCAT CTGGGTGGAA ATGTGGCCAC TGCAGGAGAT
1101 GCCACCTGAG TTAATGAAGC CGGACCTTTT CACATACCCC TGTGAAATGT 1151 CACTGATTTC TCAATCAACG AGACTCAATT CCTATTCA
The last three nucleotides of this sequence represent a stop codon.
Another highly preferred polynucleotide of the invention comprises the sequence set forth in SEQ ID NO: 17, which comprises a human CON215 encoding DNA sequence. Also preferred is a polynucleotide comprising the portion of SEQ ID
NO: 17 set forth below, which represent the portion of SEQ ID NO: 17 that encodes CON215 amino acids (the last three nucleotides represent a stop codon).
ATGGGGTTCA ACTTGACGCT TGCAAAATTA CCAAATAACG AGCTGCACGG CCAAGAGAGT 60
CACAATTCAG GCAACAGGAG CGACGGGCCA GGAAAGAACA CCACCCTTCA CAATGAATTT 120 GACACAATTG TCTTGCCAGT GCTTTATCTC ATTATATTTG TGGCAAGCAT CTTGCTGAAT 180
GGTTTAGCAG TGTGGATCTT CTTCCACATT AGGAATAAAA CCAGCTTCAT ATTCTATCTC 240
AAAAACATAG TGGTTGCAGA CCTCATAATG ACGCTGACAT TTCCATTTCG AATAGTCCAT 300
GATGCAGGAT TTGGACCTTG GTACTTCAAG TTTATTCTCT GCAGATACAC TTCAGTTTTG 360
TTTTATGCAA ACATGTATAC TTCCATCGTG TTCCTTGGGC TGATAAGCAT TGATCGCTAT 420 CTGAAGGTGG TCAAGCCATT TGGGGACTCT CGGATGTACA GCATAACCTT CACGAAGGTT 480
TTATCTGTTT GTGTTTGGGT GATCATGGCT GTTTTGTCTT TGCCAAACAT CATCCTGACA 540
AATGGTCAGC CAACAGAGGA CAATATCCAT GACTGCTCAA AACTTAAAAG TCCTTTGGGG 600
GTCAAATGGC ATACGGCAGT CACCTATGTG AACAGCTGCT TGTTTGTGGC CGTGCTGGTG 660
ATTCTGATCG GATGTTACAT AGCCATATCC AGGTACATCC ACAAATCCAG CAGGCAATTC 720 ATAAGTCAGT CAAGCCGAAA GCGAAAACAT AACCAGAGCA TCAGGGTTGT TGTGGCTGTG 780
TTTTTTACCT GCTTTCTACC ATATCACTTG TGCAGAATTC CTTTTACTTT TAGTCACTTA 840
GACAGGCTTT TAGATGAATC TGCACAAAAA ATCCTATATT ACTGCAAAGA AATTACACTT 900
TTCTTGTCTG CGTGTAATGT TTGCCTGGAT CCAATAATTT ACTTTTTCAT GTGTAGGTCA 960
TTTTCAAGAA GGCTGTTCAA AAAATCAAAT ATCAGAACCA GGAGTGAAAG CATCAGATCA 1020 CTGCAAAGTG TGAGAAGATC GGAAGTTCTC ATATATTATG ATTATACTGA TGTGTAG 1077
Another prefeπed polynucleotide ofthe invention comprises the portion ofthe sequence set forth in SEQ ID NO: 19 which comprises a human CON217 encoding DNA sequence:
1 ATGTTAGCCA ACAGCTCCTC AACCAACAGT TCTGTTCTCC CGTGTCCTGA CTACCGACCT 61 ACCCACCGCC TGCACTTGGT GGTCTACAGC TTGGTGCTGG CTGCCGGGCT CCCCCTCAAC
121 GCGCTAGCCC TCTGGGTCTT CCTGCGCGCG CTGCGCGTGC ACTCGGTGGT GAGCGTGTAC
181 ATGTGTAACC TGGCGGCCAG CGACCTGCTC TTCACCCTCT CGCTGCCCGT TCGTCTCTCC
241 TACTACGCAC TGCACCACTG GCCCTTCCCC GACCTCCTGT GCCAGACGAC GGGCGCCATC
301 TTCCAGATGA ACATGTACGG CAGCTGCATC TTCCTGATGC TCATCAACGT GGACCGCTAC 361 GCCGCCATCG TGCACCCGCT GCGACTGCGC CACCTGCGGC GGCCCCGCGT GGCGCGGCTG
421 CTCTGCCTGG GCGTGTGGGC GCTCATCCTG GTGTTTGCCG TGCCCGCCGC CCGCGTGCAC
481 AGGCCCTCGC GTTGCCGCTA CCGGGACCTC GAGGTGCGCC TATGCTTCGA GAGCTTCAGC 541 GACGAGCTGT GGAAAGGCAG GCTGCTGCCC CTCGTGCTGC TGGCCGAGGC GCTGGGCTTC 601 CTGCTGCCCC TGGCGGCGGT GGTCTACTCG TCGGGCCGAG TCTTCTGGAC GCTGGCGCGC 661 CCCGACGCCA CGCAGAGCCA GCGGCGGCGG AAGACCGTGC GCCTCCTGCT GGCTAACCTC 721 GTCATCTTCC TGCTGTGCTT CGTGCCCTAC AACAGCACGC TGGCGGTCTA CGGGCTGCTG 781 CGGAGCAAGC TGGTGGCGGC CAGCGTGCCT GCCCGCGATC GCGTGCGCGG GGTGCTGATG 841 GTGATGGTGC TGCTGGCCGG CGCCAACTGC GTGCTGGACC CGCTGGTGTA CTACTTTAGC
901 GCCGAGGGCT TCCGCAACAC CCTGCGCGGC CTGGGCACTC CGCACCGGGC CAGGACCTCG
961 GCCACCAACG GGACGCGGGC GGCGCTCGCG CAATCCGAAA GGTCCGCCGT CACCACCGAC
1021 GCCACCAGGC CGGATGCCGC CAGTCAGGGG CTGCTCCGAC CCTCCGACTC CCACTCTCTG 1081 TCTTCCTTCA CACAGTGTCC CCAGGATTCC GCCCTCTGA
The last three nucleotides of this sequence represent a stop codon.
The invention also includes polynucleotides differing from the sequences set forth in SEQ TD NOS: 1, 3, 5, 7, 9, 1 1 , 13, 15, 17 and 19 and from their complementary strand by at least one nucleotide. In a related embodiment, the invention provides vectors comprising a polynucleotide ofthe invention. Such vectors are useful, e g., for amplifying the polynucleotides in host cells to create useful quantities thereof. In prefeπed embodiments, the vector is an expression vector wherein the polynucleotide ofthe invention is operatively linked to a polynucleotide comprising an expression control sequence. Such vectors are useful for recombinant production of polypeptides of the invention.
In another related embodiment, the invention provides host cells that are transformed or transfected (stably or transiently) with a polynucleotide ofthe invention or vectors ofthe invention. As stated above, such host cells are useful for amplifying the polynucleotides and also for expressing the GPCR seven transmembrane receptor polypeptides or fragments thereof encoded by the polynucleotides. Such host cells are useful in assays as described herein.
In still another related embodiment, the invention provides a method for producing a seven transmembrane receptor polypeptide (or fragment thereof) of the invention comprising the steps of growing a host cell ofthe invention in a nutrient medium and isolating the polypeptide or variant thereof from the cell or the medium. Since the GPCR polypeptides are seven transmembrane receptors, it will be appreciated that, for some applications, such as certain activity assays, the preferable isolation may involve isolation of cell membranes containing the polypeptide embedded therein, whereas for other applications a more complete isolation may be preferable.
In still another embodiment, the invention provides antibodies that are specific for the GPCR seven transmembrane receptors of the invention. Antibody spccificity is descnbcd in greater detail below However, it should be emphasized that antibodies that can be generated fio polypeptides that have picviously been descnbcd in the hteraluie and that are capable of fortuitously ctoss-icacting with the GPCR polypeptides of the invention (e g , due to the fortuitous existence of a similai epitope in both polypeptides) aie considered "cross-ieactive" antibodies Such cioss- rcactive antibodies are not antibodies that are "specific" for the GPCR polypeptides The deteimination of whether an antibody is specific for a GPCR polypeptide or is cross-reactive with another known receptor is made using Western blotting assays or several othei assays well known in the literature For identifying cells that express GPCR polypeptides and also for modulating GPCR -ligand binding activity, antibodies that specifically bind to an extracellular epitope of one of the GPCR seven transmembrane receptors ofthe present invention are prefeπed
In one preferred variation, the invention provides monoclonal antibodies Hybndomas that produce such antibodies also are intended as aspects of the invention In yet another vaπation, the invention provides a humanized antibody
Humanized antibodies are useful for in vivo therapeutic indications
In another variation, the invention provides a cell-free composition compπsing polyclonal antibodies, wherem at least one ofthe antibodies is an antibody of the invention specific for a GPCR polypeptide of the present invention Antisera isolated from an animal is an exemplary composition, as is a composition comprising an antibody fraction of an antisera that has been resuspended in water or in another diluent, excipient, or earner
In still another related embodiment, the invention provides anti-idiotypic antibodies specific for an antibody that is specific for a GPCR polypeptide of the present invention
It is well known that antibodies contain relatively small antigen binding domains that can be isolated chemically or by recombinant techniques Such domains are useful GPCR binding molecules themselves, and also may be reintroduced into human antibodies, oi fused to toxins or other polypeptides Thus, in still another embodiment, the invention provides a polypeptide comprising a fragment of a GPCR-specific antibody, wherein the fragment and the polypeptide bind to a GPCR seven ti ansmembt ane i eccptor of the present invention By way of non- limiting example, the invention piovidcs polypeptides that are single chain antibodies and CDR-giafted antibodies
Also within the scope of the invention are compositions composing polypeptides, polynucleotides, or antibodies of he invention that have been formulated with, e g , a phaimaceutically acceptable caπier
The invention also provides methods of using antibodies of the invention For example, the invention provides a method for modulating ligand binding of a GPCR seven transmembrane receptor ofthe present invention comprising the step of contacting the seven transmembrane receptor with an antibody specific for the seven transmembrane receptor, under conditions wherein the antibody binds the receptor
GPCR polypeptides are expressed in the brain, providing an indication that abeπant GPCR polypeptide signaling activity may coπelate with one or more neurological disorders The invention also provides a method for treating a neurological disorder compπsing the step of admmisteπng to a mammal in need of such treatment an amount of an antibody-like polypeptide ofthe invention that is sufficient to modulate ligand binding of a GPCR seven transmembrane receptor ofthe present invention in neurons ofthe mammal. In addition to administration of antibody-like polypeptides, administration of natural ligands for GPCR polypeptides as well as modulators of GPCR polypeptide activity, such as small molecules that mimic, agonize or antagonize hgand-mediated GPCR polypeptide signaling, are contemplated The expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, depression, anxiety, bipolar disease, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder (ADHD/ ADO), epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzheimer's disease, Parkinson's disease, migraine, senile dementia, and the like Treatment of individuals having any of these disorders is contemplated as an aspect of the invention Thus, in yet another embodiment, the invention provides genetic screening procedures that entail analyzing a person's genome — in particular their alleles for GPCR's of the invention — to determine whether the individual possesses a genetic characteristic found in other individuals that are considered to be afflicted with, or at risk for, developing a mental disorder or disease of the brain that is suspected of having a hereditary component. For example, in one embodiment, the invention provides a method for determining a potential for developing a disorder affecting the brain in a human subject comprising the steps of analyzing the coding sequence of one or more GPCR genes from the human subject; and determining development potential for the disorder in said human subject from the analyzing step. More particularly, the invention provides a method of screening a human subject to diagnose a disorder affecting the brain or genetic predisposition therefor, comprising the steps of: (a) assaying nucleic acid of a human subject to determine a presence or an absence of a mutation altering the amino acid sequence, expression, or biological activity of at least one seven transmembrane receptor that is expressed in the brain, wherein the seven transmembrane receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8,
10, 12, 14, 16, 18, and 20, or an allelic variant thereof, and wherein the nucleic acid coπesponds to the gene encoding the seven transmembrane receptor; and (b) diagnosing the disorder or predisposition from the presence or absence of said mutation, wherein the presence of a mutation altering the amino acid sequence, expression, or biological activity of allele in the nucleic acid coπelates with an increased risk of developing the disorder. In prefeπed variations, the seven transmembrane receptor is CON202 comprising an amino acid sequence set forth in SEQ ID NO: 14, or an allelic variant thereof, and the disease is schizophrenia.
By "human subject" is meant any human being, human embryo, or human fetus. It will be apparent that methods of the present invention will be of particular interest to individuals that have themselves been diagnosed with a disorder affecting the brain or have relatives that have been diagnosed with a disorder affecting the brain.
By "screening for an increased risk" is meant deteπnination of whether a genetic variation exists in the human subject that coπelates with a greater likelihood of developing a disorder affecting the brain than exists for the human population as a vvhole, or for a relevant racial or ethnic human sub-population to which the individual belongs. Both positive and negative determinations (i.e., detemiinations that a genetic predisposition marker is present or is absent) are intended to fall within the scope of screening methods ofthe invention. In prefeπed embodiments, the presence of a mutation altering the sequence or expression of at least one CON202 seven transmembrane receptor allele in the nucleic acid is coπelated with an increased risk of developing schizophrenia, whereas the absence of such a mutation is reported as a negative deteπnination.
The "assaying" step of the invention may involve any techniques available for analyzing nucleic acid to determine its characteristics, including but not limited to well-known techniques such as single-strand confonnation polymorphism analysis (SSCP) [Orita et al, Proc Natl. Acad. Sci. USA, 86: 2766-2770 (1989)]; heteroduplex analysis [White et al, Genomics, 12: 301-306 (1992)]; denaturing gradient gel electrophoresis analysis [Fischer et al, Proc. Natl. Acad. Sci. USA, 80: 1579-1583 (1983); and Riesner et al, Electrophoresis, JO: 377-389 (1989)]; DNA sequencing; RNase cleavage [Myers et al, Science, 230: 1242-1246 (1985)]; chemical cleavage of mismatch techniques [Rowley et al, Genomics, 30: 574-582 (1995); and Roberts et al, Nucl. Acids Res., 25: 3377-3378 (1997)]; restriction fragment length polymorphism analysis; single nucleotide primer extension analysis [Shumaker et al, Hum. Mutat., 7: 346-354 (1996); and Pastinen et al, Genome Res., 7: 606-614
(1997)]; 5' nuclease assays [Pease et al, Proc. Natl. Acad. Sci. USA, 97:5022-5026 (1994)]; DNA Microchip analysis [Ramsay, G., Nature Biotechnology, 16: 40-48 (1999); and Chee et al, U.S. Patent No. 5,837,832]; and ligase chain reaction [Whiteley et al, U.S. Patent No. 5,521 ,065]. [See generally, Schafer and Hawkins, Nature Biotechnology, 16: 33-39 (1998).] All of the foregoing documents are hereby incorporated by reference in their entirety.
Thus, in one prefeπed embodiment involving screening CON202 sequences, for example, the assaying step comprises at least one procedure selected from the group consisting of: (a) determining a nucleotide sequence of at least one codon of at least one CON202 allele of the human subject; (b) performing a hybridization assay to determine whether nucleic acid from the human subject has a nuclcotide sequence identical to or different from one or more leference sequences, (c) pci foi mmg a polynucleotide migration assay to determine whethci nucleic acid fiom the human subject has a nucleotide sequence identical to 01 different from one or moie refcicnce sequences, and (d) performing a restriction endonuclease digestion to determine whethei nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences
In a highly prefeπed embodiment, the assaying involves sequencing of nucleic acid to determine nucleotide sequence thereof, using any available sequencing technique [See, e g , Sanger et al , Proc Natl Acad Sci (USA), 74 5463-5467 (1977) (dideoxy chain termination method); Mirzabekov, TIBTECH, 12: 27-32 (1994)
(sequencing by hybridization); Drmanac et al , Nature Biotechnology, 16 54-58 (1998); U S. Patent No. 5,202,231; and Science, 260: 1649-1652 (1993) (sequencing by hybridization); Kieleczawa et al , Science, 258' 1787-1791 (1992) (sequencing by primer walking); (Douglas et al, Biotechniques, 14: 824-828 (1993) (Direct sequencing of PCR products); and Akane et al, Biotechniques 16: 238-241 (1994);
Maxam and Gilbert, Meth. Enzymol, 65: 499-560 (1977) (chemical termination sequencing), all incorporated herein by reference.] The analysis may entail sequencing of the entire seven transmembrane receptor gene genomic DNA sequence, or portions thereof; or sequencing ofthe entire seven transmembrane receptor coding sequence or portions thereof. In some circumstances, the analysis may involve a determination of whether an individual possesses a particular allehc variant, in which case sequencing of only a small portion of nucleic acid — enough to determine the sequence of a particular codon characterizing the allehc variant — is sufficient. This approach is appropπate, for example, when assaying to determine whether one family member inherited the same allehc variant that has been previously characterized for another family member, or, more generally, whether a person's genome contains an allelic variant that has been previously characteπzed and coπelated with a mental disorder having a heritable component.
In another highly prefeπed embodiment, the assaying step comprises performing a hybridization assay to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference scquences In a prefeπed embodiment, the hybridization involves a detct mination of whether nucleic acid denved from the human subject will hybridize with one oi mote oligonucleotides, wheiein the oligonucleotides have nucleotide sequences that correspond identically to a portion of the GPCR gene sequence taught herein, such as the CON202 coding sequence set forth in SEQ ID NO 14, or that coi respond identically except for one mismatch The hybridization conditions are selected to differentiate between perfect sequence complementarity and imperfect matches differing by one or more bases Such hybridization experiments theieby can provide single nucleotide polymoφhism sequence information about the nucleic acid from the human subject, by virtue of knowing the sequences of the oligonucleotides used in the experiments
Several of the techniques outlined above involve an analysis wherein one perfoπns a polynucleotide migration assay, e g , on a polyacrylamide electrophoresis gel (or in a capillary electrophoresis system), under denaturing or non- denaturing conditions Nucleic acid deπved from the human subject is subjected to gel electrophoresis, usually adjacent to (or co-loaded with) one or more reference nucleic acids, such as reference GPCR-encoding sequences having a coding sequence identical to all or a portion of SEQ XD NO. 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19 (or identical except for one known polymoφhism) The nucleic acid from the human subject and the reference sequence(s) are subjected to similar chemical or enzymatic treatments and then electrophoresed under conditions whereby the polynucleotides will show a differential migration pattern, unless they contain identical sequences [See generally Ausubel et al (eds ), Current Protocols in Molecular Biology, New York John Wiley & Sons, Inc (1987-1999), and Sambrook et al , (eds ), Molecular Cloning, A Laboratory Manual, Cold Spπng Harbor, New York Cold Spring Harbor
Laboratory Press (1989), both incoφorated herein by reference in their entirety ]
In the context of assaying, the term "nucleic acid of a human subject" is intended to include nucleic acid obtained directly from the human subject (e g , DNA or RNA obtained from a biological sample such as a blood, tissue, or other cell or fluid sample), and also nucleic acid deπved from nucleic acid obtained directly from the human subject By way of non-hmitmg examples, well known procedures exist for creating cDNA that is complementary to RNA derived from a biological sample from a human subject, and for ampli fying (e.g., via polymerase chain reaction (PCR)) DNA or RNA derived from a biological sample obtained from a human subject. Any such derived polynucleotide which retains relevant nucleotide sequence information of the human subject's own DNA/RNA is intended to fall within the definition of "nucleic acid of a human subject" for the puφoses ofthe present invention.
In the context of assaying, the term "mutation" includes addition, deletion, and/or substitution of one or more nucleotides in the GPCR gene sequence (e.g., as compared to the seven transmembrane receptor-encoding sequences set forth in SEQ XD NO: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, or 19) and other polymoφhisms that occur in introns (where introns exist) and that are identifiable via sequencing, restriction fragment length polymoφhism, or other techniques. The various activity examples provided herein permit deteπnination of whether a mutation modulates activity of the relevant receptor in the presence or absence of various test substances.
In a related embodiment, the invention provides methods of screening a person's genotype with respect to GPCR's ofthe invention, and coπelating such genotypes with diagnoses for disease or with predisposition for disease (for genetic counseling). For example, the invention provides a method of screening for a CON202 hereditary schizophrenia genotype in a human patient, comprising the steps of: (a) providing a biological sample comprising nucleic acid from the patient, the nucleic acid including sequences coπesponding to said patient's CON202 alleles; (b) analyzing the nucleic acid for the presence of a mutation or mutations; (c) determining a CON202 genotype from the analyzing step; and (d) coπelating the presence of a mutation in a CON202 allele with a hereditary schizophrenia genotype. In a prefeπed embodiment, the biological sample is a cell sample containing human cells that contain genomic DNA ofthe human subject. The analyzing can be performed analogously to the assaying described in preceding paragraphs. For example, the analyzing comprises sequencing a portion of the nucleic acid (e.g., DNA or RNA), the portion comprising at least one codon ofthe CON202 alleles. Although more time consuming and expensive than methods involving nucleic acid analysis, the invention also may be practiced by assaying protein of a human subject to determine the presence or absence of an amino acid sequence variation in GPCR protein from the human subject. Such protein analyses may be performed, e.g., by fragmenting GPCR protein via chemical or enzymatic methods and sequencing the resultant peptides; or by Western analyses using an antibody having specificity for a particular allelic variant of the GPCR.
The invention also provides materials that are useful for performing methods of the invention. For example, the present invention provides oligonucleotides useful as probes in the many analyzing techniques described above.
In general, such oligonucleotide probes comprise 6, 7, 8, 9, 10 , 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides that have a sequence that is identical, or exactly complementary, to a portion of a human GPCR gene sequence taught herein (or allelic variant thereof), or that is identical or exactly complementary except for one nucleotide substitution. In a prefeπed embodiment, the oligonucleotides have a sequence that coπesponds in the foregoing manner to a human GPCR coding sequence taught herein, and in particular, the coding sequences set forth in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19. In one variation, an oligonucleotide probe ofthe invention is purified and isolated. In another variation, the oligonucleotide probe is labeled, e.g., with a radioisotope, chromophore, or fluorophore. In yet another variation, the probe is covalently attached to a solid support. [See generally Ausubel et al. And Sambrook et al, supra.]
In a related embodiment, the invention provides kits comprising reagents that are useful for practicing methods ofthe invention. For example, the invention provides a kit for screening a human subject to diagnose schizophrenia or a genetic predisposition therefor, comprising, in association: (a) an oligonucleotide useful as a probe for identifying polymorphisms in a human CON202 seven transmembrane receptor gene, the oligonucleotide comprising 6-50 nucleotides that have a sequence that is identical or exactly complementary to a portion of a human
CON202 gene sequence or CON202 coding sequence, except for one sequence ch ffercnce selected fiom the group consisting of a nucleotide addition, a nucleotide deletion, 01 nucleotide substitution, and (b) a media packaged with the oligonucleotide containing information identifying polymoiphisms identifyable with the piobe that coπelate with schizophrenia or a genetic predisposition therefoi Exemplary lnfoimation-containing media include printed paper package inserts oi packaging labels, and magnetic and optical storage media that are readable by computers oi machines used by practitioners who perform genetic screening and counseling services The practitioner uses the information provided in the media to coπelate the results ofthe analysis with the oligonucleotide with a diagnosis Tn a prefeπed variation, the oligonucleotide is labeled
In still another embodiment, the invention provides methods of identifying those allehc vanants of GPCR's ofthe invention that coπelate with mental disorders For example, the invention provides a method of identifying a seven transmembrane allehc variant that coπelates with a mental disorder, comprising steps of (a) providing a biological sample comprising nucleic acid from a human patient diagnosed with a mental disorder, or from the patient's genetic progenitors or progeny, (b) analyzing the nucleic acid for the presence of a mutation or mutations in at least one seven transmembrane receptor that is expressed in the brain, wherein the at least one seven transmembrane receptor compπses an amino acid sequence selected from the group consisting of SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, or an allehc vaπant thereof, and wherein the nucleic acid includes sequence coπesponding to the gene or genes encoding the at least one seven transmembrane receptor, (c) determining a genotype for the patient for the at least one seven transmembrane receptor from said analyzing step, and (d) identifying an allelic vanant that coπelates with the mental disorder from the determining step To expedite this process, it may be desirable to perform linkage studies in the patients (and possibly their families) to coπelate chromosomal markers with disease states The chromosomal localization data provided herein facilitates identifying an involved GPCR with a chromosomal marker The foregoing method can be performed to coπelate GPCR's ofthe invention to a number of disorders having hereditary components that are causative or that piedispose persons to the disoider For example, in one piefeπed variation, the disordci is schizophiema, and the at least one seven transmembrane leceptoi compπses CON202 having an amino acid sequence set forth in SEQ ID NO 14, or an allelic variant thereof Also contemplated as part ofthe invention are polynucleotides that comprise the allehc variant sequences identified by such methods, and polypeptides encoded by the allehc variant sequences, and oligonucleotide and ohgopeptide fragments therof that embody the mutations that have been identified Such mateπals are useful in in vitro cell-free and cell-based assays for ldenifying lead compounds and therapeutics for treatment ofthe disorders For example, the vanants are used in activity assays, binding assays, and assays to screen for activity modulators descπbed herein In one prefeπed embodiment, the invention provides a purified and isolated polynucleotide compnsing a nucleotide sequence encoding a CON202 receptor allehc variant identified according to the methods descnbed above, and an oligonucleotide that compπses the sequences that differentiate the allehc variant from the CON202 sequences set forth in SEQ ID NOs: 13 and 14 The invention also provides a vector compπsing the polynucleotide (preferably an expression vector); and a host cell transformed or transfected with the polynucleotide or vector The invention also provides an isolated cell line that is expressing the allehc vaπant GPCR polypeptide, puπfied cell membranes from such cells; purified polypeptide; and synthetic peptides that embody the allehc variation amino acid sequence. In one particular embodiment, the invention provides a punfied polynucleotide compnsing a nucleotide sequence encoding a CON202 seven transmembrane receptor protein of a human that is affected with schizophrenia, wherein said polynucleotide hybridizes to the complement of SEQ ID NO 13 under the following hybπdization conditions: (a) hybndization for 16 hours at 42°C in a hybndization solution compπsing 50% formamide, 1% SDS, 1 M NaCl , 10% dextran sulfate and (b) washing 2 times for 30 minutes at 60°C in a wash solution comprising O.lx SSC and 1% SDS, and wherein the polynucleotide encodes a CON202 amino acid sequence that differs from SEQ ID NO 14 at at least one residue An examplary assay for using the allelic variants is a method for identifying a modulator of CON202 biological activity, comprising the steps of: (a) contacting a cell expressing the allelic variant in the presence and in the absence of a putative modulator compound; (b) measuring CON202 biological activity in the cell; and (c) identifying a putative modulator compound in view of decreased or increased
CON202 biological activity in the presence versus absence of the putative modulator.
In still another example, the invention provides for a method of diagnosing schizophrenia or a susceptibility to schizophrenia comprising the steps of: determining the presence or amount of expression of CON202 polypeptide as set out as SEQ ID NO: 14 or the polypeptide encoded by the nucleic acid molecule having
SEQ ID NO: 13 in a sample; and comparing the level of CON202 polypeptide in a biological, tissue or cellular sample from normal subjects or the subject at an earlier time, wherein the susceptibility to schizophenia is based on the presence or amount of CON202 polypeptide expression. The invention also provides for a method of treating schizophrenia comprising the step of administering to a human diagnosed with schizophrenia an amount of a modulator of CON202 receptor activity sufficient to modulate CON202 receptor activity or CON202 ligand binding in said human.
The invention also provides assays to identify compounds that bind GPCR seven transmembrane receptors. One such assay comprises the steps of: (a) contacting a composition comprising one ofthe GPCR seven transmembrane receptor polypeptides ofthe invention with a compound suspected of binding a GPCR polypeptide ofthe invention; and (b) measuring binding between the compound and the GPCR polypeptide. In one variation, the composition comprises a cell expressing a GPCR polypeptide ofthe invention on its surface. In another variation, an isolated
GPCR polypeptide of the invention or cell membranes comprising a GPCR polypeptide of the invention are employed. The binding may be measured directly, e.g., using a labeled compound, or may be measured indirectly by several techniques, including measuring intracellular signaling of a GPCR polypeptide ofthe invention induced by the compound (or measuring changes in the level of GPCR polypeptide signaling). The invention also provides a method for identifying a modulator of binding between a GPCR seven transmembrane receptor of the invention and a GPCR polypeptide binding partner, comprising the steps of: (a) contacting a GPCR polypeptide binding partner and a composition comprising one ofthe GPCR seven transmembrane receptors of the invention in the presence and in the absence of a putative modulator compound; (b) detecting binding between the binding partner and the GPCR polypeptide of the invention; and (c) identifying a putative modulator compound in view of decreased or increased binding between the binding partner and the GPCR polypeptide in the presence of the putative modulator, as compared to binding in the absence of the putative modulator.
GPCR polypeptide binding partners that stimulate GPCR seven transmembrane receptors ofthe present invention are useful as agonists in disease states characterized by insufficient GPCR polypeptide signaling (e.g., as a result of insufficient expression of active GPCR polypeptide ligand). GPCR polypeptide binding partners that block ligand-mediated GPCR polypeptide signaling are useful as
GPCR polypeptide antagonists to treat disease states characterized by excessive GPCR polypeptide signaling.
Additional features and variations ofthe invention will be apparent to those skilled in the art from the entirety of this application, including the detailed description, and all such features are intended as aspects ofthe invention. Likewise, features ofthe invention described herein can be re-combined into additional embodiments that also are intended as aspects ofthe invention, iπespective of whether the combination of features is specifically mentioned above as an aspect or embodiment ofthe invention. Also, only such limitations which are described herein as critical to the invention should be viewed as such; variations ofthe invention lacking limitations which have not been described herein as critical are intended as aspects ofthe invention.
In addition to the foregoing, the invention includes, as an additional aspect, all embodiments of the invention naπower in scope in any way than the variations specifically mentioned above. Although the applicant(s) invented the full scope of the claims appended hereto, the claims appended hereto are not intended to encompass within their scope the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicants by a Patent Office or other entity or individual, the applicant(s) reserve the ight to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides purified and isolated polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, both single and double stranded, including splice variants thereof) encoding human G protein-coupled receptors refeπed to herein as GPCR polypeptides. DNA polynucleotides ofthe invention include genomic DNA, cDNA, and DNA that has been chemically synthesized in whole or in part. "Synthesized" as used herein and understood in the art, refers to polynucleotides produced by purely chemical, as opposed to enzymatic, methods. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions ofthe resulting DNA were produced by chemical means.
Genomic DNA ofthe invention comprises the protein coding region for a polypeptide of the invention and is also intended to include allelic variants thereof. It is widely understood that, for many genes, genomic DNA is transcribed into RNA transcripts that undergo one or more splicing events wherein intron (i.e., non-coding regions) ofthe transcripts are removed, or "spliced out." RNA transcripts that can be spliced by alternative mechanisms, and therefore be subject to removal of different RNA sequences but still encode a GPCR polypeptide ofthe present invention, are refeπed to in the art as splice variants which are embraced by the invention. Splice variants comprehended by the invention therefore are encoded by the same original genomic DNA sequences but arise from distinct mRNA transcripts.
Allelic variants are modified forms of a wild type gene sequence, the modification lesulting from recombination din ing chromosomal segregation 01 exposure to conditions which give use to genetic mutation Alle c vanants, like wild type genes, arc natuially occuπing sequences (as opposed to non-natuially occuπ ing vaπants which aπse horn in viti o manipulation) The invention also comprehends cDNA that is obtained thiough reverse transcription of an RNA polynucleotide encoding a GPCR of the present invention (conventionally followed by second strand synthesis of a complementary strand to provide a double-stranded DNA)
A preferred DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 1 , wherem nucleotides 157 to 1122 represent the CON 193 coding sequence, with termination codon (suπounded by upstream and downstream untranslated sequences) Another prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 3, wherein nucleotides 1 to 1014 represent the CONl 66 coding sequence and stop codon Still another prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ TD NO 5, wherein nucleotides 691 to 1845 represent the CON 103 coding sequence with stop codon (suπounded by upstream and downstream untranslated sequences) Another prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 7, wherem nucleotides 146 to 1147 represent the CON203 coding sequence with stop codon (suπounded by upstream and downstream untranslated sequences) A prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 9, wherein nucleotides 1 to 957 represent the CONl 98 coding sequence with stop codon Another prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 11, wherein nucleotides 1 to 924 represent the CON 197 coding sequence with stop codon (followed by downstream untranslated sequences) A prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ TD NO 13, wherem nucleotides 266 to 1378 represent the CON202 coding sequence and termination codon (suπounded by upstream and downstream untranslated sequences) A preferred DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO 15, wherein nucleotides 1 to 1191 represent the CON222 coding sequence and termination codon A prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO: 17, wherein nucleotides 13 to 1089 represent the CON215 coding sequence and termination codon (surrounded by upstream and downstream untranslated sequences). A prefeπed DNA sequence encoding a human GPCR polypeptide is set out in SEQ ID NO: 19, wherein nucleotides 42 to 1 157 represent the CON217 coding sequence (surrounded by upstream and downstream untranslated sequences). The foregoing sequences without their termination codons also comprise prefeπed sequences.
The worker of skill in the art will readily appreciate that the prefeπed DNA ofthe invention comprises a double stranded molecule, for example the molecule having any one ofthe sequences set forth in SEQ ID NOS: 1, 3, 5, 7, 9, 1 1,
13, 15, 17, or 19 (or coding portions thereof) along with the complementary molecule (the "non-coding strand" or "complement") having a sequence deducible from the sequence of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19 according to Watson- Crick base pairing rules for DNA. Also prefeπed are other polynucleotides encoding the GPCR polypeptides ofthe invention set forth in SEQ XD NOS: 2, 4, 6, 8, 10, 12,
14, 16, 18 and 20 which differ in sequence from the polynucleotide of SEQ ID NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19, respectively, by virtue ofthe well-known degeneracy ofthe universal genetic code.
The invention further embraces species, preferably mammalian, homologs ofthe human GPCR DNAs. Species homologs, sometimes refeπed to as
"orthologs," in general, share at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homoiogy with human DNA ofthe invention. Percent sequence "homoiogy" with respect to polynucleotides of the invention is defined herein as the percentage of nucleotide bases in the candidate sequence that are identical to nucleotides in the GPCR sequence set forth in any one of SEQ ID NOS: 1, 3, 5, 7, 9, X X, 13, 15, 17, or 19 after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. The polynucleotide sequence information provided by the invention makes possible large scale expression ofthe encoded polypeptide by techniques well known and routinely practiced in the art. Polynucleotides ofthe invention also permit ldentification and isolation of polynucleotides encoding related GPCR polypeptides, such as human allehc vaπants and species homologs, by well known techniques including Southern and/or Northern hybridization, and polymerase chain reaction (PCR) Examples of related polynucleotides include human and non-human genomic sequences, including allehc variants, as well as polynucleotides encoding polypeptides homologous to GPCR polypeptides and structurally related the polypeptides sharing one or more biological, immunological, and/or physical properties of the GPCR polypeptides Non-human species genes encoding proteins homologous to GPCR polypeptides can also be identified by Southern and/or PCR analysis and are useful in animal models for GPCR-related disorders Knowledge ofthe sequence of a human
GPCR DNA also makes possible, through use of Southern hybridization or polymerase chain reaction (PCR), the identification of genomic DNA sequences encoding GPCR expression control regulatory sequences such as promoters, operators, enhancers, repressers, and the like Polynucleotides ofthe invention are also useful in hybridization assays to detect the capacity of cells to express GPCR polypeptides. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteratιon(s) in a GPCR locus that underlies a disease state or states, which information is useful both for diagnosis and for selection of therapeutic strategies The disclosure herein of full length polynucleotides encoding GPCR polypeptides ofthe present invention makes readily available to the worker of ordinary skill m the art every possible fragment ofthe full length polynucleotides The invention therefore provides fragments of GPCR-encodmg polynucleotides comprising at least 14-15, and preferably at least 18, 20, 25, 50, or 75 consecutive nucleotides of a polynucleotide encoding GPCR polypeptides Preferably, fragment polynucleotides of the invention compnse sequences unique to the GPCR-encoding polynucleotide sequence, and therefore hybndize under highly stnngent or moderately stπngent conditions only (i e , "specifically") to polynucleotides encoding GPCR polypeptides (or fragments thereof) Polynucleotide fragments of genomic sequences of the invention comprise not only sequences unique to the coding region, but also include fragments of the full length sequence derived from introns, regulatory regions, and/or other non-translated sequences Sequences unique to polynucleotides of the invention are recognizable through sequence compaπson to othei known polynucleotides, and can be identified through use of alignment progiams routinely utilized in the art, e g , those made available in public sequence databases Such sequences also are recognizable from Southern and Northern hybridization analyses to determine the number of fragments ol genomic DNA and RNA to which a polynucleotide will hybridize Polynucleotides o( the invention can be labeled in a manner that permits their detection, including radioactive, fluorescent, and enzymatic labeling Fragment polynucleotides are particularly useful as probes for detection of full length or other fragment GPCR polynucleotides One or more fragment polynucleotides can be included in kits that are used to detect the presence of a polynucleotide encoding a GPCR polypeptide, or used to detect variations in a polynucleotide sequences encoding GPCR polypeptides The invention also embraces DNAs encoding GPCR polypeptides which DNAs hybridize under moderately stringent or high stringency conditions to the non-codmg strand, or complement, ofthe polynucleotide in any one of SEQ ID NOS 1, 3, 5, 7, 9, 11, 13, 15, 17 or 19
Exemplary highly stnngent hybridization conditions are as follows hybndization at 42°C in a hybndization solution compnsing 50% formamide, 1%
SDS, 1 M NaCl, 10% Dextran sulfate, and washing twice for 30 minutes at 60°C in a wash solution compπsing 0 lx SSC and 1% SDS It is understood in the art that conditions of equivalent stringency can be achieved through vaπation of temperature and buffer, or salt concentration as descnbed Ausubel, et al (Eds ), Protocols in Molecular Biology, John Wiley & Sons (1994), pp 6 0 3 to 6 4 10 Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing ofthe probe The hybndization conditions can be calculated as described in Sambrook et al , (Eds ), Molecular Cloning A Laboratory Manual, Cold Spπng Harbor Laboratory Press Cold Spring Harbor, New York (1989), pp 9 47 to 9 51 Autonomously replicating recombinant expression constructs such as plasmid and viral DNA vectors incoφorating polynucleotides of the invention are also provided. Expression constructs wherein GPCR-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided. Expression control DNA sequences include promoters, enhancers, and operators, and are generally selected based on the expression systems in which the expression constmct is to be utilized. Prefeπed promoter and enhancer sequences are generally selected for the ability to increase gene expression, while operator sequences are generally selected for the ability to regulate gene expression. Expression constructs of the invention may also include sequences encoding one or more selectable markers that permit identification of host cells bearing the construct. Expression constructs may also include sequences that facilitate, and preferably promote, homologous recombination in a host cell. Prefeπed consfructs of the invention also include sequences necessary for replication in a host cell.
Expression constructs are preferably utilized for production of an encoded protein, but also may be utilized simply to amplify GPCR-encoding polynucleotide sequences.
According to another aspect ofthe invention, host cells are provided, including prokaryotic and eukaryotic cells, comprising a polynucleotide ofthe invention (or vector ofthe invention) in a manner which permits expression ofthe encoded GPCR polypeptide. Polynucleotides ofthe invention may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector. Methods for introducing DNA into the host cell well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with caπiers such as liposomes, micelles, ghost cells, and protoplasts. Expression systems of the invention include bacterial, yeast, fungal, plant, insect, invertebrate, and mammalian cells systems.
Host cells ofthe invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with GPCR polypeptides.
Host cells of the invention are also useful in methods for large scale production of GPCR polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptide pioducts aie isolated from the cells or from the medium in which the cells are grown by purification methods known in the art, e g conventional chiomatogiaphic methods including lmmunoaffinity chromatography, rcceptoi affinity chromatography, hydrophobic interaction chromatography, lectin affinity chromatography, size exclusion filtration, cation or anion exchange chromatography, high pressure liquid chiomatography (HPLC), reverse phase HPLC, and the like Still other methods of purification include those wherem the desired protein is expressed and purified as a fusion protein having a specific tag, label, or chelating moiety that is recognized by a specific binding partner or agent The puπfied protein can be cleaved to yield the desired protein, or be left as an intact fusion protein Cleavage of the fusion component may produce a form of the desired protein having additional amino acid residues as a result ofthe cleavage process
Knowledge of GPCR DNA sequences allows for modification of cells to permit, or increase, expression of endogenous GPCR Cells can be modified (e g , by homologous recombination) to provide increased expression by replacing, in whole or in part, the naturally occuπing GPCR promoter with all or part of a heterologous promoter so that the cells express GPCR polypeptides at higher levels The heterologous promoter is inserted in such a manner that it is operatively linked to endogenous GPCR polypeptide encoding sequences [See, for example, PCT
International Publication No WO 94/12650, PCT International Publication No WO 92/20808, and PCT International Publication No WO 91/09955 ] It is also contemplated that, in addition to heterologous promoter DNA, amphfiable marker DNA (e g , ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase) and/or intron
DNA may be inserted along with the heterologous promoter DNA If linked to the GPCR coding sequence, amplification ofthe marker DNA by standard selection methods results in co-amplification ofthe GPCR coding sequences in the cells
The DNA sequence information provided by the present invention also makes possible the development through, e g homologous recombination or
"knock-out" strategies [Capecchi, Science 244 1288-1292 (1989)], of animals that fail to express functional GPCR polypeptides or that express a variant of GPCR polypeptides. Such animals (especially small laboratory animals such as rats, rabbits, and mice) are useful as models for studying the in vivo activities of GPCR polypeptides and modulators of GPCR polypeptides. Also made available by the invention are anti-sense polynucleotides which recognize and hybridize to polynucleotides encoding GPCR polypeptides. Full length and fragment anti-sense polynucleotides are provided. Fragment anti-sense molecules ofthe invention include those which specifically recognize and hybridize to GPCR RNA (as deteπuined by sequence comparison of DNA encoding GPCR polypeptides to DNA encoding other known molecules). Identification of sequences unique to GPCR-encoding polynucleotides, can be deduced through use of any publicly available sequence database, and/or through use of commercially available sequence comparison programs. The uniqueness of selected sequences in an entire genome can be further verified by hybridization analyses. After identification ofthe desired sequences, isolation through restriction digestion or amplification using any of the various polymerase chain reaction techniques well known in the art can be performed. Antisense polynucleotides are particularly relevant to regulating expression of GPCR polypeptides by those cells expressing GPCR mRNA.
Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides) capable of specifically binding to GPCR expression control sequences or GPCR RNA are introduced into cells (e.g., by a viral vector or colloidal dispersion system such as a liposome). The antisense nucleic acid binds to the GPCR target nucleotide sequence in the cell and prevents transcription or translation ofthe target sequence. Phosphorothioate and methylphosphonate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense oligonucleotides may be further modified by poly-L-lysine, transfeπin polylysine, or cholesterol moieties at their 5' end. Suppression of GPCR polypeptide expression at either the transcriptional or translational level is useful to general cellular and/or animal models for diseases characterized by abeπant expression. Suppression of GPCR polypeptide expression at either the transcriptional or translational level is useful to generate ccllular animal models for diseases characteπzed by aberrant GPCR polypeptide expiession
The GPCR polynucleotide and polypeptide sequences taught in the piesent invention facilitate the design of novel transcription factois for modulating GPCR polypeptide expression in native cells and animals, and cells transformed or tiansfected with GPCR polynucleotides For example, the Cys2-Hιs2 zinc finger proteins, which bind DNA via their zinc finger domains, have been shown to be amenable to structural changes that lead to the recognition ol different target sequences These artificial zinc finger proteins recognize specific target sites with high affinity and low dissociation constants, and are able to act as gene switches to modulate gene expression Knowledge ofthe particular GPCR target sequence ofthe present invention facilitates the engineering of zinc finger proteins specific for the target sequence using known methods such as a combination of structure-based modeling and screening of phage display libraries [Segal et al , Proc Natl Acad Sci USA 96 2758-2763 (1999), Liu et al , Proc Nad Acad Sci USA 94 5525-30 (1997),
Greisman and Pabo Science 275 657-61 (1997), Choo et al , J Mol Biol 273 525-32 ( 1997)] Each zinc finger domain usually recognizes three or more base pairs Since a recognition sequence of 18 base pairs is generally sufficient in length to render it unique in any known genome, a zinc finger protein consisting of 6 tandem repeats of zmc fingers would be expected to ensure specificity for a particular sequence [Segal et al , Proc Natl Acad Sci USA 96 2758-2763 (1999)] The artificial zinc finger repeats, designed based on GPCR polynucleotide sequences, are fused to activation or repression domains to promote or suppress GPCR polypeptides expression [Liu et al , Proc Natl Acad Sci USA 94 5525-30 (1997)] Alternatively, the zinc finger domains can be fused to the TATA box-bind g factor (TBP) with varying lengths of linker region between the zinc finger peptide and the TBP to create either transcnptional activators or repressors [Kim et al , Proc Natl Acad Sci USA 94 3616-3620 (1997)] Such proteins, and polynucleotides that encode them, have utility for modulating GPCR polypeptide expression in vivo in both native cells, animals and humans, and/or cells transfected with GPCR polynulcoeitde-encodmg sequences The novel transcπption factor can be delivered to the target cells by transfecting constructs that express the transcription factor (gene therapy), or by introducing the protein. Engineered zinc finger proteins can also be designed to bind RNA sequences for use in therapeutics as alternatives to antisense or catalytic RNA methods [McColl et al, Proc Natl Acad Sci USA 96:9521-6 (1999); Wu et al, Proc Natl Acad Sci USA 92:344-348 (1995)]. The present invention contemplates methods of designing such transcription factors based on the gene sequence of the invention, as well as customized zinc finger proteins, that are useful to modulate GPCR polypeptide expression in cells (native or transformed) whose genetic complement includes these sequences. The invention also provides purified and isolated mammalian GPCR polypeptides encoded by a polynucleotide ofthe invention. Presently prefeπed is a human GPCR polypeptide comprising the amino acid sequence set out in any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20.
The invention also embraces polypeptides that have at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least
65%, at least 60%, at least 55% or at least 50% identity and/or homoiogy to a prefeπed polypeptide ofthe invention. Percent amino acid sequence "identity" with respect to the prefeπed polypeptide ofthe invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in a GPCR polypeptide sequence after aligning both sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part ofthe sequence identity. Percent sequence "homoiogy" with respect to the prefeπed polypeptide of the invention is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the residues in a GPCR sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and also considering any conservative substitutions as part ofthe sequence identity.
In one aspect, percent homoiogy is calculated as the percentage of amino acid residues in the smaller of two sequences which align with identical amino acid residue in the sequence being compared, when four gaps in a length of 100 amino acids may be introduced to maximize alignment [Dayhoff, in Atlas of Protein Sequence and Structure, Vol. 5, p. 124, National Biochemical Research Foundation, Washington, D.C. (1972), incorporated herein by reference].
Polypeptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. Glycosylated and non-glycosylated forms of GPCR polypeptides are embraced.
The invention also embraces variant (or analog) GPCR polypeptides. In one example, insertion variants are provided wherein one or more amino acid residues supplement a GPCR amino acid sequence. Insertions may be located at either or both termini ofthe protein, or may be positioned within internal regions of the GPCR amino acid sequence. Insertional variants with additional residues at either or both termini can include for example, fusion proteins and proteins including amino acid tags or labels.
Insertion variants include GPCR polypeptides wherein one or more amino acid residues are added to a GPCR amino acid sequence, or to a biologically active fragment thereof.
Variant products ofthe invention also include mature GPCR polypeptide products, i.e., GPCR polypeptide products wherein leader or signal sequences are removed, with additional amino terminal residues. The additional amino terminal residues may be derived from another protein, or may include one or more residues that are not identifiable as being derived from a specific proteins.
GPCR polypeptide products with an additional methionine residue at position -1 (Met '-GPCR) are contemplated, as are variants with additional methionine and lysine residues at positions -2 and -1 (Met"2-Lys"'-GPCR). Variants of GPCR polypeptide with additional Met, Met-Lys, Lys residues (or one or more basic residues in general) are particularly useful for enhanced recombinant protein production in bacterial host cell. The invention also embraces GPCR polypeptide variants having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide as part of glutathione-S-transferase (GST) fusion product provides the desired polypeptide having an additional glycine residue at position -1 after cleavage of the
GST component from the desired polypeptide. Variants which result from expression in other vector systems are also contemplated.
Insertional variants also include fusion proteins wherein the amino and/or carboxy termini of a GPCR polypeptide is fused to another polypeptide. In another aspect, the invention provides deletion variants wherein one or more amino acid residues in a GPCR polypeptide are removed. Deletions can be effected at one or both termini of the GPCR polypeptide, or with removal of one or more residues within the GPCR amino acid sequence. Deletion variants, therefore, include all fragments of a GPCR polypeptide. The invention also embraces polypeptide fragments ofthe sequence set out in SEQ ID NO: 2 wherein the fragments maintain biological (e.g., ligand binding and/or intracellular signaling) or immunological properties of a GPCR polypeptide. Fragments comprising at least 5, 10, 15, 20, 25, 30, 35, or 40 consecutive amino acids of SEQ ID NO: 2 are comprehended by the invention. Prefeπed polypeptide fragments display antigenic properties unique to or specific for human GPCR and its allelic and species homologs. Fragments ofthe invention having the desired biological and immunological properties can be prepared by any ofthe methods well known and routinely practiced in the art.
In still another aspect, the invention provides substitution variants of GPCR polypeptides. Substitution variants include those polypeptides wherein one or more amino acid residues of a GPCR polypeptide are removed and replaced with alternative residues. In one aspect, the substitutions are conservative in nature, however, the invention embraces substitutions that are also non-conservative. Conservative substitutions for this puφose may be defined as set out in Tables A, B, or C below. Variant polypeptides include those wherein conservative substitutions have been introduced by modification of polynucleotides encoding polypeptides of the invention. Amino acids can be classified according to physical properties and contribution to secondary and tertiary protein structure. A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are set out in Table A (from WO 97/09433, page 10, published March 13, 1997 (PCT/GB96/02197, filed 9/6/96), immediately below.
Table A
Conservative Substitutions I
SIDE CHAIN
CHARACTERISTIC AMINO ACID Aliphatic
Non-polar GA P I L V
Polar - uncharged C S T M N Q
Polar - charged D E K R
Aromatic H F W Y Other N Q D E
Alternatively, conservative amino acids can be grouped as described in Lehninger, [Biochemistry, Second Edition; Worth Publishers, Inc. NY:NN (1975), pp.71 -77] as set out in Table B, immediately below. Table B Conservative Substitutions II
SIDE CHAIN
CHARACTERISTIC AMINO ACID
Non-polar (hydrophobic)
A. Aliphatic: ALIVP
B. Aromatic: FW
C. Sulfur-containing: M
D. Borderline: G
Uncharged-polar
A. Hydroxyl: STY
B. Amides: NQ
C. Sulfhydryl: C
D. Borderline: G
Positively Charged (Basic): KRH
Negatively Charged (Acidic): DE
As still an another alternative, exemplary conservative substitutions are set out in Table C, immediately below.
Table C Conservative Substitutions I II
Original Exemplarv Substitution
Residue
Ala (A) Val, Leu, He
Arg (R) Lys, Gin, Asn
Asn (N) Gin, His, Lys, Arg
Asp (D) Glu
Cys (C) Ser
Gin (Q) Asn
Glu (E) Asp
His (H) Asn, Gin, Lys, Arg
He (I) Leu, Val, Met, Ala, Phe,
Leu (L) He, Val, Met, Ala, Phe
Lys (K) Arg, Gin, Asn
Met (M) Leu, Phe, He
Phe (F) Leu, Val, He, Ala
Pro (P) Gly
Ser (S) Thr
Thr (T) Ser
Tφ (W) Tyr
Tyr (Y) Tφ, Phe, Thr, Ser
Val (V) He, Leu, Met, Phe, Ala
GPCR polypeptide variants that display ligand binding properties of native GPCR polypeptides and are expressed at higher levels, and variants that provide for constitutive active receptor are particularly useful in assays of the invention. Such variants also are useful in cellular and animal models for diseases characterized by aberrant GPCR polypeptide expression/activity.
It should be understood that the definition of polypeptides of the invention is intended to include polypeptides bearing modifications other than insertion, deletion, or substitution of amino acid residues. By way of example, the modifications may be covalent in nature, and include for example, chemical bonding with polymers, lipids, other organic, and inorganic moieties. Such derivatives may be prepared to increase circulating half-life of a polypeptide, or may be designed to improve targeting capacity for the polypeptide to desired cells, tissues, or organs. Similarly, the invention further embraces GPCR polypeptides that have been covalently modified to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol. hi a related embodiment, the present invention provides compositions comprising purified polypeptides ofthe invention. Prefeπed compositions comprise, in addition to the polypeptide ofthe invention, a pharmaceutically acceptable (i.e., sterile and non-toxic) liquid, semisolid, or solid diluents that serve as pharmaceutical vehicles, excipients, or media. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, water, saline solutions, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl- and propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, glycerol, calcium phosphate, mineral oil, and cocoa butter.
Also comprehended by the present invention are antibodies (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, bifunctional/bispecific antibodies, humanized antibodies, human antibodies, and complementary determining region (CDR)-grafted antibodies, including compounds which include CDR sequences which specifically recognize a polypeptide ofthe invention) specific for GPCR polypeptides ofthe invention or fragments thereof. Prefeπed antibodies of the invention are human antibodies which can be produced and identified according to methods described in WO93/11236, published June 20, 1993, which is incoφorated herein by reference in its entirety. Antibody fragments, including Fab, Fab', F(ab')2, and Fv, are also provided by the invention. The term "specific for," when used to describe antibodies o the invention, indicates that the variable regions of the antibodies of the invention recognize and bind GPCR polypeptides exclusively (i.e., able to distinguish GPCR polypeptides from other known GPCR polypeptides by virtue of measurable differences in binding affinity, despite the possible existence of localized sequence identity, homoiogy, or similarity between GPCR polypeptides and such polypeptides). It will be understood that specific antibodies may also interact with other proteins (for example, S aureus protein A or other antibodies in ELISA techniques) through interactions with sequences outside the variable region of the antibodies, and in particular, in the constant region ofthe molecule. Screening assays to determine binding specificity of an antibody ofthe invention are well known and routinely practiced in the art. For a comprehensive discussion of such assays, see Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor , NY (1988), Chapter 6. Antibodies that recognize and bind fragments of the GPCR polypeptides ofthe invention are also contemplated, provided that the antibodies are, first and foremost, specific for GPCR polypeptides. Antibodies ofthe invention can be produced using any method well known and routinely practiced in the art.
Non-human antibodies may be humanized by any methods known in the art. In one method, the non-human CDRs are inserted into a human antibody or consensus antibody framework sequence. Further changes can then be introduced into the antibody framework to modulate affinity or immunogenicity.
Antibodies ofthe invention are useful for, for example, therapeutic puφoses (by modulating activity of GPCR polypeptides), diagnostic puφoses to detect or quantitate GPCR polypeptides, as well as purification of GPCR polypeptides. Kits comprising an antibody ofthe invention for any ofthe puφoses described herein are also comprehended. In general, a kit ofthe invention also includes a control antigen for which the antibody is immunospecific.
Specific binding molecules, including natural ligands and synthetic compounds, can be identified or developed using isolated or recombinant GPCR polypeptide products, GPCR polypeptide variants, or preferably, cells expressing such products. Binding partners are useful for purifying GPCR polypeptide products and dctection 01 quantification of GPCR polypeptide pioducts in fluid and tissue samples using known immunological proceduies Binding molecules are also manifestly useful in modulating (i e , blocking, inhibiting or stimulating) biological activities of GPCR polypeptides, especially those activities involved in signal transduction The DNA and amino acid sequence information provided by the present invention also makes possible identification of binding partner compounds with which a GPCR polypeptide or polynucleotide will interact Methods to identify binding partner compounds include solution assays, in vitro assays wherem GPCR polypeptides are immobilized, and cell based assays Identification of binding partner compounds of GPCR polypeptides provides candidates for therapeutic or prophylactic intervention in pathologies associated with GPCR polypeptide normal and abeπant biological activity
The invention includes several assay systems for identifying GPCR polypeptide binding partners In solution assays, methods ofthe invention comprise the steps of (a) contacting a GPCR polypeptide with one or more candidate binding partner compounds and (b) identifying the compounds that bind to the GPCR polypeptide Identification ofthe compounds that bind the GPCR polypeptide can be achieved by isolating the GPCR polypeptide/binding partner complex, and separating the GPCR polypeptide from the binding partner compound. An additional step of characteπzmg the physical, biological, and/or biochemical properties ofthe binding partner compound is also comprehended in another embodiment ofthe invention. In one aspect, the GPCR polypeptide/binding partner complex is isolated using a antibody lmmunospecific for either the GPCR polypeptide or the candidate binding partner compound In still other embodiments, either the GPCR polypeptide or the candidate binding partner compound comprises a label or tag that facilitates its isolation, and methods of the invention to identify binding partner compounds include a step of isolating the GPCR polypeptide/binding partner complex through interaction with the label or tag An exemplary tag of this type is a poly-histidine sequence, generally around six histidine residues, that permits isolation of a compound so
(R) labeled using nickel chelation Other labels and tags, such as the FLAG tag ( Eastman Kodak, Rochester, NY), well known and loutinely used in the ait, are embiaced by the invention
In one vaoation of an in vitro assay, the invention provides a method comprising the steps of (a) contacting an immobili/ed GPCR polypeptide with a candidate binding partner compound and (b) detecting binding of the candidate compound to GPCR polypeptide In an alternative embodiment, the candidate binding partner compound is immobilized and binding of GPCR polypeptide is detected Immobilization is accomplished using any of the methods well known in the art, including covalent bonding to a support, a bead, or a chromatographic resm, as well as non-covalent, high affinity interaction such as antibody binding, or use of stieptavidin/biotin binding wherein the immobilized compound includes a biotin moiety Detection of binding can be accomplished (l) using a radioactive label on the compound that is not immobilized, (n) using a fluorescent label on the non- lmmobihzed compound, (in) using an antibody lmmunospecific for the non- immobilized compound, (IV) using a label on the non-immobilized compound that excites a fluorescent support to which the immobilized compound is attached, as well as other techniques well known and routinely practiced in the art
The invention also provides cell-based assays to identify binding partner compounds of a GPCR polypeptide In one embodiment, the invention provides a method composing the steps of contacting a GPCR polypeptide expressed on the surface of a cell with a candidate binding partner compound and detecting binding ofthe candidate binding partner compound to the GPCR polypeptide In a prefeπed embodiment, the detection compπses detecting a calcium flux or other physiological cellular events caused by the binding ofthe molecule Agents that modulate (i e , increase, decrease, or block) GPCR polypeptide activity or expression may be identified by incubating a putative modulator with a cell expressing a GPCR polypeptide or polynucleotide and determining the effect ofthe putative modulator on GPCR polypeptide activity or expression The selectivity of a compound that modulates the activity of GPCR polypeptides can be evaluated by comparing its effects on GPCR polypeptides to its effect on other G coupled-protein receptor compounds Selective modulators may include, for example, antibodies and other proteins, peptides, or organic molecules which specifically bind to a G coupled-protein receptor polypeptide or a G coupled- protein receptor-encoding nucleic acid. Modulators of GPCR polypeptide activity will be therapeutically useful in treatment of diseases and physiological conditions in which normal or abeπant GPCR polypeptide activity is involved.
Methods o the invention to identify modulators include variations on any of the methods described above to identify binding partner compounds, the variations including techniques wherein a binding partner compound has been identified and the binding assay is carried out in the presence and absence of a candidate modulator. A modulator is identified in those instances where binding between the GPCR polypeptide and the binding partner compound changes in the presence of the candidate modulator compared to binding in the absence of the candidate modulator compound. A modulator that increases binding between the GPCR polypeptide and the binding partner compound is described as an enhancer or activator, and a modulator that decreases binding between the GPCR polypeptide and the binding partner compound is described as an inhibitor.
The invention also comprehends high throughput screening (HTS) assays to identify compounds that interact with or inhibit biological activity (i.e., inhibit enzymatic activity, binding activity, etc.) of a GPCR polypeptide. HTS assays permit screening of large numbers of compounds in an efficient manner. Cell-based
HTS systems are contemplated to investigate GPCR receptor-ligand interaction. HTS assays are designed to identify "hits" or "lead compounds" having the desired property, from which modifications can be designed to improve the desired property. Chemical modification ofthe "hit" or "lead compound" is often based on an identifiable structure/activity relationship between the "hit" and the GPCR polypeptide.
Mutations in the GPCR gene that result in loss of normal function of the GPCR gene product underlie GPCR polypeptide-related human disease states. The invention comprehends gene therapy to restore activity to treat those disease states. Delivery of a functional GPCR gene to appropriate cells is effected ex vivo, in situ, or in vivo by use of vectors, and more particularly viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus), or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments). See, for example, Anderson, Nature, supplement to vol. 392, no. 6679, pp.25-20 (1998). For additional reviews of gene therapy technology see Friedmann, Science, 244: 1275-1281 (1989); Venna, Scientific American: 68-84 ( 1990); and Miller, Nature, 357: 455-460 (1992).
Alternatively, it is contemplated that in other human disease states, preventing the expression of or inhibiting the activity of GPCR polypeptides ofthe invention will be useful in treating the disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of GPCR polypeptides of the invention.
Additional features ofthe invention will be apparent from the following Examples.
EXAMPLE 1 Cloning of G Protein-Coupled Receptors
The hicyte and Genbank expressed sequence tag (EST) databases were searched with the NCBI program Blastall using either the transmembrane VI region of known dopamine receptors (leading to the identification of CON193, CONl 66, CONl 03 and CON 203) or all known GPCR's except olfactory and opsin receptors (leading to the identification of CON 198, CONl 97, CON202, CON222, CON215) as query sequences, to find patterns suggestive of novel G protein-coupled receptors. Positive hits from the find-pattern program were further analyzed with the GCG program BLAST to determine which ones were the most likely candidates to encode a GPCR, using the standard (default) alignment produced by BLAST as a guide.
A. Cloning of CON193 G Protein-Coupled Receptor A.l. Database Search Results
Searching identified Clone 3091220H1 in the Incyte database as an interesting candidate sequence. The 3091220H1 Clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer (Perkin-Elmer/ Applied
Biosystems Division, PE/ABD, Foster City, CA) and the ABI PRISM™ Ready Dye-Deoxy Terminator kit with Taq FSTM polymerase. Each ABI cycle sequencing reaction contained about 0.5 μg of plasmid DNA. Cycle-sequencing was perfonned using an initial denaturation at 98°C for 1 minute, followed by 50 cycles using the following parameters: 98°C for 30 seconds, annealing at 50°C for 30 seconds, and extension at 60°C for 4 minutes. Temperature cycles and times were controlled by a
Perkin-Elmer 9600 thermocycler. Extension products were purified using Centriflex™ gel filtration cartridges (Advanced Genetic Technologies Coφ., Gaithersburg, MD). Each reaction product was loaded by pipette onto the column, which was then centrifuged in a swinging bucket centrifuge (Sorvall model RT6000B tabletop centrifuge) at 1500 x g for 4 minutes at room temperature. Column-purified samples were dried under vacuum for about 40 minutes and then dissolved in 5 μl of a DNA loading solution (83% deionized formamide, 8.3 mM EDTA, and 1.6 mg/ml Blue Dextran). The samples were then heated to 90°C for three minutes and loaded into the gel sample wells for sequence analysis using the ABI377 sequencer. Sequence analysis was done by importing ABI377 files into the Sequencer program
(Gene Codes, Ann Arbor, MI). Generally, sequence reads of 700 bp were obtained. Potential sequencing eπors were minimized by obtaining sequence information from both DNA strands and by re-sequencing difficult areas using primers annealing at different locations until all sequencing ambiguities were removed. From the sequence it was deduced that Clone 3091220H1 contained only an amino-terminal fragment of a putative GPCR coπesponding to the third through the seventh transmembrane regions (3TM-7TM) of a GPCR. Refeπing to SEQ ID NO: 1, the nucleotide sequence of Clone 3091220H1 coπesponds to nucleotides 404 to 1308 of what was eventually determined to be the complete sequence of a novel seven- transmembrane receptor designated CONl 93. A database search with this partial sequence showed a 56% match to members of the olfactory receptor gene family, e.g., the gene encoding mouse odorant receptor SI 9.
A.2 Screening of a Genomic Phage Library to Obtain a Full-Length GPCR Clone: The PCR technique was used to prepare a genomic fragment for use as a probe specific for the genomic CONl 93 Clone. Based on the complete sequence of Clone 3091220H1, two oligonucleotide primers were designed: Primer LW1282: 5'- TAATACCTGCACTGCCCAC-3' (SEQ ID NO: 21 ; see nucleotides 876-894 of SEQ ID NO: 1 ) and Primer LW 1283: 5'-TCTTTCCTTCTCTTCTCACTCC-3' (SEQ ID NO: 22 see nucleotides 1 137-1 158 of SEQ ID NO: l ). These primers were designed to amplify a 283 base-pair fragment of genomic DNA containing a portion of the CON 193 coding region found in Clone 3091220H 1 (assuming the absence of introns in this region).
Initially, a suitable human genomic library constructed in EMBL3 SP6/T7 (Clontech Laboratories) was amplified to provide the materials required for screening. Two microliters of the human genomic library (approximately 108 plaque- forming units per milliliter; Clontech Laboratories, catalog number HL1067J) were added to 6 ml of an overnight culture of K802 cells (Clontech Laboratories), and 250 μl aliquots were distributed into each of 24 tubes. The tubes were incubated at 37°C for 15 minutes, and then 7 ml of 0.8% agarose (i.e., top agarose) at 50°C were added to each tube. After mixing, the contents ofthe tubes were poured onto 150 mm LB plates and incubated overnight at 37°C to allow clone amplification, evident as plaque formation (typically, confluent lysis was observed rather than discrete plaques). To each plate, 5 ml of SM phage buffer (0.1 M NaCl, 8.1 μM MgSO4 »7H2O, 50 mM Tris-HCl (pH 7.5), and 0.0001 % gelatin) was added and the top agarose was removed by scraping with a microscope slide. Top agarose slurries containing phage were then placed in individual 50 ml centrifuge tubes. A drop of chloroform was added and each tube was placed in a 37°C shaker for 15 minutes, followed by centrifuging at 2,750 x g for 15 minutes. The supernatants were isolated and separately stored at 4°C as 24 stock solutions of amplified library clones.
As noted above, polymerase chain reaction (PCR) was selected as a technique for screening the phage library. Each PCR reaction was done in a 20 μl reaction volume containing 8.84 μl H2O, 2 μl 10X PCR buffer π (Perkin-Elmer), 2 μl 25 mM MgCl2, 0.8 μl dNTP mixture (dATP, dCTP, dGTP, dCTP, each at 10 mM), 0.12 μl primer LW1282 (approximately 1 μg μl), 0.12 μl primer LW1283 (approximately 1 μg/μl), 0.12 μl AmpliTaq Gold polymerase (5 Units/μl, with "Units" as defined by the supplier, Perkin-Elmer) and 2 μl of phage from one ofthe 24 stock tubes. The PCR reaction involved 1 cycle at 95 °C for 10 minutes and 80°C for 20 minutes, followed by 22 cycles at 95°C for 30 seconds, 72-51 °C for 2 minutes (72°C for this stage of the second cycle, with a decrease of one degree for this stage in each succeeding cycle), 72°C for one minute, followed by 30 cycles at 95°C for 15 seconds, 50°C for 30 seconds, and 72°C for one minute. Following PCR cycling, the contents from each reaction tube were loaded onto a 2% agarose gel and electrophoresed adjacent to known size standards to screen for PCR products of the expected size, indicative of a clone containing the 283 bp portion of Clone 3091220H1 amplified by the two selected primers. A positive signal (i.e., a fragment of the expected size) was found in one ofthe 24 PCR reactions, thereby identifying a single stock genomic library tube containing positive clones.
From the original genomic library tube that had given a PCR product ofthe coπect size, a 5 μl phage aliquot was used to establish a set of five serial dilutions (1/100, v/v) that were plated and incubated in the same manner as described for the amplification ofthe phage library. Following incubation, BA85 nitrocellulose filters (Schleicher & Schuell) were placed on top of each of the plates for 1 hour to adsorb phage from the plaques that had formed in the top agarose during incubation. Each filter was then gently removed, placed phage side up in an individual petri dish, and covered with 4 ml of SM buffer for 15 minutes to elute the phage. One milliliter of SM containing eluted phage was removed from each plate and used to set up a PCR reaction as described above. The plate containing the most dilute phage solution to yield a PCR product ofthe expected size was then subdivided using the following procedure. A BA85 filter was placed on the top agar of the plate and the medium with applied filter was physically divided into 24 sections. After one hour to allow phage adsoφtion to the 24 filters, each filter was removed and separately incubated in
1 ml of SM buffer at room temperature for 15 minutes. Two microliters of each eluted phage solution were then used as a PCR substrate. Those plate sections yielding positive PCR results were then subdivided into 12 subsections by removing the top agar and incubating it in 200 μl of SM buffer for one hour at room temperature. Again, 2 μl ofthe eluted phage solutions were plated and lifted using
BA85 filters, and PCR reactions were repeated. The procedure for progressive dilution of phage was continued until a single plaque was isolated. Subsequently, 10 μl of eluted phage from that single plaque were added to 100 μl SM and 200 μl of K802 cells for plating in a single petri dish as described above. A total of 7 plates were inoculated in this manner. Following incubation at 37°C for 16 hours, the top agarose from each of the 7 plates was removed to recover the phage, which were used to prepare purified genomic phage DNA using the Qiagen Lambda Midi Kit.
The purified CONl 93 genomic phage DNA was sequenced using the ABI PRISM1 M 310 Genetic Analyzer (Perkin-Elmer/ Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM rM BigDye' M Terminator Cycle Sequencing Ready Reaction Kit. The cycle-sequencing reaction contained 18 μl of H2O, 16 μl of BigDyeIM Terminator mix, 3 μl of genomic phage DNA (0.26 μg/μl), and 3 μl primer (25 ng/μl). The reaction was performed in a Perkin-Elmer 9600 fhermocycler at 95°C for 5 minutes, followed by 75 cycles of 95°C for 30 seconds, 55°C for 20 seconds, and 60°C for 4 minutes. The final subclone was also sequenced using the ABI PRISM I M 310 Genetic Analyzer. The cycle-sequencing reaction contained 6 μl of H2O, 8 μl of BigDye I M Terminator mix, 5 μl of miniprep clone DNA (0.1 μg/μl), and 1 μl primer (25 ng/μl). The reaction was performed in a Perkin-Elmer 9600 thermocycler at 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes. The product ofthe PCR reaction was purified using Centriflex™ gel filtration cartridges, dried under vacuum, and dissolved in 16 μl of Template Suppression Reagent (PE- Applied Biosystems). The samples were then incubated at 95°C for 5 minutes and placed in the 310 Genetic Analyzer. These efforts resulted in the determination ofthe CONl 93 polynucleotide sequence set forth in SEQ ID NO:l and the deduced amino acid sequence ofthe encoded CONl 93 polypeptide which is set forth in SEQ XT) NO:2.
A.3 Subcloning of the Coding Region of CONl 93 via PCR
Additional experiments were conducted to subclone the coding region of CON 193 and place the isolated coding region into a useful vector. Two additional PCR primers were designed based on the coding region of CON 193. The first PCR primer, designated Primer LW1373, has the sequence 5'-GCATAAGCTTATGCTA-
ACACTGAATAAAACAG-3' (SEQ XD NO: 23), nucleotides 11-32 of which coπespond to nucleotides 157- 178 of SEQ ID NO: 1. The second PCR primer is Primer LW1374, which has the sequence 5'-GCATCTCGAGTCACA- TGCTGTAGGATTTGG-3' (SEQ ID NO: 24, nucleotides 1 1-30 of which correspond to the complement of nucleotides 1 102-1 121 of SEQ ID NO: 1. To protect against exonucleolytic attack during subsequent exposure to enzymes, e.g., Taq polymerase, primers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessarily complementary to the desired target.
PCR was performed in a 50 μl reaction containing 35 μl H2O, 5 μl 10X TT buffer (140 mM ammonium sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4), 5 μl 15 mM MgSO4, 2 μl dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM),
2 μl genomic phage DNA (0.26 μg/μl), 0.3 μl Primer LW1373 (1 μg/μl), 0.3 μl Primer LW1374 (1 μg/μl), 0.4 μl High Fidelity Taq polymerase (Boehringer Mannheim). The PCR reaction was started with 1 cycle of 94°C for 2 minutes; followed by 15 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1.3 minutes.
The contents from the PCR reaction were loaded onto a 2% agarose gel, fractionated and electroeluted. The DNA band of expected size was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge. The eluted DNA was precipitated with ethanol and resuspended in 6 μl H2O for ligation.
The PCR-amplified DNA fragment containing the CONl 93 coding region was cloned into pCR2.1 using a protocol standard in the art. In particular, the ligation reaction consisted of 6 μl of CONl 93 DNA, 1 μl 10X ligation buffer, 2 μl pCR2.1 (25 ng/μl, Invitrogen), and 1 μl T4 DNA ligase (Invitrogen). The reaction mixture was incubated overnight at 14°C and the reaction was then stopped by heating at 65 °C for 10 minutes. Two microliters of the ligation reaction were transformed into One Shot cells (Invitrogen) and plated onto ampicillin plates. A single colony containing an insert was used to inoculate a 5 ml culture of LB medium. The culture was grown for 18 hours and the plasmid DNA was purified using the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation ofthe sequence, pCR-CON193 was identified, and a 50 ml culture of LB medium was inoculated and recombinant plasmid DNA was purified using a Qiagen Plasmid Midi Kit to yield purified pCR-CON 193.
B. Cloning of CON166 G Protein-Coupled Receptor B.l Database Search Results
The database searching identified clone 2553280H1 in the lncyte database as an interesting candidate sequence. The 2553280H1 clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer and the ABI PRISM I Ready Dye-Deoxy Terminator kit with Taq FSTM polymerase as described above for CON 193 in Example 1A.1. From the sequence it was deduced that clone
2553280H1 contained 349 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR coπesponding to the sixth and seventh transmembrane regions (6TM and 7TM). In addition, clone 2553280H1 contained 1.2 kb ofthe 3' untranslated sequence of that GPCR. Refeπing to SEQ XD NO: 3, the nucleotide sequence of Clone 2553280H1 coπesponds to nucleotides 663 to 1,014 of what was eventually determined to be the complete sequence of a novel seven- transmembrane receptor that was designated CONl 66. A database search with this partial sequence showed a 44% match to an activated T cell-specific G protein- coupled receptor. B2. Screening of a Genomic Phage Library to Obtain a
Full-Length GPCR Clone
The PCR technique was used to prepare a genomic fragment for use as a probe specific for the genomic CONl 66 clone. Based on the complete sequence of clone 2553280H1, two oligonucleotide primers were designed: Primer LW1278: 5'- ACCGCTGCCTTTTTAGTC-3' (SEQ ID NO: 28; see nucleotides 715 to 732 of SEQ
TD NO: 3 and Primer LW1279: 5'-CCTTCTTTCTGGGTACATAAGTC-3' (SEQ XT) NO: 29; see the reverse complement of nucleotides 951 -973 of SEQ ID NO: 3). These primers were designed to amplify a 259 base-pair fragment of genomic DNA containing a portion ofthe CONl 66 coding region found in clone 2553280H1 (assuming the absence of introns in this region).
Initially, a suitable human genomic library constructed in EMBL SP6/T7 was amplified to provide the materials required for screening as described above for CON 193 in Example 1A.2. Polymerase chain reaction (PCR) was selected as a technique for screening the phage library. Each PCR reaction was done in a 20 μl reaction volume containing 8.84 μl H2O, 2 μl 10X PCR buffer II (Perkin-Elmer), 2 μl 25 mM MgCI2, 0.8 μl dNTP mixture (dATP, dCTP, dGTP, dCTP, each at 10 mM), 0.12 μl primer LW1278 (approximately 1 μg/μl), 0.12 μl primer LW 1279
(approximately 1 μg/μl), 0.12 μl AmpliTaq Gold polymerase (5 Units/μl, with "Units" as defined by the supplier, Perkin-Elmer) and 2 μl of phage from one of the 24 stock tubes. The PCR reaction involved 1 cycle at 95°C for 10 minutes and 80°C for 20 minutes, followed by 12 cycles at 95°C for 30 seconds, 72-61 °C for 2 minutes (72°C for this stage ofthe second cycle, with a decrease of one degree for this stage in each succeeding cycle), 72°C for 30 seconds, followed by 30 cycles at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.
Following PCR cycling, the contents from each reaction tube were loaded onto a 2% agarose gel and electrophoresed adjacent to known size standards to screen for PCR products ofthe expected size of 259 bp, indicative of a clone containing the portion of clone 2553280H1 amplified by the two selected primers. A positive signal (i.e., a fragment ofthe expected size) was found in one of the 24 PCR reactions, thereby identifying a single stock genomic library tube containing positive clones. From the original genomic library tube that had given a PCR product of the coπect size, a 5 μl phage aliquot was used to amplify the CONl 66 genomic phage DNA as described for CON 193 above in Example 1 A.2. For the amplification of the phage library, the plates containing the diluted phage solution were subdivided into 12 sections unlike that of CON193; otherwise the procedures were identical. The purified CON 166 genomic phage DNA was sequenced using the
ABI PRISMI M 310 Genetic Analyzer which uses advanced capillary electrophoresis technology and the ABI PRISM™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit as described above for CONl 93 in Example 1 A.2. These efforts resulted in the determination ofthe CON166 polynucleotide sequence set forth in SEQ ID NO: 3 and the deduced amino acid sequence ofthe encoded CON166 polypeptide which is set forth in SEQ ID NO: 4. B.3 Subcloning of the Coding Region of CON166 via PCR
Additional experiments were conducted to subclone the coding region of CONl 66 from the genomic clone and place the isolated coding region into a useful vector. Two additional PCR primers were designed based on the coding region of CON 166. The first PCR primer, designated Primer LW1405, has the sequence
5'-AAGCATAACATGGATGAAACAGGAAATCTG-3' (SEQ ID NO: 29, nucleotides 10-30 of which coπespond to nucleotides 1-21 of SEQ XD NO: 3). To protect against exonucleolytic attack during subsequent exposure to enzymes, e.g., Taq polymerase, primers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessarily complementary to the desired target. The second PCR primer is Primer LW1406, which has the sequence 5'- AAGCATAACTATACTTTACATATTTCTTC-3' (SEQ TD NO: 30, nucleotides 9-29 of which coπespond to the reverse complement of nucleotides 994-1014 of SEQ ID NO: 3). PCR was performed in a 50 μl reaction containing 34 μl H2O, 5 μl 10X
TT buffer (140 mM ammonium sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4), 5 μl 15 mM MgSO4, 2 μl dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM), 3 μl genomic phage DNA (0.25 μg/μl), 0.3 μl Primer LW1405 (1 μg/μl), 0.3 μl Primer LW1406 (1 μg/μl), 0.4 μl High Fidelity Taq polymerase (Boehringer Mannheim). The PCR reaction was started with 1 cycle of 94°C for 2 minutes; followed by 25 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1.3 minutes.
The contents from the PCR reaction were loaded onto a 2% agarose gel and fractionated. The DNA band of expected size (1,031 bp) was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microfuge. The eluted DNA was precipitated with ethanol and resuspended in 6 μl H2O for ligation.
The PCR-amplified DNA fragment containing the CON 166 coding region was cloned into pCR2.1 to generate pCR-CONl 66 using a protocol standard in the art. In particular, the ligation reaction was caπied out as described for CON 193 in
Example 1 A.3. The resulting plasmid DNA was purified using the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation of the sequence, a 50 ml culture of LB medium was inoculated with the transformed One Shot cells, cultured, and processed using a Qiagen Plasmid Midi Kit to yield purified pCR-CON166.
C. Cloning of CON103 G Protein-Coupled Receptor C.l Database Search Results
The database searching identified clone 1581220H1 in the Incyte database as an interesting candidate sequence. The 1581220H1 clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer and the ABI
PRISM 1M Ready Dye-Deoxy Terminator kit with Taq FSTM polymerase as described for CON 193 in Example 1 A.1. From the sequence it was deduced that clone 1581220H1 contained 454 nucleotides of a GPCR coding region comprising a carboxy-terminal fragment of a putative GPCR coπesponding to the sixth and seventh transmembrane regions (6TM and 7TM). In addition, clone 1581220H1 contained
1.2 kb ofthe 3' untranslated sequence of that GPCR. Refeπing to SEQ TD NO: 5, the nucleotide sequence of clone 1581220H1 coπesponds to nucleotides 698 to 1190 of what was eventually determined to be the complete sequence of a novel seven- transmembrane receptor designated CONl 03. A database search with this partial sequence showed a 44% match to an activated T cell-specific G protein-coupled receptor.
C.2 Screening of a Genomic Phage Library to Obtain a Full-Length GPCR Clone
The PCR technique was used to prepare a genomic fragment for use as a probe specific for the genomic CONl 03 clone. Based on the complete sequence of clone 1581220H1, two oligonucleotide primers were designed: Primer LW1280: 5'-
TCTGCACACAGCTCTTCCATGG-3' (SEQ ID NO: 32; see nucleotides 1568-1589 of SEQ TD NO: 5) and Primer LW1281 : 5'-TCCCTTGTCCAGTTGGTTGAGG-3'
(SEQ ID NO: 33; see nucleotides 1926 to 1947 of SEQ ID NO: 5. These primers were designed to amplify a 380 base-pair fragment of genomic DNA containing a portion of the CON103 coding region found in clone 1581220H1 (assuming the absence of introns in this region). Initially, a suitable human genomic library constructed in EMBL SP6/T7 was amplified to provide the materials required for screening as described above for CONl 93 in Example 1A.2. Polymerase chain reaction (PCR) was selected as a technique for screening the phage library. Each PCR reaction was done in a 20 μl reaction volume containing 8.84 μl H2O, 2 μl 10X PCR buffer II (Perkin-Elmer), 2 μl
25 mM MgCl2, 0.8 μl dNTP mixture (dATP, dTTP, dGTP, dCTP, each at 10 mM), 0.12 μl primer LW1280 (approximately 1 μg/μl), 0.12 μl primer LW1281 (approximately 1 μg/μl), 0.12 μl AmpliTaq Gold polymerase (5 Units/μl, with "Units" as defined by the supplier, Perkin-Elmer) and 2 μl of phage from one ofthe 24 stock tubes. PCR amplification reactions using each one ofthe other 23 stock collections of genomic clones were performed under the same conditions. The PCR reaction involved 1 cycle at 95°C for 10 minutes and 80°C for 20 minutes, followed by 12 cycles at 95°C for 30 seconds, 72-61°C for 2 minutes (72°C for this stage ofthe second cycle, with a decrease of one degree for this stage in each succeeding cycle), 72°C for one minute, followed by 30 cycles at 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.
Following PCR cycling, the contents from each reaction tube were loaded onto a 2% agarose gel and electrophoresed adjacent to known size standards to screen for PCR products ofthe expected size of 380 bp, indicative of a clone containing the portion of clone 1581220H1 amplified by the two selected primers. A positive signal (i.e., a fragment ofthe expected size) was found in one ofthe 24 PCR reactions, thereby identifying a single stock genomic library tube containing positive clones.
From the original genomic library tube that had given a PCR product ofthe coπect size, a 5 μl phage aliquot was used to amplify the CON 103 genomic phage DNA as described above for CON 193 in Example 1A.2. A total of 8 plates were inoculated with eluted phage in this manner described above. Following incubation at 37°C for 16 hours, the top agarose from each of the 8 plates was removed to recover the phage, which were used to prepare purified genomic phage DNA using the Qiagen Lambda Midi Kit. The CON 103 clone was sequenced using the ABI PRIS I 3 10 Genetic Analyzer The cycle-sequencing reaction contained 6 μl ol H2O, 8 μl of BigDye1 ι Teiminator mix, 5 μl of miniprep clone DNA (0 1 μg/μl), and 1 μl primer (25 ng/μl) The reaction was performed m a Perkin-Elmet 9600 theπnocycler at 25 cycles ol 96°C for 10 seconds, 50°C for 10 seconds, and 60°C foi 4 minutes The product of the PCR reaction was purified using Centπflex™ gel filtiation cartridges, dried under vacuum, and dissolved in 16 μl of Template Suppiession Reagent (PE- Apphed Biosystems) The samples were then incubated at 95°C for 5 minutes and placed in the 310 Genetic Analyzer These efforts resulted in the deteπnination of the CON 103 polynucleotide sequence set forth in SEQ ID NO 5 and the deduced amino acid sequence ofthe encoded CONl 03 polypeptide which is set forth in SEQ XD NO 6 C.3 Subcloning of the Coding Region of CONl 03 via PCR
Additional experiments were conducted to subclone the coding region of CON 103 from the genomic clone and place the isolated coding region into a useful vector Two additional PCR primers were designed based on the sequence of the coding region of CON103 Pnmer LW1385 (5'-GCATAAGCT- TCCATGGAACTTCATAACCTG-3', SEQ ID NO 34, nucleotides 13-30 of which coπespond to nucleotides 1-18 of SEQ TD NO 5) and Pnmer LW1386 (5'- GC ATCTCGAGTTACCCCC AC AGCGCTGC AG-3 ' , SEQ XD NO 35, nucleotides
1 1-30 of which coπespond to the reverse complement of nucleotides 1171-1190 of SEQ ID NO 5) To protect against exonucleolytic attack during subsequent exposure to enzymes, e g , Taq polymerase, pnmers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessanly complementary to the desired target
PCR was performed in a 50 μl reaction containing 22 6 μl H2O, 5 μl 10X TT buffer (140 mM ammonium sulfate, 0 1% gelatin, 0 6 M Tπs-tocine, pH 8 4), 5 μl 15 mM MgSO4, 10 μl rapid dye (Oogene), 2 μl dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM), 0 5 μl genomic phage DNA (0 97 μg/μl), 0 3 μl Primer LW1385 (1 μg/μl), 0 3 μl Pomer LW1386 (1 μg/μl), and 0 4 μl High Fidelity
Taq polymerase (Boeh nger Mannheim) The PCR reaction was started with 1 cycle of 94°C for 2 minutes, followed by 12 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 .3 minutes.
The contents from the PCR reaction were loaded onto a 2% agarose gel and fractionated. The DNA band of expected size (1 ,212 bp) was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge. The eluted DNA was precipitated with ethanol and resuspended in 6 μl H2O for ligation.
The PCR-amplified DNA fragment containing the CON 103 coding region was cloned into pCR2.1 using a protocol standard in the art. In particular, the ligation reaction was caπied out as described above for CONl 93 in Example 1 A.3.
The resulting plasmid DNA was purified using the Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation of the sequence, pCR- CON103 was identified, and a 50 ml culture of LB medium was inoculated, cultured, and processed using a Qiagen Plasmid Midi Kit to yield purified pCR-CON103.
D. Cloning of CON203 G Protein-Coupled Receptor D.l Database Search Results
The database searching identified clone 3210396H1 in the Incyte database as an interesting candidate sequence. The 3210396H1 clone was obtained and sequenced directly using an ABI377 fluorescence-based sequencer and the ABI
PRISM I M Ready Dye-Deoxy Terminator kit with Taq FSTM polymerase as described above for CON 193 in Example 1A.1. From the sequence it was deduced that clone 3210396H1 contained all 1,002 nucleotides of a GPCR coding region (see SEQ ID NO: 7). A database search with this sequence showed a 33% match to a platelet activating receptor (Gene H963, GenBank Ace. No. AF002986).
D.2 Subcloning of the Coding Region of CON203 via PCR
Additional experiments were conducted to subclone the coding region of CON203 and place the isolated coding region into a useful vector. Two additional PCR primers were designed based on the sequence of the coding region of CON203: Primer LW1329: 5'-GCATCTCGAGTCAGCCTAAGGTTATGTTG-3' (SEQ ID
NO: 36; see nucleotides 984 to 1,002 of SEQ ID NO: 7 for the reverse complement of nucleotides 9-29 of SEQ ID NO: 36) and Primer LW 1377: 5'- GCATAAGCTTATGAACACCACAGTGATGC-3' (SEQ TD NO: 37; see nucleotides 1- 19 of SEQ ID NO: 7 which coπespond to nucleotides 11-29 of SEQ ID NO: 37). To protect against exonucleolytic attack during subsequent exposure to enzymes, e.g., Taq polymerase, primers were routinely synthesized with a protective run of nucleotides at the 5' end that were not necessarily complementary to the desired target. These primers were designed to amplify a 1,020 base-pair fragment of clone 3210396H1 containing the complete coding region of CON203.
PCR was perfoπned in a 50 μl reaction containing 34 μl H2O, 5 μl 10X TT buffer (140 mM ammonium sulfate, 0.1 % gelatin, 0.6 M Tris-tricine, pH 8.4), 5 μl
15 mM MgSO4, 2 μl dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM), 3 μl clone 3210396H1 (miniprep DNA), 0.3 μl Primer LW1329 (1 μg/μl), 0.3 μl Primer LW1377 (1 μg/μl), and 0.4 μl High Fidelity Taq polymerase (Boehringer Mannheim). The PCR reaction was started with 1 cycle of 94°C for 2 minutes, followed by 12 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1.3 minutes.
The contents from the PCR reaction were loaded onto a 1.2% agarose gel and fractionated. The DNA band of expected size (1,020 bp) was excised from the gel, placed in a GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge. The eluted DNA was precipitated with ethanol and resuspended in 6 μl H2O for ligation.
The PCR-amplified DNA fragment containing the CON203 coding region was cloned into pCR2.1 using a standard protocol and the Original TA Cloning Kit (Invitrogen). Ligation reactions were caπied out as described above for CON 193 in Example 1 A.3. The resulting plasmid DNA was purified using the Concert Rapid
Plasmid Miniprep System (GibcoBRL) and sequenced. Following confirmation of the sequence, pCR-C203 was identified, and a 50 ml culture of LB medium was inoculated, cultured, and processed using a Qiagen Plasmid Midi Kit to yield purified pCR-C203. The CON203 clone was sequenced using the ABI PRISM™ 310
Genetic Analyzer (P-E Applied Biosystems), which uses advanced capillary electrophoresis technology and the ABI Prism ι xι BigDyeI M Terminator Cycle Sequencing Ready Reaction Kit. The cycle-sequencing reaction contained 6 μl of H2O, 8 μl of BigDyeI M Terminator mix, 5 μl of miniprep clone DNA (0.1 μg/μl), and 1 μl primer (25 ng/μl). The reaction was perfoπued in a Perkin-Elmer 9600 theπnocycler using the following conditions: 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes. The product of the PCR reaction was purified using Centriflex™ gel filtration cartridges, dried under vacuum, and dissolved in 16 μl of Template Suppression Reagent (PE-Applied Biosystems). The samples were then incubated at 95°C for 5 minutes and placed in the 310 Genetic Analyzer.
Initially, these efforts showed that the CON203 coding region cloned into pCR2.1 had a single bp difference from the coπesponding sequence of clone 3210396H1. The single bp change in the pCR2.1 clone was eliminated by conforming that sequence to the sequence of clone 3210396H1 using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). The method involves modification of a sequence during PCR amplification, for which PCR primers LW1387 (5'- GAGAAATATTTTTCTAAAAAAACCTGTTTTTGCAAAAACGG-3'; SEQ ID NO: 38) and LW1388 (5'-CCGTTTTTGCAAAAACAGGTTTTTTTAGAAAA- ATATTTCTC-3'; SEQ XD NO: 39) were used. The PCR reaction contained 40 μl H2O, 5 μl 10X proprietary Reaction Buffer (Stratagene), 1 μl pCR-C203 (0.125 μg/μl) mini-prep DNA, 1 μl dNTP mixture (dGTP, dATP, dTTP, and dCTP, each at 10 mM), 1 μl Pfu DNA polymerase (2.5 Units/μl), 1 μl LW1387 (125 ng/μl) and 1 μl LW1388 (125 ng/ 1). The cycle conditions were 95°C for 30 seconds, followed by 12 cycles at 95°C for 30 seconds, 55°C for 1 minute, and 68°C for 12 minutes. The tube was then placed on ice for 2 minutes and 1 μl of DpnX was added. The tube was then incubated at 37°C for one hour. One microtiter of the E>/wI-treated DNA was transformed into Epicurian coli XLl-Blue supercompetent E. coli cells. Following isolation of pCR-C203, the entire insert was re-sequenced, thereby successfully verifying repair of the single-site polymoφhism. As expected, the sequence of the CON203 coding region determined using this pCR2.1 clone is in complete agreement vvith the CON203 coding region sequence of SEQ ID NO: 7 which specifies the amino acid sequence set forth in SEQ ID NO: 8.
E. Cloning of CONl 98 G Protein-Coupled Receptor E.l Database Search Results
The database searching identified Clone 3359808HI in the Incyte database as an interesting candidate sequence. The 3359808HI clone was obtained and sequenced using standard techniques. From the sequence it was deduced that Clone 3359808HI contained the entire coding region for a previously unidentified GPCR, which was designated "CONl 98." The DNA and deduced amino acid sequences for CON198 are set forth in SEQ XD NOS: 9 and 10, respectively. A database search with this CONl 98 DNA sequence showed a 61% match to the rat putative GPCR designated RAlc [Raming et. al, Recept Channels, 6: 141-151 (1998)] and 46% identity to an olfactory receptor. E.2 Subcloning of the Coding Region of CON198 via PCR
Additional experiments were conducted to subclone the coding region of the CONl 98 clone into a useful vector. Two PCR primers were designed based on the coding region of CON198 for the puφose of PCR amplification ofthe CON198 coding sequence. The first, Primer LW1326, from 5' to 3' (SEQ ED NO: 42): GCATGAATTCATGATGGTGGATCCCAATGG. includes the 5 ' end of the
CON 198 coding sequence (underlined) as well as a EcoRI restriction site, useful for subsequent expression work. The second, Primer LW1327, from 5' to 3' (SΕQ ID NO: 43): GCATCTCGAGCCTAGGGCTCTGAAGCG. includes sequence complementary to the 3' end ofthe CON 198 coding sequence (underlined), preceded by a XhoX restriction site sequence useful for subsequent cloning and expression work.
The PCR was performed in a 50 μl reaction containing 34 μl H2O, 5 μl of 10X TT buffer (140 mM Ammonium Sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4), 5 μl of 15 mM MgSO4, 2 μl of 10 mM dNTPs (dATP, dCTP, dTTP, dGTP), 2 μl of Clone 3359808H1 mini-prep DNA (approx. 0.125 μg/μl), 0.3 μl of Primer LW1326 (1 μg/μl), 0.3 μl of Primer LW1327 (1 μg/μl), and 0.5 μl of High Fidelity
Taq polymerase (Boehringer Mannheim). The PCR reaction was started with 1 cycle of 94°C for 2 minutes, followed by 12 cycles at 94°C for 30 seconds. 55°C for 30 seconds, and 72°C foi 1 minute
I he contents fiom the PCR reaction weie loaded onto a 1 2% agaiose gel and electrophoresed The DNA band of expected size was excised from the gel, placed in a GenElutc Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a microcentπfuge The eluted DNA was ethanol-precipitated and resuspended in 6 μl H2O for ligation
The puπfied PCR fragment containing the CON 198 coding sequence was ligated into a commercial vector using Invitrogen's Original TA Cloning Kit The ligation reaction was earned out as described above for CONl 93 in Example 1 A 3
The resulting plasmid DNA was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CON 198 insert Sequencing ofthe subcloned CON 198 construct revealed that the PCR amplification had introduced a mutation (relative to the sequence of the original clone) at the nucleotide coπesponding to position 204 of SEQ ID NO- 9 A site-directed mutagenesis expeπment was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene) to repair the mutation
Two pnmers were designed to revert the mutated A nucleotide at position 204 back to a G nucleotide via polymerase chain reaction Pnmer LW1415 (SEQ ID NO- 44) contained the sequence:
5 '-CCATGTATATATTTCTTTGC ATGCTTTCAGGC ATTGACATCC-3 ' ; and primer LW1416 (SEQ ID NO- 45) contained the sequence
5 ' -GGATGTC AATGCCTG AAAGC ATGC AAAGAAAT AT AT AC ATGG-3 ' The PCR reaction contained 40 μl of H2O, 5 μl of lOx Reaction buffer, 1 μl of mmi-prep DNA (approx 0 125 μg/μl) from the CON198-pCR2 1 clone (as template), 1 μl of primer LW1415 (125 ng/μl), 1 μl of primer LW1416 (125 ng/μl), 1 μl of 10 mM dNTPs, 1 μl Pfu DNA polymerase. The PCR cycle conditions were as follows initial denaturation at 95°C for 30 seconds, then 14 cycles at 95°C for 30 seconds, 55°C annealing for 1 minute, and 68°C extension for 12 minutes Thereafter, the reaction tube was placed on ice for 2 minutes After PCR, 1 μl of Dpiύ was added and the tube incubated at 37°C for one hour to digest the methylated parental DNA template. One microliter of the _D ?/;I-treated DNA was transformed into Epicurian coli XLl-Blue supercompetent cells and the entire insert was re-sequenced. The resequencing confirmed that position 204 of SEQ ID NO: 9 had been successfully reverted to a guanine nucleotide.
Upon confirmation of the insert, the E. coli transformant was used to inoculate a 50 ml culture of LB medium. The culture was grown for 16 hours at 37°C, and centrifuged into a cell pellet. Plasmid DNA was purified from the pellet using a Qiagen Plasmid Midi Kit and again sequenced to confirm successful cloning ofthe CONl 98 insert, using an ABI377 fluorescence-based sequencer and the ABI
PRISM™ Ready Dye-Deoxy Terminator kit with Taq FS,M polymerase as described abvoe for CON 193 in Example 1 A.l .
F. Cloning of CON197 G Protein-Coupled Receptor F.l Database Search Results
The database searching identified Clone 866390H1 in the Incyte database as an interesting candidate sequence. The 866390H1 clone was obtained and sequenced using standard techniques. From the sequence it was deduced that Clone 866390H1 contained the entire coding region for a previously unidentified GPCR, which was designated "CON197." The DNA and deduced amino acid sequences for
CONl 97 are set forth in SEQ ID NOs: 11 and 12, respectively. A database search with this CONl 97 DNA sequence showed a 42% match to an olfactory receptor. F.2 Subcloning of the Coding Region of CONl 97 via PCR
Additional experiments were conducted to subclone the coding region ofthe CONl 97 clone into a useful vector. Two PCR primers were designed based on the coding region of CON197 for the puφose of PCR amplification of the CON197 coding sequence. The first, Primer LW1324, from 5' to 3' (SEQ TD NO: 48): GATCGGATCCATGGAAAGCGAGAACAG. includes the 5' end of the CON 197 coding sequence (underlined) as well as a BamT X restriction site, useful for subsequent expression work. The second, Primer LW1325, from 5' to 3' (SEQ ID
NO: 49): GATCCTCGAGTCAGGCTATGTGCTTATTAAACACC. includes sequcncc complementary to the 3' end ol the CON 197 coding sequence (underlined), pieceded by a Xhol restriction site sequence useful fot subsequent cloning and expression work
The PCR was performed in a 50 μl reaction containing 24 μl H2O, 10 μl Rapid Dye Loading buffer (Origene) 5 μl 10X TT buffer (140 mM Ammonium
Sulfate, 0 1% gelatin, 0 6 M Tπs-tπcine, pH 8 4), 5 μl of 15 mM MgSO4, 2 μl of 10 mM dNTPs (dATP, dCTP, dTTP, dG P), 3 μl of Clone 866390H1 mini-prep DNA (approx 0 125 μg/μl), 0 3 μl of Primer LW 1324 (1 μg/μl), 0 3 μl of Pnmer LW 1325 (1 μg/μl), and 0 5 μl of High Fidelity Taq polymerase (Boehπnger Mannheim) The PCR reaction was started with 1 cycle of 94°C for 2 minutes, followed by 12 cycles at
94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute
The contents from the PCR reaction was loaded onto a 1 2% agarose gel and electrophoresed The DNA band of expected size was excised from the gel, placed in GenElute Agarose spin column (Supelco) and spun for 10 minutes at maximum speed in a Savant microcentrifuge The eluted DNA was ethanol- precipitated and resuspended in 6 μl H2O for ligation
The purified PCR fragment containing the CONl 97 coding sequence was ligated into a commercial vector using Invitrogen's Onginal TA Cloning Kit The resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CONl 97 insert
Upon confirmation ofthe insert, the same transformant was used to inoculate a 50 ml culture of LB medium The culture was grown for 16 hours at 37°C, and centrifuged into a cell pellet Plasmid DNA was purified from the pellet using a Qiagen Plasmid Midi Kit and again sequenced to confirm successful cloning ofthe CON197 insert, using an ABI377 fluorescence-based sequencer (Perkin Elmer/ Applied Biosystems Division, PE/ABD, Foster City, CA) and the ABI PRISM™ Ready Dye-Deoxy Terminator kit with Taq FS1 M polymerase as described above for CON193 in Example 1A 1 G. Cloning of CON202 G Protein-Coupled Receptor G. l Database Search Results
The database searching identified Clone Number 1305513H1 in the Incyte database as an interesting candidate sequence. The 1305513H 1 clone was obtained and sequenced using an ABI377 fluorescence-based sequencer (Perkin
Elmer/Applied Biosystems Division, PE/ABD, Foster City, CA) and the ABI PRISM I M Ready Dye-Deoxy Terminator kit with Taq FS™ polymerase as described above for CONl 93 in Example 1A.1.
Sequencing of Incyte Clone 1305513H1 revealed a sequence coπesponding to nucleotides 1054 to 1378 of SEQ ID NO: 13. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl. Biosci., 5: 527- 535 (1994)], Clone 1305513H1 was deduced to contain two transmembrane-spanning domains (TMVI and TMVH) and an extracellular loop for a previously unidentified GPCR, which was designated as "CON202". The sequence obtained was used as a tool to identify a full length GPCR clone as described in the next section.
G.2 PCR Screening of Genomic Clones
A human genomic phage library was selected as a source from which to attempt to clone the CON202 gene. The genomic library was amplified as described above for CON193 in Example 1A.2. This genomic library was screened by PCR using the primers: GV599
(5'GGCAGAAGAAGGCTATTGGTCTTAGACGAG3'; SEQ ID NO: 52), and GV600 (5'CTGAAACAGCGCCTCAGCTCCC3'; SEQ ID NO: 53). These primers were designed from the sequence of Clone 1305513H1 to amplify a 253 base pair fragment (coπesponding to nucleotides 1064 to 1317 of SEQ ID NO: 13) from any coπesponding genomic clone in the library. The 20 μl PCR reactions each contained
12.8 μl of H2O, 2 μl of lOx PCR buffer II (Perkin-Elmer), 2 μl of 25 mM MgCl2, 0.8 μl of 10 mM dNTP's (dATP, dGTP, dCTP, dTTP), 0.12 μl of primer GV599 (1 μg/ml), 0.12 μl of primer GV600 (1 μg/ml), 0.2 μl AmpliTaq Gold polymerase (5 Units/μl, with "Units" as defined by the supplier, Perkin Elmer) and 2 μl of phage from one ofthe 24 tubes. The PCR reaction consisted of 1 cycle at 95°C for 10 minutes; then 17 cycles at 95°C for 20 seconds, 72°C for 2 minutes decreasing 1°C each cycle, 72"C for 30 seconds followed by 30 cycles at 95°C for 20 seconds, 55°C for 30 seconds, and 72"C for 30 seconds.
The PCR products were visualized on a 2% agarose gel. For those tubes which produced the coπect sized band of 253 bp, five microliters from each original phage culture tube were used to amplify the CON202 genomic phage DNA as described above for CON 193 in Example 1 A.2.
The genomic DNA from the single phage isolate, was sequenced with the ABI PRISM™ 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM™ Big Dye™ Terminator Cycle Sequencing Ready Reaction Kit. The cycle-sequencing reaction contained 20 ml of H2O, 16 ml of BigDye™ Terminator Mix, 1 ml of genomic phage
DNA (1.1 mg/ml), and 3 ml primer (25 ng/ml). The reaction was performed in a
Perkin-Elmer 9600 thermocycler at 95°C for 5 minutes, followed by 99 cycles of 95°C for 30 seconds, 55°C for 20 seconds and 60°C for 4 minutes. The product was purified using a Centriflex™ gel filtration cartridge, dried under a vacuum, then dissolved in 16 ml of Template Suppression Reagent. The samples were heated at
95°C for 5 minutes then placed in the 310 Genetic Analyzer.
G.3 Subcloning of the Coding Region of CON202 via PCR
Additional experiments were conducted to subclone the coding region ofthe CON202 clone into a more useful vector. Two PCR primers were designed based on the coding region of CON202 for the puφose of PCR amplification ofthe
CON202 coding sequence. The first, Primer LW1482
(5ΑGCTATGGCGAACTATAGCCATGCAGC3': SEQ ID NO: 54) included the 5' end ofthe CON202 coding sequence (underlined). The second, Primer LW148 (5AGTCCTCATATAACACAGTAAGGTTCC3': SEQ ID NO: 55) included the sequence complementary to the 3' end ofthe CON202 coding sequence (underlined). The PCR was performed in a 50 μl reaction containing 36.5 μl of H2O,
5 μl of lOx TT buffer (140 mM Ammonium Sulfate, 0.1% gelatin, 0.6 M Tris-tricine, pH 8.4), 5 μl of 15 mM MgSO4, 2 μl of 10 mM dNTP's (dATP, dCTP, dTTP, dGTP), 0.5 μl of CON202 genomic phage DNA (approx. 1.1 μg/μl), 0.3 μl of Primer LW1482
(1 μg/μl), 0.3 μl of Primer LW1483 (1 μg/μl), and 0.4 μl of High Fidelity Taq polymerase (Boehringer Mannheim). The PCR reaction was started with 1 cycle of 94°C for 2 minutes; followed by 12 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 .3 minutes.
The contents from the PCR reaction were loaded onto a 2.1 % agarose gel and electrophoresed. The DNA band of expected size (1.1 kb) was excised from the gel, placed on a GenElute Agarose spin column (Supelco), and spun for 10 minutes at maximum speed in a microfuge. The eluted DNA was ethanol-precipitated and resuspended in 6 μl of H2O for ligation.
The purified PCR fragment, containing the CON202 coding sequence, was ligated into a commercial vector using Invitrogen's Original TA Cloning Kit. The ligation reaction was caπied out as described above for CONl 93 in Example 1A.3. The resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CON202 insert. The resulting construct was denoted as pCR-CON202. The final subclone was sequenced using the ABI PRISM™ 310
Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM™ Terminator Cycle Sequencing Ready Reaction Kit. The cycle-sequencing reaction contained 6 ml of H2O, 8 ml of BigDye™ Terminator mix, 5 ml miniprep DNA (0.1 mg/ml), and 1 ml primer (25 ng/ml). The reaction was performed in a Perkin-Elmer 9600 thermocycler at 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes. The product was purified using Centriflex™ gel filtration cartridges, dried under vacuum, then dissolved in 16 ml of Template Suppression Reagent. The samples were heated to 95°C for 5 minutes then placed in the 310 Genetic Analyzer. Upon confirmation ofthe insert, the same transformant was used to inoculate a 50 ml culture of LB medium. The culture was grown for 16 hours at 37°C, and centrifuged into a cell pellet. Plasmid DNA was purified from the pellet using a Qiagen Plasmid Midi Kit and again sequenced to confirm successful cloning of the CON202 insert, as described above. H. Cloning of CON222 G Protein-Coupled Receptor H.l Database Search Results
The database searching in the Incyte database identified Sequence Number 2488822CB 1 as an interesting candidate sequence. This Incyte sequence is a consensus sequence derived by compiling multiple, shorter contiguous (apparently overlapping) partial sequences from cDNA clones. A single clone known to contain the complete consensus sequence was not available from Incyte. The following experiments were performed to clone a piece of human DNA which coπesponds to the region ofthe theoretical Incyte Sequence Number 2488822CB that was deduced to encode a heretofore undescribed GPCR. The human DNA and protein that was eventually isolated is refeπed to herein as CON222. H.2 Isolation of CON222 Genomic DNA using PCR
To isolate a clone of CON222, PCR primers were designed based on the 5' and 3' ends ofthe open reading frame that was identified in the Incyte Sequence Number 2488822CB1. The first primer, designated as LW1440, has the sequence
5ΑAGCGGATGTTTAGACCTCTTGTG3' (SEQ ID NO: 60) which coπesponds to nucleotides 1 to 18 of SEQ ID NO: 15 (underlined). The second primer, designated LW1441, has the sequence 5ΑACAGTCATGAATAGGAATTGAG3' (SEQ XD NO: 61) which is the reverse complement of nucleotides 1173 to 1191 of SEQ ID NO: 15 (underlined).
PCR was performed in a 50 ml reaction containing 22.1 ml H2O, 10 ml Rapid Dye Loading Buffer (Origene), 5 ml 1 Ox TT buffer (140 mM Ammonium Sulfate, 0.1%o gelatin, 0.6 M Tris-tricine pH 8.4), 5 ml 15 mM MgSO4, 2 ml 10 mM dNTP's (dATP, dCTP, dGTP, dTTP), 5 ml human genomic DNA (0.03 mg/ml) (Clontech, Cat# 6550-1), 0.3 ml of Primer LW1440 (1 mg/ml) (SEQ XD NO: 59), 0.3 ml of LW1441 (1 mg/ml) (SEQ XD NO: 60), 0.4 ml High Fidelity Taq polymerase (Boehringer Mannheim). The PCR reaction was started with 1 cycle of 94°C for 2 minutes followed by 10 cycles at 94°C for 30 seconds, 55°C for 2 minutres, 72°C for 2 minutes then 25 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 2 minutes. The PCR reaction was loaded onto a 1.2% agarose gel. The resulting band was not 1.2 kB in length as expected, indicating that this method was unsuccessful in identi fying an appropriate clone from the selected Clontech genomic DNA library containing the coding region of CON222.
A human genomic DNA phage library was selected as an alternate source from which to attempt to clone the CON222 gene. Internal primers were designed to attempt to isolate from a genomic library a single phage which expresses the complete coding region. The procedure was caπied out as described above for CONl 93 in Example 1A.2.
PCR was performed to identify a phage that contained a genomic DNA insert which coπesponds to the deduced complete coding region of Incyte Sequence Number 2488822CB1 using the primers: Primer LW1442:
5OCCATTCTGTCCACAGAAG3' (SEQ ID NO: 58; see nucleotides 391 to 410 of SEQ XD NO: 15) and Primer LW1443: 5TCAGTTGCTGTTATGGCAC3' (SEQ ID NO: 59; see reverse complement of nucleotides 744 to 761 of SEQ TD NO: 15). These primers were designed based on the deduced coding region of Incyte Sequence Number 2488822CB1, to amplify a 370 bp fragment (coπesponding to nucleotides
391 to 761 of SEQ ID NO: 1) from any coπesponding genomic clone in the library. The 50 μl PCR reactions each contained 32 μl of H2O, 5 μl of lOx PCR gold buffer (PE Applied Biosystems), 5 μl of 25 mM MgCl2, 2 μl of 10 mM dNTP's (dATP, dCTP, dGTP, dTTP), 0.3 μl of primer LW1442 (1 μg/ml), 0.3 μl of primer LW1443 (1 μg/ml), 0.4 μl AmpliTaq Gold polymerase (5 U/μl, with "Units" defined by the supplier; PE Applied Biosystems) and 5 μl of phage isolated human genomic DNA (0.03 μg/μl). The PCR reaction consisted of 1 cycle at 95°C for 10 minutes, then 17 cycles at 95°C for 20 seconds and 72υC for 2 minutes decreasing 1 degree each cycle, and 72°C for 1 minute, followed by 30 cycles at 95°C for 20 seconds, 55°C for 30 seconds, and 72°C for 1 minute. An aliquot ofthe PCR reaction was loaded onto a
1.2% agarose gel and electrophoresed. Although the internal primers were designed to produce a 370 bp PCR fragment, the resulting band was approximately 1.4 kb in length.
The DNA band was excised from the gel, placed on GenElute Agarose spin columns (Supelco) and spun for 10 minutes at maximum speed in a microcentrifuge. The eluted DNA was ethanol-precipitated and resuspended in 10 μl of H,0 and 5 μl was used to sequence the PCR band.
The PCR fragment was sequenced with an ABI PRISM™ 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM™ BigDye™ Terminator Cycle Sequencing Ready
Reaction Kit. Each cycle-sequencing reaction contained 6 ml of H2O, 8 ml of BigDye Terminator mix, 5 ml PCR fragment DNA (0.2 mg/ml), and 1 ml Primer LW1442 (25 ng/ml) and Primer LW1443 (25 ng/ml). The reaction was performed in a Perkin- Elmer 9600 thermocycler with 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60UC for 4 minutes. The product was purified using Centriflex™ gel Reagent (PE
Applied Biosystems). The samples were heated at 95°C for 5 minutes then placed in the 310 Genetic Analyzer.
The sequence analysis determined that there is an intron in the middle of the 5th transmembrane-spanning domain between nucleotides 673 and 674 in SEQ ID NO: 15. This intron was responsible for the unexpectedly large PCR fragment.
H.3 Isolation of Full Length cDNA
Since attempts to isolate an uninterrupted coding region from genomic DNA were unsuccessful, a fetal brain cDNA was used to generate the complete coding region of Incyte Sequence Number 2488833CB1. The PCR primers described above, LW1440 (SEQ ID NO: 60) and LW1441 (SEQ XD NO: 61), which coπespond to the
5' and 3' end of CON222 respectively, were used to generate the full length coding region.
The 50 μl PCR reaction contained 37.4 μl of H2O, 5 μl of lOx cDNA PCR buffer (Clontech), 1 μl of 10 mM dNTP's (dATP, dCTP, dTTP, dGTP), 5 μl of Marathon-Ready Fetal Brain cDNA (Clontech), 0.3 μl of Primer LW1440 (1 μg/μl),
0.3 μl of Primer LW 1441 (1 μg/μl), and 1 μl of 50x Advantage cDNA polymerase (Clontech). The PCR reaction was started with 1 cycle of 94°C for 1 minute, followed by 30 cycles at 94°C for 30 seconds, 50°C for 30 seconds, and 68°C for 3 minutes. The contents from the PCR reaction were loaded onto a 1.2% agarose gel and electrophoresed. The DNA band of expected size (1 .2 kb) was excised from the gel, placed on a GenElute Agarose spin column (Supelco), and spun for 10 minutes at maximum speed in a microfuge The eluted DNA was cthanol-piecipitated and resuspended in 6 μl H2O foi ligation H.4 Subcloning of Coding Region of CON222 via PCR After a cDNA containing the full length CON222 open reading frame was obtained, the coding region of CON222 was then subcloned into a more useful vector as follows
The puπfied PCR fragment described above, containing the CON222 coding sequence, was ligated into a commercial vector using Invitrogen's Original TA Cloning Kit The ligation reaction was earned out as described above for CON 193 in
Example 1 A 3 The resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confirm that the plasmid contained the CON222 insert
The subcloned insert in pCR2 1 was sequenced using the ABI PRISM™ 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary technology and the ABI PRISM ™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit Each cycle-sequence reaction contained 6 ml of H2O, 8 ml of BigDye™ Terminator mix, 5 ml mmi-prep DNA (0 1 mg/ml), and 1 ml of primer (25 ng/ml) and was performed in a Perkin-Elmer 9600 thermocycler with 25 cycles of 96°C for 10 seconds, 50°C for 10 seconds, and 60°C for 4 minutes. The product was purified using a Centnflex™ gel filtration cartndge, vacuum dried and dissolved in 16 ml of Template Suppression Reagent (PE Applied Biosystems) The samples were heated at 95°C for 5 minutes then placed in the 310 Genetic Analyzer
Upon confirmation ofthe insert, the same transformant was used to inoculate a 50 ml culture of LB medium The culture was grown for 16 hours at
37°C, and centπfuged into a cell pellet Plasmid DNA was purified from the pellet using a Qiagen Plasmid Midi Kit and again sequenced to confirm successful cloning ofthe CON222 insert, as described above I. Cloning of CON215 G Protein-Coupled Receptor
1.1 Database Search Results
The database searching identified Clone 1452259H1 in the Incyte database as an interesting candidate sequence. The sequence from 1452259H1 clone was used to search the Incyte fill-length database and matched the entry 1650519CB 1.
An inspection ofthe clones that made up 1650519CB 1 indicated that Incyte Clone 2796157H1 probably contained the full-length coding region. Sequence analysis of Incyte Clone 2796157H1 indicated that it contains the entire coding region for a previously unidentified GPCR, which was designated "CON215", along with 12 nucleotides of 5' untranslated region, 63 nucleotides of 3' untranslated region and a poly A+tail. The DNA and deduced amino acid sequences for CON215 are set forth in SEQ TD NOS: 17 and 18, respectively. A database search with this CON215 sequence showed a 47% match to the human probable G protein-coupled receptor K1A0001. Since the untranslated regions were relatively short, it was not necessary to remove the coding region of CON215 from the pINCY vector (Incyte) and the construct is refeπed to as pINCY-CON215. The Incyte Clone 2796157H1 was sequenced using the ABI PRISM™ 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit as described above for CON222 in ExamplelH.4.
J. Cloning of CON217 G Protein-Coupled Receptor
J.l Database Search Results The Incyte database search identified EST 3700658H1 as an interesting candidate sequence. The EST sequence No. 3700658H1 was used to search the Incyte full length database. This search identified Incyte clone No. 3356166H1 as a clone that potentially contained a full length GPCR coπesponding to the selected EST.
The 3356166H1 clone was obtained from Incyte and sequenced using an ABI377 fluorescence-based sequencer ( and the ABI PRISM™ Ready Dye-Deoxy Terminator kit with Taq FSI M polymerase as described above for CON193 in Example 1A.1.
Sequencing of Incyte Clone No. 3356166H 1 revealed a 2480 basepair sequence as shown in SEQ NO: 19. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al., Comput. Appl. Biosci., 5: 527-535 (1994)], Clone No.
3356166H1 was deduced to contain seven transmembrane-spanning domains (TMI- TMVII) and was designated as "CON217" (SEQ ID NO: 20). The following experiments were performed to subclone and isolate the full length coding sequence of CON217 from Incyte Clone No. 3356166H 1. J.2 Subcloning of the Coding Region of GPCR217
To subclone the full length coding sequence of CON217, PCR primers were designed based on the 5' and 3' ends ofthe open reading frame that was identified in the Incyte Clone No. 3356166H1. The first primer, designated as LW1448, has the sequence 5ΑAGCGGTACCATGTTAGCCAACAGCTCCTC3' (SEQ ID NO: 66) which coπesponds to nucleotides 42 to 62 of SEQ ID NO: 19
(underlined). The second primer, designated LW1449, has the sequence 5ΑAGCTCTAGATCAGAGGGCGGAATCCTGG3' (SEQ ID NO: 67) which is the reverse complement of nucleotides 1 142 to 1160 of SEQ TD NO: 20 (underlined). The primers also include recognition sequences (bold) for the restriction enzymes Kpnl and Xbal, respectively.
PCR was performed in a 50 ml reaction containing 32.5 ml of H2O, 5 ml of lOx Pfx Amplification buffer (GibcoBRL), 5 ml of lOx PCR Enhancer solution (GibcoBRL), 1.5 ml of 50 mM MgSO4, 2 ml of 10 mM dNTP's (dATP, dCTP, dGTP, dTTP), 3 ml 3356166H1 mini-prep DNA (0.125 mg/ml obtained with the Concert Rapid Plasmid Miniprep System; GibcoBRL), 0.3 ml of Primer LW1448 (1 mg/ml)
(SEQ XD NO: 3), 0.3 ml of Primer LW1449 (1 mg/ml) (SEQ ID NO: 4), 0.5 ml Platinum Pfx DNA polymerase (2.5 U/ml; GibcoBRL). The PCR reaction was started with 1 cycle of 94°C for 2 minutes followed by 25 cycles at 94°C for 30 seconds, 55°C for 30 seconds, 68°C for 1.3 minutes. The contents from the PCR reaction were loaded onto a 1.2% agarose gel and electrophoresed. The DNA band of expected size (- 1.1 kb) was excised from the gel, placed on a GenElute Agarose spin column (Supelco), and spun for 10 minutes at maximum speed in a microfuge. The eluted DNA was ethanol-precipitated and resuspended in 6 μl of H2O for ligation.
The purified PCR fragment, containing the CON217 coding sequence, was ligated into a commercial vector designated pCR2.1 using Invitrogen's Original
TA Cloning Kit. The ligation reaction was caπied out as described above for CON 193 in Example 1A.3. The resulting plasmid DNA from the culture was isolated using a Concert Rapid Plasmid Miniprep System (GibcoBRL) and sequenced to confiπn that the plasmid contained the CON217 insert and to confinn that no eπors were introduced during PCR amplification. The resulting construct was denoted as pCR-CON217.
The final subclone was sequenced using the ABI PRISM™ 310 Genetic Analyzer (PE Applied Biosystems) which uses advanced capillary electrophoresis technology and the ABI PRISM™ Terminator Cycle Sequencing Ready Reaction Kit as described above for CON222 in Example 1H.4.
EXAMPLE 2 Analysis of G Protein-Coupled Receptor Sequence A. CON193 The DNA and deduced amino acid sequence for CONl 93 are set forth in SEQ ID NOS: 1 and 2, respectively. Beginning with the initiation codon (methionine), the CON 193 genomic Clone contains an open reading frame of 963 nucleotides encoding 321 amino acids, followed by a stop codon. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl BioscL, 5: 527- 535 (1994)], CONl 93 was shown to contain seven transmembrane-spanning domains coπesponding to residues 30-49 (1TM), 61-81 (2TM), 103-122 (3TM), 146-165 (4TM), 199-222 (5TM), 243-262 (6TM), and 270-295 (7TM) of SEQ XD NO: 2. These transmembrane domains define first ("N-terminal," residues 1-29), second ("first EC loop," residues 82-102), third ("second EC loop," residues 166-198), and fourth ("third EC loop," residues 263-269) extracellular domains, as well as first
("first IC loop," residues 50-60), second ("second IC loop," residues 123-145), third ("third IC loop," residues 223-242), and fourth ("C-terminal," residues 296-321 ) intracellular domains.
Inspection of the CONl 93 amino acid sequence (SEQ ID NO: 2) reveals that this GPCR contains a DRY sequence following the third transmembrane domain (3TM) and a PIVY sequence found in the sixth transmembrane domain
(TM6). In addition, the CON193 polynucleotide sequence was compared to sequences of known genes. CON193 is 45% identical and 72% similar to the mouse olfactory receptor gene S19 [see Malnic et al., Cell 96:713-723 (1999)]. This level of sequence similarity suggests that CON 193 is a novel GPCR. The CON 193 cDNA clone (SEQ XD NO: l) was deposited with the
National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30250.
B. CONl 66
The DNA and deduced amino acid sequence for CONl 66 are set forth in SEQ ID NOS: 3 and 4, respectively. Beginning with the initiation codon (methionine), the CONl 66 genomic clone contains an open reading frame of 1,011 nucleotides encoding 337 amino acids, followed by a stop codon. Using a
FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl Biosci., 5: 527-535 (1994)], CON166 was shown to contain seven transmembrane- spanning domains coπesponding to the following residues presented in SEQ ID NO: 4: 1TM (30-49), 2TM (59-79), 3TM (99-119), 4TM (141-161), 5TM (191 -215), 6TM (231 -251 ), and 7TM (277-296) . These transmembrane domains define first ("N- terminal," residues 1-29), second ("first EC loop," residues 80-98), third ("second EC loop," residues 162-190), and fourth ("third EC loop," residues 252-276), extracellular domains as well as first ("first IC loop," residues 50-58), second ("second IC loop," residues 120-140), third ("third IC loop," residues 216-230), and fourth ("C-terminal," residues 297-337) intracellular domains. Inspection of the CON 166 amino acid sequence (SEQ TD NO:2) reveals that this GPCR contains an FRC sequence following the third transmembrane domain (3TM), which is typically occupied by a consensus DRY sequence in other GPCRs; a PLLY sequence is also found in the seventh transmembrane domain (7TM). In addition, the CON 166 polynucleotide sequence was compared to sequences of known genes. CON 166 is 44% identical and 62% similar to a T-cell-specific G protein-coupled receptor oϊ Gallus gallus found in the TREMBL database (Accession No. L06109). This level of sequence similarity suggests that CONl 66 is a novel GPCR. The CON166 cDNA clone (SEQ ID NO:3) was deposited with the
National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30248.
C. CON103
The DNA and deduced amino acid sequence for CONl 03 are set forth in SEQ ID NOS: 5 and 6, respectively. Beginning with the initiation codon (methionine), the CONl 03 genomic clone contains an open reading frame of 1 ,152 nucleotides encoding 384 amino acids, followed by a stop codon and a short open reading frame (SEQ ID NO: 5). Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl. Biosci., 5: 527-535 (1994)], CON103 was shown to contain seven transmembrane-spanning domains coπesponding to the following residues in SEQ ID NO: 6: 54-77 (1TM), 89-108 (2TM), 134-149 (3TM), 167-188 (4TM), 216-240 (5TM), 258-283 (6TM), and 301-320 (7TM). These transmembrane domains define first ("N-terminal," residues 1-53), second ("first EC loop," residues 109-133), third ("second EC loop," residues 189-215), and fourth ("third EC loop," residues 284-300) extracellular domains, as well as first ("first IC loop," residues 78-88), second ("second IC loop," residues 150-166), third ("third IC loop," residues 241-257), and fourth ("C-terminal," residues 321-384) intracellular domains. lnspection of the CON 103 amino acid sequence (SEQ ID NO: 6) reveals that this GPCR contains an NRY sequence following the third transmembrane domain (3TM), which is typically occupied by a consensus DRY sequence in other GPCRs. In addition, the CON 103 polynucleotide sequence was compared to sequences of known genes. CON 103 is 36% identical to GPR31 (GenBank Accession
No. U65402) and 31% identical to the P2Y 1 purinergic receptor (GenBank Accession No. S81950). This level of sequence similarity indicates that CON103 is a novel GPCR.
The CON 103 cDNA clone (SEQ ID NO:5) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30247.
D. CON203
The DNA and deduced amino acid sequence for CON203 are set forth in SEQ TD NOS: 7 and 8, respectively. Beginning with the initiation codon (methionine), the CON203 genomic clone contains an open reading frame of 999 nucleotides encoding 333 amino acids, followed by a stop codon. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput. Appl Biosci., 5: 527-
535 (1994)], CON203 was shown to contain seven transmembrane-spanning domains coπesponding to the following residues of SEQ TD NO: 7: nucleotides 29-53 (1TM), 63-82 (2TM), 97-118 (3TM), 136-160 (4TM), 189-211 (5TM), 232-252 (6TM), and 281-300 (7TM). These transmembrane domains define first ("N-terminal," residues 1-28), second ("first EC loop," residues 83-96), third ("second EC loop," residues
161-188), and fourth ("third EC loop," residues 253-280) extracellular domains, as well as first ("first IC loop," residues 54-62), second ("second IC loop," residues 1 19- 135), third ("third IC loop," residues 212-231), and fourth ("C-terminal," residues 301-333) intracellular domains. Inspection of the CON203 amino acid sequence (SEQ XD NO: 8) reveals that this GPCR contains a DRF sequence following the third transmembrane domain (3TM), which is typically occupied by a consensus DRY sequence in other GPCRs; CON203 also exhibited a PLIY sequence in the seventh transmembrane domain (7TM). In addition, the CON203 polynucleotide sequence was compared to sequences of known genes. CON203 is 33% identical to a platelet activating receptor (GenBank Accession No. AF002986. This level of sequence similarity suggests that
CON203 is a novel GPCR.
The CON203 cDNA clone (SEQ ID NO: 7) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B-
30254.
E. CON198
The DNA and deduced amino acid sequence for CONl 98 are set forth in SEQ TJD NO: 9 and 10 respectively. Beginning with the initiator methionine, the
CON198 genomic clone contains an open reading frame of 954 nucleotides encoding 318 amino acids, followed by a stop codon. It will be appreciated that residue 2 of SEQ ID NO: 10 also is a methionine. Amino-terminal sequencing of purified native or recombinant CON 198 protein will provide an indication as to which methionine acts as an initiator codon in vivo. Using a FORTRAN computer program called
"tmtrest.all" [Parodi et al, Comput . Appl. Biosci., 5: 527-535 (1994)], CON198 was deduced to contain seven transmembrane-spanning domains coπesponding to residues 28-52 (TM1), 61-80 (TM2), 104-123 (TM3), 147-167 (TM4), 200-226 (TM5), 239- 263 (TM6), and 274-295 (TM7) of SEQ ID NO: 10 . These transmembrane domains define first ("N-terminal," residues 1-27 or 2-27), second ("first EC loop," residues
81-103), third ("second EC loop," residues 168-199), and fourth ("third EC loop," residues 264-273) extracellular domains as well as first ("first IC loop," residues 53- 60), second ("second IC loop," residues 124-146), third ("third IC loop," residues 227-238), and fourth ("C-terminal," residues 296-318) intracellular domains. CONl 98 contains a DRY sequence following the third transmembrane domain (TM3), a feature that is conserved in most GPCR. The most similar sequence m a public database, at the tune of initial screening, was that of tat GPCR RA l c, which shared only 61 % identity at the amino acid level
The CON 198 cDNA clone (SEQ ID NO 9) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agπcultuic 1815 North University Street, Peoπa, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000 The clone was given accession no B- 30252
F. CON197 The DNA and deduced amino acid sequence for CON 197 are set forth in SEQ ID NO 1 1 and 12, respectively Beginning with the initiator methionine, the CONl 97 genomic clone contains an open reading frame of 921 nucleotides encoding 307 ammo acids, followed by a stop codon Using a FORTRAN computer program called "tmtrest all" [Parodi et al , Comput Appl Biosci , 5 527-535 (1994)], CON197 was deduced to contain seven transmembrane-spanning domains coπesponding to residues 23-47 (TM1), 58-78 (TM2), 99-120 (TM3), 142-164 (TM4), 195-219 (TM5), 237-258 (TM6), and 270-289 (TM7) of SEQ TD NO 12 These transmembrane domains define first ("N-terminal" residues 1-22), second ("first EC loop "residues 79- 98), third ("second EC loopNesidues 165-194), and fourth ("third EC loopNesidues 259-269) extracellular domains as well as first ("first IC loop" residues 48-57), second
("second IC loop" residues 121-141), third ("third IC loop" residues 220-236), and fourth ("C-termmal" residues 290-309) intracellular domains
CONl 97 contains a DRY sequence following the third transmembrane domain (TM3), a feature that is conserved in most GPCR The most similar sequence in a public database, at the time of initial screening, was that of an olfactory receptor, which shared only 42% identity at the ammo acid level
The CONl 97 cDNA clone (SEQ ID NO 11) was deposited with the National Center for Agπcultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoπa, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000 The clone was given accession no B-
30251 G. CON202
The DNA and deduced amino acid sequence foi this phage insert, termed "CON202", are set forth in SEQ ID NO 13 and 14, respectively The CON202 open leading fiame, as depicted in SEQ ID NO 14, begins with the mitiatoi methionine and spans 1 1 10 nucleotides which encode 370 amino acids, followed by a stop codon Since this gene was isolated from genomic DNA and there aie no apparent interruptions in the sequence, it is likely that CON202 contains no introns within the coding legion The full length clone of CON202 contained seven transmembrane-spanning domains coπesponding to residues, 24 to 46 (TM 1 ) , 57 to 77 (TM2), 96 to 1 17 (TM3), 135 to 159,(TM4) TMV comprises 184 to 202 (TM5),
286 to 308 (TM6), 316 to 339 (TM7) of SEQ TD NO 14 TM2 terminates with PFVC instead ofthe characteristic PXXY TM3 is followed by the sequence TRY instead of the characteristic DRY These transmembrane domains define first ("N-termmal," residues 1-23), second ("first EC loop," residues 78-95), third ("second EC loop," residues 160-183), and fourth ("third EC loop," residues 309-315) extracellular domains as well as first ("first IC loop," residues 47-56), second ("second IC loop," residues 118-134), third ("third IC loop," residues 203-285), and fourth ("C-terminal," residues 340-370) intracellular domains
The CON202 cDNA clone (SEQ ID NO 13) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peona, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000 The clone was given accession no B- 30253
H. CON222
The sequence of CON222 coding region deduced the DNA and amino acid sequence set forth in SEQ TD NO 15 and 16, respectively The open reading frame that is depicted in SEQ XD NO 16 begins with an initiator codon and spans 1188 nucleotides which encode 396 ammo acids, followed by a stop codon The full length clone of CON222 contains seven transmembrane- spanning domains coπesponding to residues 42-65 (TM1) 79-103, (TM2), 125-156, (TM3), 167-188 (TM4), 217-241 (TM5), 268-290 (TM6), 301-320 (TM7) of SEQ ID NO: 16. TM2 is followed by a FRC sequence and TM7 contains a PILY sequence within. These transmembrane domains define first ("N-terminal," residues 1 -41 ), second ("first EC loop," residues 104-124), third ("second EC loop," residues 189- 216), and fourth ("third EC loop," residues 291 -300) extracellular domains as well as first ("first IC loop," residues 66-78), second ("second IC loop," residues 157-166), third ("third IC loop," residues 242-267), and fourth ("C-teπninal," residues 321-396) intracellular domains. A search of the public database indicated that CON222 is about 35% identical to a unique GPCR found in the nervous system of Lymnaea stagnalis.
The CON222 cDNA clone (SEQ ID NO: 15) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30257.
I. CON215
The DNA and deduced amino acid sequence for CON215 are set forth in SEQ ID NO: 17 and 18, respectively. Beginning with the initiator methionine, the CON215 genomic clone contains an open reading frame of 1074 nucleotides encoding
358 amino acids, followed by a stop codon. Using a FORTRAN computer program called "tmtrest.all" [Parodi et al, Comput . Appl. Biosci., 5: 527-535 (1994)], CON215 was deduced to contain seven transmembrane-spanning domains coπesponding to residues 42-66 (TM1), 81-99 (TM2), 116-137 (TM3), 156-180 (TM4), 210-234 (TM5), 256-275 (TM6), and 308-328 (TM7) of SEQ XD NO: 18.
These transmembrane domains define first ("N-terminal," residues 1-41), second ("first EC loop," residues 100-115), third ("second EC loop," residues 181-209), and fourth ("third EC loop," residues 276-307) extracellular domains as well as first ("first IC loop," residues 67-80), second ("second IC loop," residues 138-155), third ("third IC loop," residues 235-255), and fourth ("C-terminal," residues 329-358) intracellular domains. CON215 contains a DRY sequence following the third transmembrane domain (TM3), a feature that is conserved in most GPCR. CON215 also contains a PIIY sequence within the seventh transmembrane domain (TM7).
The CON215 cDNA clone (SEQ ID NO: 17) was deposited with the National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30255.
J. CON217
The DNA and deduced amino acid sequences of CON217 are set forth as SEQ ID NO: 19 and 20, respectively. The open reading frame that is depicted in SEQ ID NO: 2 begins with an initiator methionine codon and spans 11 16 nucleotides which encode 372 amino acids, followed by a stop codon. In addition, the nucleotide sequence consists of 41 bp in the 5' untranslated region and 1323 bp in the 3' untranslated region.
The full length clone of CON217 contains seven transmembrane- spanning domains as indicated by the FORTRAN computer program "tmtrest.all" [Parodi et al, Comput. Appl. Biosci., 5: 527-535 (1994)] which coπesponds to 29-50 (TM1), 57-75 (TM2), 96-117 (TM3), 137-160 (TM4), 188-210 (TM5), 235-258
(TM6), 277-297 (TM7). TM3 is followed by a DRY sequence and TM7 contains a PLVY sequence within. These transmembrane domains define first ("N-terminal," residues 1-28), second ("first EC loop," residues 76-95), third ("second EC loop," residues 161-187), and fourth ("third EC loop," residues 259-276) extracellular domains as well as first ("first IC loop," residues 51-56), second ("second IC loop," residues 118-136), third ("third IC loop," residues 21 1 -234), and fourth ("C-terminal," residues 298-372) intracellular domains. A search of the public database indicated that CON217 is about 41 % identical to GPR23 (Genebank Accession No.: U66578) and to a purinergic receptor P2Y9 (Genebank Accession No.: U90322). The CON215 cDNA clone (SEQ ID NO: 19) was deposited with the
National Center for Agricultural Utilization Research at the United States Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 in accordance with the Budapest Treaty on January 18, 2000. The clone was given accession no. B- 30256.
K. Summary of Deposits
The polynucleotides (SEQ ID NO: 1 , 3, 5, 7, 9, 1 1 , 13, 15 and 17) encoding the GPCR polypeptides of the invention were deposited with the Agricultural Research Service Culture Collection (NRRL) at the National Center Agricultural Utilization Research at the U.S. Department of the Agriculture 1815 North University Street, Peoria, Illinois 61604. These deposits were made in accordance with the Budapest Treaty on the International Recognition ofthe Deposit of Microorganism for the Puφoses of Patent Procedures. The table below lists the details of these deposits.
GPCR SEO XD NO: NRRL No. Deposit Date
CONl 93 1 B-30250 1/18/00
CONl 66 3 B-30248 1/18/00
CONl 03 5 B-30247 1/18/00
CON203 7 B-30254 1/18/00
CONl 98 9 B-30252 1/18/00
CONl 97 11 B-30251 1/18/00
CON202 13 B-30253 1/18/00
CON222 15 B-30257 1/18/00
CON215 17 B-30255 1/18/00
CON217 19 B-30256 1/18/00
EXAMPLE 3
Hybridization Analysis Demonstrates that the GPCRs are
Expressed in the Brain
The expression of GPCR polynucloetides in mammals, such as the rat, was investigated by in situ hybridization histochemistry. Coronal and sagittal rat brain cryosections (20 μm thick) were prepared using a Reichert-.lung cryostat. Individual sections were thaw-mounted onto silanized, nuclease-free slides (CEL Associates, Inc., Houston, TX), and stored at -80°C. Sections were processed starting with post-fixation in cold 4% paraformaldehyde, rinsed in cold phosphate-buffered saline (PBS), acetylated using acetic anhydride in triethanolamine buffer, and dehydrated through a series of alcohol washes in 70%, 95%, and 100% alcohol at room temperature. Subsequently, sections were delipidated in chloroform, followed by rehydration through successive exposure to 100% and 95% alcohol at room temperature. Microscope slides containing processed cryosections were allowed to air dry prior to hybridization.
A. CON 193
A CONl 93 -specific probe was generated using PCR. The probe consisted of a 270 bp fragment containing sequence at the 3' end of CON-193. The primers for PCR amplification were LW 1248 [5'-
GCATGAATTCCAATATACTTCCCCATACCTAC-3'; SEQ XD NO: 26) and LW 1249 [5'-GCATGGATCCGGAAAAGAAGGAGAAGAAAG-3'; SEQ XD NO: 27), which introduced terminal EcoRI and BamTXX restriction sites into the PCR product. Following PCR amplification, the fragment was digested with EcoRI and BamTXX and cloned into pBluescriptll cleaved with the same enzymes. For production of a probe specific for the sense strand of CONl 93, the CONl 93 Clone in pBluescriptll was linearized with BamRX, which provided a substrate for labeled run-off transcripts (i.e., cRNA riboprobes) using the vector-borne T7 promoter and commercially available T7 RNA polymerase. A probe specific for the antisense strand of CON 193 was also readily prepared using the CONl 93 Clone in pBluescriptll by cleaving the recombinant plasmid with EcoRI to generate a linearized substrate for the production of labeled run-off cRNA transcripts using the T3 promoter and cognate polymerase. The riboprobes were labeled with [35S]-UTP to yield a specific activity of 0.81 x 106 cpm/pmol for antisense riboprobes and 0.55 x 106 cpm/pmol for sense-strand riboprobes. Both riboprobes were subsequently denatured by incubating at 70°C for 3 minutes and added (2 pmol/ml) to hybridization buffer which contained 50% formamide, 10% dextran, 0.3 NaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, IX Denhardt's Solution, and 10 mM dithiothreitol. Microscope slides containing sequential brain cryosections were independently exposed to 45 μl of hybridization solution per slide and silanized cover slips were placed over the sections being exposed to hybridization solution. Sections were incubated overnight (15-18 hours) at
52°C to allow hybridization to occur. Equivalent series of cryosections were exposed to sense or antisense CON 193-specific cRNA riboprobes.
Following the hybridization period, coverslips were washed off the slides in IX SSC. Slides were subjected to RNase A treatment by incubation in a buffer containing 20 μg/ml RNase A, 10 mM Tris (pH 8.0), 0.5 M NaCl and 1 mM
EDTA for 45 minutes at 37°C. The cryosections were then subjected to three high- stringency washes in 0.1 X SSC at 52°C for 20 minutes each. Following the series of washes, cryosections were dehydrated by consecutive exposure to 70%, 95%, and 100% ammonium acetate in alcohol, followed by air drying and exposure to Kodak BioMax MR-1 film. After 13 days of exposure, the film was developed. Based on these results, brain sections that gave rise to positive hybridization signals were coated with Kodak NTB-2 nuclear track emulsion and the slides were stored in the dark for 32 days The slides were then developed and counterstained with hematoxylin. Emulsion-coated sections were analyzed microscopically to determine the specificity of labeling. The signal was determined to be specific if autoradiographic grains
(generated by antisense probe hybridization) were clearly associated with crystal violet-stained cell bodies. Autoradiographic grains found between cell bodies indicates non-specific binding.
Specific labeling with the antisense probe occuπed at low levels in the cortex and in the substantia nigra-pars compacta (SN-c). The specificity of labeling was confirmed by microscopic analysis of emulsion-coated cryosections, as described above. In contrast, hybridization using the riboprobe specific for the sense strand of CONl 93 did not result in specific tissue labeling. The observed regional distribution of CON 193 mRNA suggests that ligands for this GPCR may be involved in signal transductions important for cellular processes underlying neurological functioning. In addition, expression of CON 193 in the brain provides an indication that modulators of CON193 activity have utility for treating neuiological disorders, including but not limited to, schizophienia, depression, anxiety, bipolai disease, epilepsy, neuritis, neui asthenia, neuropathy, neuroses, and the like Use of CON 193 modulators, including CON 193 ligands and antι-CON 193 antibodies, to treat individuals having such disease states is intended as an aspect of the invention
B. CONl 66
A CONl 66-specι fie probe was generated using PCR as described above for CONl 93 in Example 3 A (but using CON166-specιfic primers) The probe consisted of a 259 bp fragment containing sequence at the 3' end of CON- 166
(nucleotides 715-974 of SEQ ID NO 1) and containing terminal EcoRI and BamTXX restπction sites The nboprobes were labeled with [35S]-UTP to yield a specific activity of 0.40 x 106 cpm/pmol for antisense riboprobes and 0 65 x 106 cpm/pmol for sense-strand nboprobes Hybndization with the riboprobes and subsequent washing ofthe slides was earned out as descnbed above for CONl 93 in Example 3 A
Specific labeling with the antisense probe occuπed in cortical regions, including the pinform complex, neostπatum, thalamus and hippocampus The specificity of labeling was confirmed by microscopic analysis of emulsion-coated cryosections. These sections revealed that the autoradiographic grains resulting from antisense riboprobe in situ hybridizations were distnbuted over cell bodies rather than trapped between cell bodies In contrast, hybndization using the nboprobe specific for the sense strand of CONl 66 produced a faint signal in the hippocampus only, but even this signal was found to be non-specific upon microscopic examination The observed regional distnbution of CONl 66 mRNA suggests that ligands for this GPCR may be involved m signal transductions important for cellular processes underlying neurological functioning In addition, expression of CONl 66 in the brain provides an indication that modulators of CON 166 activity have utility for treating neurological disorders, including but not limited to, schizophrenia, affective disorders, ADHD/ ADD (i e , Attention Deficit-Hyperactivity Disorder/ Attention Deficit Disorder), and neural disorders such as Alzheimer's disease, Parkinson's disease, migraine, and senile dementia Some other diseases for which modulators of CON 166 may have utility include depression, anxiety, bipolar disease, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, and the like. Use of CON 166 modulators, including CONl 66 ligands and anti-CON 166 antibodies, to treat individuals having such disease states is intended as an aspect of the invention.
C. CON 103
A cocktail of two CON103-specific antisense oligonucleotide probes (CON103a and CON103b) were used because of the relatively high GC content ofthe CONl 03 coding region. The CON103a sequence (5TTTATTAATATTGGAAGGGACAAACTGGAGAGCACAGAACAT3'; SEQ ID
NO: 72) coπesponds to the reverse complement of nucleotides 2196-2237 of SEQ ID NO: 5 and CONl 03b sequence (5'AAAGCCACCATGGA
AGCCATGCCAAAGATGATGCTGGGCAAGAA 3'; SEQ XD NO: 73) coπesponds to the reverse complement of nucleotides 195-1538 of SEQ ID NO: 5. Terminal deoxynucleotidyltransferase and [a -33P]dATP were used to 3' end-label CONl 03a
(1.36 x 107 cpm/pmol) and CONl 03b (9.1 x 106 cpm/pmol). The probes were denatured by incubation at 70°C for three minutes and added to hybridization buffer containing 50% formamide, 10% dextran, 0.3 M NaCl, 10 mM Tris (pH 8.0), 1 mM EDTA, IX Denhardt's Solution, and 200 mM dithiothreitol. The final concentration of each radiolabeled probe was 2 pmol/ml of hybridization solution. Microscope slides containing sequential brain cryosections were independently exposed to 45 μl of hybridization solution (containing the antisense oligonucleotide probes CON103a and CON 103b) per slide and silanized cover slips were placed over the sections being exposed to hybridization solution. Sections were incubated overnight (15-18 hours) at 37°C to allow hybridization to occur.
Following the hybridization period, coverslips were washed off the slides in IX SSC. The cryosections were then subjected to three high-stringency washes in 1 X SSC at 65°C for 20 minutes each. Following two room-temperature washes, cryosections were dehydrated by consecutive exposure to 70%, 95%, and 100% ethanol (0.3 M ammonium acetate added to 70% and 95% ethanol solutions), followed by air drying and exposure to Kodak BioMax MR-1 film. After 28 days of exposure, the film was developed. Based on these results, brain sections that showed positive hybridization signals were coated with Kodak NTB-2 nuclear track emulsion and the slides were stored in the dark for four months. The slides were then developed and counterstained with hematoxylin. Emulsion-coated sections were analyzed microscopically to determine the specificity of labeling. The signal was determined to be specific if autoradiographic grains (generated by antisense probe hybridization) were present over cell bodies and not trapped between cell bodies. Specific labeling with the antisense probe occuπed in all cortical regions, including the piriform cortex and hippocampus. The specificity of labeling was confirmed by microscopic analysis of emulsion-coated cryosections. These sections revealed that the autoradiographic grains resulting from antisense riboprobe in situ hybridizations were distributed over cell bodies rather than trapped between cell bodies. The observed distribution of CONl 03 mRNA in the cortical and paralimbic regions ofthe mammalian brain suggests that ligands for this GPCR may be involved in signal transductions important for cellular processes underlying neurological functioning. In addition, expression of CON 103 in the brain provides an indication that modulators of CONl 03 activity have utility for treating neurological and neuropsychiatric disorders, including but not limited to, schizophrenia, depression, anxiety, attention deficit disorder (with or without hyperactivity), bipolar disease, epilepsy, migraine, neuritis, neurasthenia, neuropathy, neuroses, obesity,
Parkinson's disease, other dementias, and the like. Use of CONl 03 modulators, including CON103 ligands and anti-CON103 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
D. CON203
CON203-specific cRNA probes were prepared using conventional techniques. Initially, a 293 bp fragment of the CON203 coding region, with a BamHX site and an EcoRI site disposed on opposite ends, was prepared by PCR using primers LW1314 (5'-GCATGAATTCCCACCTTCATCATCTACCTC-3'; SΕQ ID NO: 40) and LW1315 (5'-GCATGGATCCGAAGACCAAAAAGACCCAG-3'; SΕQ ID NO:
41). LW1314 includes an EcoRT site and additional protective residues at its 5' terminus, with the test of the sequence coπesponding to CON203 coding nucleotides 164- 183, which con cspond to positions 309-328 of SEQ ID NO 7 LW1315 includes 5' protective nucleotides and a Bamtil site, with the rest of the sequence coπesponding to the complement of CON203 coding nucleotides 438-456, which coπespond to positions 583-601 of SEQ ID NO 7 The PCR-amphfied fragment was then digested with Bamtil and EcoRI and ligated into the coπesponding sites of pBluescript II to yield pCon203 BS The recombinant clone was then linearized either with BamtiX or EcoRI Linearization with BamTXX provided a substrate for in vitro expression of a sense-strand cRNA probe using the vector-borne T7 promoter Digestion with EcoRX was used to provide a substrate for in vitro transcription using the vector-borne T3 promoter to generate an anti-sense cRNA probe In vitro transcriptions were performed in the presence of [35S] UTP, thereby yielding sense- and anti-sense strand riboprobes having specific radioactivities of 5 38 x 107 cpm pmol and 5 34 x 107 cpm/pmol, respectively Hybndization with the riboprobes and subsequent washing ofthe slides was earned out as described above for CONl 93 m Example 3 A Subsequently, the slides were exposed to Kodak BioMax MR-1 film After 9 days of exposure, the film was developed Based on these results, bram sections that gave nse to positive hybndization signals were coated with Kodak NTB-2 nuclear track emulsion and the slides were stored in the dark for 25 days The slides were then developed as described above for CON193 in Example 3A
Specific labeling with the antisense probe occuπed in several hmbic and parahmbic regions, as well as areas thought to be involved in voluntary motor control In particular, the probe hybridized to CON203 mRNAs in the following regions ofthe bra cortical regions, including the pinform cortex, neostπatum, lateral olfactory tract, hypothalamic nuclei, bed nucleus ofthe stria terminahs, amygdala, hippocampus, reticular thalamus and other thalamic regions, subthalamic nucleus, and the red nucleus The specificity of labeling was confirmed by microscopic analysis of emulsion-coated cryosections These sections revealed that the autoradiographic grains resulting from antisense nboprobe in situ hybridizations were distributed over cell bodies rather than trapped between cell bodies Confirming expression of CON203 mRNA, the sense-strand nboprobe did not show specific hybridization. The observed distribution of CON203 mRNA in the cortical (particularly, motor circuits) and paralimbic regions of the mammalian brain suggests that CON203 and the ligands for this GPCR may be involved in signal transductions important for cellular processes underlying neurological functioning. In addition, expression of CON203 in the brain provides an indication that modulators of
CON203 activity have utility for treating neurological disorders, including but not limited to, schizophrenia, depression, anxiety, bipolar disease, epilepsy, migraine, attention deficit disorder (with or without hyperactivity), neuritis, neurasthenia, neuropathy, neuroses, Parkinson's disease, dementia, obesity, and the like. Use of CON203 modulators, including CON203 ligands and anti-CON203 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
E. CON 198
A 266 bp fragment of CONl 98 containing EcoRI and BamTXX restriction sites was amplified from the full-length clone by PCR, using the primers
LW1308: 5 '-GCATGAATTC ACTCACTTCTCATCTCCTTC-3 ' (SΕQ XD NO: 46) and LW1309:5'-GCATGGATCCAATCTCCTTTGTCTTCACTC-3' (SΕQ ID NO: 47) Primer LW1308 contains an EcoRI site (underlined) followed by sequence identical to nucleotides 638-657 of SΕQ XD NO: 9. Primer LW1309 contain a BamTXX site (underlined) followed by sequence complementary to nucleotides 903-884 of SΕQ
ID NO: 9. The amplification product was digested with EcoRI and BamTXX, and then subcloned into an EcoRI- and ifømHI-digested pBluescript H vector (Stratagene). The 266 amplified and subcloned basepairs coπespond to nucleotides 638 to 903 of SΕQ ID NO: 9. The subcloned CON198-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments. The construct was linearized with BamtiX, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes. The riboprobes were labeled with 3S-UTP to yield a specific activity of 0.45 x 106 cpm/pmol for antisense and 0.732 x 106 cpm/pmol for sense probe. Hybridization with the riboprobes and subsequent washing of the slides was carried out as described above for CON 193 in Example 3A.
Specific labeling with the antisense probe showed distribution of CON 198 mRNA in the rat brain in several limbic and paralimbic regions as well as areas thought to be involved in voluntary motor control. Labelled regions included cortical regions, piriform cortex, hypothalamic nuclei (paraventricular nucleus, supraoptic nucleus, suprachiasmatic nucleus), hippocampus, reticular thalmus, substantia nigra-pars compacta (SN-C), ventral tegmental area, and the red nucleus. The specificity of labeling was confirmed by microscopic analysis of emulsion coated sections. These sections revealed that the autoradiographic grains generated by the antisense probe were distributed over cell bodies rather than trapped between cell bodies. Sense probe did not generate specific labeling.
The observed regional distribution of CONl 98 mRNA provides a therapeutic indication for natural ligands for CONl 98 as well as modulators of CON198 activity, such as anti-CON198 antibody substances or small molecules that agonize or antagonize ligand-mediated CON 198 signalling. In particular, the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, depression, anxiety, bipolar disease, affective disorders, ADHD/ ADD, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzheimer's disease,
Parkinson's disease, migraine, senile dementia, and the like. Use of CONl 98 modulators, including CON198 ligands and anti-CON198 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention. Such modulators are administered by any means effective to safely deliver the modulators to the CON198-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or caπier. Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that correlates with disease severity or treatment efficacy. F. CON 197
A 261 bp fragment of CON 197 containing EcoRI and Bamtil restriction sites was amplified from the full-length clone by PCR, using the primers LW 1306: 5'-GCATGAATTCTTCTACTTCATCATCCTCC-3' (SΕQ ID NO: 50) and LW 1307: 5'-GCATGGATCCAAAGGCCATCACAACAAG-3' (SΕO ID NO: 51).
Primer LW 1306 includes sequence identical to nucleotides 100- 1 18 of SΕQ ID NO: 1 1 (underlined), preceded by an EcoRI site. Primer LW1307 includes sequence complementary to nucleotides 361-343 of SΕQ TD NO: 1 1 (underlined), preceded by a Bamtil restriction site. The amplification product was digested with EcoRI and Bamtil, and then subcloned into an EcoRI- and ifømHI-digested pBluescript II vector
(Stratagene). The 261 amplified and subcloned basepairs coπespond to nucleotides 100 to 361 of SΕQ TD NO: 11.
The subcloned CON197-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments. The construct was linearized with BamtiX, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes. The riboprobes were labeled with 35S-UTP to yield a specific activity of 0.51 x 106 cpm/pmol for antisense and 0.432 x 106 cpm/pmol for sense probe. Hybridization with the riboprobes and subsequent washing ofthe slides was carried out as described above for CONl 93 in Example 3 A.
Specific labeling with the antisense probe showed wide spread distribution of CONl 97 mRNA in the rat brain. Labelled regions included neo and allo cortex, piriform cortex, neostriatum, thalamic nuclei, hypothalamic nuclei, hippocampus, amygdala, cerebellum, and the olfactory bulb. The specificity of labeling was confirmed by microscopic analysis of emulsion coated sections. These sections revealed that the autoradiographic grains generated by the antisense probe were distributed over cell bodies rather than trapped between cell bodies. Sense probe did not generate specific labeling.
The observed regional distribution of CON 197 mRNA provides a therapeutic indication for natural ligands for CON 197 as well as modulators of
CON 197 activity, such as anti-CON197 antibody substances or small molecules that agonize or antagonize ligand-mediated CON197 signalling. In particular, the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to dementia, schizophrenia, depression, anxiety, bipolar disease, migraine, Parkinson's disease, affective disorders, Alzheimer's disease, senile dementia, attention deficit hyperactivity disorder/attention deficit disorder (ADHD/ADD), epilepsy, neuritis, neurasthenia, neuropathy, neuroses, and the like. Use of CON 197 modulators, including CON 197 ligands and anti-CON197 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention. Such modulators are administered by any means effective to safely deliver the modulators to the CON 197- expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or carrier. Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that coπelates with disease severity or treatment efficacy.
G. CON202
A 272 bp fragment of CON202 containing EcoRI and BamHI restriction sites was amplified from the full-length clone by PCR, using the primers LW1310 GCATGAATTCGCAGAAGAAGGCTATTGG (SEQ ID NO: 56) and
LW1311 GCATGGATCCGCAGTAAAGAAGGGTTGTG (SEQ ID NO: 57). The amplification product was digested withJEcoRI and BamHI, and then subcloned into a pBluescript II vector (Strategene) that was digested with EcoRI and BamHI. The 272 amplified and subcloned basepairs coπespond to nucleotides 1065 to 1336 of SEQ ID NO: 13.
The subcloned CON202-Bluescript constiiict was used to generate strand-specific probes for the in situ hybridization experiments. The construct was linearized with BamHI, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes. The riboprobes were labeled with 5S-UTP to yield a specific activity of 4.7 x 105 cpm/pmol for antisense and 4.3 x lO3 cpm/pmol for sense piobe Hybndization with the πbopiobcs and subsequent washing of the slides was earned out as described above foi CON 193 in Example 3A
Specific labeling with the antisense probe showed wide spread distribution of CON202 mRNA in the rat brain Labelled regions included the cortical regions, lateral olfactory nuclei, hippocampus, subthalamic nucleus, and at a lower level, the nigra-pars compacta
The observed regional distribution of CON202 mRNA provides a therapeutic indication for natural ligands for CON202 as well as modulators of CON202 activity, such as antι-CON202 antibody substances or small molecules that agomze or antagonize hgand-mediated CON202 signaling In particular, the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuntis, neurasthenia, neuropathy, neuroses, Alzheimer's disease, Parkinson's disease, migraine, senile dementia and the like Use of CON202 modulators, including CON202 ligands and antι-CON202 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention Such modulators are administered by any means effective to safely deliver the modulators to the CON202-expressιng cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or caπier Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that coπelates with disease severity or treatment efficacy
H. CON222
A 264 bp fragment of CON222 containing EcoRI and BamHI restriction sites was amplified from the full-length clone by PCR, using the primers LW1472 (5OCAT \ATTCTGCCATGTCAATCATTTCTCTC3', SEQ XD NO 62, EcoRI site is underlined) and LW1473 (5'GCATGGATCCGTTCTGCATTTTCC-
AGGTCTC3', SEQ ID NO 63, BamHI site is underlined) The amplification product was digested with EcoRI and BamHI, and then subcloned into a predigested pBluescript H vector (Stratagene). The 264 ampli fied and subcloned basepairs correspond to nucleotides 237 to 500 of SEQ ID NO: 15.
The subcloned CON222-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments. The construct was linearized with BamHI, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes. The riboprobes were labeled with 35S-UTP to yield a specific activity of 4.25 x 105 cpm/pmol for antisense and 3.9 x 105 cpm/pmol for sense probe. Hybridization with the riboprobes and subsequent washing ofthe slides was caπied out as described above for CON 193 in Example 3 A.
Specific labeling with the antisense probe showed wide spread distribution of CON222 mRNA in the rat brain. Labelled regions included the cortical regions, piriform cortex, striatum, hippocampus, thalamus, hypothalamus, dorsal raphe, and habenula.
The observed regional distribution of CON222 mRNA provides a therapeutic indication for natural ligands for CON222 as well as modulators of CON222 activity, such as anti-CON222 antibody substances or small molecules that agonize or antagonize ligand-mediated CON222 signaling. In particular, the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzhemeimer's disease, Parkinson's Disease, migraine, senile dementia, and the like. Use of CON222 modulators, including CON222 ligands and anti-CON222 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention. Such modulators are administered by any means effective to safely deliver the modulators to the CON222-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or caπier. Efficacy of treatment can initially be determined in any accepted animal model that provides a - I l l - biochemical or behavioral marker that correlates with disease severity or treatment efficacy.
I. CON215 A 261 bp fragment of CON215 containing EcoRI and BamtiX restriction sites was amplified from the full-length clone by PCR, using the primers LW 141 1 : 5'-GCATGAATTCTGCCAAACATCATCCTGAC-3' (SΕQ ID NO: 64) and LW1412: 5'-GCATGGATCCTACACAGCCACAACAACCC-3' (SΕQ ID NO: 65). Primer LW1411 contains an EcoRI site (underlined) followed by sequence identical to CON215 coding nucleotides 521-537, which correspond to positions 533-
549 of SΕQ ID NO: 17. Primer LW1412 contain a BamtiX site (underlined) followed by sequence complementary to CON215 coding nucleotides 764-781, which coπespond to positions 776-793 of SΕQ TD NO: 17. The amplification product was digested with EcoRI and BamtiX, and then subcloned into an EcoRI- and BamtiX- digested pBluescript II vector (Stratagene). The 261 amplified and subcloned basepairs coπespond to nucleotides 521 to 781 of SΕQ ID NO: 17.
The subcloned CON215-Bluescript construct was used to generate strand-specific probes for the in situ hybridization experiments. The construct was linearized with BamtiX, for labeling with T7 polymerase (sense), or EcoRI, for T3 polymerase (antisense), and used as a template for in vitro transcription of sense and antisense cRNA riboprobes. The riboprobes were labeled with 35S-UTP to yield a specific activity of 48.03 x 106 cpm/pmol for antisense and 48.09 x 106 cpm/pmol for sense probe. Hybridization with the riboprobes and subsequent washing ofthe slides was carried out as described above for CONl 93 in Example 3 A. Subsequently, the slides were exposed to Kodak BioMax MR-1 film.
After 9 days of exposure, the film was developed. Slides containing sections that showed a hybridization signal on film autoradiograms were coated with Kodak NTB-2 nuclear track emulsion and stored in the dark for 25 days. The slides were then developed as described above for CON 193 in Example 3 A. Specific labeling with the antisense probe showed distribution of
CON215 mRNA in the rat brain in limbic endocrine and motor circuits. Specifically, CON215 mRNA was present in the cortex, hippocampus, and red nucleus. The specificity of labeling was confirmed by microscopic analysis of emulsion coated sections. These sections revealed that the autoradiographic grains generated by the antisense probe were distributed over cell bodies rather than trapped between cell bodies. Sense probe did not generate specific labeling.
The observed regional distribution of CON215 mRNA provides a therapeutic indication for natural ligands for CON215 as well as modulators of CON215 activity, such as anti-CON215 antibody substances or small molecules that agonize or antagonize ligand-mediated CON1215 signaling. In particular, the expression pattern provides an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, depression, anxiety, bipolar disease, epilepsy, migraine, attention deficit (with or without hyperactive disorder), neuritis, neuasthenia, neuropathy, neuroses, Parkinson's disease, dementia, obesity, and the like. Use of CON215 modulators, including CON215 ligands and anti-CON215 antibodies, to treat individuals having such disease states is intended as an aspect ofthe invention.
Such modulators are administered by any means effective to safely deliver the modulators to the CON215-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or carrier. Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that coπelates with disease severity or treatment efficacy.
J. CON 217
Two oligonucleotides were designed based on SEQ ID NO: 19 and obtained from Sigma-Genosys (St. Louis, MO) to use as probes for in situ hybridization. The first oligonucleotide, designated 217A, has the sequence 5TAGGTCGGTAGTCAGGACACGGGAGAACAGAACTGTTGGTTGA3' (SEQ TD NO: 68) which is complementary to nucleotides 102 to 60 of SEQ TD NO: 19. The second oligonucleotide, designated 217B, has the sequence 5'GCCCCTGTGGCGGTTTAGATCCAGAATGCCCATTTTCTGTTCCATCTAAC CA3' (SEQ ID NO: 69) which coπesponds to the complement of nucleotides 1530 to 1479 of SEQ ID NO: 17. Both oligonucleotides, 217A and 217B, were reconstituted with lx TE buffer to a concentration of 20 pMol/ml and labeled with 3P-dATP to yield a specific activity of 2.08 x 10° and 1.53 x 106 cpm/ml, respectively.
Hybridization was caπied out at 37°C overnight as described above for CONl 93 in Example 3 A. Following the hybridizations, the coverslips were washed off the slides with lx SSC for 45 minutes. The slides were then washed for 20 minutes at room temperature in lx SSC followed by three high stringency washes in lx SSC at 65°C. After washing, the slides were dehydrated with 70%, 95%, and
100% ethanol containing 0.3 mM NH4OAc, air-dried, and exposed to Kodak BioMax MR-1 film. After 21 days of exposure, the film was developed. Based on these results, sections that showed a hybridization signal on film autoradiography were coated with Kodak NTB-2 nuclear track emulsion and stored in the dark for 42 days. The slides were then developed and counterstained with hematoxylin. Emulsion- coated sections were analyzed microscopically to determine the specificity of labeling. The signal was judged to be specific if autoradiographic grains (generated by antisense probe hybridization) were associated clearly with crystal violet stained cell bodies. Autoradiographic grains found between cell bodies were deemed non- specific.
Specific labeling with the antisense probe showed wide spread distribution of CON217 mRNA in the rat brain. Labelled regions included the cortex, piriform cortex, hippocampus, cerebellum, medulla, spinal cord, temporal lobe, putamen, substantia nigra and thalamus. The observed regional distribution of CON217 mRNAs provide a therapeutic indication for natural ligands for these G protein-coupled receptors as well as modulators of their activity, such as anti-CON217 antibody substances or small molecules that mimic, agonize or antagonize ligand-mediated CON217 signaling. In particular, the expression patterns provide an indication that such molecules will have utility for treating neurological and/or psychiatric diseases, including but not limited to schizophrenia, affective disorders, attention deficit hyperactivity disorder/attention deficit disorder, depression, anxiety, bipolar disease, epilepsy, neuritis, neurasthenia, neuropathy, neuroses, Alzhemeimer's disease, Parkinson's Disease, migraine, senile dementia, and the like. Use of CON217 polypeptide modulators, including CON217 ligands and anti-CON217 polypeptide antibodies, to treat individuals having such disease states is intended as an aspect of the invention. Such modulators are administered by any means effective to safely deliver the modulators to the GPCR polypeptide-expressing cells, including but not limited to oral administration, inhalation, or injection of compositions comprising the modulators in a pharmaceutically acceptable diluent, adjuvant, or caπier. Efficacy of treatment can initially be determined in any accepted animal model that provides a biochemical or behavioral marker that coπelates with disease severity or treatment efficacy.
EXAMPLE 4 Recombinant Expression of GPCR Polypeptides in Eukaryotic Host Cells To produce GPCR protein, a GPCR polypeptide-encoding polynucleotide is expressed in a suitable host cell using a suitable expression vector, using standard genetic engineering techniques. For example, one ofthe GPCR polypeptide-encoding sequences described in Example 1 (such as SEQ TD NOS: 1, 3, 5, 7, 9, 11, 13, 15, 17 or 19) is subcloned into the commercial expression vector pzeoSV2 (Invitrogen, San Diego, CA) and transfected into Chinese Hamster Ovary
(CHO) cells (ATCC CRL-1781) using the transfection reagent fuGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert. Additional eukaryotic cell lines, such as African Green Monkey Kidney cells (COS- 7, ATCC CRL-1651) or Human Kidney cells (HEK 293, ATCC CRL-1573), may be used as well. Cells stably expressing a GPCR polypeptide (e.g., CONl 93, CONl 66,
CON103, CON203, CON198, CON197, CON202, CON222, CON215, or CON217) are selected by growth in the presence of 100 mg/ml zeocin (Stratagene, LaJolla, CA). Optionally, GPCR polypeptide is purified from the cells using standard chromatographic techniques. To facilitate purification, antisera is raised against one or more synthetic peptide sequences that coπespond to portions of the GPCR amino acid sequence, and the antisera is used to affinity purify GPCR polypeptides. The GPCR gene also may be expressed in frame with a tag sequence (e.g., polyhistidine, hemaggluttinin, FLAG) to facilitate purification. Moreover, it will be appreciated that many of the uses for GPCR polypeptides, such as assays described below, do not require purification of GPCR polypeptides from the host cell.
EXAMPLE 5 Antibodies to GPCR Polypeptides Standard techniques are employed to generate polyclonal or monoclonal antibodies to the GPCR receptors (e.g., CON193, CON166, CON 103, CON203, CON198, CON197, CON202, CON222, CON215, or CON217), and to generate useful antigen-binding fragments thereof or variants thereof, including "humanized" variants. Such protocols can be found, for example, in Sambrook et al, Molecular Cloning: a Laboratory Manual. Second Edition, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory (1989); Harlow et al. (Eds), Antibodies A Laboratory Manual; Cold Spring Harbor Laboratory; Cold Spring Harbor , NY
(1988); and other documents cited below. In one embodiment, recombinant GPCR polypeptides (or cells or cell membranes containing such polypeptides) ofthe invention are used as an antigen to generate the antibodies. In another embodiment, one or more peptides having amino acid sequences coπesponding to an immunogenic portion of a GPCR polypeptide (e.g., 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19,
20, or more amino acids) are used as antigen. Peptides coπesponding to extracellular portions of GPCR polypeptides, especially hydrophilic extracellular portions, are prefeπed. The antigen may be mixed with an adjuvant or linked to a hapten to increase antibody production.
A. Polyclonal or Monoclonal antibodies
As one exemplary protocol, a recombinant GPCR polypeptide or synthetic fragment thereof is used to immunize a mouse for generation of monoclonal antibodies (or larger mammal, such as a rabbit, for polyclonal antibodies). To increase antigenicity, peptides are conjugated to Keyhole Lympet Hemocyanine
(Pierce), according to the manufacturer's recommendations. For an initial injection, the antigen is emulsified with Freund's Complete Adjuvant and injected subcutaneously. At intervals of two to three weeks, additional aliquots of GPCR antigen are emulsified with Freund's Incomplete Adjuvant and injected subcutaneously. Prior to the final booster injection, a serum sample is taken from the immunized mice and assayed by Western blot to confirm the presence of antibodies that immunoreact with GPCR polypeptide. Serum from the immunized animals may be used as a polyclonal antisera or used to isolate polyclonal antibodies that recognize GPCR polypeptide. Alternatively, the mice are sacrificed and their spleen removed for generation of monoclonal antibodies. To generate monoclonal antibodies, the spleens are placed in 10 ml serum-free RPMI 1640, and single cell suspensions are formed by grinding the spleens in serum-free RPMI 1640, supplemented with 2 mM L-glutamine, 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 μg/ml streptomycin (RPMI) (Gibco, Canada). The cell suspensions are filtered and washed by centrifugation and resuspended in serum-free RPMI. Thymocytes taken from three naive Balb/c mice are prepared in a similar manner and used as a Feeder Layer. NS-1 myeloma cells, kept in log phase in RPMI with 10% fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, are centrifuged and washed as well. To produce hybridoma fusions, spleen cells from the immunized mice are combined with NS-1 cells and centrifuged, and the supernatant is aspirated. The cell pellet is dislodged by tapping the tube, and 2 ml of 37°C PEG 1500 (50% in 75mM Hepes, pH 8.0) (Boehringer Mannheim) is stiπed into the pellet, followed by the addition of serum-free RPMI. Thereafter, the cells are centrifuged and resuspended in RPMI containing 15% FBS, 100 μM sodium hypoxanthine, 0.4 μM aminopterin, 16 μM thymidine (HAT) (Gibco), 25 units/ml of 1L-6 (Boehringer
Mannheim) and 1.5 x 106 thymocytes/ml and plated into 10 Corning flat-bottom 96-well tissue culture plates (Corning, Coming New York).
On days 2, 4, and 6, after the fusion, 100 μl of medium is removed from the wells ofthe fusion plates and replaced with fresh medium. On day 8, the fusions are screened by ELISA, testing for the presence of mouse IgG that binds to a GPCR polypeptide. Selected fusion wells are further cloned by dilution until monoclonal cultures producing anti-GPCR polypeptide antibodies are obtained.
B. Humanization of Anti-GPCR Monoclonal Antibodies The expression patterns of GPCR polypepties as reported herein and the proven track record of GPCR's as targets for therapeutic intervention suggest therapeutic indications for GPCR polypeptide inhibitors (antagonists). GPCR polypeptide-neutralizing antibodies comprise one class of therapeutics useful as antagonists. Following are protocols to improve the utility of anti-GPCR polypeptide monoclonal antibodies as therapeutics in humans, by "humanizing" the monoclonal antibodies to improve their serum half-life and render them less immunogenic in human hosts (i.e., to prevent human antibody response to non-human anti-GPCR polypeptide antibodies).
The principles of humanization have been described in the literature and are facilitated by the modular aπangement of antibody proteins. To minimize the possibility of binding complement, a humanized antibody ofthe IgG4 isotype is prefeπed.
For example, a level of humanization is achieved by generating chimeric antibodies comprising the variable domains of non-human antibody proteins of interest with the constant domains of human antibody molecules. (See, e.g.,
Moπison and Oi, Adv. Immunol, 44:65-92 (1989). The variable domains of GPCR- neutralizing anti-GPCR antibodies are cloned from the genomic DNA of a B-cell hybridoma or from cDNA generated from mRNA isolated from the hybridoma of interest. The V region gene fragments are linked to exons encoding human antibody constant domains, and the resultant construct is expressed in suitable mammalian host cells (e.g., myeloma or CHO cells).
To achieve an even greater level of humanization, only those portions ofthe variable region gene fragments that encode antigen-binding complementarity determining regions ("CDR") ofthe non-human monoclonal antibody genes are cloned into human antibody sequences. [See, e.g., Jones et al, Nature, 321:522-525
(1986); Riechmann et al, Nature, 332:323-327 (1988); Verhoeyen et al, Science, 239: 1534-36 (1988); and Tempest et al, Bio/Technology. 9:266-71 ( 1991). If necessary, the β-sheet framework of the human antibody surrounding the CDR3 regions also is modified to more closely mirror the three dimensional structure of the antigen-binding domain of the original monoclonal antibody. (See Kettleborough et al, Protein Engin., 4:773-783 ( 1991 ); and Foote et al, J. Mol. Biol, 224:4X7-499
(1992).
In an alternative approach, the surface of a non-human monoclonal antibody of interest is humanized by altering selected surface residues ofthe non-human antibody, e.g., by site-directed mutagenesis, while retaining all ofthe interior and contacting residues of the non-human antibody. See Padlan, Molecular
Immunol, 28(4/5):489-98 (1991).
The foregoing approaches are employed using GPCR-neutralizing anti-GPCR monoclonal antibodies and the hybridomas that produce them to generate humanized GPCR-neutralizing antibodies useful as therapeutics to treat or palliate conditions wherein GPCR expression or ligand-mediated GPCR signaling is detrimental.
C. Human GPCR-Neutralizing Antibodies from Phage Display
Human GPCR-neutralizing antibodies are generated by phage display techniques such as those described in Aujame et al, Human Antibodies, 8(4):X 55-168
(1997); Hoogenboom, TIBTECH. 15:62-70 (1997); and Rader et al, Curr. Opin. Biotechnol, 5:503-508 (1997), all of which are incoφorated by reference. For example, antibody variable regions in the form of Fab fragments or linked single chain Fv fragments are fused to the amino terminus of filamentous phage minor coat protein pill. Expression of the fusion protein and incoφoration thereof into the mature phage coat results in phage particles that present an antibody on their surface and contain the genetic material encoding the antibody. A phage library comprising such constructs is expressed in bacteria, and the library is panned (screened) for GPCR-specific phage-antibodies using labelled or immobilized GPCR polypeptide as antigen-probe. D. Human GPCR-Neutralizing Antibodies Irom Transgenic Mice
Human GPCR-neutralizing antibodies ate generated in tiansgenic mice essentially as descπbed in Bruggemann and Ncubcrgei, Immunol Today, 17(8) 391-97 (1996) and Bruggemann and Taussig, Curr Opin Biotechnol , 8 455-58 ( 1997) Transgenic mice caπying human V-gene segments in germlme configuration and that express these transgenes in their lymphoid tissue are immunized with a GPCR composition using conventional immunization protocols Hybridomas are generated using B cells from the immunized mice using conventional protocols and screened to identify hybndomas secreting anti-GPCR human antibodies (e g , as described above)
EXAMPLE 6 Assays to Identify Modulators of GPCR Polypeptide Activity
Set forth below are assays for identifying modulators (agonists and antagonists) of GPCR polypeptide activity Among the modulators that can be identified by these assays include natural ligand compounds of the receptor, synthetic analogs and derivatives of natural ligands, antibodies, antibody fragments, and/or antibody-like compounds deπved from natural antibodies or from antibody-like combinatoπal hbranes; and/or synthetic compounds identified through high throughput screening of hbranes, and the like All modulators that bind GPCR polypeptide are useful for identifying GPCR polypeptide in tissue samples (e g , for diagnostic puφoses, pathological puφoses, and the like) Agonist and antagonist modulators are useful for up-regulating and down-regulating GPCR polypeptide activity, respectively, to treat disease states characterized by abnormal levels of GPCR polypeptide activity GPCR polypeptide binding molecules also may be used to deliver a therapeutic compound or a label to cells that express GPCR polypeptide (e g , by attaching the compound or label to the binding molecule) The assays may be performed using single putative modulators, and/or may be performed using a known agonist in combination with candidate antagonists (or visa versa) Performance ofthe assays using any of the GPCR polypeptides ofthe invention described herein (e g , CON193, CON166, CON103, CON203, CON198, CON197, CON202, CON222, CON215, or CON217) is contemplated. It will be appreciated that co-transfecting cells with two or more of the receptors for simultaneous screening also is possible.
A. cAMP Assays
In one type of assay, levels of cyclic adenosine monophosphate (cAMP) are measured in GPCR-transfected cells that have been exposed to candidate modulator compounds. Protocols for cAMP assays have been described in the literature. [See, e.g., Sutherland et al, Circulation, 37: 279 (1968); Frandsen, E.K. and Krishna, G, Life Sciences, 18: 529-541 (1976); Dooley et al, Journal of
Pharmacology and Experimental Therapeutics, 283 (2): 735-41 (1997); and George et al. Journal of Biomolecular Screening, 2 (4): 235-40 (1997).] An exemplary protocol for such an assay, using an Adenylyl Cyclase Activation FlashPlate® Assay from NEN™ Life Science Products, is set forth below. Briefly, the GPCR coding sequence (e.g., a cDNA or intronless genomic DNA) is subcloned into a commercial expression vector, such as pzeoSV2 (Invitrogen, San Diego, CA), and transiently transfected into Chinese Hamster Ovary (CHO) cells using known methods, such as the transfection reagent FuGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert. The transfected CHO cells are seeded into the 96 well microplates from the FlashPlate® assay kit, which are coated with solid scintillant to which antisera to cAMP has been bound. For a control, some wells are seeded with wild type (untransfected) CHO cells. Other wells on the plate receive various amounts of cAMP standard solution for use in creating a standard curve. One or more test compounds are added to the cells in each well, with water and/or compound-free media/diluent serving as a control. After treatment, cAMP is allowed to accumulate in the cells for exactly 15 minutes at room temperature. The assay is terminated by the addition of lysis buffer containing [125TJ- labelled cAMP, and the plate is counted using a Packard Topcount™ 96-well microplate scintillation counter. Unlabelled cAMP from the lysed cells (or from standards) competes with the fixed amounts of [125I]-cAMP for antibody bound to the plate. A standard curve is constructed, and cAMP values for the unknowns are obtained by interpolation. Changes in intracellular cAMP level of the cells in response to exposure to a test compound are indicative of GPCR polypeptide modulating activity. Modulators that act as agonists at receptors which couple to the Gs subtype of G-proteins will stimulate production of cAMP, leading to a measurable 3-10 fold increase. Receptor agonists which couple to the Gi/o subtype of G-proteins will inhibit forskolin-stimulated cAMP production, leading to a measurable decrease of 50-100%). Modulators that act as inverse agonists will reverse these effects at receptors that are either constitutively active or activated by known agonists.
B. Aequorin Assays
In another assay cells (e.g., CHO cells) are transiently co-transfected with both a GPCR expression construct and a construct that encodes the photoprotein apoaequorin. In the presence ofthe cofactor coelenterazine, apoaequorin will emit a measurable luminescence that is proportional to the amount of intracellular
(cytoplasmic) free calcium. [See generally Cobbold P.H. and Lee, J.A.C. "Aequorin measurements of cytoplasmic free calcium. In: McCormack J.G. and Cobbold P.H., eds., Cellular Calcium: A Practical Approach. Oxford:IRL Press (1991); Stables et al, Analytical Biochemistry, 252: X 15-26 (1997); and Haugland, R.P. Handbook of Fluorescent Probes and Research Chemicals. Sixth edition. Eugene OR: Molecular
Probes (1996).]
In one exemplary assay, a GPCR-encoding polynucleotide is subcloned into the commercial expression vector pzeoSV2 (Invitrogen, San Diego, CA) and transiently co-transfected along with a construct that encodes the photoprotein apoaequorin (Molecular Probes, Eugene, OR) into CHO cells using the transfection reagent FuGENE 6 (Boehringer-Mannheim) and the transfection protocol provided in the product insert.
The cells are cultured for 24 hours at 37°C in αMEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% FBS, 2 mM glutamine, 10 U/ml of penicillin and 10 μg/ml of streptomycin. Subsequently, the media is changed to serum-free αMEM containing 5 μM coelenterazine (Molecular Probes, Eugene, OR), and the cells are cultured for two additional hours at 37°C. Cells are then detached from the plate using VERSEN (Gibco/BRL), washed and resuspended at 2 x 103 cells/ml in serum-free αMEM.
Dilutions of candidate GPCR modulator drugs are prepared in serum- free αMEM and dispensed into wells of an opaque 96-well assay plate, 50 μl/well.
Plates are loaded onto an MLX microtiter plate luminometer (Dynex Technologies, Inc., Chantilly, VA). The instrument is programmed to dispense 50 μl of cell suspension into each well, one well at a time, and immediately read luminescence for 15 seconds. Dose-response curves for the modulator candidates are constructed using the area under the curve for each light signal peak. Data are analyzed with
SlideWrite, using the equation for 1 -site ligand, and EC50 values are obtained. Changes in luminescence caused by the drugs are considered indicative of modulator/ activity. Modulators that act as receptor agonists which couple to the Gq subtype of G-proteins give an increase in luminescence of up to 100 fold. Modulators that act as inverse agonists will reverse this effect at receptors that are either constitutively active or activated by known agonists.
C. Luciferase Reporter Gene Assay
The photoprotein luciferase provides another useful tool for assaying for modulators of GPCR activity. Cells (e.g., CHO cells or COS 7 cells) are transiently co-transfected with both a GPCR expression construct (e.g., GPCR- encoding sequence in pzeoSV2 (Invitrogen, San Diego, CA)) and a reporter construct which includes a gene for the luciferase protein downstream from a transcription factor, either cAMP-response element (CRE), AP-1, or NF kappa B. Agonist binding to receptors coupled to the Gs subtype of G-proteins leads to increases in cAMP, activating the CRE transcription factor and resulting in expression ofthe luciferase gene. Agonist binding to receptors coupled to the Gq subtype of G-protein leads to production of diacylglycerol that activates protein kinase C. As a result, the AP-1 or NF kappa B transcription factors are activated which stimulate expression of the luciferase gene. Expression levels of luciferase reflect the activation status ofthe signaling events. [See generally George et al, Journal of Biomolecular Screening, 2(4): 235-40 ( 1997); and Stratowa et al. Current Opinion in Biotechnology, 6: 574-81 ( 1995).] Luciferase activity may be quantitatively measured using, e.g., luciferase assay reagents that are commercially available from Promega (Madison, Wl).
In one exemplary assay, CHO cells are plated in 24-wcll culture dishes at a density of 100,000 cells/well one day prior to transfection and cultured at 37°C in αMEM (Gibco/BRL, Gaithersburg, MD) supplemented with 10% FBS, 2 mM glutamine, 10 U/ml penicillin and 10 μg/ml streptomycin. Cells are transiently co-transfected with both a GPCR expression construct and a reporter construct containing the luciferase gene. The reporter plasmids CRE-luciferase, AP-1 -luciferase and NF kappa B-luciferase may be purchased from Stratagene (LaJolla, CA).
Transfections are performed using FuGENE 6 transfection reagent (Boehringer-Mannheim), and the protocol provided in the product insert. Cells transfected with the reporter construct alone are used as a control. Twenty-four hours after transfection, cells are washed once with phosphate buffered saline (PBS) pre-warmed to 37°C. Serum-free αMEM is then added to the cells either alone
(control) or with one or more candidate modulators and the cells are incubated at 37°C for five hours. Thereafter, cells are washed once with ice cold PBS and lysed by the addition of 100 μl of lysis buffer/well (from luciferase assay kit, Promega, Madison, WI). After incubation for 15 minutes at room temperature, 15 μl ofthe lysate is mixed with 50 μl substrate solution (Promega) in an opaque white 96-well plate, and the luminescence is read immediately on a Wallace model 1450 MicroBeta scintillation and luminescence counter (Wallace Instruments, Gaithersburg, MD).
Differences in luminescence in the presence versus the absence of a candidate modulator compound are indicative of modulatory activity. Receptors that are either constitutively active or activated by agonists give a 3-20 fold stimulation of luminescence compared to cells transfected with the reporter gene alone. Modulators that act as inverse agonists will reverse this effect.
D. Intracellular Calcium Measurement using FLIPR Changes in intracellular calcium levels are another recognized indicator of G protein-coupled receptor activity, and such assays can be employed to evaluate modulators of GPCR activity. For example, CHO cells stably transfected with a GPCR expression vector are plated at a density of 4 x I 04 cells/well in Packard black-walled 96-well plates specially designed to isolate fluorescent signal to individual wells. The cells are incubated for 60 minutes at 37°C in modified Dulbecco's PBS (D-PBS) containing 36 mg/L of pyruvate and 1 g/L of glucose with the addition of 1% FBS and one of four calcium indicator dyes (Fluo-3™ AM, Fluo- 4™ AM, Calcium Green™- 1 AM, or Oregon Green™ 488 BAPTA-1 AM) at a concentration of 4 μM. Plates are washed once with modified D-PBS without 1% FBS and incubated for 10 minutes at 37°C to remove residual dye from the cellular membrane. In addition, a series of washes with modified D-PBS without 1% FBS is performed immediately prior to activation ofthe calcium response.
Calcium response is initiated by the addition of one or more candidate receptor agonist compounds, calcium ionophore A23187 (10 μM), or ATP (4 μM). Fluorescence is measured by Molecular Device's FLIPR with an argon laser, excitation at 488 nm. [See, e.g., Kuntzweiler et al. Drug Development Research,
44(1): 14-20 (1998).] The F-stop for the detector camera was set at 2.5 and the length of exposure was 0.4 milliseconds. Basal fluorescence of cells was measured for 20 seconds prior to addition of agonist, ATP, or A23187, and was subtracted from the response signal. The calcium signal is measured for approximately 200 seconds, taking readings every two seconds. Calcium ionophore and ATP increase the calcium signal 200% above baseline levels. In general, activated oφhan GPCRs increase the calcium signal approximately 10-15% above baseline signal.
E. Mitogenesis Assay In mitogenesis assays, the ability of candidate modulators to induce or inhibit GPCR-mediated cell growth is determined. [See, e.g., Lajiness et al. Journal of Pharmacology and Experimental Therapeutics, 267(3): 1573-81 (1993).]
For example, CHO cells stably expressing a GPCR are seeded into 96- well plates at a density of 5000 cells/well and grown at 37°C in αMEM supplemented with 10% fetal calf serum. After 48 hours, the cells are rinsed twice with serum-free αMEM and 80 μl of fresh αMEM, or αMEM containing a known mitogen, is added along with 20 μl αMEM containing varying concentrations of one or more test compounds diluted in serum free media. As controls, some wells on each plate receive serum-free media alone, and some receive media containing 10% FBS. Untransfected cells or cells transfected with vector alone also may serve as controls. After culture for 16-18 hours, 1 μCi/well of [3H]-thymidine (2
Ci/mmol; cpm) is added to the wells and cells are incubated for an additional 2 hours at 37°C. The cells are trypsinized and harvested onto filter mats with a cell harvester (Tomtec) and the filters are counted in a Betaplate counter. The incoφoration of 3H- thymidine in semm-free test wells is compared to the results achieved in cells stimulated with serum. Use of multiple concentrations of test compounds permits creation and analysis of dose-response curves using the non-linear, least squares fit equation: A = B x [C7 (D + C)] + G where A is the percent of serum stimulation; B is the maximal effect minus baseline; C is the EC50; D is the concentration of the compound; and G is the maximal effect. Parameters B, C and G are determined by Simplex optimization.
Agonists that bind to the receptor are expected to increase [3H]-thymidine incoφoration into cells, showing up to 80% of the response to serum. Antagonists that bind to the receptor will inhibit the stimulation seen with a known agonist by up to 100%.
F. [ 5SlGTPvS Binding Assay
Because G protein-coupled receptors signal through intracellular "G proteins" whose activity involves GTP/GDP binding and hydrolysis. Another indicator of GPCR modulator activity is measuring binding of the non-hydrolyzable GTP analog [35S]GTPγS in the presence and absence of putative modulators. [See, e.g., Kowal, et al, Neuropharmacology, 37: 179-87 (1998).]
In one exemplary assay, cells stably transfected with a GPCR expression vector are grown in 10 cm dishes to subconfluence, rinsed once with 5 ml of ice cold Ca27Mg2+ free PBS, and scraped into 5 ml ofthe same buffer. Cells are pelleted by centrifugation (500 x g, 5 minutes), resuspended in TEE buffer (25 mM
Tris, 5 mM EDTA, 5 mM EGTA, pH 7.5) and frozen in liquid nitrogen. After thawing, the cells are homogenized using a dounce (one ml TEE per plate of cells), and centrifuged at 1,000 x g for 5 minutes to remove nuclei and unbroken cells. The homogenate supernatant is centrifuged at 20,000 x g for 20 minutes to isolate the membrane fraction. The membrane pellet is then washed once with TEE and resuspended in binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl,
10 mM MgCl2, 1 mM EDTA). The resuspended membranes can be frozen in liquid nitrogen and stored at -70°C until use.
Aliquots of cell membranes prepared as described above and stored at -70°C are thawed, homogenized, and diluted to a concentration of 10-50 μg/ml in buffer containing 20 mM HEPES, 10 mM MgCl2, 1 mM EDTA, 120 mM NaCl, 10 μM GDP, and 0.2 mM ascorbate. In a final volume of 90 μl, homogenates are incubated with varying concentrations of putative modulator compounds or 100 μM GTP for 30 minutes at 30°C and then placed on ice. To each sample, 10 μl guanosine 5'-O-(3[35S]thio) triphosphate (NEN, 1200 Ci/mmol), ([35S]-GTPγS), was added to a final concentration of 100-200 pM. Samples are incubated at 30°C for an additional
30 minutes. The reaction is then stopped by the addition of 1 ml of 10 mM HEPES, and 10 mM MgCl2 (pH 7.4), at 4°C, and filtration.
Samples are filtered over Whatman GF/B filters. These filters are washed with 20 ml ice-cold 10 mM HEPES (pH 7.4) and 10 mM MgCl2 and counted by liquid scintillation spectroscopy. Nonspecific binding of [35S]-GTPγS is measured in the presence of 100 μM GTP and subtracted from the total. Compounds are selected that modulate the amount of [ 5S]-GTPγS binding in the cells, compared to untransfected control cells. Activation of receptors by agonists gives up to a five-fold increase in [35S]GTPγS binding. This response is blocked by antagonists.
G. MAP Kinase Activity Assay
Evaluation of MAP Kinase activity in cells expressing a GPCR provide another assay to identify modulators of GPCR activity. [See, e.g., Lajiness et al, Journal of Pharmacology and Experimental Therapeutics, 267(3): 1573-81 (1993); and Boulton et al, Cell, 65: 663-75 (1991).] In one embodiment, CHO cells stably transfected with a GPCR- encoding polynucleotide are seeded into 6 well plates at a density of 70,000 cells/well 48 hours prior to the assay. During this time, the cells are cultured at 37°C in αMEM media supplemented with 10% FBS, 2 mM glutamine, 10 U/ml penicillin and 10 μg/ml streptomycin. The cells are serum starved for 1-2 hours prior to the addition of stimulants.
For the assay, the cells are treated with media alone or media containing a putative agonist or phorbal ester-myistoyl acetate (PMA) as a positive control. After treatment, cells are incubated at 37°C for varying times. To stop the reaction, the plates are placed on ice, the media is aspirated, and the cells are rinsed with 1 ml of ice-cold PBS containing 1 mM EDTA. Thereafter, 200 μl cell lysis buffer (12.5 mM MOPS (pH 7.3), 12.5 mM β-glycerophosphate, 7.5 mM MgCl2, 0.5 mM EGTA, 0.5 mM sodium vanadate, 1 mM benzamidine, 1 mM dithiothreitol, 10 μg/ml leupeptin, 10 μg/ml aprotinin, 2 μg/ml pepstatin A, and 1 μM okadaic acid) is added to the cells. The cells are scraped from the plates and homogenized by 10 passages through a 23 3/4 gauge needle. The cytosol fraction is prepared by centrifugation at 20,000 x g for 15 minutes.
Aliquots (5-10 μl containing 1-5 μg protein) of cytosols are mixed with 1 mM MAPK Substrate Peptide (APRTPGGRR; SEQ ID NO: 25); Upstate Biotechnology, hie, N.Y.) and 50 μM [γ-32P]ATP, (NEN, 3000 Ci/mmol) diluted to a final specific activity of -2000 cpm/pmol in a total volume of 25 μl. The samples are incubated for 5 minutes at 30°C, and reactions are stopped by spotting 20 μl on 2 cm2 of Whatman P81 phosphocellulose paper. The filter squares are washed in 4 changes of 1% H3PO4, and the squares are counted by liquid scintillation spectroscopy. Equivalent cytosolic extracts are incubated without MAPK substrate peptide, and the cpm from these samples are subtracted from the matched samples with the substrate peptide. The cytosolic extract from each well is used as a separate point. Protein concentrations are determined by a dye binding protein assay (Bio-Rad). Agonist activation of the receptor is expected to result in up to a five fold increase in MAPK enzyme activity. This increase is blocked by antagonists. H. |3H|Arachidonic Acid Release
The activation of GPCR's also has been observed to potentiate arachidonic acid release in cells, providing yet another useful assay for modulators of the activity of GPCR's ofthe present invention. [See, e.g., Kanteπnan et al, Molecular Pharmacology, 39: 364-9 (1991).] For example, CHO cells that are stably transfected with a GPCR expression vector are plated in 24-well plates at a density of 15,000 cells/well and grown in αMEM media supplemented with 10% FBS, 2 mM glutamine, 10 U/ml penicillin and 10 μg/ml streptomycin for 48 hours at 37°C before use. Cells of each well are labeled by incubation with [3H]arachidonic acid (Amersham Coφ., 210 Ci/mmol) at 0.5 μCi/ml in 1 ml αMEM supplemented with 10 mM HEPES (pH 7.5), and 0.5%> fatty-acid- ree bovine serum albumin for 2 hours at 37°C. The cells are then washed twice with 1 ml ofthe same buffer.
Candidate modulator compounds are added in 1 ml of the same buffer, either alone or containing 10 μM ATP (Adenosine 5'-triphosphate) and the cells are incubated at 37°C for 30 minutes. Buffer alone and mock transfected cells are used as controls. Samples (0.5 ml) from each well are counted by liquid scintillation spectroscopy. Agonists which activate the receptor will lead to potentiation ofthe ATP-stimulated release of [3H]-arachidonic acid. This potentiation is blocked by antagonists.
I. Extracellular Acidification Rate
In yet another assay, the effects of putative modulators of GPCR activity are assayed by monitoring extracellular changes in pH induced by the putative modulators. [See, e.g., Dunlop et al, Journal of Pharmacological and Toxicological Methods, 40(1): 47-55 (1998).]
CHO cells transfected with a GPCR expression vector are seeded into 12-mm capsule cups (Molecular Devices Coφ.) at 4 x 105 cells/cup in αMEM supplemented with 10%) FBS, 2 mM 1 -glutamine, 10 units/ml penicillin, and 10 μg/ml streptomycin. The cells are incubated in this media at 37°C in 5% CO2 for 24 hours. Extracellular acidification rates are measured using a Cytosensor microphysiometer (Molecular Devices Coφ.). The capsule cups are loaded into the sensor chambers of the microphysiometer and the chambers are perfused with running buffer (bicarbonate free αM EM supplemented with 4 mM 1 -glutamine, 10 units/ml penicillin, 10 μg/ml streptomycin, 26 mM NaCl) at a flow rate of 1 0 μl/min. Agonists or other agents are diluted into the running buffer and perfused through a second fluid path. During each 60 second pump cycle, the pump is run for 38 seconds and is off for the remaining 22 seconds. The pH of the running buffer in the sensor chamber is recorded during the cycle from 43-58 seconds, and the pump is re-started at 60 seconds to start the next cycle. The rate of acidification of the running buffer during the recording time is calculated by the Cytosoft program. Changes in the rates of acidification are calculated by subtracting the baseline value (the average of 4 rate measurements immediately before addition of modulator candidates) from the highest rate measurement obtained after addition of a modulator candidate. The selected instrument detects 61 mV/pH unit. Modulators that act as agonists at the receptor result in an increase in the rate of extracellular acidification as compared to the rate in the absence of agonist. This response is blocked by modulators which act as antagonists at the receptor.
EXAMPLE 7 Luciferase Reporter Gene Assays Luciferase reporter gene assays (essentially as described in Example 6) were caπied out to measure signaling activity ofthe GPCR receptors when coupled to Gs, Gi or Gq G-proteins. Activation of Gs coupled receptors results in stimulation of intracellualar cAMP production which leads to activation of the transcription factor cyclic AMP response element (CRE). Therefore activation of Gs coupled receptors can be detected by measuring transcription and translation ofthe reporter gene CRE- luciferase. The level of expression of the CRE reporter gene is dependent on the intracellular level of cAMP. Similarily, activation of Gs, Gi or Gq coupled receptors will result in activation ofthe AP-1 transcription factor. Expression ofthe AP-1 transcription factor can be attributed to changes in cAMP levels and/or increases in the levels of intracellular calcium and therefore can be an indication of G-protein coupled receptor activation. CHO 10001 A cells (Gottesman et al, Somatic Cell Genetics 6: 45-61 , 1980) were maintained in Minimal Essential Medium (MEM) supplemented with 10% FBS (Hyclone Laboratories, Inc., Logan, Utah) at 37°C in an atmosphere of 5% CO,. The cells were split 1 :5 twice a week for maintence. Plasmids used in the experiments were propogated in E.coli strain DH5 (Gibco BRL) and purified using the Qiagen Maxi-prep plasmid purification system according to the manufacturer's instructions.
One day prior to transfection, lxlO5 CHO cells/well were plated on 24 well culture plates and allowed to adhere overnight. Each well on the plate was transfected with 0.5 μg of either AP-1 luciferase (Stratagene,, LaJolla, CA) or CRE luciferase plasmid alone or in combination with 0.125 μg of a GPCR plasmid (GPCR DNA inserted into the pCDNA3 vector form Invitrogen). Cell were transiently transfected with the commercially available transfection reagent FUGENE-6 according the manufacturer's instructions (Boehringer Mannheim, Indianapolis, IN). Twenty- four hours after transfection, the cells were washed in PBS pre-warmed to 37°C. Agonists and antagonists were diluted in pre-warmed serum- free MEM, added to the transfected cells and incubated at 37°C, 5% CO2 for 5 hours. Subsequently, the cells were washed once in ice cold PBS and lysed with the addition of 100 μl of lysis buffer (Promega) to each well, fter a 15 minute incubation at room temperature, luciferase reporter gene activation was analyzed with the Luciferase
Assay Reagents commercially available from Promega (Madison. WI). An alloquot of lysate (15 μl) was mixed with 50 μl of substrate solution in an opaque white 96 well plate. The luminescence from the plate was read in a Wallance 1450 MicroBeta scintillation and luminscence counter (Wallac Instruments, Gaithersburg, MD). Constitutive GPCR activity was calculated as activity measured in GPCR transfected cells divided by activity measured in control cells (control cells= luciferase- transfected cells in the absence of GPCR plasmid). The measurements of GPCR constitutive activity (as a percentage of control measurements) are summarized in the table below: GPCR CRE Activity AP-1 Activity
CON 193 128% 100%,
CON 197 165% 100%
CON 198 178% 146%
CON203 100% 468%
CON215 173% 307%
CON222 100% 100%
CON202 135% 336%
CONl 66 1 15% 100%
CON217 21 1% 100%
These results provide useful information for designing screening assays to identify molecules (natural or artificial) that activate or inhibit the GPCR's ofthe invention. For example, compound libraries can be screened using the AP-1 luciferase (for CON198, CON203, CON215, or CON202) or the CRE-luciferase assay
(for CON193, CON197, CON198, CON215, CON202, and CON166) to identify compounds which increase the signaling activity in GPCR polypeptide expressing cells as compared to receptor negative cells. The identified compounds may be useful for predicting endogenous ligands for the GPCR polypeptides, for measuring the physiological effects of GPCR activation in animal models, and for designing therapeutics to modulate GPCR activity to treat disease states.
EXAMPLE 8 Chromosomal Localization of GPCR The following example pertains to chromosomal localization of GPCR genes ofthe present invention (e.g., CONl 93, CON166, CON103, CON203, CON198, CON197, CON202, CON222, CON215, or CON217). The chromosomal localization peπnits use ofthe GPCR polynucleotide sequences (including fragments thereof) as chromosomal markers to assist with genome mapping and to provide markers for disease states. Chromosomal localization also permits coπelation of the GPCR's of the invention with disease states in which abeπant activity of the GPCR is implicated, especially disease states that have previously linked (or will be linked) with mutations, polymoφhisms, chromosomal reaπangements, and other chromosomal changes near the locus of the GPCR gene.
A. CON197
Chomosomal localization ofthe gene encoding CONl 97 (SEQ XD NO: 1 1) was determined using the Standford G3 Radiation Hybrid Panel (Research Genetics, Inc. Huntsville, AL). This panel contains 83 radiation hybrid clones of the entire human genome as created by the Stanford Human Gemone Center (Stanford,
California). PCR was caπied out with each clone within the Hybrid Panel and the results were submitted to the Standford Human Genomic Center via e-mail for analysis (http://www.shgc.standford.edu/RH/rhserverformnew.html).
PCR reactions were caπied out with the Expand Hi-Fi PCR System™ according the manufacturer's instructions (Roche Molecular Biochemicals,
Indianapolis, IN). Primers, synthesized by Genosys Coφ. (The Woodlands, TX), were designed to generate a 10 base pair fragment of CON197-encoding DNA in the presence ofthe appropriate genomic DNA. The forward primer, denoted as LW1332 (TCCTACTGTCATGAACCC; SEQ TD NO: 74), coπesponded to nuceotides 396 through 413 of SEQ TD NO: 11. The reverse primer, denoted as LW1333
(CAGAAGAAGTTGTCCAGC; SEQ ID NO: 75), coπesponded to the complement of nucleotides 519 through 536 of SEQ TD NO: 1 1. Each reaction contained 25 ng of DNA from a hybrid clone, 60 ng of Primer LW1332, and 60 ng of Primer LW1333 resulting in a final volume of 15 μl. The PCR reactions were caπied our in a GeneAmp 9700 PCR thermocycler (Perkin Elmer Applied Biosystems) under the following conditions: 94°C for 3 minutes followed by 35 cycles of 94°C for 30 seconds, 52°C for 1 minute, and 72°C for 2 minutes. The PCR reactions were then analyzed on a 2.0% agarose gel and stained with ethidium bromide. The lanes were scored for the presence ofthe 140 base pair PCR product. The G3 Hybrid Panal analysis revealed that the CONl 97 gene (SEQ ID
NO: 1 1) was localized to chromosome 14, most nearly linked to Standford marker SHGC- 10764 with a LOD score of 9.10. The SHGC-10764 marker lies at position l q l l . l .
B. CON202 Chomosomal localization of the gene encoding CON202 (SEQ ID NO:
13) was determined using the Standford G3 Radiation Hybrid Panel (Research Genetics, Inc. Huntsville, AL). This panel contains 83 radiation hybrid clones of the entire human genome as created by the Stanford Human Gemone Center (Stanford, California). PCR was caπied out with each clone within the Hybrid Panel and the results were submitted to the Standford Human Genomic Center via e-mail for analysis (http://www.shgc.standford.edu/RH/rhserverformnew.html).
PCR reactions were caπied out with the Expand Hi-Fi PCR System™ according the manufacturer's instructions (Roche Molecular Biochemicals, Indianapolis, IN). Primers, synthesized by Genosys Coφ. (The Woodlands, TX), were designed to generate a 250 base pair fragment of CON202-encoding DNA in the presence of the appropriate genomic DNA. The forward primer, denoted as LW1480 (GGTTCTACCTGGACTTATGG; SEQ ID NO: 70), coπesponded to nuceotides 515 through 534 of SEQ XD NO: 13. The reverse primer, denoted as LW1481 (TAATGAATGAGTAAGTGCCC; SEQ ID NO: 71), coπesponded to the complement of nucleotides 745 through 764 of SEQ ID NO: 13. Each reaction contained 25 ng of DNA from a hybrid clone, 60 ng of Primer LW1480, and 60 ng of Primer LW1481 resulting in a final volume of 15 μl. The PCR reactions were caπied our in a GeneAmp 9700 PCR thermocycler (Perkin Elmer Applied Biosystems) under the following conditions: 94°C for 3 minutes followed by 35 cycles of 94°C for 30 seconds, 52°C for 1 minute, and 72°C for 2 minutes. The PCR reactions were then analyzed on a 2.0%> agarose gel and stained with ethidium bromide. The lanes were scored for the presence ofthe 250 base pair PCR product.
The G3 Hybrid Panal analysis revealed that the CON202 gene (SEQ XD NO: 13) was localized to chromosome 7, most nearly linked to Standford marker SHGC- 12021 with a LOD score of 10.36. The SHGC- 12021 marker lies at position
7q21. There is evidence that schizophrenia is linked to chromosome 7q22, and therefor any genes localized to this region are candidates for disease involvement or susceptibility. [See Ekelund et al. Human Mol. Genetics 9(7): 1049-1057 (2000); Faraone et al. Am. J. Med. Genet. 81: 290-295 (September, 1998); and Blouin et al, Nat. Genet., 20: 70-73 ( 1998)]. The SHGC-12021 marker is proximal to 7q22 (-1 cM) and therefore may be associated with schizophrenia susceptibility.
In particular, G protein-coupled receptors, such as CON202 polypeptide, have the biochemical and functional potential to play a role in the disease process of schizophenia. CON202 is an attractive target for screening for ligands (natural and synthetic) that are useful in modulating cellular processes involved in schizophrenia. In addition, the chromosomal localization data (especially coupled with CON202 expression patterns in the brain) identifies CON202 as a candidate for screening healthy and affected (schizophrenia) individuals for CON202 allelic variants, mutations, duplications, rearrangements, and other chromosomal variations that coπelate with the disesase state. Variations that coπelate with disease state are useful for diagnosis of disease or disease susceptibility. CON202 constπicts containing the variations are useful for designing targeted therapeutics for treatment ofthe disease (e.g., by using the assays for modulators described in preceding examples.
C. High throughput Analysis
The EMBL High Throughput Genome database (provided by the European Bioinformics Institute) was searched with GPCR nucleotide sequences to determine chromosomal localization for CON193, CON166, CONl 03, CON203, CONl 98, and CON215 genes. The results are summarized in the table below:
GPCR SEO ID NO: Chomosome Based on Genbank
Localization Accession No.
CONl 93 1 1 1 AC026090
CON 166 3 X AC021992
CONl 03 5 2 AC013396
CON203 7 3 AC024886
CONl 98 9 11 AC025249
CON215 17 3 AC024886
While the present invention has been described in terms of specific embodiments, it is understood that variations and modifications will occur to those in the art, all of which are intended as aspects of the present invention. Accordingly, only such limitations as appear in the claims should be placed on the invention.
Summary of Sequences:
SEO ID NO. Description
1 CON 193 DNA
2 CON 193 protein
3 CON 166 DNA
4 CON 166 protein
5 CON 103 DNA
6 CON 103 protein
7 CON 203 DNA
8 CON 203 protein
9 CON 198 DNA
10 CON 198 protein
11 CON 197 DNA
12 CON 197 protein
13 CON 202 DNA
14 CON 202 protein
15 CON 222 DNA
16 CON 222 protein
17 CON 215 DNA SEQ ID NO. Description
18 CON 215 protein
19 CON 217 DNA
20 CON 217 protein
21 PCR primer LW 1282 for CON 193 22 PCR primer LW 1283 for CON 193
23 PCR primer LW 1372 for CON 193
24 PCR primer LW 1 74 for CON 193
25 MAPK Substrate Peptide
26 Primer LW 1248 for CON 193 to generate insitu hybridization probe 27 Primer LW 1249 for CON 193 to generate insitu hybridization probe
28 PCR primer LW 1278 for CON 166
29 PCR primer LW 1279 for CON 166
30 PCR primer LW 1405 for CON 166
31 PCR primer LW 1406 for CON 166 32 PCR primer LW 1280 for CON 103
33 PCR primer LW 1281 for CON 103
34 PCR primer LW 1385 for CON 103
35 PCR primer LW 1386 for CON 103
36 PCR primer LW 1329 for CON 203 37 PCR primer LW 1377 for CON 203
38 PCR primer LW 1387 for CON 203
39 PCR primer LW 1388 for CON 203
40 Primer LW 1314 for CON 203 to generate insitu hybridization probe
41 Primer LW 1315 for CON 203 to generate insitu hybridization probe 42 PCR primer LW 1326 for CON 198
43 PCR primer LW 1327 for CON 198
44 PCR primer LW 1415 for CON 198
45 PCR primer LW 1416 for CON 198
46 Primer LW 1308 for CON 198 to generate insitu hybridization probe 47 Primer LW 1309 for CON 198 to generate insitu hybridization probe
48 PCR primer LW 1324 for CON 197
49 PCR primer LW 1325 for CON 197
50 Primer LW 1306 for CON 197 to generate insitu hybridization probe
51 Primer LW 1307 for CON 197 to generate insitu hybridization probe SEO ID NO. Description
52 PCR primer GV 599 for CON 202
53 PCR primer GV 600 for CON 202
54 PCR primer LW 1482 for CON 202
55 PCR primer LW 148 for CON 202 56 Primer LW 1310 for CON 202 to generate insitu hybridization probe
57 Primer LW 131 1 for CON 202 to generate insitu hybridization probe
58 PCR primer L W 1442 for CON 222
59 PCR primer LW 1443 for CON 222
60 PCR primer LW 1440 for CON 222 61 PCR primer LW 1441 for CON 222
62 Primer LW 1472 for CON 222 to generate insitu hybridization probe
63 Primer LW 1473 for CON 222 to generate insitu hybridization probe
64 Primer LW 1411 for CON 215 to generate insitu hybridization probe
65 Primer LW 1412 for CON 215 to generate insitu hybridization probe 66 PCR primer LW 1448 for CON 217
67 PCR primer LW 1449 for CON 217
68 Primer LW 217A for CON 217 to generate insitu hybridization probe
69 Primer LW 218B for CON 217 to generate insitu hybridization probe
70 Primer LW 1480 for CON 202 chromosomal localization 71 Primer LW 1481 for CON 202 chromosomal localization
72 Primer CONl 03a for CON 103 to generate insitu hybridization probe
73 Primer CONl 03b for CON 103 to generate insitu hybridization probe
74 Primer LW 1332 for CON 197 chromosomal localization
75 Primer LW 1333 for CON 197 chromosomal localization
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule \ 3bιι)
A. The indications made below relate to the miciooiganism referred to in the description on page 90 ; 98 . line 10- 14 ; 15
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet |X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U S.A.
Date of deposit Accession Number 18 January 2000 B-30250
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway).
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g . "Accession Number of Deposit")
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13te)
A. The indications made below relate to the microorganism referred to in the description on page 91 ; 98 , |,ne 10- 14 ; 16
B. IDENTIFICATION OF DEPOSIT Further deposits aie identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U.S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S. A.
Date of deposit Accession Number 18 January 2000 B-30248
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No. 71 ), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before: the patent is granted on the application; or the application has lapsed or been withdrawn or refused; to a person who is' a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE ADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
H This sheet was received with the international application D This sheet was received by the International Bureau on
-x jχ_ Authorized officer
Form PCT/RO/I 34 (July 1992) LegalStar 1997 Form PCTM5
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule \ 3bιs)
A The indications made below relate to the miciooiganism referred to in the description on page 91 ; 98 line 10-14 ; 16
B IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U S A
Date of deposit Accession Number 18 January 2000 B-30248
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway).
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
I55 This sheet was received with the international application This sheet was received by the International Bureau on
Au utthhoorπizzeed ooftftiicceerr i Authorized officer
Form PCT/RO/134 (July 1992) LegalStar 1997 Form PCTMS
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13ύ«)
A The indications made below i elate to the microorganism referred to in the description on page 92 ; 98 , |,ne 10-14 ; 17
B IDENTI FICA TION OF DEPOSIT Further deposits arc identified on an additional sheet [ X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U S A
Date of deposit Accession Number 18 January 2000 B-30247
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia in accordance with regulation 3 25 of the Patents Regulations (Australia Statutory Rules 1991 No 71 ), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before the patent is granted on the application, or the application has lapsed or been withdrawn or refused to a person who is a skilled addressee without an interest in the invention, and nominated by a person who makes a request for the furnishing of those samples
D DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application D This sheet was received by the International Bureau on
Authorized officer J fJx
Form PCT/RO/l 34 (July 1992) LegalSlar 1997 Form PCTM5
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
( PCT Rule 13
A. The indications made below relate to the mici ooiganism referred to in the description on page 92 ; 98 . line 10- 14 ; 1 7
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet |X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U.S Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S A.
Date of deposit Accession Number 18 January 2000 B-30247
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway).
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE ADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e ι "Accession Number of Deposit")
Apphcant's or agent's file IntematιonaJι applιςat!.on N lcfcrcncc number 28341/O DK To Be De β pi
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
A. The indications made below relate to the microorganism referred to in the description on page 93 ; 98 , line 10-1-4 ; 18
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U.S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S. A.
Date of deposit Accession Number 18 January 2000 B-30254
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No. 71), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before: the patent is granted on the application; or the application has lapsed or been withdrawn or refused; to a person who is: a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications eg , "Accession Number of Deposit")
For receiving Office use only For International Bureau use only ft This sheet was received with the international application j j This sheet was received by the International Bureau on
Au itthhoorπizzeedd ooftftiieeββrr /- Authorized officer
Form PCT/RO/134 (July 1992) LegalStar 1997. Form PCTM5 Applicant's or agent's file International " — l"",IΛ M' reference numbei 28341/62/bP To Be Dete
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 1
A. The indications made below relate to the imcioorganism rcfened to in the description on page 93 ; 98 line 10-14 ; 18
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal c ode and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S Department of Agriculture 1815 North University Street, Peoria Illinois 61604 U S A
Date of deposit Accession Number 18 January 2000 B-30254
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway)
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g 'Accession Number of Deposit")
Applicant's or agent's file International aDDlication I reference number 2834l/b 'bH To Be t
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 136w)
A. The indications made below relate to the microorganism referred to in the description on page 94 : 98 , line 3-7 : 19
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U.S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S A.
Date of deposit Accession Number 18 January 2000 B-30252
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No. 71), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before: the patent is granted on the application; or the application has lapsed or been withdrawn or refused; to a person who is: a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "Accession Number of Deposit")
INDICATIONS RELATI NG TO A DEPOSITED MICROORGANISM
( PCT Rule 13M
A. The indications made below relate to the iniciooiga sm referred to in the description on page 94 ; 98 , line 3-7 ; 19
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U S A.
Date of deposit Accession Number 18 January 2000 B-30252
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway).
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e "Accession Number of Deposit")
For receiving Office use only For international Bureau use only
This sheet was received with the international application α This sheet was received by the International Bureau on
Α J Authorized officer
Form PCT/RO/134 (July 1992) LegalStar 1997 Form CTM5 Apphcant's or agent's fi le • Inter" icfcrcncc number 28341/O ΥDK To E
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13M
A. The indications made below relate to the microorganism referred to in the description on page 94 ; 98 , line 27-31 ; 20
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S. A.
Date of deposit Accession Number 18 January 2000 B-30251
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No. 71 ), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before: the patent is granted on the application; or the application has lapsed or been withdrawn or refused; to a person who is: a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "A ccession Number of Deposit ")
For International Bureau use only
This sheet was received by the International Bureau on
Authorized officer
LegalStar 1997 Form PCTM5 Apphcant's or agent's file Internation" reference number 28341 / ^ / To Be Del
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13M
A. The indications made below relate to the miciooigamsm referred to in the description on page 94 ; 98 ne 27-31 ; 20
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U S A
Date of deposit Accession Number 18 January 2000 B-30251
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway).
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "Accession Number of Deposit")
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13M
A. The indications made below relate to the microorganism referred to in the description on page 95 ; 98 , line 19-23 : 21
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U.S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S. A.
Date of deposit Accession Number 18 January 2000 B-30253
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No. 71 ), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before: the patent is granted on the application; or the application has lapsed or been withdrawn or refused; to a person who is: a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "Accession Number of Deposit")
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13M
A. The indications made below relate to the micioorganism rcfeπed to in the description on page 95 ; 98 . line 19-23 : 21
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S.A.
Date of deposit Accession Number 18 January 2000 B-30253
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway).
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated Slates)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application D This sheet was received by the International Bureau on
& uthorAed offiβer Λ I Authorized officer
Form PCT/RO/134 (July 1 92) LegalStar 1997 For PCTM5
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13
A The indications made below relate to the microorganism referred to in the description on page 96 ; 98 'me 11- 1 5 ; 22
B IDENTI FICATION OF DEPOSIT Further deposits aie identified on an additional sheet |X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service U S Department of Agriculture 1815 North University Street, Peoria Illinois 61604 U S A
Date of deposit Accession Number 18 January 2000 B-30257
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia, in accordance with regulation 3 25 of the Patents Regulations (Australia Statutory Rules 1991 No 71) samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before the patent is granted on the application, or the application has lapsed or been withdrawn or refused, to a person who is a skilled addressee without an interest in the invention, and nominated by a person who makes a request for the furnishing of those samples
D DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E SEPARATE FUR ISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e 'Accession Number of Deposit ')
For receiving Office use only For International Bureau use only
This sheet was received with the international application D This sheet was received by the International Bureau on
AuthorjΛd office^ / , Authorized officer
Form PCT/RO/134 (July 1992) LegalStar 1997 Form PCTM5 Applicant's or agent s file Intematior reference numbei 28341. u^ . u To Be De
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
( PCT Rule 13M
A The indications made below relate to the miciooi amsm referred to in the description on page 96 ; 98 |ιnc 11- 15 ; 22
B IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U S A
Date of deposit Accession Number 18 January 2000 B-30257
C ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
In respect of those designations in which a European patent or a patent in Norway is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or the corresponding information concerning the patent in Norway or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28 (4) EPC and the corresponding regulations in Norway)
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g 'Accession Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application D This sheet was received by the International Bureau on
Auutthoorrjpeedd oofπfiicceerr Authorized officer
Form PCT/RO/134 (July 1992) LegalStar 1997 Form PCTMS
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13
A. The indications made below relate to the microorganism referred to in the description on page 97 ; 98 , line 4-8 ; 23
B. IDENTI FICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agπcultural Research Service, U S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S. A.
Date of deposit Accession Number 18 January 2000 B-30255
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet X
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No 71), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before: the patent is granted on the application; or the application has lapsed or been withdrawn or refused; to a person who is: a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature ofthe indications eg , "Accession Number of Deposit")
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
For International Bureau use only
D This sheet was received by the International Bureau on
Authorized officer
Form PCT/RO/134 (July 1992) LegalStar 1997 Form PCT δ
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13M
A. The indications made below relate to the microorganism referred to in the description on page 98 , line 1-3 ; 24
B IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | X
Name of depositary institution
Agricultural Research Service Culture Collection
Address of depositary institution (including postal code and country) National Center for Agricultural Utilization Research Agricultural Research Service, U S. Department of Agriculture 1815 North University Street, Peoria, Illinois 61604 U.S A.
Date of deposit Accession Number 18 January 2000 B-30256
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet
When designating Australia, in accordance with regulation 3.25 of the Patents Regulations (Australia Statutory Rules 1991 No 71 ), samples of materials deposited in accordance with the Budapest Treaty in relation to this Patent Request are only to be provided before, the patent is granted on the application; or the application has lapsed or been withdrawn or refused, to a person who is a skilled addressee without an interest in the invention; and nominated by a person who makes a request for the furnishing of those samples.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indications listed below will be submitted to the International Bureau later (specify the general nature of the indications e g , "Accession Numbei of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application D This sheet was received by the International Bureau on
Authoπβed officer Λ Authorized officei
Form PCT/RO/134 (July 1 92) LegalStar 1997 Form PCTM5
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13M
For receiving Office use only For International Bureau use only
This sheet was received with the international application α This sheet was received by the International Bureau on
Au itthhoorπizzeedd ooftftiicceerr , Authorized officer
Form PCT/RO/134 (July 1 92) LegalStar 1997 Form PCT β

Claims

CLAIMSWhat is claimed is:
1 . A puri fied and isolated seven transmembrane receptor polypeptide comprising an amino acid sequence at least 90% identical to an amino acid sequence set forth in any one of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide.
2. A purified and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 2, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide.
3. A purified and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 4, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide.
4. A purified and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 6, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide.
5. A purified and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO: 8, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide.
6 A puri fied and isolated seven transmembrane receptor polypeptide accoidmg to claim 1 compnsing an amino acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO 10, or a fragment thereof compnsing an epitope specific to said seven tiansmcmbrane receptor polypeptide
7 A puri fied and isolated seven transmembrane receptoi polypeptide according to claim 1 compnsing an amino acid sequence at least 90% identical to the ammo acid sequence set forth in SEQ XD NO 12, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide
8 A purified and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an ammo acid sequence at least 90% identical to the amino acid sequence set forth in SEQ ID NO 14, or a fragment thereof compπsing an epitope specific to said seven transmembrane receptor polypeptide
9 A puπfied and isolated seven transmembrane receptor polypeptide according to claim 1 compπsing an ammo acid sequence at least 90% identical to the ammo acid sequence set forth in SEQ ID NO 16, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide
10 A puπfied and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an ammo acid sequence at least 90% identical to the ammo acid sequence set forth in SEQ ID NO 18, or a fragment thereof compnsing an epitope specific to said seven transmembrane receptor polypeptide
11 A puπfied and isolated seven transmembrane receptor polypeptide according to claim 1 comprising an ammo acid sequence at least 90% identical to the ammo acid sequence set forth in SEQ ID NO 20, or a fragment thereof comprising an epitope specific to said seven transmembrane receptor polypeptide
12. A purified and isolated seven transmembrane receptor polypeptide according to any one of claims 1 - 1 1 .
13. A purified and isolated polypeptide according to any one of claims 1- 1 1 comprising at least one extracellular domain of the seven transmembrane receptor polypeptide.
14. A purified and isolated polypeptide according to any one of claims 1-11 comprising the N-terminal extracellular domain of the seven transmembrane receptor polypeptide.
15. A purified and isolated polypeptide according to any one of claims 1-1 1 comprising a seven transmembrane receptor fragment selected from the group consisting of an N-terminal extracellular domain transmembrane domains, extracellular loops connecting transmembrane domains, intracellular loops connecting transmembrane domains, a C-terminal cytoplasmic domain, and fusions thereof.
16. A polypeptide according to any one of claims 1-15, wherein the polypeptide further includes a heterologous tag amino acid sequence.
17. A purified and isolated polynucleotide comprising a nucleotide sequence that encodes the polypeptide of claim 16.
18. A purified and isolated polynucleotide comprising a nucleotide sequence that encodes a polypeptide according to any one of claims 2, 3, 4, 8 or 9.
19. A purified and isolated polynucleotide comprising a heterologous expression control sequence operatively linked to a nucleotide sequence that encodes a polypeptide according to any one of claims 1 -16.
20 The polynucleotide according to claim 19, wheiein the expression control sequence is a promoter sequence that piomotcs expiession of said polynucleotide in an eukaiyotic cell
21 The polynucleotide according to claim 19, wheiein the promoter is a heteiologous promoter that promotes expression of the polynucleotide in a human cell
22 A purified and isolated polynucleotide comprising a nucleotide sequence that encodes a mammalian seven transmembrane receptor, wherein said polynucleotide hybridizes to any one ofthe nucleotide sequences set forth in SEQ ID NOS 1 , 3, 5, 7, 9, 11, 13, 15, 17, or 19 or the non-coding strand complementary thereto, under the following hybndization conditions
(a) hybridization for 16 hours at 42°C in a hybridization solution compπsing 50% formamide, 1% SDS, 1 M NaCl, 10% dextran sulfate and
(b) washing 2 times for 30 minutes at 60°C in a wash solution compπsing 0 lx SSC and 1% SDS, with the proviso that the nucleotide sequence of the polynucleotide differs from the coding sequence set forth in any one of SEQ ID NOS 1, 3, 5, 7, 9, 11, 13, 15, 17, or 19 and from its complementary strand by at least one nucleotide.
23 A polynucleotide according to claim 22 that encodes a human seven transmembrane receptor
24 A vector comprising a polynucleotide according to any one of claims 17-23
25 A vector according to claim 24 that is an expression vector for expressing the polynucleotide in a mammalian cell
26 A host cell stably transformed or transfected with a polynucleotide according to any one of claims 17-23 in a manner allowing the expression in said host cell ol the polypeptide or fragment thereof encoded by the polynucleotide
27. A host cell stably transformed or transfected with a vector according to claim 24 or 25 in a manner allowing the expression in said host cell of the polypeptide or fragment thereof encoded by the polynucleotide
28 A method for producing a seven transmembrane receptor polypeptide comprising the steps of growing a host cell according to claim 26 or 27 in a nutrient medium under conditions in which the host cell expresses a seven transmembrane receptor encoded by the polynucleotide.
29. A method according to claim 28, further comprising a step of isolating said polypeptide from said cell or said medium.
30. A method according to claim 29, further compnsing a step of isolating cell membranes from the host cell, wherein the cell membrane compnses the seven transmembrane receptor.
31. An antibody specific for a polypeptide according to any one of claims 1-15.
32. The antibody of claim 31 which is a monoclonal antibody.
33. A hybridoma that produces an antibody according to claim 32.
34. An antibody according to claim 31 that is a humanized antibody.
35. An antibody according to claim 31 that specifically binds an extracellular epitope of a seven transmembrane receptor having an amino acid sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20.
36. An antibody according to claim 35 that specifically binds to the amino-terminal extracellular domain of the seven transmembrane receptors.
37. A cell-free composition comprising polyclonal antibodies, wherein at least one of said antibodies is an antibody according to claim 31.
38. An anti-idiotypic antibody specific for an antibody according to claim 31.
39. A polypeptide comprising a fragment of an antibody according to claim 31, wherein said fragment and said polypeptide specifically bind to a seven transmembrane receptor having an amino acid sequence selected from the group consisting of SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18 or 20.
40. A polypeptide according to claim 39 that is selected from the group consisting of single chain antibodies and CDR-grafted antibodies.
41. A composition comprising a polypeptide according to any one of claims 1-16 in a pharmaceutically acceptable carrier.
42. A composition comprising an antibody according to any one of claims 31, 32, 34, 35, or 36, or a polypeptide according to claim 39 or 40, in a pharmaceutically acceptable carrier.
43. A method for modulating ligand binding of a seven transmembrane receptor polypeptide according to any one of claims 1- 15, comprising the step of contacting said seven transmembrane receptor polypeptide with an antibody specific for said seven transmembrane receptor, under conditions wherein the antibody binds the receptor.
44. A method for modulating ligand binding of a seven transmembrane receptor polypeptide comprising the step of contacting said seven transmembrane receptor polypeptide with a polypeptide according to claim 39 or 40.
45. An assay to identify compounds that bind a seven transmembrane receptor polypeptide, said assay comprising the steps of:
(a) contacting a composition comprising a seven transmembrane receptor polypeptide according to any of claims 1-15 with a compound suspected of binding the seven transmembrane receptor polypeptide; and
(b) measuring binding between the compound and the seven transmembrane receptor polypeptide.
46. A method for identifying a modulator of binding between a seven transmembrane receptor polypeptide and a binding partner ofthe seven transmembrane receptor polypeptide, comprising the steps of:
(a) contacting the binding partner and a composition comprising the seven transmembrane receptor polypeptide in the presence and in the absence of a putative modulator compound, where the seven transmembrane receptor polypeptide is a polypeptide according to any one of claims 1-15;
(b) measuring binding between the binding partner and said seven transmembrane receptor polypeptide; and
(c) identifying a putative modulator compound in view of decreased or increased binding between the binding partner and seven transmembrane receptor polypeptide in the presence of the putative modulator, as compared to binding in the absence of the putative modulator.
47. An assay according to claim 45 or 46 wherein the composition comprises a cell expressing the seven transmembrane receptor polypeptide on its surface.
48. An assay according to claim 47 wherein the measuring step comprises measuring intracellular signaling of the seven transmembrane receptor polypeptide induced by the compound.
49. A method for treating a neurological disorder comprising the step of administering to a mammal in need of such treatment a pharmaceutical composition comprising a compound in an amount effective to modulate biological activity of a seven transmembrane receptor in neurons of said mammal, wherein the compound is selected from the group consisting of:
(a) an antibody according to any one of claims 31, 32, 34, 35, or 36; (b) an anti-idiotypic antibody according to claim 38;
(c) a polypeptide according to claim 39 or 40;
(d) a compound identified according to the method of claim 45; and
(e) a modulator identified according to claim 46.
50. The method of claim 49 wherein the neurological disorder is schizophrenia.
51. A method according to claim 50, wherein the seven transmembrane receptor comprises a polypeptide according to claim 8.
52. A method of treating schizophrenia comprising the step of administering to a human diagnosed with schizophrenia an amount of a modulator of CON202 receptor activity sufficient to modulate CON202 receptor activity or CON202 ligand binding in said human.
53. A method of diagnosing schizophrenia or a susceptibility to schizophrenia comprising the steps of:
(a) measuring the presence or amount of expression or activity of a polypeptide according to claim 8 in a cell of a human patient; and (b) comparing the measurement of step (a) to a measurement of expression or activity of the polypeptide in a cell from a normal subject or the patient at an earlier time, wherein the diagnosis of schizophrenia or susceptibility to schizophrenia is based on the presence or amount of CON202 polypeptide expression or activity.
54. A method of screening a human subject to diagnose a disorder affecting the brain or genetic predisposition therefor, comprising the steps of:
(a) assaying nucleic acid of a human subject to determine a presence or an absence of a mutation altering the amino acid sequence, expression, or biological activity of at least one seven transmembrane receptor that is expressed in the brain, wherein the seven transmembrane receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, or an allelic variant thereof, and wherein the nucleic acid coπesponds to the gene encoding the seven transmembrane receptor; and
(b) diagnosing the disorder or predisposition from the presence or absence of said mutation, wherein the presence of a mutation altering the amino acid sequence, expression, or biological activity of allele in the nucleic acid correlates with an increased risk of developing the disorder.
55. A method according to claim 54, wherein the seven transmembrane receptor is CON202 comprising an amino acid sequence set forth in
SEQ ID NO: 14, or an allelic variant thereof.
56. A method according to claim 55, wherein the disease is schizophrenia.
57. A method according to claim 56, wherein the assaying step comprises at least one procedure selected from the group consisting of.
(a) determining a nucleotide sequence of at least one codon of at least one CON202 allele of the human subject; (b) performing a hybridization assay to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences;
(c) performing a polynucleotide migration assay to detennine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences; and
(d) performing a restriction endonuclease digestion to determine whether nucleic acid from the human subject has a nucleotide sequence identical to or different from one or more reference sequences.
58. A method according to claim 56 wherein the assaying step comprises: performing a polymerase chain reaction (PCR) to amplify nucleic acid comprising CON202 coding sequence, and determining nucleotide sequence ofthe amplified nucleic acid.
59. A method of screening for a CON202 hereditary schizophrenia genotype in a human patient, comprising the steps of:
(a) providing a biological sample comprising nucleic acid from said patient, said nucleic acid including sequences corresponding to said patient's
CON202 alleles; (b) analyzing said nucleic acid for the presence of a mutation or mutations;
(c) determining a CON202 genotype from said analyzing step; and
(d) correlating the presence of a mutation in a CON202 allele with a hereditary schizophrenia genotype.
60. The method according to claim 59 wherein said biological sample is a cell sample.
61. The method according to claim 59 wherein said analyzing comprises sequencing a portion of said nucleic acid, said portion comprising at least one codon of said CON202 alleles.
62. The method according to claim 59 wherein said nucleic acid is DNA.
63. The method according to claim 59 wherein said nucleic acid is RNA.
64. A kit for screening a human subject to diagnose schizophrenia or a genetic predisposition therefor, comprising, in association:
(a) an oligonucleotide useful as a probe for identifying polymoφhisms in a human CON202 seven transmembrane receptor gene, the oligonucleotide comprising 6-50 nucleotides that have a sequence that is identical or exactly complementary to a portion of a wild type human CON202 gene sequence or CON202 coding sequence, except for one sequence difference selected from the group consisting of a nucleotide addition, a nucleotide deletion, or nucleotide substitution; and
(b) a media packaged with the oligonucleotide containing information identifying polymoφhisms identifyable with the probe that correlate with schizophrenia or a genetic predisposition therefor.
65. A method of identifying a seven transmembrane allelic variant that correlates with a mental disorder, comprising steps of:
(a) providing a biological sample comprising nucleic acid from a human patient diagnosed with a mental disorder, or from the patient's genetic progenitors or progeny;
(b) analyzing said nucleic acid for the presence of a mutation or mutations in at least one seven transmembrane receptor that is expressed in the brain, wherein the at least one seven transmembrane receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, or an allelic variant thereof, and wherein the nucleic acid includes sequence corresponding to the gene or genes encoding the at least one seven transmembrane receptor;
(c) determining a genotype for the patient for the at least one seven transmembrane receptor from said analyzing step; and (d) identifying an allelic variant that correlates with the mental disorder from the determining step.
66. A method according to claim 65, wherein the disorder is schizophrenia, and wherein the at least one seven transmembrane receptor comprises CON202 having an amino acid sequence set forth in SEQ ID NO: 14, or an allelic variant thereof.
67. A purified and isolated polynucleotide comprising a nucleotide sequence encoding a CON202 receptor allelic variant identified according to claim 66.
68. A host cell transformed or transfected with a polynucleotide according to claim 67 or with a vector comprising the polyncleotide.
69. A purified polynucleotide comprising a nucleotide sequence encoding a CON202 seven transmembrane receptor protein of a human that is affected with schizophrenia; wherein said polynucleotide hybridizes to the complement of SEQ ID NO: 13 under the following hybridization conditions:
(a) hybridization for 16 hours at 42°C in a hybridization solution comprising 50% formamide, 1% SDS, 1 M NaCl, 10% dextran sulfate and
(b) washing 2 times for 30 minutes at 60°C in a wash solution comprising O. lx SSC and 1% SDS; and wherein the polynucleotide encodes a CON202 amino acid sequence that differs from SEQ ID NO: 14 at at least one residue.
70. A vector comprising a polynucleotide according to claim 69.
71. A host cell that has been transformed or transfected with a polynucleotide according to claim 70 and that expresses the CON202 protein encoded by the polynucleotide.
72. A host cell according to claim 71 that has been co-transfected with a polynucleotide encoding the CON202 amino acid sequence set forth in SEQ ID
NO: 14 and that expresses the con202 protein having the amino acid sequence set forth in SEQ ID NO: 14.
73. A method for identifying a modulator of CON202 biological activity, comprising the steps of: a) contacting a cell according to claim 71 in the presence and in the absence of a putative modulator compound; b) measuring CON202 biological activity in the cell; and c) identifying a putative modulator compound in view of decreased or increased CON202 biological activity in the presence versus absence of the putative modulator.
74. An assay to identify compounds useful for the treatment of schizophrenia, said assay comprising steps of:
(a) contacting a composition comprising a seven transmembrane receptor polypeptide according to claim 8 with a compound suspected of binding the seven transmembrane receptor polypeptide;
(b) measuring binding between the compound and the seven transmembrane receptor polypeptide; and
(c) identifying molecules that bind the seven transmembrane receptor as candidate compounds useful for the treatment of schizophrenia.
75. A method for identifying compound useful for a modulator of binding between a seven transmembrane receptor polypeptide and a binding partner of the seven transmembrane receptor polypeptide, which modulator is useful for treatment of schizophrenia, comprising the steps of: (a) contacting the binding partner and a composition comprising the seven transmembrane receptor polypeptide in the presence and in the absence of a putative modulator compound, where the seven transmembrane receptor polypeptide is a polypeptide according to claim 8;
(b) measuring binding between the binding partner and the seven transmembrane receptor polypeptide;
(c) identifying a modulator compound useful for the treatment of schizophrenia in view of decreased or increased binding between the binding partner and seven transmembrane receptor polypeptide in the presence ofthe putative modulator, as compared to binding in the absence ofthe putative modulator.
76. An assay according to claim 74 or 75 wherein the composition comprises a cell expressing the seven transmembrane receptor polypeptide on its surface. 77 An assay accoiding to claim 76 wherein the composition comprises a cell tiansfoπned oi tiansfected with a polynucleotide encoding the seven tiansmembrane polypeptide and expiessing the seven transmembrane receptor polypeptide on its surface
EP00978278A 1999-10-27 2000-10-27 G protein-coupled receptors expressed in human brain Withdrawn EP1230361A2 (en)

Applications Claiming Priority (21)

Application Number Priority Date Filing Date Title
US429517 1989-10-31
US42765399A 1999-10-27 1999-10-27
US42811499A 1999-10-27 1999-10-27
US42785999A 1999-10-27 1999-10-27
US42802099A 1999-10-27 1999-10-27
US427859 1999-10-27
US428114 1999-10-27
US428020 1999-10-27
US427653 1999-10-27
US42951799A 1999-10-28 1999-10-28
US42969599A 1999-10-28 1999-10-28
US42955599A 1999-10-28 1999-10-28
US42967699A 1999-10-28 1999-10-28
US429695 1999-10-28
US429676 1999-10-28
US45439999A 1999-12-03 1999-12-03
US48179400A 2000-01-12 2000-01-12
US481794 2000-01-12
PCT/US2000/029601 WO2001031014A2 (en) 1999-10-27 2000-10-27 G protein-coupled receptors expressed in human brain
US429555 2003-05-05
US454399 2003-06-03

Publications (1)

Publication Number Publication Date
EP1230361A2 true EP1230361A2 (en) 2002-08-14

Family

ID=27581260

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00978278A Withdrawn EP1230361A2 (en) 1999-10-27 2000-10-27 G protein-coupled receptors expressed in human brain

Country Status (4)

Country Link
EP (1) EP1230361A2 (en)
AU (1) AU1575601A (en)
CA (1) CA2386509A1 (en)
WO (1) WO2001031014A2 (en)

Families Citing this family (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6555339B1 (en) 1997-04-14 2003-04-29 Arena Pharmaceuticals, Inc. Non-endogenous, constitutively activated human protein-coupled receptors
US7119190B2 (en) 1997-04-14 2006-10-10 Arena Pharmaceuticals, Inc. Endogenous and non-endogenous versions of human G protein-coupled receptors
WO2000050458A1 (en) * 1999-02-26 2000-08-31 Smithkline Beecham Corporation Cloning of a p2y-like 7tm receptor (axor17)
US6790631B1 (en) 1999-10-05 2004-09-14 Agensys, Inc. G protein-coupled receptor up-regulated in prostate cancer and uses thereof
US7361338B2 (en) 1999-10-05 2008-04-22 Agensys, Inc. Methods to inhibit growth of prostate cancer cells
IL149569A0 (en) * 1999-11-17 2002-11-10 Arena Pharm Inc Endogenous and non-endogenous versions of human g protein-coupled receptors
GB0001700D0 (en) * 2000-01-25 2000-03-15 Glaxo Group Ltd Novel protein
CA2408134A1 (en) * 2000-05-18 2001-11-22 Incyte Genomics, Inc. G-protein coupled receptors
WO2001088127A2 (en) * 2000-05-18 2001-11-22 Bayer Aktiengesellschaft Regulation of human follicle stimulating hormone-like g protein-coupled receptor
AU6604901A (en) * 2000-06-05 2001-12-17 Bayer Aktiengesellschaft Regulation of human hm74-like g protein coupled receptor
US20030212255A1 (en) * 2000-07-26 2003-11-13 Muralidhara Padigaru Novel proteins and nucleic acids encoding same
AU2002352554A1 (en) * 2001-06-26 2003-03-03 Novartis Ag G protein coupled receptors and dna sequences thereof
US6902902B2 (en) 2001-11-27 2005-06-07 Arena Pharmaceuticals, Inc. Human G protein-coupled receptors and modulators thereof for the treatment of metabolic-related disorders
AU2002359729A1 (en) * 2001-12-20 2003-07-09 Aventis Pharmaceuticals Inc. Novel g proein-coupled receptor, gave7
JP2005514934A (en) * 2002-01-23 2005-05-26 アベンティス・ファーマスーティカルズ・インコーポレイテツド Nucleic acids encoding G protein-coupled receptors and uses thereof
US7527935B2 (en) 2002-03-19 2009-05-05 Mitsubishi Tanabe Pharma Corporation G-protein coupled receptor having eicosanoid as ligand and gene thereof
AU2003220913A1 (en) * 2002-03-19 2003-09-29 Tanabe Seiyaku Co., Ltd. Novel g protein-coupled recepotrs and genes thereof
US20080260744A1 (en) 2002-09-09 2008-10-23 Omeros Corporation G protein coupled receptors and uses thereof
US7524638B1 (en) 2003-06-27 2009-04-28 Osi Pharmaceuticals, Inc. Methods for identification of modulators of OSGPR114 or OSGPR78 activity, and their use in the treatment of disease
WO2006024449A2 (en) * 2004-09-01 2006-03-09 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with cysteinyl leukotriene receptor 1 (cyslt1)
WO2006040534A2 (en) * 2004-10-11 2006-04-20 Paradigm Therapeutics Limited Method of detecting the presence or activity of g - protein coupled receptor 92 (gpr92)
EP2091556B1 (en) * 2006-11-15 2018-07-25 Omeros Corporation Non-human animal comprising a mutation in the sreb2/gpr85 gene as animal model of metabolic disease

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5955308A (en) * 1997-06-18 1999-09-21 Smithkline Beecham Corporation cDNA clone HEAOD54 that encodes a human 7-transmembrane receptor
DE69931360T2 (en) * 1998-03-12 2007-02-08 Astellas Pharma Inc. NEW RECIPE PROTEINS COUPLED TO A G-PROTEIN
US6071722A (en) * 1998-04-24 2000-06-06 Smithkline Beecham Corporation Nucleic acids encoding a G-protein coupled 7TM receptor (AXOR-1)
WO2000012707A1 (en) * 1998-09-02 2000-03-09 Millennium Pharmaceuticals, Inc. 14926 receptor, a novel g-protein coupled receptor
WO2000022131A2 (en) * 1998-10-13 2000-04-20 Arena Pharmaceuticals, Inc. Non-endogenous, constitutively activated human g protein-coupled receptors
DK1133559T3 (en) * 1998-11-20 2006-04-10 Arena Pharm Inc Human G protein-coupled orphan receptor RUP3
AU6232300A (en) * 1999-07-21 2001-02-13 Incyte Genomics, Inc. Receptors and associated proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0131014A2 *

Also Published As

Publication number Publication date
WO2001031014A2 (en) 2001-05-03
WO2001031014A3 (en) 2002-06-06
AU1575601A (en) 2001-05-08
CA2386509A1 (en) 2001-05-03

Similar Documents

Publication Publication Date Title
WO2001031014A2 (en) G protein-coupled receptors expressed in human brain
EP0579758B1 (en) Parathyroid hormone receptor and dna encoding same
US7456255B2 (en) Nogo receptor homologs that decrease inhibition of axonal elongation
US6368812B1 (en) Process for determining the agonist or antagonist of galanin receptor (GALR3)
US5886148A (en) Parathyroid hormone receptor
JPH10262687A (en) New human 11cb splice variant
JP2012065671A (en) P-glycoprotein from macaca fascicularis and use thereof
JPH10327889A (en) Novel G-protein coupled receptor (HFGAN72Y)
US7132260B2 (en) DNA encoding parathyroid hormone receptor
JP3813156B2 (en) Opioid receptor, composition thereof and method for producing the same
US7374895B2 (en) Guanosine triphosphate (GTP) binding protein-coupled receptor proteins that bind histamine and are expressed in the brain
US20040091928A1 (en) G protein-coupled receptors expressed in brain
US20050074808A1 (en) G protein-coupled receptor expressed in brain
MX2007001543A (en) Cell surface glycoprotein.
US20030119726A1 (en) P-glycoproteins and uses thereof
USH2136H1 (en) Nucleic acids encoding G protein-coupled receptors
JP2003504054A (en) G-protein coupled receptor and its DNA sequence
EP1204747A1 (en) G protein-coupled receptor expressed in brain
US20030082534A1 (en) Novel G protein-coupled receptors
US6783973B1 (en) Mammalian catecholamine receptor genes and uses
AU2004210549A1 (en) G protein-coupled receptor expressed in brain
US20020123083A1 (en) Nucleic acid endocing growth factor protein
WO2000031108A1 (en) Dna molecules encoding hg51, a g-protein-coupled receptor
JPH10117791A (en) Human G protein-coupled receptor HLYAZ61

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020521

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20020521;LT PAYMENT 20020521;LV PAYMENT 20020521;MK PAYMENT 20020521;RO PAYMENT 20020521;SI PAYMENT 20020521

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: PHARMACIA & UPJOHN COMPANY LLC

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20050711