EP1230357A2 - Genes differentially expressed in tr1 cells and their use in the manufacture of immunoregulatory compositions - Google Patents

Abstract

Genes which are differentially expressed in certain T cell populations are described together with their expression products (e.g. cognate proteins), cognate receptors, regulators, binding partners, and inhibitors or mimetics thereof. In particular, pharmaceutical compositions are described for treatment of an inflammatory or immune disorder and therapeutic and prophylactic methods based on their use, as targets for therapeutic intervention, of components of the Treg immunoregulatory pathway.

Description

IMMU OREGULATORY COMPOSITIONS

Field of the invention

The present invention is based, at least in part, on the elucidation of components of the Treg _lmmunoregulatory pathway In particular, the invention relates to genes which are differentially exυressed in certain T cell populations and to their expression products (e g cognate proteins), cognate receptors regulators, binding partners and inhibitors or mimetics thereof In particular, the invention relates to pharmaceutical compositions and therapeutic and prophylactic methods based on the use, as targets for therapeutic intervention, of components of the Treg lmmunoregulatory pathway

Backeround of the invention

Immunoregulation is of fundamental importance in the management and treatment of a wide variety of diseases and disorders One form of immunoregulation, immunosuppression, finds utility in a w ide vaπer of medical indications important examples include graft rejection, autoimmune and chronic lnflammatorv disorders In contrast, immunostimulation may be indicated m the treatment of infection and certain pro ferative disorders (such as cancer)

Thus, there is considerable interest in the development of therapeutic agents which act as immunoregulators

Among the principal mediators of the immune response and its regulation are various subsets of CD4~ T helper cells Once primed via T cell receptor (TCR) interaction, naive CD4⁺ T helper cells, designated ThO cells, differentiate into several functionally distinct subsets T helper 1 (Thl) lymphocytes contribute to cellular immunity, while T helper 2 (Th2) lymphocytes appear to contribute mainly to humoral immunity These subsets have characteristic cytokme profiles Thl lymphocytes produce 1L- 2, IFϊs- and TNF-β, while Th2 lymphocytes proαuce IL-4, IL-5 and IL-10 Thl cells may be induced by actuation in the presence of IFNγ and IL-12, whereas IL-4 can direct the differentiation of Th2 cells

It has recently become apparent that yet other subsets of CD4⁺ T cells are involved in immunoregulation These cells are referred to herein as T regulatory ceils (Treg cells) At least two different subsets of T regulatory cells have been described to date Groux et al (1997), Nature, Volume 389, pages 737-742 describe T regulatory cells 1 (Trl cells), which are reported to be driven by IL-10 and which suppress antigen-specific immune responses and actively downregulate certain pathological immune responses in vivo These Trl cells appear to be similar to (but distinct from) the TGF-β-secreting Th3 cells described in Letterio and Roberts (1998), Ann. Rev. Immunol., Volume 16, pages 137-161.

However, the full extent of the CD4⁺ T cell immunoregulatory network, both in terms of its cellular elements (i.e. the nature and number of its constituent T cell subsets) and biochemical elements (i.e. the molecular composition of the regulatory network(s)) remains obscure. Given the importance of immunoregulation in medicine, the lack of knowledge in this area is a significant obstacle to the development of effective immunotherapeutic agents.

Summary of the invention

The present invention is based, at least in part, on the elucidation of elements of the Treg immunoregulatory network and on the development of a general approach for studying the network. In particular, it has now been discovered that the pattern of gene expression in certain cell populations which are enriched in Treg cells is quite different from that in Th l- and Th2-enriched populations. This finding was quite unexpected, since Treg cells have been suggested to suppress Thl and/or Th2 responses via a mechanism which does not require differential gene expression (viz. a passive competition for cytokines or antigen presenting cells - see Waldmann and Cobbold (1 98), Ann. Rev. Immunology 16, pages 619-644).

Thus, in a first aspect of the present invention there is provided an isolated gene obtainable by a process comprising the steps of: (a) providing a Thl -enriched cell population, a Th2-enriched cell population and a Treg-enriched cell population; and (b) comparing the relative expression of one or more genes in said cell populations; thereby (c) identifying a gene which is differentially expressed in the cell populations; and then (d) isolating the gene identified in step (c).

It should be noted that the populations provided in step (a) need not be clonal populations, and they may therefore contain cells other than the T cells in which they are enriched. Thus, the Treg-enriched population may contain ancillary cells which, though not themselves Treg cells, are supported and/or stimulated by the Treg cells and so neverthelss contribute to the Treg regulatory pathway. Thus, the gene of the invention may be any gene which is differentially expressed in the populations when examined as a whole, so that the genes of the invention may include those which, at the cellular level, are differentially expressed not in Treg cells but in other ancillary cell subpopulations.

Preferably, the gene identified in step (c) is one which is over- or under-expressed in the Treg-enriched population relative to the Thl- and Th2-enriched populations. The differentially expressed genes of the invention comprise the constituent generic elements of the Treg immunoregulatory network. As such, they permit the identification of a wide range of novel targets for immunoregulatory agents. For example, those skilled in the art will appreciate that knowledge of (at least part of) the sequence of a given gene permits isolation or synthesis of the corresponding protein. Such proteins form a particularly important aspect of the invention, since they (or their agonises/antagonists) can be used as the basis for novel immunoregulatory drugs.

The Treg-enriched cell population is preferably that prepared as described herein (and referred to hereinafter as Trl/Treg cells). However, any other enriched population of Treg subsets (e.g. based on the known Tregl and Th3 cells mentioned earlier) from any suitable source can also be used. Thus, the principal elements of the Treg immunoregulatory network may be elucidated by using any Treg subset as a reference population.

The term "isolated" is used herein to indicate that the material exists in a physical milieu distinct from that in which it occurs in nature. For example, the isolated gene or protein may be substantially isolated with respect to the complex cellular milieu in which it naturally occurs. The absolute level of purity is not critical, and those skilled in the art can readily determine appropriate levels of purity according to the use to which the material is to be put.

In many circumstances, the isolated material will form part of a composition (for example a more or less crude extract containing many other substances), buffer system or pharmaceutical excipient, which may for example contain other components (including proteins, such as albumin).

In other circumstances, the isolated material may be purified to essential homogeneity, for example (and in the case of the proteins of the invention) as determined by PAGE or column chromatography (for example HPLC or mass spectrometry). In certain preferred embodiments where the material forms part of a pharmaceutical composition, the isolated material of the invention may be essentially the sole active ingredient of the composition. Particularly preferred are compositions in which the material of the invention is present as the sole active ingredient in a pharmaceutical composition.

The term "isolated" as applied to the genes and nucleic acids (both RNA and DNA) of the invention also indicates that the genes/nucleic acids may be present in any of a wide variety of vectors and in any of a wide variety of host cells (or other milieu, such as buffers, viruses or cellular extracts).

Examples of genes according to the invention are listed in Table 1. In this table, the abundance of each tag is indicated on the left-hand side, while the columns on the right hand side indicate the degree to which a transcript is up/down-modulated with a statistical confidence of 95%. Table 1

Trl AT ,95% reg IN Total Tag Sequence oπfideπce

92 0 94 CGATCTGGCC MMCP-5 mast cell sεrine proteinase 24

85 0 89 AAGTCCTGCA m C-CPA carboxypeptidase A 17

44 0 44 TCAACTCGAG ESTs 14

35 0 35 GAGG ! 1 I i i I no match 11

50 2 53 AACACTTGGA no match 10

29 0 32 GATTGTCAGA gly96 : unknow function, homologue 5.6

22 0 23 TGGAAGAAAG ESTs 5.4

21 0 22 AATGAGTTGC trγptophan hydroxyiase 5.1

17 0 17 CCACGTGCCT no match 4.8

24 2 27 GTGGACTCAA EST 4.5

54 0 72 GGATATGTGG egr-1 = zif/268 = krox-24 4.1

99 18 146 CCCTGAGTCC beta-actin 3.7

16 2 18 AACTGCTTCA no match 3.2

23 0 29 CTGCTTTGTG proenkephalin 3.2

31 3 42 ATCAACACCG Gs alpha subuπR 3.1

11 0 1 1 AGAGAGAGAG PAF-AH : platelet activating factor 2.9

11 0 1 1 CCTGAGCTCC no match 2.9

12 0 13 ACCCAAGGTT no match 2.7

34 1 50 ATTGTGGTGC LAPTM5 2.7

13 2 15 AAGGCAGAGG no match 2.5

15 2 20 AACTCACAAT ESTs 2.1

8 0 8 TTGGTAGCTG no match 2

35 3 59 ACAACTTCCT GM2 activator protein (Gm2a) 2

33 19 57 CCTCAGCCTG cathepsin 0 (EC 3.4.23.5). 1.9

11 0 1 ACCATTACTG ESTs 1.8

8 0 9 CTAAGGAGAT ESTs 1.7

7 0 7 ATGTAGAAGG no match 1.7

7 0 7 CAATAAATAG Fc-epsilon-RI-alpha-suounit 1.7

7 0 7 CCTTTAACCC no match 1.7

7 0 7 GAAGCGTGGG no match 1.7

7 0 7 GCTGCGAGGG no match 1.7

7 0 7 TTAAGATATG ιnterleukιn-3 recεptor beta-subunit 1.7

24 12 43 CACGGCTTTC L26 ribosomal protein 1.6

1 14 5 21 TGTAGTGTAA ribosomai protein S8 1.6

9 18 1 30 TTTCTGTATG no match 1.6

25 0 45 GGGCATTTGA no match 1.6

9 15 0 24 AGCAGATTCT leukocystatm 1.5

1 7 0 8 AAGCATCCCG no match 1.4

0 7 1 8 GAGTGGATTC CD63 1.4

0 7 1 8 TTTACATACA no match 1.4

0 6 0 6 CAAACTAGAA no match 1.4

0 6 0 6 CACGTGAATG no match 1.4

0 6 0 6 GGGCCCTGCT ESTs 1.4

0 .6 0 6 TCAACTCCAG no match 1.4

0 5 0 6 TCAGAGACCC ESTs 1.4

0 6 0 6 TCTTGAATCC no match 1.4

0 6 0 6 TGCAAAATAA no match 1.46 29 5 58 TTGGGATACC EN-7 = Rac2 GTP-binding protein 1.4

4 11 0 17 AACATACAAG L1 repeat family region 1.3 n 8 0 1 1 CCTGGTGCCT ESTs 1.3

3 8 0 1 1 GTTACTTATG class I cytokiπe recεptor (Wsx1 ) 1.33 23 1 46 TGGAACAATG secretory granule proteoglycan core 1.3 Table 1 (cont.)

0 6 10 0 16 TAAGCCTTTC no match 1.2

0 0 9 5 14 ATTTGACTGG ESTs 1.2

2 2 9 1 14 CTAATAAAGC MNSFb 1.2

1 0 7 1 9 AAAAGGAGΛT no match 1 2

0 2 7 0 9 TGAAACACTG MA-3 = TIS (inducer of apoptosis) 1.2

0 2 7 0 9 TGAGAGGGAA ESTs 1.2

0 0 6 1 7 CCAAAAAAAA clathπn-assoαated AP-2 complex 1 2

0 1 6 0 7 GCTGAACACA ESTs 1.2

0 1 6 0 7 GTAAGCAAAA EST 1.2

0 0 5 0 5 AGCGTCGCTG ESTs 1.2

0 0 5 0 5 GAAAAAAAAA EST 1.2

0 0 5 0 5 GGTTAAATGT cathepsin L 1.2

0 0 5 0 5 GTAACAACGC no match 1.2

0 0 5 0 5 GTACTGGTAT ESTs 1.2

100 1 10 37 4 251 AGTTGGAAAC ESTs -1 6

12 16 1 4 33 CCTGGCAGAG ESTs -1 7

40 24 7 18 89 GATTCCGTGA ESTs -2

61 69 17 53 200 TTGGTGAAGG no match -2.5

39 47 4 24 114 TCCCCGTACA EST -3 6

149 128 19 6 302 I I I I CAAAAA beta-2-mιcroglobulin -3.7

7 9 0 2 18 GACAACGCCA ESTs -1.3

13 10 2 3 28 TTATATAGTG Interleukin 3 -1.2

8 7 2 10 27 AGGCTGACAA ESTs -1.2

9 7 1 6 23 TCCTATTAAG EST -1.2

5 8 1 8 22 GCCTTTATGA πbosomal protein S24 -1 2

25 22 7 1 55 TTGATCATCA GDP-dissociation inhibitor -1 2

41 23 12 18 94 ATGACTGATA ESTs - 1 4

35 20 9 1 1 75 CACAAACGGT ESTs -1.4

29 27 9 10 75 GAGCG I I I I G cyclophilin (EC 5.2.1.8) -1.4

57 55 19 18 149 AAGGTGGAAG ESTs -1.6

22 25 3 0 50 AGACCGGAAG CD3 delta chain -1.8

12 15 2 0 29 GTGGCTCATA TACE= TNFalpha converting enzyme -1 2 These genes listed in Table 1 are mouse genes, but the invention also contemplates homologues, derivatives, allehc forms, species variants, mutant forms or equivalents thereof

The term "homologue" is used herein m two distinct senses It is used sensv stricto to define the corresponding gene from a different organism (l e a species variant), in which case there is a direct evolutionary relationship between the gene and its homologue This may be reflected in a structural and functional equivalence, the gene and its homologue performing the same role in each organism

Particularly preferred species variants according to the invention are the human homologues of each of the mouse genes shown in Table 1

The term is also used herein sensu lato to define a gene which is structurally similar (l e not necessarily related and/or structurally and functionally equivalent) to a given (reference) gene In this sense, homolog} is recognised on the basis of purely structural criteria by the presence of nucleic acid sequence For the purposes of the invention, homologues may be recognised as those genes the corresponding DNAs of which-are capable of specifically or selectively cross-hybridizing, or which can cross-h bπdιze under selective, appropriate and/or appropriately stringent hybridization conditions

The term ' selectively or specifically (cross)hybπdιzιng" in this context indicates that the sequences of the corresponding ssDNAs are such that bindmg to a unique (or small class) of homologous sequences can be obtained under more or less stringent hybridization conditions This method of the invention is not dependent on any particular hybridization conditions, which can readily be determined by the skilled worker (e g by routine trial and error or on the basis of thermodynamic considerations) One example of hybridization conditions that can be used involves a pre-u ashing solution of 5 X SSC, 0 5% SDS, 1 0 M EDTA (pH8 0) and attempting hybridization overnight at 55°C using 5 X SSC

As applied to the proteins encoded by the genes of the invention, a homologue may be used herein to define a protein which has an amino acid sequence which differs from the reference protein (e g the native muπne protein) because of one or more deletions, insertions or substitutions The homologous amino acid sequence preferably is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical The percent identity may be determined, for example by comparing sequence information using the GAP computer program, version 6 0 described by Devereux et al (1984), Nucl Acids Res 12.387 This program uses the alignment method of Needleman and Wunsch (1970), J Mol Biol 48 443, as revised by Smith and Waterman (1981), Adv Appl Math 2 482 The preferred default parameters for the GAP program include (1) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides. and the weighted comDaπson matrix of Gπbskov and Burgess (1986) Nucl Acids Res. 14 6745, as described by Schwartz and Dayhoff, eds.(1979), Atlas of Protem Sequence and Structure, National Biomedical Research Foundation, pp 353-358, (2) a penalty of 3 0 for each gap and an additional 0 1 penalty for each symbol in each gap, and (3) no penalty for end gaps

Protem homologues may comprise conservatively substituted sequences, meaning that a given ammo acid residue is replaced by a residue having similar physiochemical characteπstics Conservative substitutions are well known in the art and mclude substitution of one aliphatic residue for another (such as lie, Val, Leu or Ala for one another), or substitutions of one polar residue for another (such as between Lys and Arg, Glu and Asp, or Gin and Asn) Conventional procedures and methods can be used for making and using such homologues Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known and routineh performed

The term "derivative ' as applied herein to both genes and protems is used to define modified versions of the genes and proteins Such derivatives may mclude fusion proteins, in which the protems of the invention have been fused to one or more different protems or peptides (for example an antibody or a protein domain conferring a biochemical activity, to act as a label, or to facilitate purification) The derivatives ma% also be products of synthetic processes which use a gene or protem of the invention as a starting material or reactant

The term mutant form" is used herein to define genes in which one or more nucleotides have been added deleted or substituted The mutant forms of the invention therefore include fragments, truncates and chimeras The mutant forms of the genes encode corresponding mutant proteins, termed "mutems' these are proteins in which one or more ammo acids have been added, deleted or substituted The muteins of the invention therefore include fragments, truncates and fusion proteins

The muteins of the invention also include proteins in which mutations have been introduced which effectively promote or impair one or more activities of the protein, for example mutations which promote or impair the function of a receptor, a recognition sequence or an effector binding site

Muteins may be produced by any convenient method Conveniently, site-directed mutagenesis with mutagenic ohgonucleotides may be employed using a double stranded template (pBluescπpt KS II ™ construct containing the gene After verifying each mutant derivative by sequencing, the mutated gene is excised and inserted into a suitable vector so that the modified protein can be over-expressed and purified The term "equivalent" as used herein and applied to the materials of the invention defines materials (e.g. protems, DNA etc.) which exhibit substantially the same functions as those of the materials of the invention while differing in structure (e.g. nucleotide or amino acid sequence). Such equivalents may be generated for example by identifying sequences of functional importance (e.g. by identifying conserved or canonical sequences or by mutagenesis followed by functional assay), selecting an amino acid sequence on that basis and then synthesising a peptide based on the selected amino acid sequence. Such synthesis can be achieved by any of many different methods known in the art, including solid phase peptide synthesis (to generate synthetic peptides) and the assembly (and subsequent cloning) of oligonucleotides.

The homologues, fragments, muteins, equivalents or derivatives of the proteins of the invention may also be defined inter alia as those proteins which cross-react with antibodies to the proteins of the invention.

The relative expression of the genes of the invention may be compared by any one of a number of standard techniques. Such techniques may measure expression at various levels, for example at the level of gene transcription or at the level of translation. A particularly convenient technique is described by Velculescu et al. (1995), Science, Vol. 270, pages 484-487. The technique, referred to herein as serial analysis of gene expression (SAGE), allows the quantitative and simultaneous analysis of a large number of transcripts. Other techniques based on an analysis of the nature and quantities of the proteins produced by the cells (proteomic analysis), for example using 2-dimensional chromatography and microsequencing, may also be used.

The invention also contemplates an isolated regulator of the gene of the invention. The gene regulator may be an activator or repressor of transcription of the gene, or antisense nucleic acid corresponding to the gene.

The invention also contemplates an isolated regulator of the protein of the invention. The protein regulator may be an agonist or antagonist of the protein, and may be selected from a cognate receptor of the protein, an antibody or antibody fragment which blocks the activity of the protein or its cognate receptor, a mimetic, an activator or repressor of transcription of a gene encoding a cognate receptor of the protein, a nucleic acid encoding any of (a) to (d) or antisense DNA corresponding to the nucleic acid of(e).

The invention also contemplates an isolated binding partner for the gene of the invention. The binding paπner may be nucleic acid (optionally, single stranded nucleic acid). Also contemplated is an isolated binding partner for the protem of the invention as well as an isolated binding partner for the regulator of the invention The binding partner for the protem or regulator preferably comprises an antibody (or antibody derivative) specific for (or selectively reactive with) the protein or regulator The antibody may be a monoclonal antibody, and may be labelled

In another aspect, the invention relates to an isolated single stranded nucleic acid comprising the complement of the coding or non-codmg strand of the gene of the invention Also provided according to the invention is nucleic acid hybπdizable with the gene of the invention Such nucleic acids may function as probes

In another aspect of the invention there is provided anti-sense DNA corresponding to the gene of the invention Such DNA may be used to regulate the expression of the cognate gene in VTVO, and may therefore form the basis of therapeutic compositions

The un entioπ also contemplates a vector (e g an expression vector) comprising the gene of the invention The nature of the vector is not critical to the invention Any suitable vector may be used, including plasmid, virus, bacteπophage, transposon, minichromosome, posome or mechanical carrier

The expression vectors of the invention are DNA constructs suitable fo> expressing which may mclude (a) a regulatory element (e g a promoter, operator, activator, repressor and/or enhancer), (b) a structural or coding sequence which is transcribed into mRNA and (c) appropriate transcription, translation, initiation and termination sequences They may also contain sequence encoding any of various tags (e g to facilitate subsequent purification of the expressed protem, such as affinity (e g His) tags)

Particularh preferred are vectors which comprise an expression element or elements operably linked to the DNA of the invention to provide for expression thereof at suitable levels Any of a wide variety of expression elements may be used, and the expression element or elements may for example be selected from promoters, enhancers, πbosome binding sites, operators and activating sequences Such expression elements may comprise an enhancer, and for example may be regulatable, for example being inducible the addition of an inducer)

As used herein, the term "operably linked" refers to a condition in which portions of a linear DNA sequence are capable of influencing the activity of other portions of the same linear DNA sequence For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates m the secretion of the polypeptide, a promoter is operabK linked to a coding sequence if it controls the transcription of the sequence, a πbosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation The vector may further compnse a positive selectable marker and/or a negative selectable marker The use of a positive selectable marker facilitates the selection and/or identification of cells containing the vector

In another aspect, the invention relates to a host cell comprismg tne vector of the invention Any suitable host cell may be used, including prokaryotic host cells (such as Escher chia coli, Streptomyces spp and Bacillus s btilis) and eukaryotic host cells

Also provided accordmg to the invention is a pharmaceutical composition comprismg the gene, protem, regulator binding partner, nucleic acid, vector or host cell of the mvention as an active ingredient, the gene, protein, regulator, binding partner, nucleic acid, vector or host cell optionally being present at a concentration sufficient to confer biological activity on the pharmaceutical composition

A pharmaceutical composition is a solid or liquid composition m a form, concentration and level of purity suitable for administration to a patient (e g a human or animal patient) upon which administration it can elicit the desired physiological changes The composition may be an immunoregulatory composition, for example an lmmuno-suppressive composition, immuno-stimulatory composition or anti-inflammatory composition

The gene protem, regulator, bindmg partner, nucleic acid, vector or host cell of the invention may be for use in medicine (for example in therapy, prophylaxis or diagnosis) and/or provided in a pharmaceutical excipient, a unit dosage form or in a form suitable for local or systemic administration

The indention also contemplates a diagnostic kit or reagent comprismg the gene, protem, regulator, binding partner, nucleic acid, vector or host cell of the invention

The invention also contemplates a cell typing reagent comprising the gene, protein, regulator, binding partner nucleic acid, vector or host cell of the invention

In another aspect, the mvention provides an ex vivo method for analysing the status of the Treg immunoregulatory pathway in a biological sample comprising the step of determining the presence or activity of (a) a gene of the invention, or (b) a cognate expression product(s) of said gene, or (c) a biochemical marker of the activity of said gene, or (d) Thl and/or Th2 and/or Treg cells

In yet another aspect, the invention provides an ex vivo method for detectmg Thl and/or Th2 and/or Treg cells in a biological sample comprising the step of contacting the sample with a reagent which selecrivel) binds to the gene, protem, regulator or bmdmg partner of the mvention Preferably, the reagent comprises the cell typing reagent of the mvention

The detecting method of the mvention may be for detecting the presence of the cells or for determining the number of Thl and/or Th2 and/or Treg cells In preferred embodiments, the number of Thl cells relative to Th2 and/or Treg cells, or Th2 cells relative to Thl and/or Treg cells, or Treg cells relative to Thl and'or Th2 cells, may be determined

The aforementioned methods have many applications m diagnosis and in monitor g the efficacy and/or endpoint of various treatments Thus, in another embodiment, the mvention relates to an ex vivo method for monitoring the progress of an anti-mflammatory or immunoregulatory treatment in a sub_ject or the progress of an inflammatory or immune disorder in a subject, the method comprismg the step of analysing the status of the Treg immunoregulatory pathway in a sample from the subject Preferably, the method monitors the efficacy or endpoint of a treatment

Also contemplated by the mvention is an ex \ ivo method for determining the posology of an anti- lnflammatory or immuno-regulatory drug administration regime in a subject undergoing treatment comprising the step of analysing the status of the Treg immunoregulatory pathway m a biological sample comprising the step of determining the presence or activity of (a) a gene of the mvention, or (b) a cognate expression product(s) of said gene, or (c) a biochemical marker of the activity of said gene, or (d) Thl and/or Th2 and/or Treg cells

The samples for use in the foregoing methods may be from an accessible body site, for example a mucous membrane of the vagma, anus, nose, urethra, cervix, skin, conjunctiva, mouth or throat The sample mav comprise a fluid or semi-solid (for example a bodily fluid or semi-solid, e g discharge, vomit, secretion, excreta, urine, sputum, plasma, serum or blood) Alternatively, the sample may compnse a solid (e g stool, tissue or biopsy sample) or a cell culture (e g a lymphocyte culture) Particularl) preferred are samples from urine, serum, plasma or blood

Also contemplated by the invention is the use of the gene, protem, regulator, bmdmg partner, nucleic acid, vector or host cell of the invention for the manufacture of a medicament for use in the treatment of an inflammatory or immune disorder

Also contemplated by the invention is the use of the gene, protein, regulator, binding partner, nucleic acid, vector or host cell of the invention for the manufacture of an agent for use in a bipartite anti- mflammatory or immunoregulatory treatment, the first part comprising administration of an anti- lnflammatory or immunoregulatory agent and the second part comprising monitormg the progress of the treatment by analysing the status of the Treg immunoregulatory pathway m a biological sample comprising the step of determmmg the presence or activity of (a) a gene of the mvention, or (b) a cognate expression product(s) of said gene, or (c) a biochemical marker of the activity of said gene, or (d) Thl and/or Th2 and/or Treg cells Preferably, the efficacy and or endpoint of treatment is monitored by the method of the invention

Also contemplated by the mvention is the use of an anti-mflammatory or immunoregulatory agent for the manufacture of a medicament for the treatment of an inflammatory or immune disorder m a sub_ject, characterized in that the treatment comprises the step of analysing the status of the Treg immunoregulatory pathway the subject determmmg the presence or activity of (a) a gene of the mvention, or (b) a cognate expression product(s) of said gene, or (c) a biochemical marker of the activity of said gene, or (d) Thl and or Th2 and/or Treg cells

The biochemical marker may for example comprise a molecule which is produced, directly or indirecth by the gene and which therefore serves as an index of the expression of said gene

The step of analysing the status of the Treg immunoregulatory pathway in the subject may be for monitormg the efficacy of an anti-inflammatory or unmunoregulatory treatment, or for determmmg the posolog of an anti-mflammatory or immunoregulatory drug administration regime

In another aspect, the mvention provides a process for producing a pharmaceutical composition comprismg the steps of

(a) providing a test system comprising the Treg immunoregulatory pathway (or a component thereof), (b) providing candidate drugs,

(c) screening the candidate drugs by contacting the test system with one of the candidate drugs and analysing the interaction of the candidate drug with the test system, wherein the nature of the interaction is an index of pharmaceutical activity, and optionally

(d) synthesising or purifying a drug having pharmaceutical activity on the basis of the identity of the candidate drug screened in step (c)

Also contemplated is a pharmaceutical composition produced by (or obtainable by) the aforementioned process or a derivative thereof

In another aspect, the invention provides a process for producing the gene, protein, regulator, binding partner, nucleic acid or vector of the invention comprising the steps of (a) cultuπng the host cell of the invention, and (b) purifying the gene, protem, regulator, binding partner, nucleic acid or vector from the cultured host cell (e g from a culture supernatant or cell fraction)

In another aspect, the invention provides an isolated Treg cell (which may be capable of suppressing the proliferation and cytokme production of Thl and Th2 cells), said ce'l having a gene expression profile substannally as shown in Table 1 Preferably, the gene expression profile is such that the expression of at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the genes listed in Table 1 are up- or down- regulated relative to Thl and Th2 cells at least to the extent mdicated in the Table

The cell of the mvention may be used as a test system in the preparation and screenmg of candidate drugs, or directly (in adoptive immunotherapy protocols) in therapy or prophylaxis In the latter case, the cell may be used in immunoregulation (e g immunosuppression or lmmunostimulation) or the treatment of inflammation When used m therapy, the cells of the invention may be administered by any convenient method, for example by site-specific instillation (e g into a capillary bed or into a vessel via a catneter)

Medical applications

The mvention permits the isolation, synthesis and rational design of a wide l ange of novel medicaments and pharmaceuticals for use m therapy, prophylaxis and diagnosis The various forms of therapy, prophylaxis and diagnosis in which the materials of the invention find application involve targeting the Treg immunoregulatory pathway Thus, the mvention finds application in therapies based on immunoregulation In some embodiments, the mvention is used to effect immunosuppression, while m other embodiments lmmunostimulation is achieved

A particularly important application of immunosuppressive embodiments is the treatment, control or management of inflammation Thus, the invention provides anti-mflammatory agents for use in a wide range of applications, for example in the treatment or prophylaxis of chronic inflammatory disorders The mvention may also be used to treat damage to cells resulting from the effects of inflammatory response Thus, the mvention finds application in the treatment of rheumatoid and osteo-arthπtis and of glomerular nephritis, diabetes, inflammatory bowel disease, vascular diseases such as atheroclerosis and vascuhtis and skin diseases such as psoriasis and dermatitis The mvention may also be used to prevent or treat graft rejection

Other diseases which may be treated according to the invention include Crohn's disease, ulcerative colitis, Type I diabetes, lupus erythematosus, auto-immune disorders, hypersensitivity disorders and multiple sclerosis A variety of lung diseases are associated with airway inflammation, including chronic bronchitis, emphysema, ldiopathic pulmonary fibrosis and asthma, and these also may be treated accordmg to the invention

The lmmunostimulants of the invention find particular application in the treatment of infections and prohferative disorders (such as cancer)

Diagnostic applications

There is a need to be able to monitor not only the progress of a disease or disorder but also its therapy Indeed these activities may be complementary where the posology of drug administration and or drug selection influence the response to the treatment, smce efficacy and/or endpoint can be monitored during the course of treatment In the case of diseases where the immune and related defence (e g mflammatory ) systems may be mvolved, measures of the responsive-behaviour of those systems may provide useful information to guide therapy For example, measures of blood C-reactive protein have provided a good index of inflammation and can be used to manage the appropriate treatment

The genes and their cognate protein products described herein form part of the Treg immunoregulatory network As such their activity can be used as an index of the status of the network they can be used as "markers' which are either present or absent in accessible body fluids and tissues (usually blood, serum urine or biopsy material)

In the case of specific immune responses mediated by lymophocytes-it is known that only a small percentage of anyone's lymphocytes get involved in any immune response However, these need to circulate and if an active response is happening then the blood lymphocytes may disproportionately reflect the behaviour of this small subset, as cells circulate from one site to another The blood may then be an indicator of changes in the behaviour of small subsets of lymphocytes, if one had sensitive enough techniques to measure their change in behaviour, or if one could easily isolate or identify the few antigen-specific cells As the blood is easily accessible then it offers the opportunity to monitor changes in the behaviour of a small subset of lymphocytes and related cells in response to a disease process As these cells might also secret their products then analysis of the plasma or serum, as well as urme may pick up such products and their degraded forms

Thus, the mvention finds application in monitoring during and after therapy for multiple sclerosis The blood may initially show evidence of Thl behaviour directed to brain antigens-there are numerous documented examples of increases in the frequency of antigen-specific cells m acute episodes of the disease. These cells activate particular genes of the Treg immunoregulatory network and can be identified according to the invention. Successful treatment would damp this activation, lowering the expression of these genes and allowing the efficacy and/or endpoint of the treatment to be determined.

Many diseases might benefit from such an approach, mcluding -rheumatoid arthritis, psoriasis, Crohn's disease, ulcerative colitis, Type I diabetes, lupus erythematosus, and other hypersensitivity and/or autoimmune disorders.

Exemplification

The invention will now be described in more detail with reference to several Examples. These are for exemplary purposes only and are not intended to limit the invention in any way.

Example 1 : Preparation of Treg/Trl clone D l fa Treg-enriched cell population)

Regulatory T cell clones were generated from the spleen of a naϊve AlxRAG-/- mouse (see WO 99/16867 and Zelenika et al. (1998) Journal of Immunology, 161, pages 1868-1874) essentially following the method of Groux et al. (supra). 5xl 0³ spleen cells were cultured with 5x l 0⁶ mitomycin C treated male CBA spleen cells (male stimulators) in 2 ml volumes in RPMI 1640 medium containing 10% foetal calf serum (FCS) and 50ng/ml recombinant murine IL-10 (Genzyme) for 7 days at which time spent medium was removed and fresh stimulator cells and medium containing IL-10 added. After three 7 day cycles of stimulation in IL-10 the viable cells were harvested by separation over Ficoll/Hypaque and cloned by limit dilution ( 1 cell/200 microlitre well) on anti-CD3 coated plates (1452C1 1, 50 microgram/ml) in the presence of mitomycin treated female CBA spleen feeder cells (10⁷ /ml) in RPMI 1640 containing 10% FCS and 20U/ml recombinant murine IL-2 (rmIL-2). Wells containing growing cells were progressively expanded into 48 x 1 l and then 24 x 2ml well plates with male stimulators in RPMI 1640 containing 10% FCS, rmIL-2 (20U/ml) and recombinant murine IL-4 (rmIL-4 20U/mI). Once established the clones that continued to proliferate to male stimulators were maintained by harvesting every 14 days on Ficoll/Hypaque and then passaging 2xl0⁵ cells in 24x2ml well plates with 5xl0⁶ male CBA stimulator cells/well in RPMI 1640 medium containing 10% FCS, rmIL-2 (20 U/ml) plus rmIL-4 (20U/ml).

Three different clones were isolated by this method, and one (TrlDl) was selected for SAGE analysis. Some of the differential genes have been confirmed by testing on the two other clones.

Thl and Th2 cells for use in the analysis were prepared as described in Zelenika et al. (supra). 1.6

Example 2: Testing for mRNA expression of differentially expressed Treg gene sequences by quantitative real-time RT-PCR.

This example demonstrates how it is possible to test for the level of mRNA, and therefore the level of gene expression, in different cell or tissue samples. In this case total RNA was obtained from each of the Thl, Th2 and Treg clones, as well as normal spleen cells from normal CBA/Ca mice that were in the process of rejecting a B 10.BR skin graft, using standard methodology. Each sample was then treated with DNA-ase to ensure that no PCR product would be generated from contaminating genomic DNA. First strand cDNA was then generated using Reverse Transcriptase (RT) together with either random hexamers or polyA primers. This material was then subjected to real time quantitiative PCR using the standard protocols (User Bulletin #5: Multiplex PCR with TaqMan VIC Probes, and User Bulletin -2: Relative Quantitation of Gene Expression) for the Perkin Elmer Applied Biosystems ABI Prism 7700 Sequence Detection System. In brief, this uses standard PCR 5' and 3 ' primers to generate a specific PCR product for the gene of interest, and utilises an internal oligonucleotide specific for the product that is doubly labelled with a fluorescent dye (eg. FAM or VIC) and a quencher dye (eg.

TAMRA). Primers and probes used in this example are shown in Table 2: these were designed from the appropriate gene or cDNA sequence using the PE Applied Biosystems software (Primer Express). Due to fluorescence energy transfer this double labelled probe does not itself fluoresce at the FAM or VIC wavelengths, but will anneal quantitatively to the DNA product of each PCR cycle. During the next extension phase of the PCR the specifically bound probe will be cleaved by the Taq polymerase, releasing an amount of fluorescent dye proportional to the product of that cycle. This fluorescence is detected in the ABI Prism 7700 machine by scanning the PCR reactions in an optical 96 well plate multiple times for each cycle, generating a real time semi-logarithmic plot of the PCR reaction that can be used to accurately calculate a threshold cycle (Ct) for each reaction. By multiplexing (using two dyes such as FAM and VIC that fluoresce at different wavelengths) the primers and probes of the gene of interest (FAM probe) with a housekeeping gene such as HPRT or ribosomal RNA (VIC probe), that is expressed at a similar level in all cells and tissues, it is possible to normalise the levels of the gene of interest across the different RNA samples, allowing correction for any differences in amounts or quality of the RNA that might have been introduced during the extraction, DNA-ase treatment, or cDNA generation steps. In the example shown in Table 3, the amount of HPRT as measured by the VIC probe in each sample has been arbitrarily defined as 1000 units, and all the measurements of the three other Treg or TregTh2 markers that are shown (PAFAH = PAF acetyl hydrolase; Enkephalin = Preproenkephalin; TPH = tryptophan hydoxylase; HPRT = hypoxanthine phosphoribosyl transferase) are given relative to these units.

This approach would allow rapid, thigh throughput, simple and automatic, measurement of a number of Thl , Th2 and Treg differential genes in, for example, blood samples from normal individuals compared to patients undergoing treatment, in order to monitor the status of the patient during their course of therapy.

Table 2: Primers and probes

5' primer 3' primer FAM/VIC probe

HPRT gaccggtcccgtcatgc tcataacctggttcatcatcgc VIC-acccgcagtcccagcgtcgtg-TAMRA

PAFAH tgatcagtgggaccctctgg gagagtgttgctgagccgg FAM-ctgggtcaccctttgacgcagtca-TAMRA

En ephalin aaatctgggagacctgcaagg gatctctcctccgttcgcttc FAM-tccaggcccgagttcccttgg-TAMRA

TPH tgcgacatcagccgagaac tgttggcgcagaagtccag FAM-ccccctgctgaagtcgcacgc-TAMRA

Table 3 : Real time quantitative PCR test for differential gene expression

mRWA species Thl Thl Trl Spleen

Arbitrary Units as measured by TaqMan RT-PCR

HPRT 1000 1000 1000 1000 By definition

PAFAH <lt <ιt 12,625t 152*

±o ±o + 149 +203

Enkephalin <0.01 3254 1 ,898 <0.01

±o +607 + 178 ±0

TPH 0.02 0.01 41 1 <0.01

+0.01 +0.01 + 103 +0

t Mean Standard Deviation of triplicate samples at two different dilutions * Mean + Standard Deviation of spleens from six individual, skin grafted mice

Example 3: Testing for expression of differentially expressed Treg gene by immunofluorescence specific for a biochemical product

In this example the expression of the Treg differentially expressed gene tryptophan hydroxylase is tested for indirectly by accumulation in Treg cells or tolerant T cells of the product of the biochemical pathway for which tryptophan hydroxylase is the rate limiting enzyme (i.e. serotonin). Both polyclonal antisera and at least one monoclonal antibody (YC5) are widely available for identification of cells containing serotonm after fixation oy formalin to generate the specific serotonin-protein con_jugate that the antibodies recognise In order to perform the test on a given sample of blood cells, tissue cells or other source of cells, it is necessary to first fix the sample in, for example 1% formaldehyde or paraformaldehyde, and then permeabilise the cells, for example using phosphate buffered saline contaming 0 5% saponm, and then stammg by standard methods of immunofluorescence with the anti- serotomn antibody, most conveniently conjugated directly with an appropriate fluorescent dye such as fluorescein lsothiocyanate (FITC) or indirectly using anti-species specific immunoglobulm (IgG) antibodies coupled to FITC or other appropriate dye In order to show that this expression is associated with T cells it is most convenient to perform this test under conditions of multiple stammg, usmg antibodies against other standard T cell or T cell subset markers, such as CD3 or CD4 that can be coupled to dyes with different spectral properties, such as PhycoErythrin (PE), Cy3, Cy5 or similar, as appropriate The cells are then analysed either by observation on a fluorescent microscope, confocal microscope fluorescence activated cell sorter (FACS), or cytofluorograph to determine the quantity of serotonm bound fluorescent antibody on a representative sample of individual T cells identified by the T cell marker fluorescence (see example FACS analysis - Figure 1 )

Example 4 Gene cloning from the 14 nucleotide tag

Many of the differentially expressed tag found in the SAGE libraries do not map to any published mouse sequence Two independent strategies can be used to characterise a cDNA sequence from which a tag has been originally derived

Virtual clon z uses the data produced by random sequencing of short cDNA fragments, called ESTs If one or more matching EST is found, they are analysed and compared usmg different softwares made available to all on the web A "virtual" cDNA sequence can be produced by usmg this procedure

Real bench clon ζ is necessary where no homology can be found m any of the databases This can bee done usmg different molecular techniques One way of proceeding, that has proven relatively easy and successful, is usmg what is called cloning by RACE-PCR

These two approaches are completely independent and can be in fact complementary

The initial tag sequence is as follows GCAGTGGTTC. All the tags were generated using an Nlalll restriction enzyme (CATG), therefore they all start with the corresponding restriction site Thus, the complete tag sequence, of 14 nucleotides, is CATGGCAGTGGTTC

Virtual clonmg The following EST sequence has been pulled out by the tag , after searches through mouse ESTs databases usmg the NCBI site http //www ncbi nlm nih gov

>gι|3733312|gb|AIl 82674 1|AI182674 ub73g05 rl Soares mouse mammary gland NMLMG Mus musculus cDNA clone IMAGE 1383416 5', mR A sequence

GAACACACAATCAAAACTTCTCCTGGAATAAATCATCTGACATCAGATCCTTCCCATTGTC TGTACTGTTTCTGCTGCCCTGGAAACC ΓGCAAGGACAGGAACAGACCACCATGGCAGTG GTTCCTGGAGGTGCTCCAC CTTCAGAGAAT

The tag is underlined

The next step was to create a contig (organised overlapping ESTs fragments) and to derive a consensus sequence from it This was done usmg freely available software (available on the website http //gcg tigem lt/BLASTEXTRACT/estextract html)

The final cDNA sequence obtained is set out below

ATTCGGCACGATGGGTGAACACACAATCAAAACTTCTCCTGGAATAAATCATCTGACATCA

GATCCTTCCCATTGTCTGTACTGTTTCTGCTGCCCTGGAAACC/^rσCAAGGACAGGAACAG

ACCACCATGGCAGTGGTTCCTGGAGGTGCTCCACCTTCAG AGAATTCTGTTATGACATCA CAAATGTGGAATGAGAAGAAGGAGAAATTCTTGAAGGGGGAACCAAAGTCCTTGGGGTTT TACAAGTTΛTGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTTGACAACTTTATTT TCTGAAACTACCCACTTCAGTGATGTTAATGGTCCCAATTTGGGGATCAATAATGTTCATT GTCTCCGGATCCCTGTCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATT TGGTATGTTTTGCTATGGAAAAGGAGTAATTTCATCAACTATGCATATATCTGCTAAGATA TAA. GGGGTTAATTCTATTTTCCTAAAATCACAGCTATGGGCTTTAGAGGCACCTGACTTT CAAAAGTGTAGCTGAGCTACTGATTCATAACAAGT

The tag is underlined and it is indeed located next to the most 3' Nlalll site

This contig does not contain an open readmg frame (ORF) However ESTs sequences are full of mistakes, therefore an ORF could be hidden within the sequence of the clone A carefull analysis of the sequence showed that a long ORF could be generated by shifting through the 3 different frames The "virtual cDNA" can then be used for homology searches, and in this case significant homologies have been found with the Mouse CD20 antigen, particularly within the region coding for the transmembrane domains indicating that the new cD A may encode a membrane receptor This would be confirmed by the "real" cloning Bench clonins:

The real cloning is technically completely independent from the virtual cloning. However, _the obtention of a virtual cDNA, whenever it is possible, can be useful to cross-check the real clonin°. Cloning by RACE-PCR is a standard technique, although usually used from longer starting sequences. In our case, cDNAs produced from our T-cell clones have been ligated at their both ends by specific adaptors. Starting from the tag sequence of 14 nt, two fragments can be generated by PCR extension towards the 3' or the 5' end of the cDNA.

The primers used to generate the 5' fragment are underlined :

AGCAGTGGTAACAACGCAGAGATTCGGCACGATGGGTGAACACACA ATP A A A A ΓTTΓTΓ

CTGGAATAAATCATCTGACATCAGATCCTTCCCATTGTCTGTACTGTTTCTGCTGCCCTGGA AACCATGCAAGGACAGGAACAGACCACCATGGCAGTGGTTC The sequence of the 5' primer ( AGCAGTGGTAACAACGCAGAGA) corresponds to the 5' SMART adaptor designed by Clontech. The 3' primer is the tag itself (CATGGCAGTGGTTC)

The primers used to generate the 3' fragment are underlined :

CATGGCAGTGGTTCCTGGAGGTGCTCCACCTTCAGAGAATTCTGTTATGACATΓA ΓA A AT

GTGGAACGAGAAGAAGGAGAAATTCTTGAAGGGGGAACCAAAGTCCTTGGGGTTTTACAA GGTATGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTCGACAACTTTGGTTTTCT GAACTACCCACTTCAGTGATGTTAATGGTCCCAATTGGGGGATCAGTAGTGTCCATTGTCT CCGGATCCCTGGCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATTTGGT ATGTTTTGCTATGGAAAAGGAGTAATTTCATCAACTATGCATATATCTGCTAAGATATAAA GGGGTTAATTCTATTTTCCTAAAATCACAGCTATGGGCTTTAGAGGCACCTGACTTTCAAA AGTGTAGCTGAGCTACTGATTCATAACAAGTCTCATAAAAAAAAAAAAAAAAAAAAAGAC TCGAGTTGACATCGAG

The sequence of the 5' primer is the tag itself. The 3' primer sequence is derived from the polyA- anchored-3'adaptor.

A 3^rd round of PCR (and cloning) has been done using an internal primer in order to show that the 5' and the 3' fragments have been generated from a unique cDNA.

Tne complete cDNA sequence is: TTCGGCACGATGGGTGAACACACAATCAAAACTTCTCCTGGAATAAATCATCTGACATCAG ATCCTTCCCATTGTCTGTACTGTTTCTGCTGCCCTGGAAACCATGCAAGGACAGGAACAGA CCACCCATGGCAGTGGTTCCTGGAGGTGCTCCACCTTCAGAGAATTCTGTTATGACATCA CAAATGTGGAACGAGAAGAAGGAGAAATTCTTGAAGGGGGAACCAAAGTCCTTGGGGTTT TACAAGGTATGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTCGACAACTTTGGT TTTCTGAACTACCCACTTCAGTGATGTTAATGGTCCCAATTGGGGGATCAGTAGTGTCCAT TGTCTCCGGATCCCTGGCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAAT TTGGTATGTTTTGCTATGGAAAAGGAGTAATTTCATCAACTATGCATATATCTGCTAAGAT ATAAAGGGGTTAATTCTATTTTCCTAAAATCACAGCTATGGGCTTTAGAGGCACCTGACTT TCAAAAGTGTAGCTGAGCTACTGATTCATAACAAGTCTCAT

This new cDNA sequence contains an ORF:

MGEHTEKTSPGΓNHLTSDPSHCLYCFCCPGNHARTGTDHHGSGSWRCSTFREFCYDITNVEREE GEILEGGTKVLGVLQGMIAIΓNLSLGIIISTTLFSELPTSVMLMVPIGGSVVSIVSGSLAIAAGVTP TKCLCFAMEKE

The predicted protein deduced from that ORE shows 32% homology with 2 tetraspan proteins: Mouse CD20 receptor and the Human FcRIa.

This example shows that two independent methodologies can be used to determine the complete sequence of each of the gene transcripts corresponding to the genes listed in Table 1 and so permit their synthesis or isolation. The particular example described above encodes a previously unidentified protem that has 4 transmembrane domains (as shown by the analysis of hydrophobicity) and probably belongs to the 4TM family of proteins together with the CD20 antigen and the FcRIa.

As described herein, this protein may be potentially used as a biomarker of the Thl subset. An antibody could be raised against the predicted protein using standard methodology. Such an antibody would be a very useful tool for monitoring Thl cells in normal and pathological situations quite independently of the biological function of the predicted protein (for which further studies can be carried out).

Claims

1 An isolated gene obtainable by a process comprising the steps of

(a) providmg a Thl-enriched cell population, a Th2-enrιched cell population and a Treg- enriched cell population, and

(b) comparing the relative expression of one or more genes said populations, thereby

(c) identifying a gene which is differentially expressed m the populations, and then

(d) isolating the gene identified in step (c)

2 The gene of claim 1 wherem the gene identified in step (c) is one which is

(a) expressed at high levels m the Treg-enriched population relative to Thl and or Th2 cells, or

(b) expressed at low levels in the Treg-enriched population relative to Thl and/or Th2 cells

3 The gene of claim 1 or claim 2 wherein the gene is any one of the genes listed m Table 1 , or a homologue, derivative, allelic form, species variant, mutant form or equivalent thereof

4 The gene of claim 3 which is the human variant of any one of the genes listed Table 1

5 The gene of any one of claims 1 to 4 wherem the relative expression is compared step (b) by SAGE analy sis

6 The gene of any one of claims 1 to 4 wherem the relative expression is compared m step (b) by proteomic analysis

7 An isolated protem encoded by a gene as defined m any one of the precedmg claims

8 .An isolated regulator of the gene as defined in any one of the precedmg claims

9 The regulator of claim 8 which is selected from

(a) an activator or repressor of transcription of the gene,

(b) antisense nucleic acid corresponding to the gene

10 An isolated regulator of the protem as defined any one of the preceding claims

11 The regulator of claim 10 which is an agonist or antagonist of the protein

2. The regulator of claim 11 which is selected from

(a) a cognate receptor of the protem,

(b) an antibody or antibody fragment which blocks the activity of the protem or its cognate receptor,

(c) a mimetic,

(d) an activator or repressor of transcription of a gene encoding a cognate receptor of the protem,

(e) nucleic acid encoding any of (a) to (d),

(f) antisense DNA corresponding to the nucleic acid of (e)

13 An isolated bmdmg partner for the gene as defined in any one of claims 1 to 6

14 The bindmg partner of claim 13 which is nucleic acid (optionally, s gle stranded nucleic acid)

15 An isolated bmdmg partner for the protem as defined in claim 7

16 An isolated bmdmg partner for the regulator of any one claims 8 to 12

17 The bmdmg partner of claim 15 or claim 16 comprising an antibody (or antibody derivative) specific for (or selectively reactive with) the protem or regulator

18 Isolated smgle stranded nucleic acid comprismg the complement of the codmg or non-coding strand of the gene as defined in any one of claims 1 to 6

19 Nucleic acid hybπdizable with the gene of any one of claims 1 to 6

20 Antisense DNA corresponding to the gene of any one of claims 1 to 6

21 A vector comprismg the gene of any one of claims 1 to 6

22 A host cell comprismg the vector of claim 21

23 A pharmaceutical composition comprismg the gene, protein, regulator, bmdmg partner, nucleic acid, vector or host cell as defined in any one of the preceding claims as an active ingredient, the gene, prote , regulator, binding partner, nucleic acid, vector or host cell optionally being present at a concentration sufficient to confer biological activity on the pharmaceutical composition 4 The composition of claim 23 which is an anti-mflammatory composition

25 The composition of claim 23 which is an immunoregulatory composition

26 The composition of claim 25 which is an immuno-suppressive composition

27 The composition of claim 25 which is an lmmuno-stimulatory composition

28 The gene, protem, regulator, bmdmg partner, nucleic acid, vector or host cell as defined m any one of claims 1 to 22 which is

(a) for use in medicine (for example therapy, prophylaxis or diagnosis), and/or

(b) m a pharmaceutical excipient, a unit dosage form or m a form suitable for local or systemic administration

29 A diagnostic kit or reagent comprising the gene, protein, regulator, bmdmg partner, nucleic acid, vector or host cell of any one of claims 1 to 22

30 A cell typing reagent comprising the gene, protem, regulator, bmdmg parmer, nucleic acid, vector or host cell of any one of claims 1 to 22

31 An ex vivo method for analysing the status of the Treg immunoregulatory pathway in a biological sample comprising the step of determmmg the presence or activity of

(a) a gene as defined in any one of claims 1 to 6, or

(b) a cognate expression product(s) of said gene, or (c) a biochemical marker of the activity of said gene

(d) Thl and/or Th2 and/or Treg cells

32 An ex vivo method for detecting Thl and or Th2 and/or Treg cells m a biological sample compπsmg the step of contacting the sample with a reagent which selectively bmds to the gene, protein, regulator or bmdmg partner as defined in any one of claims 1 to 17

33 The method of claim 32 wherem the reagent comprises the cell typing reagent of claim 30

34 The method of claim 32 or claim 33 where the method is for detectmg the presence of the cells

35 The method of any one of claims 32 to 34 wherein the number of Th l and/or Th2 and/or Treg cells is determined 6 The method of claim 35 where the number of

(a) Thl cells relative to Th2 and or Treg cells, or

(b) Th2 cells relative to Thl and/or Treg cells, or (c) Treg cells relative to Thl and or Th2 cells, is determined

37 An ex vrvo method for monitormg

(a) the progress of an anti-mflammatory or immunoregulatory treatment m a sub_ject, or (b) the progress of an mflammatory or immune disorder m a subject, compπsmg the step of analysmg the status of the Treg unmunoregulatory pathway in the sample

38 The method of claim 37 wherem m (a) the efficacy or endpomt of the treatment is monitored

39 An ex v rvo method for determmmg the posology of an anti- flammatory or immuno-regulatory drug administration regime m a subject undergomg treatment comprismg the step of analysmg the status of the Treg immunoregulatory pathway according to the method of claim 3 1

40 Use of the gene, protein, regulator, binding partner, nucleic acid vector or host cell of any one of claims 1 to 22 for the manufacture of a medicament for use in the treatment of an mflammatory or immune disorder

41 Use of the gene, protein, regulator, bmdmg partner, nucleic acid, vector or host cell of any one of claims 1 to 22 for the manufacture of an agent for use in a bipartite anti-mflammatory or immunoregulatory treatment, the first part comprising administration of an anti-mflammatory or immunoregulatory agent and the second part compπsmg monitormg the progress of the treatment by analysmg the status of the Treg immunoregulatory pathway according to the method of claim 31

42 The use of claim 41 wherem the the efficacy and/or endpoint of treatment is monitored by the method of claim 37

43 Use of an anti-mflammatory or immunoregulatory agent for the manufacture of a medicament for the treatment of an inflammatory or immune disorder in a subject, characterized m that the treatment comprises the step of analysing the status of the Treg immunoregulatory pathway in the subject accordmg to the method of claim 31

44. Use of claim 43 wherein the step of analysing the status of the Treg immunoregulatory pathway in the subject is for:

(a) monitoring the efficacy of an anti-inflammatory or immunoregulatory treatment; or

(b) determining the posology of an anti-inflammatory or immunoregulatory drug administration regime.

45. A process for producing a pharmaceutical composition comprising the steps of:

(a) providing a test system comprising the Treg immunoregulatory pathway (or a component thereof); (b) providing candidate drugs;

(c) screening the candidate drugs by contacting the test system with one of the candidate drugs and analysing the interaction of the candidate drug with the test system, wherein the nature of the interaction is an index of pharmaceutical activity, and optionally

(d) synthesising or purifying a drug having pharmaceutical activity on the basis of the identity of the candidate drug screened in step (c).

46. A pharmaceutical composition produced by (or obtainable by) the process of 45, or a derivative thereof.

47 . A process for producing the gene, protein, regulator, binding parmer, nucleic acid or vector of any one of claims 1 to 21 comprising the steps of:

(a) culturing the host cell of claim 22, and

(c) purifying the gene, protein, regulator, binding partner, nucleic acid or vector from the cultured host cell (e.g. from a culture supernatant or cell fraction).

48. An isolated Treg cell having a gene expression profile substantially as shown in Table 1.

49. The Treg cell of claim 48 wherein the gene expression profile is such that the expression of at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the genes listed in Table 1 are up- or down-regulated relative to Th l and Th2 cells at least to the extent indicated in Table 1.

50. The Treg cell of claim 48 or claim 49 wherein the cell is capable of suppressing the proliferation and cytokine production of Thl and Th2 cells.

The cell of any one of claims 48 to 50, for use in therapy or prophylaxis.

2. Tne cell of claim 51 for use in immunoregulation (e.g. immunosuppression or immunostimulation) or the treatment of inflammation.