CA2386815A1 - Immunoregulatory compositions - Google Patents

Abstract

Genes which are differentially expressed in certain T cell populations are described together with their expression products (e.g. cognate proteins), cognate receptors, regulators, binding partners, and inhibitors or mimetics thereof. In particular, pharmaceutical compositions are described for treatment of an inflammatory or immune disorder and therapeutic and prophylactic methods based on their use, as targets for therapeutic intervention, of components of the Treg immunoregulatory pathway.

Description

IMMUNOREGULATORY COMPOSITIONS
Field of the invention The present invention is based, at least in part, on the elucidation of components of the Treg immunoregulatory pathway. In particular, the invention relates to genes which are differentially expressed in certain T cell populations and to their expression products (e.g.
cognate proteins), cognate receptors. regulators, binding partners and inhibitors or mimetics thereof. In particular, the invention relates to pharmaceutical compositions and therapeutic and prophylactic methods based on the use, as targets for therapeutic intervention, of components of the Treg immunoreQulatory pathway.
Background of the invention Immunoresulation is of fundamental importance in the management and treatment of a wide variety of 1 ~ diseases and disorders. One form of immunoregulation, immunosuppression, finds utility in a wide variety of medical indications: important examples include graft rejection, autoimmune and chronic inflammatory disorders. In contrast, immunostimulation may be indicated in the treatment of infection and certain proliferative disorders (such as cancer).
Thus, there is considerable interest in the development of therapeutic agents which act as immunore~ulators.
Among the principal mediators of the immune response and its regulation are various subsets of CD4' T
helper cells. Once primed via T cell receptor (TCR) interaction, naive CD4' T
helper cells, designated Th0 cells, differentiate into several functionally distinct subsets. T helper l (Thl) lymphocytes contribute to cellular itnmuniry, while T helper 2 (Th2) lymphocytes appear to contribute mainly to humoral immunity. These subsets have characteristic cytokine profiles: Thl lymphocytes produce IL-

2, IFN--; and T'~TF-p, while Th2 lymphocytes produce IL-4, IL-~ and IL-10. Thl cells may be induced by activation in the presence of IFNy and IL-12, whereas IL-4 can direct the differentiation of Th2 cells.
It has recently become apparent that yet other subsets of CD4' T cells are involved in immunoreQulation. These cells are referred to herein as T regulatory cells (Treg cells). At least two different subsets of T regulatory cells have been described to date. Groux er a!. (1997), Nature, Volume 389, pages 737-742 describe T regulatory cells I (Trl cells), which are reported to be driven by IL-10 and which suppress antigen-specific immune responses and actively downregulate certain pathological immune responses in vivo. These Trl cells appear to be similar to (but distinct from) the TGF-~3-secreting Thi cells described in i.etterio and Roberts (1998), Ann.
Rev. Immunol., Volume 16, pages 137-161.
However. the full extent of the CD4+ T cell immunoregulatory network, both in terms of its cellular elemenu (i.e. the nature and number of its constituent T cell subsets) and biochemical elements (i.e. the molecular composition of the regulatory network(s)) remains obscure. Given the importance of immunoregulation in medicine, the lack of knowledge in this area is a significant obstacle to the development of effective immunotherapeutic agents.
Summary of the invention The present invention is based, at least in part, on the elucidation of elements of the Treg immunoregulatory network and on the development of a general approach for studying the network. In particular. it has now been discovered that the pattern of gene expression in certain cell populations which are enriched in Treg cells is quite difrerent from that in Th 1- and Th2-enriched populations. This fording n'as quite unexpected, since Treg cells have been suggested to suppress Thl and/or Th2 responses via a mechanism which does not require differential gene expression (vi.. a passive competition for cytokines or antigen presenting cells - see Waldmann and Cobbold (1998), Ann. Rev.
Immunology 16, pages 619-644).
Thus, in a first aspect of the present invention there is provided an isolated gene obtainable by a process comprising the steps of: (a) providing a Thl-enriched cell population, a Th2-enriched cell population and a Treg-enriched cell population; and (b) comparing the relative expression of one or more genes in said cell populations; thereby (c) identifying a gene which is differentially expressed in the cell populations: and then (d) isolating the gene identified in step (c).
It should be noted that the populations provided in step (a) need not be clonal populations, and they may therefore contain cells other than the T cells in which they are enriched.
Thus, the Tr~~ enriched population may contain ancillary cells which, though not themselves Treg cells, are supported and/or stimulated by the Treg cells and so neverthelss contribute to the Treg regulatory pathway. Thus, the gene of the invention may be any gene which is differentially expressed in the populations when examined as a whole, so that the genes of the invention may include those which, at the cellular level, are differentially expressed not in Treg cells but in other ancillary cell subpopulations.
Preferably, the gene identified in step (c) is one which is over- or under-expressed in the Treb enriched population- relative to the Thl- and Th2-enriched nopnlations.

WO 01/27267 , PCT/GB00/03821 The differentially expressed genes of the invention comprise tire constituent genetic elemeras of the Treg immunoregulatory network. As such, they permit the identification of a wide range of novel targets for immunoregulatory agents. For example, those skilled in the art will appreciate that knowledge of (at least part of) the sequence of a given gene permits isolation or synthesis of the corresponding protein. Such proteins form a particularly important aspect of the invention, since they (or their agonises/antagonists) can be used as the basis for novel immunoregulatory drugs.
The Trea-enriched cell population is preferably that prepared as described herein (and referred to hereinafter as Trl/Treg cells). However, any other enriched population of Treg subsets (e.g. based on the known Tregl and Th3 cells mentioned earlier) from any suitable source can also be used. Thus, the principal element of the Treg immunoregulatory network may be elucidated by using any Treg subset as a reference population.
The term "isolated" is used herein to indicate that the material exists in a physical milieu distinct from 1 ~ that in which it occurs in nature. For example, the isolated gene or protein may be substantially isolated with respect to the complex cellular milieu in which it naturally occurs. The absolute level of purity is not critical. and those skilled in the art can readily determine appropriate levels of purity according to the use to ~~~hich the material is to be put.
In many circumstances, the isolated material will form part of a composition (for example a more or less crude extract containing many other substances), buffer system or pharmaceutical excipient, which may for example contain other components (including proteins, such as albumin).
In other circumstances, the isolated material may be purified to essential homogeneity, for example (and in the case of the proteins of the invention) as determined by PAGE or column chromatography (for example 1~PLC or mass spectrometry). In certain preferred embodiments where the material forms part of a pharmaceutical composition, the isolated material of the invention may be essentially the sole active in~edient of the composition. Particularly preferred are compositions in which the material of the invention is present as the sole active ingredient in a pharmaceutical composition.
The term "isolated" as applied to the genes and nucleic acids (both RNA and DNA) of the invention also indicates that the genes/nucleic acids may be present in any of a wide variety of vectors and in any of a wide varien~ of host cells (or other milieu, such as buffers, viruses or cellular extracts).
Examples of genes according to the invention are listed in Table 1. In this table, the abundance of each tag is indicated on the lefr-hand side, while the colum:.s on the right hand side indicate :he deE;.ee to which a transcript is up/down-modulated with a statistical confidence of 95%.

Table 1 Tr'1!t .95.%

1 Total :o.nfidence Th2 Tag reg Sequence LH

2 0 92 0 94 cGATCTGGCCMMCP-5 mast cell serine24 proteinase 4 0 85 0 89 AAGTCCTGCAmMC-CPA carboxypeptidase17 A

0 0 4d 0 44 TCAACTCGAGESTs 14 0 0 35 0 35 GAGGTrrtno match 11 T r 1 0 50 2 53 AACACTTGGAno match 10 1 2 29 0 32 GATTGTCAGAg1y96 : unknow function,5.6 homologue 1 0 22 0 23 TGGAAGAAAGESTS 5.4 0 1 21 0 22 AATGAGTTGCtryptophan hydroxyiase5.1 0 0 17 0 17 ccACCrcccrno match 4.8 0 1 24 2 27 GTGGACTCAAEST 4.5 1 17 54 0 72 GGATATGTGGegr-1= zif1268 = krox-244.1 1217 99 18146 CCCTGAGTCCbeta-actin 3.7 0 0 16 2 18 AACTGCrrcAno match 3.2 0 6 23 0 29 CTGCTTTGTGproenkephalin 3.2

3 5 31 3 42 ATCAACACCGGs alpha subunit 3_ 1 0 0 11 0 11 AGAGAGAGAGPAF-AH : platelet activating2.9 factor 0 0 11 0 11 ccTGAGCTCCno match 2_g 1 0 12 0 i3 ACCCAAGGTTno match 2.7 6 9 3.4 1 50 ATTGTGGTGCI.APTMS 2.7 0 0 13 2 15 AAGGCAGAGGno match 2.5 1 2 1 2 20 AACTCACAATESTs 2.1 S

0 0 8 0 8 TTGGTAGCTGno match 2 1 20 35 3 59 AcAAcrrcCTGM2 activator protein 2 (Gm2a) 1 4 33 1957 ccrcAGCCrGcathepsin 0 (EC 3.4.23.5).1.9 0 3 11 0 14 AccATTACrGESTs 1.8 0 t 8 0 9 CTaAGGAGATESTs 1.7 0 0 7 0 7 ATGTAGAAGGno match 1.7 0 0 7 0 7 CAATAAATAGFc-epsilon-RI-alpha-subunit1.7 0 0 7 0 7 CCTTTAAcccno match 1.7 0 0 7 0 7 GAAGCGTGGGno match 1.7 0 0 7 0 7 GCTGCGAGGGno match 1.7 0 0 7 0 7 TTAAGATATGinterleukin-3 receptor1.7 beta-subunit 3 4 24 1243 cACGGcrrrcL26 ribosomal protein 1.6 1 1 14 S 21 TGTAGTGTAAribosomal protein S8 1.6 2 9 18 1 30 ~CTGTATGno match 1.6 0 20 25 0 45 GGGCATTTGAno match 1.6 0 9 15 0 24 AGCAGATTCTleukocystatin 1.5 0 1 7 0 8 AAGCATCCCGno match 1.4 0 0 7 1 8 GAGTGGATTCCD63 1.4 0 0 7 1 8 TTTACATACAno match 1.4 0 0 6 0 6 cAAACraGAAno match 1.4 0 0 6 0 6 cACGTGAATGno match 1.4 0 0 6 0 6 GGGCCCTGCTESTs 1.4 0 0 .6 0 6 TCAACTCCAGn0 mdtCh 1.4 O O 6 O 6 TCAGAGACCCESTS 1.4 0 0 6 0 6 TCTTGAATCCno match 1.4 0 0 6 0 6 rccAAAp,rAAno match 1.4 8 16 29 5 58 r'rGGGATACCEN-7 = Rac2 GTP-binding1.4 protein 2 4 11 0 17 AACATACAAGL1 repeat family region1.3 1 2 8 0 11 ccTGGTGCCTESTs 1.3 0 3 8 0 11 GTTACTTATGclass I cytokine receptor1.3 (Wsx1 ) 9 13 23 1 46 rGCAAC.AArGsecretory granule proteogiycan1.3 core SUBSTITUTE SHEET (RULE 26) Table 1 (cont.) 0 6 10 0 16 TAAGCCTTTCno match 1.2 0 0 9 S 14 ArrrGACTGGESTs 1.2 2 2 9 1 14 CTAATAAAGCMNSFb 1.2 1 0 7 1 9 AAa,AGGAGnTno match 1.2 0 2 7 0 9 TGAAACACTGMA-3 = TIS (inducer of 1.2 apoptosis) O 2 7 0 9 TGAGAGGGAAESTs 1.2 0 0 6 1 7 CCAAAAa.AAAclathrin-associated AP-2 1.2 complex ~psJ

0 1 6 0 7 GCTGAACACAESTs 1.2 O 1 6 0 7 GTAAGCAAAAEST 1.2 0 O S 0 5 AGCGTCGCTGESTS 1.2 0 0 5 0 5 GSA EST 1.2 0 0 5 0 5 GG'rTAAATGTcathepsin L 1.2 0 0 5 0 5 GTAACAACGCno match 1.2 O O 5 0 5 GTACTGGTATESTS 1.2 100 110 37 4 251 AGTTGGAAACESTs -1.6 12 16 1 4 33 CCTGGCAGAGESTs -1.7 40 24 7 18 89 GATTCCGTGAESTs -2 61 69 17 53 200 TTGGTGAAGGno match -2.5 39 47 4 24 114 TCCCCGTACAEST -3.6 149 128 19 6 302 rtTTCAAAAAbeta-2-microglobulin -3.7 7 9 0 2 18 GACAACGCCAESTs -1.3 13 10 2 3 28 TTATATAGTGInterleukin 3 -1.2 8 7 2 10 27 AGGCTGACAAESTs -1.2 9 7 1 6 23 rccTATTAAGEST -1.2 5 8 1 8 22 GCCTTtATGAribosomal protein S24. -1.2 25 22 7 1 55 TTGATCATCAGDP-dissociation inhibitor-1.2 41 23 12 18 94 ATGACTGATAESTs -1.4 35 20 9 11 75 CACAAACGGTESTs -1.4 29 27 9 10 75 GAGCGTT-rTGcyclophilin (EC 5.2.1.8) -1.4 57 55 19 18 149 AAGGTGGAAGESTs -1.6 22 25 3 0 50 AGACCGGAAGCD3 delta chain -1.8 12 15 Z 0 29 GTGGCTCATATACE= TNFalpha converting-1.2 enzyme SUBSTITUTE SHEET (RULE 26) These genes listed in Table 1 are mouse genes, but the invention also contemplates homologues, derivatives. allelic forms, species variants, mutant forms or equivalents thereof.
The term "homologue" is used herein in two distinct senses. It is used seruu stricto to define the corresponding gene from a different organism (i.e. a species variant), in which case there is a direct evolutionary relationship between the gene and its homologue. This may be reflected in a structural and functional equivalence, the gene and its homologue performing the same role in each organism.
Particularly preferred species variants according to the invention are the human homologues of each of the mouse Genes shown in Table 1.
The term is also used herein sensu lato to define a gene which is structurally similar (i.e. not necessarily related andtor structurally and functionally equivalent) to a given (reference) gene. In this sense, homoloy is recognised on the basis of purely structural criteria by the presence of nucleic acid sequence. For the purposes of the invention, homologues may be recognised as those genes the corresponding DNAs of which-are capable of specifically or selectively cross-hybridizing, or which can cross-hybridize under selective, appropriate and/or appropriately stringent hybridization conditions.
The term "selectively or specifically (cross)hybridizing" in this context indicates that the sequences of the corresponding ssDNAs are such that binding to a unique (or small class) of homologous sequences can be obtained under more or less stringent hybridization conditions. This method of the invention is not dependent on any particular hybridization conditions, which can readily be determined by the skilled worker (e.g. by routine trial and error or on the basis of thermodynamic considerations). One example of hybridization conditions that can be used involves a pre-washing solution of 5 X SSC, 0.5%
SDS, 1.0 mM EDTA (pH8.0) and attempting hybridization overnight at 55°C
using 5 X SSC.
As applied to the proteins encoded by the genes of the invention, a homologue may be used herein to define a protein which has an amino acid sequence which differs from the reference protein (e.g. the native murine protein) because of one or more deletions, insertions or substitutions. The homologous amino acid sequence preferably is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical. The percent identity may be determined, for example; by comparing sequence information using the GAP computer program, version 6.0 described by Devereux et al. (1984), Nucl.
Acids Res. 12:387. This program uses the alignment method ofNeedleman and Wunsch (1970), J.
Mol. Biol. 48:443, as revised by Smith and Waterman (1981), Adv. Appl. Math 2:482. The preferred default parameters for the GAP program include: (1) a unitary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the weighted comparison matrix of Gribskov and Burgess (1986) Nucl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds.(1979), Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp.
353-3p8; (2) a penalty of 3.0 for each gap and an additional 0.1 penalty for each symbol in each gap;
and (3) no penalty for end gaps.
Protein homologues may comprise conservatively substituted sequences, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics. Conservative substitutions are well known in the art and include substitution of one aliphatic residue for another (such as Ile, Val, Leu or Ala for one another), or substitutions of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn). Conventional procedures and methods can be used for making and using such homologues. Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known and routinely performed.
The term "derivative" as applied herein to both genes and proteins is used to define modified versions of the genes and proteins. Such derivatives may include fusion proteins, in which the proteins of the invention have been fused to one or more different proteins or peptides (for example an antibody or a protein domain conferring a biochemical activity, to act as a label, or to facilitate purification). The derivatives may also be products of synthetic processes which use a gene or protein of the invention as a starting material or reactant.
The term "mutant form" is used herein to define genes in which one or more nucleotides have been added, deleted or substituted. The mutant forms of the invention therefore include fragments, truncates and chimeras. The mutant forms of the genes encode corresponding mutant proteins, termed "muteins":
these are proteins in which one or more amino acids have been added, deleted or substituted. The muteins of the invention therefore include fragments, truncates and fusion proteins.
The muteins of the invention also include proteins in which mutations have been introduced which effectively promote or impair one or more activities of the protein, for example mutations which promote or impair the function of a receptor, a recognition sequence or an effector binding site.
Muteirts may be produced by any convenient method. Conveniently, site-directed mutagenesis with mutagenic oligonucleotides may be employed using a double stranded template (pBluescript KS II T""
construct containing the gene. Afrer verifying each mutant derivative by sequencing, the mutated gene is excised and inserted into a suitable vector so that the modified protein can be over-expressed and purified.

The term "equivalent" as used herein and applied to the materials of the invention defines materials (e.g. proteins, DNA etc.) which exhibit substantially the same functions as those of the materials of the invention while differing in structure (e.g. nucleotide or amino acid sequence). Such equivalents may be generated for example by identifying sequences of functional importance (e.g. by identifying conserved or canonical sequences or by mutagenesis followed by functional assay), selecting an amino acid sequence on that basis and then synthesising a peptide based on the selected amino acid sequence.
Such synthesis can be achieved by any of many different methods known in.the art, including solid phase peptide synthesis (to generate synthetic peptides) and the assembly (and subsequent cloning) of olioonucleotides.
The homologues, fra~nents, muteins, equivalents or derivatives of the proteins of the invention may also be defined inter alia as those proteins which cross-react with antibodies to the proteins of the invention.
1 ~ The relative expression of the genes of the invention may be compared by any one of a number of standard techniques. Such techniques may measure expression at various levels, for example at the level of sene transcription or at the level of translation. A particularly convenient technique is described by Velculescu et al. (1995), Science, Vol. 270, pages 484-487. The technique, referred to herein as serial analysis of gene expression (SAGE), allows the quantitative and simultaneous analysis of a laree number of transcripts. Other techniques based on an analysis of the nature and quantities of the proteins produced by the cells (proteomic analysis), for example using 2-dimensional chromatography and microsequencing, may also be used.
The invention also contemplates an isolated regulator of the gene of the invention. The gene regulator may be an activator or repressor of transcription of the gene, or antisense nucleic acid corresponding to the gene.
The invention also contemplates an isolated regulator of the protein of the invention. The protein regulator may be an agonist or antagonist of the protein, and may be selected from a cognate receptor of the protein, an antibody or antibody fragment which blocks the activity of the protein or its cognate receptor. a mimetic, an activator or repressor of transcription of a gene encoding a co~ate receptor of the protein, a nucleic acid encoding any of (a) to (d) or antisense DNA
corresponding to the nucleic acid of (e).
The invention also contemplates an isolated binding partner for the gene of the invention. The binding pamer may be nucleic acid (optionally, single stranded nucleic acid).

Also contemplated is an isolated binding partner for the protein of the invention as well as an isolated binding partner for the regulator of the invention. The binding partner for the protein or regulator preferably comprises an antibody (or antibody derivative) specific for (or selectively reactive with) the protein or regulator. The antibody may be a monoclonal antibody, and may be labelled.
In another aspect, the invention relates to an isolated single stranded nucleic acid comprising the complement of the coding or non-coding strand of the gene of the invention.
Also provided according to the invention is nucleic acid hybridizable with the gene of the invention.
Such nucleic acids may function as probes.
In another aspect of the invention there is provided anti-sense DNA
corresponding to the gene of the invention. Such DNA may be used to regulate the expression of the cognate gene in vivo, and may therefore form the basis of therapeutic compositions.
The invention also contemplates a vector (e.g. an expression vector) comprising the gene of the invention. The nature of the vector is not critical to the invention. Any suitable vector may be used, including plasmid, virus, bacteriophage, transposon, minichromosome, liposome or mechanical carrier.
The expression vectors of the invention are DNA constructs suitable fo!~
expressing which may include:
(a) a regulatory element (e.g. a promoter, operator, activator, repressor and/or enhancer), (b) a structural or coding sequence which is transcribed into rnRNA and (c) appropriate transcription, translation, initiation and termination sequences. They may also contain sequence encoding any of various tags (e.g.
to facilitate subsequent purification of the expressed protein, such as affmiry (e.~. His) tags).
Particularly preferred are vectors which comprise an expression element or elements operably linked to the DNA of the invention to provide for expression thereof at suitable levels.
Any of a wide variety of expression elements may be used, and the expression element or elements may for example be selected from promoters, enhancers, ribosome binding sites, operators and activating sequences. Such expression elements may comprise an enhancer, and for example may be re~ulatable, for example being inducible (via the addition of an inducer).
As used herein, the term "operably linked" refers to a condition in which portions of a linear DNA
sequence are capable of influencing the activity of other portions of the same linear DNA sequence.
For example, DNA for a signal peptide (secretory leader) is operably linked to DNA for a polypeptide if it is expressed as a precursor which participates in the secretion of the polypeptide; a promoter is operable linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation.

The vector may further comprise a positive selectable marker and/or a negative selectable marker. The use of a positive selectable marker facilitates the selection and/or identification of cells containing the vector.
In another aspect, the invention relates to a host cell comprising the vector of the invention. Any suitable host cell may be used, including prokaryotic host cells (such as Escherichia coli, Streptomyces spp. and Bacillus subtilis) and eukaryotic host cells.
10 Also provided according to the invention is a pharmaceutical composition comprising the gene, protein, regulator. binding partner, nucleic acid, vector or host cell of the invention as an active ingredient, the gene, protein, regulator, binding partner, nucleic acid, vector or host cell optionally being present at a concentration su~cient to confer biological activity on the pharmaceutical composition.
I ~ A pharmaceutical composition is a solid or liquid composition in a form, concentration and level of purity suitable for administration to a patient (e.g. a human or animal patient) upon which administration it can elicit the desired physiological changes. The composition may be an immunoregulatory composition, for example an immuno-suppressive composition, immuno-stimulatory composition or anti-inflammatory composition.
The gene. protein, regulator, binding partner, nucleic acid, vector or host cell of the invention may be for use itr medicine (for example in therapy, prophylaxis or diagnosis) and/or provided in a pharmaceutical excipient, a unit dosage form or in a form suitable for local or systemic administration.
The invention also contemplates a diagnostic kit or reagent comprising the gene, protein, regulator, binding partner, nucleic acid, vector or host cell of the invention.
The invention also contemplates a cell typing reagent comprising the gene, protein, regulator, binding partner. nucleic acid, vector or host cell of the invention.
In another aspect, the invention provides an er vivo method for analysing the status of the Treg immunorewlatory pathway in a biological sample comprising the step of determining the presence or activiy of: (a) a gene of the invention; or (b) a cognate expression products) of said gene; or (c) a biochemical marker of the activity of said gene; or (d) Thl and/or Th2 and/or Treg cells.
In yet another aspect, the invention provides an ex vivo method for detecting Thl and/or Th2 and/or Treg cells in a biological sample comprising the step of contacting the sample with a reagent which selectively binds to the gene, protein, regulator or binding partner of the invention. Preferably, the reagent comprises the cell typing reagent of the invention.
The detecting method of the invention may be for detecting the presence of the cells or for determining the number of Thl and/or Th2 and/or Treg cells. In preferred embodiments, the number of Th 1 cells relative to Th2 and/or Treg cells, or Th2 cells relative to Th 1 and/or Treg cells, or Treg cells relative to Thl and!or Th2 cells, may be determined.
The aforementioned methods have many applications in diagnosis and in monitoring the efficacy and/or endpoint of various treatments. Thus, in another embodiment, the invention relates to an ex vivo method for monitoring the progress of an anti-inflammatory or immunoregulatory treatment in a subject or the progress of an inflammatory or immune disorder in a subject, the method comprising the step of analysing the status of the Treg immunoregulatory pathway in a sample from the subject. Preferably, the method monitors the e~cacy or endpoint of a treatment.
1~
Also contemplated by the invention is an ex vivo method for determining the posology of an anti-inflammatory or immuno-regulatory drug administration regime in a subject undergoing treatment comprising the step of analysing the status of the Treg immunoregulatory pathway in a biological sample comprising the step of detetTnining the presence or activity of: (a) a gene of the invention; or (b) a cognate expression products) of said gene; or (c) a biochemical marker of the activity of said gene; or (d) Th 1 and/or Th2 and/or Treg cells.
The samples for use in the foregoing methods may be from an accessible body site, for example a mucous membrane of the vagina, anus, nose, urethra, cervix, skin, conjunctiva, mouth or throat. The sample may comprise a fluid or semi-solid (for example a bodily fluid or semi-solid, e.g. discharge, vomit. secretion, excreta, urine, sputum, plasma, serum or blood).
Alternatively, the sample may comprise a solid (e.~. stool, tissue or biopsy sample) or a cell culture (e.g.
a lymphocyte culture).
Particularly preferred are samples from urine, serum, plasma or blood.
Also contemplated by the invention is the use of the gene, protein, regulator, binding partner, nucleic acid, vector or host cell of the invention for the manufacture of a medicament for use in the treatment of an inflammatory or immune disorder.
Also contemplated by the invention is the use of the gene, protein, regulator, binding partner, nucleic 3p acid, vector or host cell of the invention for the manufacture of an agent for use in a bipartite anti-inflammatory or immunoregulatory treatment, the first part comprising administration of an anti-inflammatory or immunoregulatory agent and the second part comprising monitoring the progress of the treatment by analysing the status of the Treg immunoregulatory pathway in a biological sample comprising the step of determining the presence or activity of: (a) a gene of the invention; or (b) a cognate expression products) of said gene; or (c) a biochemical marker of the activity of said gene; or (d) Thl and/or Th2 and/or Treg cells. Preferably, the efficacy and/or endpoint of treatment is monitored by the method of the invention.
Also contemplated by the invention is the use of an anti-inflammatory or immunoregulatory agent for the manufacture of a medicament for the treatment of an inflammatory or-immune disorder in a subject, characterized in that the treatment comprises the step of analysing the status of the Treg immunorewlatory pathway in the subject determining the presence or activity of: (a) a gene of the invention; or (b) a co~ate expression products) of said gene; or (c) a biochemical marker of the activiy of said Gene; or (d) Th 1 and/or Th2 and/or Treg cells.
The biochemical marker may for example comprise a molecule which is produced, directly or 1 ~ indirectly. by the gene and which therefore serves as an index of the expression of said gene.
The step of analysing the status of the Treg immunoregulatory pathway in the subject may be for monitoring the efficacy of an anti-inflammatory or immunoregulatory treatment, or for determining the posoloy of an anti-inflammatory or immunoregulatory drug administration regime.
In another aspect, the invention provides a process for producing a pharmaceutical composition comprising the steps of:
(a) providing a test system comprising the Trek immunore~ulatory pathway (or a component thereof);
(b) providing candidate drugs;
(c) screening the candidate drugs by contacting the test system with one of the candidate drugs and analysing the interaction of the candidate drug with the test system, wherein the nature of the interaction is an index of pharmaceutical activity, and optionally (d) synthesising or purifying a drug having pharmaceutical activity on the basis of the identity of the candidate drug screened in step (c).
Also contemplated is a pharmaceutical composition produced by (or obtainable by) the aforementioned process; or a derivative thereof.
In another aspect, the invention provides a process for producing the gene, protein, regulator, binding partner, nucleic acid or vector of the invention comprising the steps of:
(a) culturing the host cell of the invention, and (b) purifying the gene, protein, reD lator, binding partner, nucleic acid or vector from the cultured host cell (e.g. from a culture supernatant or cell fraction).
In anoth:r aspect, the invention provides an isolated Treg cell (which may be capable of suppressing the proliferation and cytokine production of Thl and Th2 cells), said cell having a gene expression profile substantially as shown in Table 1. Preferably, the gene expression profile is such that the expression of at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the genes listed in Table 1 are up- or down-regulated relative to Thl and Th2 cells at least to the extent indicated in the Table.
The cell of the invention may be used as a test system in the preparation and screening of candidate drugs, or directly (in adoptive immunotherapy protocols) in therapy or prophylaxis. In the latter case, the cell may be used in immunoregulation (e.g. immunosuppression or immunostimulation) or the treatment of inflammation. When used in therapy, the cells of the invention may be administered by any con~~:nient method, for example by site-specific instillation (e.g. into a capillary bed or into a vessel 1 ~ via a catheter).
Medical aoolications The invention permits the isolation, synthesis and rational design of a wide range of novel medicaments and pharmaceuticals for use in therapy, prophylaxis and diagnosis. The various forms of therapy, prophylaxis and diagnosis in which the materials of the invention find application involve targeting the Treg immunoregulatory pathway. Thus, the invention finds application in therapies based on immunoregulation. In some embodiments, the invention is used to effect immunosuppression, while in other embodiments immunostimulation is achieved.
A particularly important application of immunosuppressive embodiments is the treatment, control or management of inflammation. Thus, the invention provides anti-inflammatory agents for use in a wide range of applications, for example in the treatment or prophylaxis of chronic inflammatory disorders.
The invention may also be used to treat damage to cells resulting from the effects of inflammatory response. Thus, the invention finds application in the treatment of rheumatoid and osteo-arthritis and of glomerular nephritis, diabetes, inflammatory bowel disease, vascular diseases such as atheroclerosis and vasculitis and skin diseases such as psoriasis and dermatitis. The invention may also be used to prevent or neat graft rejection.
Other diseases which may be treated according to the invention include Crohn's disease, ulcerative colitis, Tvpe I diabetes, lupus erythematosus, auto-immune disorders, hypersensitivity disorders and multiple sclerosis.

A varien~ of lung diseases are associated with airway inflammation, including chronic bronchitis, emphysema. idiopathic pulmonary fibrosis and asthma, and these also may be treated according to the invention.
The immunostimulants of the invention find particular application in the treatment of infections and proliferative disorders (such as cancer).
Diagnostic aoolications There is a need to be able to monitor not only the progress of a disease or disorder but also its therapy lndeed. these activities may be complementary where the posology of drug administration and/or drug selection influence the response to the treatment, since efficacy and/or endpoint can be monitored during the course of treatment. In the case of diseases where the immune and related defence (e.g.
1~ inflammatow) systems may be involved, measures of the responsive-behaviour of those systems may provide useful information to guide therapy. For example, measures of blood C-reactive protein have provided a good index of inflammation and can be used to manage the appropriate treatment.
The genes and their cognate protein products described herein form part of the Treg immunoregulatory network. As such. their activity can be used as an index of the status of the network: they can be used as "markers" which are either present or absent in accessible body fluids and tissues (usually blood, serum, urine or biopsy material).
In the case of specific immune responses mediated by lymophocytes-it is known that only a small percentage of anyone's lymphocytes get involved in any immune response.
However, these need to circulate and if an active response is happening then the blood lymphocytes may disproportionately reflect the behaviour of this small subset, as cells circulate from one site to another. The blood may then be an indicator of changes in the behaviour of small subsets of lymphocytes, if one had sensitive enough techniques to measure their change in behaviour, or if one could easily isolate or identify the few antigen-specific cells. As the blood is easily accessible then it offers the opportunity to-monitor changes in the behaviour of a small subset of lymphocytes and related cells in response to a disease process. As these cells might also secret their products then analysis of the plasma or serum, as well as urine may pick up such products and their degraded forms.
Thus, the invention finds application in monitoring during and after therapy for multiple sclerosis. The blood may initially show evidence of Thl behaviour directed to brain antigens-there are numerous documented examples of increases in the frequency of antigen-specific cells in acute episodes of the 1~
disease. These cells activate particular genes of the Treg immunoregulatory network and can be identified according to the invention. Successful treatment would damp this activation, lowering the expression of these genes and allowing the efficacy and/or endpoint of the treatment to be determined.
Many diseases might benefit from such an approach, including -rheumatoid arthritis, psoriasis, Crohn's disease, ulcerative colitis, Type I diabetes, lupus erythematosus, and other hypersensitivity and/or auto-immune disorders.
Exemplification The invention will now be described in more detail with reference to several Examples. These are for exemplary purposes only and are not intended to limit the invention in any way.
Example l: Preparation of TreJTrl clone Dl (a Trey-enriched cell copulation) 1~
Regulatory T cell clones were generated from the spleen of a naive AIxRAG-/-mouse (see WO
99/16867 and Zelenika et al. (1998) Journal of Immunology, 161, pages 1868-1874) essentially following the method of Groux et af. (supra). x105 spleen cells were cultured with x106 mitomycin C
treated male CBA spleen cells (male stimulators) in 2 ml volumes in RPMI 1640 medium containing 10% foetal calf serum (FCS) and SOng/ml recombinant murine IL-10 (Genz~~rne) for 7 days at which time spent medium was removed and fresh stimulator cells and medium containing IL-10 added. Afrer three 7 day cycles of stimulation in IL-10 the viable cells were harvested by separation over Ficoll/Hypaque and cloned by limit dilution ( 1 cell/200 microlitre well) on anti-CD3 coated plates (14~2C11, p0 microgram/ml) in the presence of mitomycin treated female CBA
spleen feeder cells (10' /ml) in RPMI 1640 containing 10% FCS and 20U/ml recombinant murine IL-2 (rmIL-2). Wells containing growing cells were progressively expanded into 48 x lml and then 24 x 2m1 well plates with male stimulators in RPMI 1640 containing 10% FCS, rmIL-2 (20U/m1) and recombinant murine IL-4 (rmIL-4 20U/ml). Once established the clones that continued to proliferate to male stimulators were maintained by harvesting every 14 days on Ficoll/Hypaque and then passaging 2x105 cells in 24x2m1 well plates with 5x106 male CBA stimulator cells/well in RPMI 1640 medium containing 10% FCS, tmIL-2 (20 Ulml) plus rmIL-4 (20U/m1).
Three different clones were isolated by this method, and one (TrlDl) was selected for SAGE analysis.
Some of the differential genes have been confirmed by testing on the tu~o other clones.
Thl and Th2 cells for use in the analysis were prepared as described in Zelenika et al. (supra).

1.6 Example 2: Testing for mRNA expression of differentially expressed Trey gene sequences by guantitadve real-time RT-PCR.
This example demonstrates how it is possible to test for the level of mRNA, and therefore the level of gene expression, in different cell or tissue samples. In this case total RNA
was obtained from each of the Thl, Th2 and Trek clones, as well as normal spleen cells from normal CBA/Ca mice that were in the process of rejecting a B lO.BR skin graft, using standard methodology.
Each sample was then treated with DNA-ase to ensure that no PCR product would be generated from contaminating genomic DNA. First strand cDNA was then generated using Reverse Transcriptase (RT) together with either random hexamers or polyA primers. This material was then subjected to real time quantitiative PCR
using th: standard protocols (User Bulletin #~: Multiplex PCR with TaqMan VIC
Probes, and User Bulletin =2: Relative Quantitation of Gene Expression) for the Perkin Elmer Applied Biosystems ABI
Prism 7100 Sequence Detection System. In brief, this uses standard PCR 5' and 3' primers to generate a specinc PCR product for the gene of interest, and utilises an internal oligonucleotide specific for the 1 ~ product that is doubly labelled with a fluorescent dye (eg. FAM or VIC) and a quencher dye (eg.
TAMRA). Primers and probes used in this example are shown in Table 2: these were desisted from the appropriate Qene or cDNA sequence using the PE Applied Biosystems software (Primer Express). Due to fluorescence energy transfer this double labelled probe does not itself fluoresce at the FAM or VIC
wavelengths. but will anneal quantitatively to the DNA product of each PCR
cycle. During the next extension phase of the PCR the specifically bound probe will be cleaved by the Taq polymerise, releasing an amount of fluorescent dye proportional to the product of that cycle. This fluorescence is detected in the ABI Prism 7700 machine by scanning the PCR reactions in an optical 96 well plate multiple times for each cycle, generating a real time semi-logarithmic plot of the PCR reaction that can be used to accurately calculate a threshold cycle (Ct) for each reaction. By multiplexing (using two dyes such as FAM and VIC that fluoresce at different wavelengths) the primers and probes of the gene of interest (FAM probe) with a housekeeping gene such as HPRT or ribosomal RNA
(VIC probe), that is expressed at a similar level in all cells and tissues, it is possible to normalise the levels of the gene of interest across the different RNA samples, allowing correction for any differences in amounts or quality of the R\A chat might have been introduced during the extraction, DNA-ase treatment, or cDNA
generation steps. In the example shown in Table 3, the amount of HPRT as measured by the VIC probe in each sample has been arbitrarily defined as 1000 units, and all the measurements of the three other Treg or Tre~rIh2 markers that are shown (PAFAH = PAF acetyl hydrolase;
Enkephalin =
Preproenkephalin; TPH = tryptophan hydoxylase; HPRT = hypoxanthine phosphoribosyl transferase) are given relative to these units.
This approach would allow rapid. thigh throughput, simple and automatic.
measurement of a number of Thl, Th3 and Treg differential genes in, for example, blood samples from normal individuals compared to patients undergoing treatment, in order to monitor the status of the patient during their course of therapy.
Table 2: Primers and probes 5' primer 3' primer FAM/VIC probe HPRT ~accggtccc~tcatgctcataacctggttcatcatcgcVIC-acccgcagtcccaecgtcgtg-TAMRA

PAFAH tgatcagtggoaccctctgggagagtgttgctgagccggFAM-ct~?o caccctttgacgcagtca-TAMRA

EnkephalinaaatctgggagacctgcaagggatctctcctccgttcgcttcFAM-tccaggcccgagttcccttgg-TAMRA

TPH tecgacatcagccgagaactgttggcgcagaagtccagFAM-ccccctgctgaagtcgcacgc-TAMRA

Table 3: Real time guantitative PCR test for differential Qene expression mRNA species Thl Th2 Trl Spleen Arbitrary Units as measured by TaqMan RT-PCR
2~ HPRT 1000 1000 1000 1000 By definition PAFAH <l i <1T 12,62~t 1~2 +0 +0 +149 +203 Enkephalin<0.01 324 1,898 <0.01 +0 +607 +178 +0 TPH 0.02 0.01 411 <0.01 +_0.01 _+0.01 +_ 103 +0 t Mean _+ Standard Deviation of triplicate samples at two different dilutions ' Mean _+ Standard Deviation of spleens from six individual, skin grafted mice Example 3: Testing for expression of differentially expressed TreE eeneby immunofluorescence specific for a biochemical product In this example the expression of the Treg differentially expressed gene tryptophan hydroxylase is tested for indirectly by accumulation in Treg cells or tolerant T cells of the product of the biochemical pathway for which tryptophan hydroxylase is the rate limiting enzyme (i.e.
serotonin). Both polyclonal antisera and at least one monoclonal antibody (YC~) are widely available for identification of cells containing serotonin after fixation by formalin to generate the specinc serotonin-protein conjugate that the antibodies recognise. In order to perform the test on a given sample of blood cells, tissue cells or other source of cells, it is necessary to first fix the sample in, for example 1% formaldehyde or paraformaldehyde, and then permeabilise the cells, for example using phosphate buffered saline containing 0.~% saponin, and then staining by standard methods of immunofluorescence with the anti-serotonin antibody, most conveniently conjugated directly with an appropriate fluorescent dye such as fluorescein isothiocyanate (FITC) or indirectly using anti-species specific immunoglobulin (IgG) antibodies coupled to FITC or other appropriate dye. In order to show that this expression is associated with T cells it is most convenient to perform this test under conditions of multiple staining, using antibodies against other standard T cell or T cell subset markers, such as CD3 or CD4 that can be coupled to dues with different spectral properties, such as PhycoEcythrin (PE), Cy3, Cy~ or similar, as appropriate. The cells are then analysed either by observation on a fluorescent microscope, confocal microscope. fluorescence activated cell sorter (FACS), or cytofluorograph to determine the quantity of serotonin bound fluorescent antibody on a representative sample of individual T cells identified by the 1 ~ T cell marker fluorescence (see example FACS analysis - Figure 1 ).
Example 4: Gene cloning from the 14 nucleotide tai Many of the differentially expressed tag found in the SAGE libraries do not map to any published mouse sequence. Two independent strategies can be used to characterise a cDNA
sequence from which a tag has been originally derived.
Virtual cloning uses the data produced by random sequencing of short cDNA
fragments, called ESTs. If one or more matching EST is found, they are analysed and compared using different softwares made 2~ available to all on the web. A "virtual" cDNA sequence can be produced by using this procedure.
Real bench cloning is necessary where no homology can be found in any of the databases. This can bee done using different molecular techniques. One way of proceeding, that has proven relatively easy and successful, is using what is called cloning by RACE-PCR.
These nro approaches are completely independent and can be in fact complementary.
The initial tag sequence is as follows: GCAGTGGTTC. All the tags were generated using an NIaIII
restriction enzyme C( ATG), therefore they all start with the corresponding restriction site. Thus, the complete tag sequence, of 14 nucleotides, is CATGGCAGTGGTTC.
Virtual cloning The following EST sequence has been pulled out by the tag , after searches through mouse ESTs databases using the NCBI site http://www.ncbi.nlm.nih.gov.
>gi~3733312~gb~AI182674.1~AI182674 ub73gO5.rl Soares mouse mammary gland NMLMG
Mus musculus cDNA clone IMAGE:1383416 5', mRNA sequence GAACACACAATCAAAACTTCTCCTGGAATAAATCATCTGACATCAGATCCTTCCCATTGTC
TGTACTGTTTCTGCTGCCCTGGAAACCATGCAAGGACAGGAACAGACCACCATGGCAGTG
GTTCCTGGAGGTGCTCCAC CTTCAGAGAAT
The tai is underlined.
The next step was to create a contig (organised overlapping ESTs fra~nents) and to derive a consensus sequence from it. This was done using freely available software (available on the website:
http://gcg.tigem.itBLASTEXTR.ACT/estextract.html).
1 ~ The final cDNA sequence obtained is set out below:
ATTCGGCACGATGGGTGAACACACAATCAAAACTTCTCCTGGAATAAATCATCTGACATCA
GATCCTTCCCATTGTCTGTACTGTTTCTGCTGCCCTGGAAACCATGCAAGGACAGGAACAG
ACCACCATGGCAGTGGTTCCTGGAGGTGCTCCACCTTCAG.AGAATTCTGTTATGACATCA
CAAATGTGGAATGAGAAGAAGGAGAAATTCTTGAAGGGGGAACCAAAGTCCTTGGGGTTT
TACAAGTTATGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTTGACAACTTTATTT
TCTGAA.4CTACCCACTTCAGTGATGTTAATGGTCCCAATTTGGGGATCAATAATGTTCATT
GTCTCCGGATCCCTGTCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATT
TGGTATGTTTTGCTATGGAAAAGGAGTAATTTCATCAACTATGCATATATCTGCTAAGATA
26 TAA.AGGGGTTAATTCTATTTTCCTAA.AATCACAGCTATGGGCTTTAGAGGCACCTGACTTT.
CAAAAGTGTAGCTGAGCTACTGATTCATAACAAGT
The tag is underlined and it is indeed located next to the most 3' NIaIII
site.
This contig does not contain an open reading frame (ORF). However ESTs sequences are full of mistakes, therefore an ORF could be hidden within the sequence of the clone. A
carefull analysis of the sequence showed that a long ORF could be generated by shifting through the 3 different frames. The "virtual cDNA" can then be used for homology searches, and in this case significant homologies have been found with the Mouse CD20 antigen, particularly within the region coding for the transmembrane domains indicating that the new cDNA may encode a membrane receptor.
This.would be confirmed by the "real" cfoninQ_ Bench clonirrQ:
The real cloning is technically completely independent from the virtual cloning. However, the obtention of a virtual cDNA, whenever it is possible, can be useful to cross-check the real cloning.
Cloning by RACE-PCR is a standard technique, although usually used from loner starting sequences.
In our case, cDNAs produced from our T-cell clones have been ligated at their both ends by specific adaptors. Starting from the tag sequence of 14 nt, two fragments can be generated by PCR extension towards the 3' or the ~' end of the cDNA.
10 The primers used to generate the 5' fragment are underlined AGCAGTGGTAACAACGCAGAGATTCGGCACGATGGGTGAACACACAATCAAAACTTCTC
CTGG.4ATA.AATCATCTGACATCAGATCCTTCCCATTGTCTGTACTGTTTCTGCTGCCCTGGA
A,ACCATGCAAGGACAGGAACAGACCACCATGGCAGTGGTTC
15 The sequence of the ~' primer ( AGCAGTGGTAACAACGCAGAGA) corresponds to the ~' SMART
adaptor desired by Clontech. The 3' primer is the tag itself (CATGGCAGTGGTTC) The primers used to generate the 3' fragment are underlined 20 CATGGCAGTGGTTCCTGGAGGTGCTCCACCTTCAGAGAATTCTGTTATGACATCACA.AAT
GTGGAACGAGAAGAAGGAGAAATTCTTGAAGGGGGAACCA.AAGTCCTTGGGGTTTTACAA
GGTATGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTCGACAACTTTGGTTTTCT
GAACTACCCACTTCAGTGATGTTAATGGTCCCAATTGGGGGATCAGTAGTGTCCATTGTCT
CCGGATCCCTGGCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAATTTGGT
2~ ATGTTTTGCTATGGAAAAGGAGTAATTTCATCAACTATGCATATATCTGCTAAGATATAAA
GGGGTTAATTCTATTTTCCTAAAATCACAGCTATGGGCTTTAGAGGCACCTGACTTTCAAA
AGTGTAGCTGAGCTACTGATTCATAACAAGTCTCATAAA AAAAAAAAGAC
TCGAGTTGACATCGAG
The sequence of the ~' primer is the tag itself. The 3' primer sequence is derived from the polyA-anchored-3'adaptor.
A 3'° round of PCR (and cloning) has been done using an internal primer in order to show that the 5' and the 3' fra~nents have been generated from a unique cDNA.
The complete cDNA sequence is:

TTCGGCACGATGGGTGAACACACAATCAA.AACTTCTCCTGGAATAAATCATCTGACATCAG
ATCCTTCCCATTGTCTGTACTGTTTCTGCTGCCCTGGAAACCATGCAAGGACAGGAACAGA
CC.ACCCATGGCAGTGGTTCCTGGAGGTGCTCCACCTTCAGAGAATTCTGTTATGACATCA
CAAATGTGGAACGAGAAGAAGGAGAAATTCTTGAAGGGGGAACCAAAGTCCTTGGGGTTT
S TACAAGGTATGATTGCTATCATAAACCTCAGCTTAGGAATAATAATTTCGACAACTTTGGT
TTTCTGAACTACCCACTTCAGTGATGTTAATGGTCCCAATTGGGGGATCAGTAGTGTCCAT
TGTCTCCGGATCCCTGGCCATTGCAGCAGGAGTGACACCTACAAAATGCCTGGTATGTAAT
TTGGTATGTTTTGCTATGGAAAAGGAGTAATTTCATCAACTATGCATATATCTGCTAAGAT
ATAAAGGGGTTAATTCTATTTTCCTAAAATCACAGCTATGGGCTTTAGAGGCACCTGACTT
TCAA.AAGTGTAGCTGAGCTACTGATTCATAACAAGTCTCAT
This ne~3~ cDNA sequence contains an ORF:
MGEHTIKTSPGINHLTSDPSHCLYCFCCPGNHARTGTDHHGSGSWRCSTFREFCYDITNVEREE

TKCLCFAMEKE
The predicted protein deduced from that ORF shows 32% homology with 2 tetraspan proteins: Mouse CD20 receptor and the Human FcRIa.
This example shows that two independent methodologies can be used to determine the complete sequence of each of the gene transcripts corresponding to the genes listed in Table 1 and so permit their synthesis or isolation. The particular example described above encodes a previously unidentified protein that has 4 transmembrane domains (as shown by the analysis of hydrophobicity) and probably 2S belongs to the 4TM family of proteins together with the CD20 antigen and the FcRIa.
As described herein, this protein may be potentially used as a biomarker of the Thl subset. An antibody could be raised against the predicted protein using standard methodology. Such an antibody would be a vey useful tool for monitoring Thl cells in normal and pathological situations quite independently of the biological function of the predicted protein (for which further studies can be carried out).

Claims (52)

CLAIMS:

1. An isolated gene obtainable by a process comprising the steps of:
(a) providing a Th1-enriched cell population, a Th2-enriched cell population and a Treg-enriched cell population; and (b) comparing the relative expression of one or more genes in said populations; thereby (c) identifying a gene which is differentially expressed in the populations;
and then (d) isolating the gene identified in step (c).

2. The gene of claim 1 wherein the gene identified in step (c) is one which is:
(a) expressed at high levels in the Treg-enriched population relative to Th1 and/or Th2 cells;
or (b) expressed at low levels in the Treg-enriched population relative to Th1 and/or Th2 cells.

3. The gene of claim 1 or claim 2 wherein the gene is any one of the genes listed in Table 1, or a homologue, derivative, allelic form, species variant, mutant form or equivalent thereof.

4. The gene of claim 3 which is the human variant of any one of the genes listed in Table 1.

5. The gene of any one of claims 1 to 4 wherein the relative expression is compared in step (b) by SAGE analysis.

6. The gene of any one of claims 1 to 4 wherein the relative expression is compared in step (b) by proteomic analysis.

7. An isolated protein encoded by a gene as defined in any one of the preceding claims.

8. An isolated regulator of the gene as defined in any one of the preceding claims.

9. The regulator of claim 8 which is selected from:
(a) an activator or repressor of transcription of the gene;
(b) antisense nucleic acid corresponding to the gene.

10. An isolated regulator of the protein as defined in any one of the preceding claims.

11. The regulator of claim 10 which is an monist or antagonist of the protein.

12. The regulator of claim 11 which is selected from:
(a) a cognate receptor of the protein;
(b) an antibody or antibody fragment which blocks the activity of the protein or its cognate receptor;
(c) a mimetic;
(d) an activator or repressor of transcription of a gene encoding a cognate receptor of the protein;
(e) nucleic acid encoding any of (a) to (d);
(f) antisense DNA corresponding to the nucleic acid of (e).

13. An isolated binding partner for the gene as defined in any one of claims 1 to 6.

14. The binding partner of claim 13 which is nucleic acid (optionally, single stranded nucleic acid).

15. An isolated binding partner for the protein as defined in claim 7.

16. An isolated binding partner for the regulator of any one claims 8 to 12.

17. The binding partner of claim 15 or claim 16 comprising an antibody (or antibody derivative) specific for (or selectively reactive with) the protein or regulator.

18. Isolated single stranded nucleic acid comprising the complement of the coding or non-coding strand of the gene as defined in any one of claims 1 to 6.

19. Nucleic acid hybridizable with the gene of any one of claims 1 to 6.

20. Antisense DNA corresponding to the gene of any one of claims 1 to 6.

21. A vector comprising the gene of any one of claims 1 to 6.

22. A host cell comprising the vector of claim 21.

23. A pharmaceutical composition comprising the gene, protein, regulator, binding partner, nucleic acid, vector or host cell as defined in any one of the preceding claims as an active ingredient, the gene, protein, regulator, binding partner, nucleic acid, vector or host cell optionally being present at a concentration sufficient to confer biological activity on the pharmaceutical composition.

24. The composition of claim 23 which is an anti-inflammatory composition.

25. The composition of claim 23 which is an immunoregulatory composition.

26. The composition of claim 25 which is an immuno-suppressive composition.

27. The composition of claim 25 which is an immuno-stimulatory composition.

28. The gene, protein, regulator, binding partner, nucleic acid, vector or host cell as defined in any one of claims 1 to 22 which is:
(a) for use in medicine (for example in therapy, prophylaxis or diagnosis);
and/or (b) in a pharmaceutical excipient, a unit dosage form or in a form suitable for local or systemic administration.

29. A diagnostic kit or reagent comprising the gene, protein, regulator, binding partner, nucleic acid, vector or host cell of any one of claims 1 to 22.

30. A cell typing reagent comprising the gene, protein, regulator, binding partner, nucleic acid, vector or host cell of any one of claims 1 to 22.

31. An ex vivo method for analysing the status of the Treg immunoregulatory pathway in a biological sample comprising the step of determining the presence or activity of:
(a) a gene as defined in any one of claims 1 to 6; or (b) a cognate expression product(s) of said gene; or (c) a biochemical marker of the activity of said gene.
(d) Th1 and/or Th2 and/or Treg cells.

32. An ex vivo method for detecting Th1 and/or Th2 and/or Treg cells in a biological sample comprising the step of contacting the sample with a reagent which selectively binds to the gene, protein, regulator or binding partner as defined in any one of claims 1 to 17.

33. The method of claim 12 wherein the reagent comprises the cell typing reagent of claim 30.

34. The method of claim 32 or claim 33 wherein the method is for detecting the presence of the cells.

35. The method of any one of claims 32 to 34 wherein the number of Th 1 and/or Th2 and/or Treg cells is determined.

36. The method of claim 35 wherein the number of:
(a) Th1 cells relative to Th2 and/or Tree cells; or (b) Th2 cells relative to Th1 and/or Treg cells; or (c) Treg cells relative to Th1 and/or Th2 cells, is determined.

37. An er vivo method for monitoring:
(a) the progress of an anti-inflammatory or immunoregulatory treatment in a subject; or (b) the progress of an inflammatory or immune disorder in a subject;
comprising the step of analysing the status of the Treg immunoregulatory pathway in the sample.

38. The method of claim 37 wherein in (a) the efficacy or endpoint of the treatment is monitored.

39. An ex vivo method for determining the posology of an anti-inflammatory or immuno-regulatory drug administration regime in a subject undergoing treatment comprising the step of analysing the status of the Treg immunoregulatory pathway according to the method of claim 31.

40. Use of the gene, protein, regulator, binding partner, nucleic acid. vector or host cell of any one of claims 1 to 22 for the manufacture of a medicament for use in the treatment of an inflammatory or immune disorder.

41. Use of the gene, protein, regulator, binding partner, nucleic acid, vector or host cell of any one of claims 1 to 22 for the manufacture of an agent for use in a bipartite anti-inflammatory or immunoregulatory treatment, the first part comprising administration of an anti-inflammatory or immunoregulatory agent and the second part comprising monitoring the progress of the treatment by analysing the status of the Treg immunoregulatory pathway according to the method of claim 31.

42. The use of claim 41 wherein the the efficacy and/or endpoint of treatment is monitored by the method of claim 37.

43. Use of an anti-inflammatory or immunoregulatory agent for the manufacture of a medicament for the treatment of an inflammatory or immune disorder in a subject, characterized in that the treatment comprises the step of analysing the status of the Treg immunoregulatory pathway in the subject according to the method of claim 31.

44. Use of claim 43 wherein the step of analysing the status of the Treg immunoregulatory pathway in the subject is for:
(a) monitoring the efficacy of an anti-inflammatory or immunoregulatory treatment; or (b) determining the posology of an anti-inflammatory or immunoregulatory drug administration regime.

45. A process for producing a pharmaceutical composition comprising the steps of:
(a) providing a test system comprising the Treg immunoregulatory pathway (or a component thereof);
(b) providing candidate drugs;
(c) screening the candidate drugs by contacting the test system with one of the candidate drugs and analysing the interaction of the candidate drug with the test system, wherein the nature of the interaction is an index of pharmaceutical activity, and optionally (d) synthesising or purifying a drug having pharmaceutical activity on the basis of the identity of the candidate drug screened in step (c).

46. A pharmaceutical composition produced by (or obtainable by) the process of 45, or a derivative thereof.

47. A process for producing the gene, protein, regulator, binding partner, nucleic acid or vector of any one of claims 1 to 21 comprising the steps of:
(a) culturing the host cell of claim 22, and (c) purifying the gene, protein, regulator, binding partner, nucleic acid or vector from the cultured host cell (e.g. from a culture supernatant or cell fraction).

48. An isolated Treg cell having a gene expression profile substantially as shown in Table 1.

49. The Treg cell of claim 48 wherein the gene expression profile is such that the expression of at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of the genes listed in Table 1 are up- or down-regulated relative to Th1 and Th2 cells at least to the extent indicated in Table 1.

50. The Treg cell of claim 48 or claim 49 wherein the cell is capable of suppressing the proliferation and cytokine production of Th1 and Th2 cells.

51. The cell of any one of claims 48 to 50, for use in therapy or prophylaxis.

52. The cell of claim 51 for use in immunoregulation (e.g. immunosuppression or immunostimulation) or the treatment of inflammation.