EP1228225A2 - Veränderte resistenzgene - Google Patents

Veränderte resistenzgene

Info

Publication number
EP1228225A2
EP1228225A2 EP00968085A EP00968085A EP1228225A2 EP 1228225 A2 EP1228225 A2 EP 1228225A2 EP 00968085 A EP00968085 A EP 00968085A EP 00968085 A EP00968085 A EP 00968085A EP 1228225 A2 EP1228225 A2 EP 1228225A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
plant
created
auto
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00968085A
Other languages
English (en)
French (fr)
Inventor
Abdelhafid INRA-URGV BENDAHMANE
David Charles Baulcombe
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Plant Bioscience Ltd
Original Assignee
Plant Bioscience Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Plant Bioscience Ltd filed Critical Plant Bioscience Ltd
Publication of EP1228225A2 publication Critical patent/EP1228225A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8283—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for virus resistance

Definitions

  • the present invention relates to modified resistance or other genes, for instance for use in plants, and methods and materials for producing the genes .
  • R disease resistance
  • NBS nucleotide binding site
  • LRR leucine rich repeat
  • the recognition domain may involve the C terminal LRR domain. Sequence analysis of related R genes indicates that this is the most variable region of the protein and that it is under selection to diverge (Meyers et al . , 1998).
  • the N terminal domains of the R proteins have been implicated in signalling through the identification of sequence motifs. These motifs, referred to collectively as the NB-ARC domain, include the Ap-ATPase region in which there are five signature motifs that differentiate these proteins from other nucleotide binding proteins (Aravind et al., 1999).
  • 'CFLY' and 'MHD Two other motifs, referred to as 'CFLY' and 'MHD, ' are also included in the NB-ARC domain (Hammond-Kosack and Jones, 1997; van der Biezen and Jones, 1998).
  • the present inventors have investigated the activation of NBS-LRR R proteins in plants.
  • the inventors have succeeded in modifying the activation characteristics of these R proteins such that they were able to activate a resistance response in the absence of their natural elicitors.
  • These gain of function modifications included, inter alia, point mutations, for instance in the highly conserved NB-ARC domain, and to a lesser extent in the LRR domain, and also artificial dimerisation of the R proteins.
  • Modified NBS- LRR R proteins having these characteristics have not previously been disclosed in the art. This decoupling of the R response from its natural elicitor has potential utility, inter alia , in developing novel pathogen responsive plants.
  • the invention provides processes for modifying the activation characteristics of a (first) polypeptide capable of conferring elicitor-dependent activation of resistance response against a pathogen (i.e. an R protein).
  • the process comprises the step of modifying the sequence of the R protein which displays such elicitor-dependent activation, such that activation of the resistance response can be achieved in the absence of the elicitor.
  • 'Elicitor dependent' in this context means that under normal conditions, for instance at cellular levels found in planta under its natural promoter, the R gene does not activate a resistance response in the absence of the pathogen or an elicitor therefrom.
  • the modified activation characteristic will be automatic (e.g.
  • a so called 'auto- activator' R protein which is permanently switched on by mutation or dimerisation) or will be based upon artificial dimerisation under predefined conditions (e.g. an R protein can be dimerised and hence activated in response to a non-native dimerising agent) .
  • the present invention relates to a process for producing (or identifying, or isolating) a modified NB-ARC protein, which comprises the steps of:
  • NB-ARC domain protein which is not autonomously activated
  • modifying the NB-ARC domain such as to produce a protein which is capable of autonomously activating a cellular response leading to cell death or dysfunction (e.g. an apoptosis response, or HR) .
  • the modified protein is optionally screened to confirm this activity.
  • Rx encodes an NBS-LRR protein that mediates recognition of the coat protein of potato virus X (PVX) leading to virus resistance.
  • PVX potato virus X
  • the Rx-mediated resistance against PVX is thought to conform to an elicitor-receptor model.
  • the model there are two phases in the Rx resistance mechanism: a recognition phase that is believed to be highly specific for the potato virus X coat protein (CP) elicitor and a response phase that prevents accumulation of a broad spectrum of plant viruses, including those taxonomically unrelated to PVX.
  • CP potato virus X coat protein
  • Rx there is a very high degree of similarity between Rx and a subclass of NBS-LRR resistance proteins represented by Rps2, Rpml and Prf (Jones and Jones, 1997) .
  • These Arabidopsis and tomato proteins contain a putative four to six heptad amphipathic leucine zipper (LZ) motif at the N-terminus (Jones and Jones, 1997) .
  • LZ heptad amphipathic leucine zipper
  • the putative NBS domain of Rx comprises three motifs: kinase 1A or 'P-loop' , kinase 2, and kinase 3a.
  • the putative NBS is followed by a domain that includes GLPL, CFLY and the MHD motifs.
  • NB-ARC domain R proteins which will together provide means for conferring resistance against bacteria, fungi and invertebrates (e.g. insects such as aphids).
  • Rx resistance response is effective against viruses that are unrelated to PVX (Bendahmane et al., 1995) and the Rx homologue in BAC111 (see PCT/GB99/01182, Plant Bioscience Limited) is a nematode resistance gene (Bendahmane and Baulcombe, 1999; Rouppe van der Voort et al . , 1999).
  • NB-ARC domain containing R genes include the root knot nematode resistance gene 'MI' from tomato, which also confers resistance against potato aphid (see Milligan et al, 1998 Plant Cell 10, 1307-1319; Rossi et al, 1998 Proc Natl Acad Sci USA 95, 9750-9754. Also the 'N' gene which gives resistance against TMV (see Whitham et al, 1994 Cell 78, 1105-1115) .
  • modified resistance proteins disclosed herein will have utility, inter alia, in conferring resistance in response to non- natural agents or stimuli, and also for investigating resistance response pathways and protein interactions e.g. with activators and repressors.
  • Auto-activators could also be used to control development. For example, if the auto-activators were expressed under control of a pollen specific promoter there would be death of the pollen cells and male sterility. This could also be used as a strategy in developing (e.g. trees) that did not flower.
  • R proteins could be expressed modified such that they could be dimerised in the presence of a specific dimerizing agent, which in turn could be expressed under the control of an inducible promoter activated by a particular pathogen. Likewise dimerised
  • tandem repeat R proteins could themselves be expressed under an inducible promoter.
  • a process for modifying the activation characteristics of a first polypeptide having an amino acid sequence which includes a nucleotide binding site (NBS) and a leucine rich repeat (LRR) domain which first polypeptide mediates a cellular response leading to pathogen resistance and ⁇ or cell death or dysfunction in response to an elicitor, the process comprising the step of introducing a modification to the amino acid sequence of the first polypeptide such as to produce an auto-activator polypeptide which is capable of activation in the absence of the elicitor.
  • this aspect provides a process for producing (or identifying, or isolating) a modified R protein which is capable of activating a resistance response in the absence of a pathogen (or elicitor therefrom) the process comprising the steps of: (i) selecting an NB-ARC domain R protein which displays elicitor- dependent activation,
  • the 'elicitor dependent' protein prior to modification refers to the protein's characteristic under normal conditions.
  • Rx when expressed under its own promoter in vivo is an elicitor-dependent R protein.
  • the Rx protein can be 'switched on' even in the elicitor 's absence (although this does not imply that the protein may not be switched in its presence) .
  • modified Rx proteins have been produced which, in the absence of the PVX coat protein, or other homologous 'natural' elicitors, lead to activation of an Rx resistance response.
  • the modification will be achieved by expression from a modified nucleic acid sequence, as described in more detail hereinafter.
  • the analysis may be done using transient or stable expression of the appropriate proteins e.g. R protein and elicitor in plants.
  • the resistance response may be observed directly (e.g. challenge of appropriate pathogen, or related reporter construct) or may be inferred from an associated resistance effect e.g. a hypersensitive response (HR) resulting in necrosis or other cell damage (see WO 95/31564, Gatsby Charitable Foundation, for a general discussion of HR) .
  • HR hypersensitive response
  • Example methods for testing R gene activity can be found in the following publications: bacterial (Grant et al, 1995); fungal (Dixon et al, 1996; Jones, 1994; Thomas et al, 1997); nematode and viral (Whitham et al, 1994) . These can be modified as required in the light of the present disclosure in order to detect the autoactivating mutations.
  • activity is tested ultimately by complementation of trait in a plant. This can be achieved by coupling the putative autoactive variant to a promoter and terminator for expression in plants and transforming it into a 'susceptible' plant that lacks a given resistance trait. The activity of the auto-activator is then confirmed by challenge with the appropriate pathogen.
  • the LRR region may be deleted, and the mutations made elsewhere .
  • the effect is achieved by modifying the identity of only 1,2,3,4,5, 10 or more amino acids.
  • the invention also embraces multiple mutations including multiple mutations each having an auto-activator effect, possibly in conjunction with mutations made for quite different reasons. Put another way, there is no requirement that the initial selected sequence is 'wild-type' or naturally occurring, or even full- length (although this may be preferred) provided that mutations are introduced which have the effects discussed above.
  • mutations which have this effect are also preferred e.g. substitution of 'acidic' amino acids (such as Glu and Asp) for neutral, or basic ones (such as Arg, Lys, His), or neutral ones for basic ones, in accordance with the pKa values of their side chains.
  • the desired mutation may be one which decreases the net negative charge of the NB-ARC region (or regions therein as disccused above) thereby modulating or otherwise inhibiting an electrostatic interaction with a more positive binding partner e.g. a repressor.
  • the modification comprises the incorporation of a heterologous dimerization-enabling sequence into the selected protein.
  • a heterologous dimerization-enabling sequence will permit dimerization of the protein in which it is incorporated in the presence of a dimerization effector agent. Examples are given in Experimental Procedures section below. Generally the enabling sequence will be added to the R protein (or portion thereof) as a fusion.
  • an auto- activator R polypeptide obtainable by the processes described above .
  • nucleic acid molecule encoding an auto-activator R protein (or polypeptide) which has been modified in the terms discussed above e.g. is capable of initiating a resistance response against a pathogen even in the absence of its natural elicitor.
  • the expression product of these nucleic acids, and methods of making the expression product by expression from encoding nucleic acid therefor under suitable conditions, are also encompassed.
  • Nucleic acid molecules according to the present invention may be provided in recombinant form or free or substantially free of nucleic acid or genes of the species of interest or origin other than the sequence encoding a polypeptide with the required function.
  • the nucleic acid molecules (and their encoded polypeptide products) may also be (i) isolated and/or purified from their natural environment (although not necessarily in pure form per se) , or (ii) in substantially pure or homogeneous form.
  • Nucleic acid according to the present invention may include cDNA or RNA but will be wholly or at least partially synthetic ( 'constructs' ) . Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed .
  • each nucleotide is base paired to its counterpart i.e. G to C, and A to T or U.
  • polypeptides include the 'auto-activator' sequences labelled 193, 25, 32, 39, 7, 72 in Table III below.
  • Nucleic acids include those encoding all or a functional (autoactivated) part of these sequences.
  • Nucleic acids of the invention include those shown in Table II.
  • the autoactivating R gene activity can be tested by methods described herein, or analogous to those, as appropriate to the nature of the resistance being investigated.
  • Homology may be at the nucleotide sequence and/or the expressed amino acid sequence level.
  • the nucleic acid and/or amino acid sequence shares homology with the NB-ARC coding sequences herein preferably at least about 50%, or 60%, or 70%, or 80% homology, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% homology.
  • Homology may be over the full-length of the relevant sequence shown herein, or may more preferably be over a contiguous sequence of about or greater than about e.g. 20, 100, 200, 300, 500, 600 or more amino acids or codons, compared with the relevant amino acid sequence or nucleotide sequence as the case may be.
  • filters are washed as follows: (1) 5 minutes at room temperature in 2X SSC and 1% SDS; (2) 15 minutes at room temperature in 2X SSC and 0.1% SDS; (3) 30 minutes - 1 hour at 37°C in IX SSC and 1% SDS; (4) 2 hours at 42- 65°C in IX SSC and 1% SDS, changing the solution every 30 minutes.
  • T m 81.5°C + 16.6Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600/#bp in duplex.
  • telomere binding for detection of sequences that are about 80-90% identical, hybridization overnight at 42°C in 0.25M Na 2 HP0 4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 55°C in 0. IX SSC, 0.1% SDS.
  • suitable conditions include hybridization overnight at 65°C in 0.25M Na 2 HP0 4 , pH 7.2, 6.5% SDS, 10% dextran sulfate and a final wash at 60°C in 0. IX SSC, 0.1% SDS. Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art.
  • probes may be radioactively, fluorescently or enzymatically labelled.
  • Other methods not employing labelling of probe include amplification using PCR (including, where appropriate, RACE PCR) , RN' ase protection and allele specific oligonucleotide probing.
  • the invention provides autoactivating homologous variants of the Rx sequences provided, which may for instance comprise additional mutations, or be based on autoactivating derivatives of naturally occurring Rx homologues such as other R proteins including the NB-ARC region, allelic variants, paralogues, or orthologues.
  • Rx2 can be correspondingly autoactivated by introducing a D to V substitution in the MHD region (see Example 1) . These autoactivated an HR with similar kinetics to the corresponding Rx mutant (data not shown) .
  • the nucleic acid molecule which is the autoactivating mutant is generated either directly or indirectly (e.g. via one or amplification or replication steps) from an original nucleic acid corresponding to the NB-ARC protein.
  • Changes to a sequence, to produce a mutant or derivative may be by one or more of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more amino acids in the encoded polypeptide.
  • a variant nucleic acid may encode an amino acid sequence including additional amino acids at the C-terminus and/or N-terminus, for instance to facilitate dimerization, or to actually generate a dimer (which is autoactivated) .
  • Oligonucleotides for use in PCR mutagenesis include those shown in the Examples below, and may be about 30 or fewer nucleotides in length (e.g. 18, 21 or 24). Generally specific primers are upwards of 14 nucleotides in length. For optimum specificity and cost effectiveness, primers of 16-24 nucleotides in length may be preferred. Those skilled in the art are well versed in the design of primers for use processes such as PCR.
  • the nucleic acid described above is in the form of a recombinant and preferably replicable vector .
  • Vector is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacteri um binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication) .
  • shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eucaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
  • a vector including nucleic acid according to the present invention need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce the nucleic acid into cells for recombination into the genome.
  • the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. bacterial, or plant cell.
  • a host cell such as a microbial, e.g. bacterial, or plant cell.
  • the vector may be a bi- functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
  • promoter is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA) .
  • operably linked means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter.
  • DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter.
  • this aspect of the invention provides a gene construct, preferably a replicable vector, comprising a promoter operatively linked to a nucleotide sequence provided by the present invention, such as an auto-activator Rx mutant.
  • Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • appropriate regulatory sequences including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate.
  • Plant vectors Particularly of interest in the present context are plant vectors. Specific procedures and vectors previously used with wide success upon plants are described by Bevan (Nucl. Acids Res. 12, 8711-8721 (1984)) and Guerineau and Mullineaux (1993) (Plant transformation and expression vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BIOS Scientific Publishers, pp 121-148) .
  • this aspect of the present invention provides a gene construct, preferably a replicable vector, comprising an inducible promoter operatively linked to a nucleotide sequence provided by the present invention.
  • inducible as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on” or increased in response to an applied stimulus. The nature of the stimulus varies between promoters . Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus. The preferable situation is where the level of expression increases upon application of the relevant stimulus by an amount effective to alter a phenotypic characteristic.
  • an inducible (or “switchable”) promoter may be used which causes a basic level of expression in the absence of the stimulus which level is too low to bring about a desired phenotype (and may in fact be zero).
  • expression is increased (or switched on) to a level which brings about the desired phenotype.
  • preferred inducible promoters may be those which are activated by either (i) a pathogen (particularly one which does not provide the 'natural' elicitor of the R protein but which is nonetheless affected by the resistance response) or (ii) an artificial inducer such as ethanol which can be readily applied by human intervention.
  • a pathogen particularly one which does not provide the 'natural' elicitor of the R protein but which is nonetheless affected by the resistance response
  • an artificial inducer such as ethanol which can be readily applied by human intervention.
  • the GST-II-27 gene promoter which has been shown to be induced by certain chemical compounds which can be applied to growing plants.
  • the promoter is functional in both monocotyledons and dicotyledons.
  • the GST- 11-27 promoter is also suitable for use in a variety of tissues, including roots, leaves, stems and reproductive tissues.
  • Other promoters include the patatin promoter (tubers), ubiquitin promoter (wheat embryos).
  • the promoter may include one or more sequence motifs or elements conferring developmental and/or tissue-specific regulatory control of expression.
  • an artificially dimerizable R protein is operably linked to a constitutive promoter, and the same or a different construct is provided in which the dimerizing effector is operably linked to an appropriate inducible promoter.
  • the vectors of the present invention may include the autoactivating gene, in addition to various sequences required to give them replicative, integrative and/or expression functionality, including ancillary dimerization effectors.
  • Such vectors can be used, for instance, to make plants into which they are introduced resistant to plant pathogens.
  • the present invention also provides methods comprising introduction of these constructs discussed above (such as vectors) into a host cell and/or induction of expression of a construct within a plant cell, by application of a suitable stimulus, an effective exogenous inducer .
  • the vectors described above may be introduced into hosts by any appropriate method e.g. conjugation, mobilisation, transformation, transfection, transduction or electroporation, as described in further detail below.
  • a host cell containing nucleic acid or a vector according to the present invention, especially a plant or a microbial cell.
  • DNA can be transformed into plant cells using any suitable technology, such as a disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene transfer ability (EP-A- 270355, EP-A-0116718, NAR 12(22) 8711 - 87215 1984), particle or microprojectile bombardment (US 5100792, EP-A-444882, EP-A-434616) microinjection (WO 92/09696, WO 94/00583, EP 331083, EP 175966, Green et al .
  • Agrobacterium transformation is widely used by those skilled in the art to transform dicotyledonous species. Recently, there has been substantial progress towards the routine production of stable, fertile transgenic plants in almost all economically relevant monocot plants (Toriyama, et al. (1988) Bi o/Technology 6, 1072-1074; Zhang, et al . (1988) Plant Cell Rep . 1 , 379-384; Zhang, et al . (1988) Theor Appl Genet 76, 835-840; Shimamoto, et al . (1989) Nature 338, 274-276; Datta, et al . (1990) Bio/Technology 8, 736-740; Christou, et al .
  • Microprojectile bombardment, electroporation and direct DNA uptake are preferred where Agrobacterium is inefficient or ineffective.
  • a combination of different techniques may be employed to enhance the efficiency of the transformation process, eg bombardment with Agrobacterium coated microparticles (EP-A- 486234) or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium (EP-A-486233 ) .
  • selectable genetic markers consisting of chimaeric genes that confer selectable phenotypes such as resistance to antibiotics such as kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate.
  • a further aspect of the present invention provides a method of transforming a plant cell involving introduction of a vector comprising a nucleic acid of the present invention into a plant cell and causing or allowing recombination between the vector and the plant cell genome to introduce the sequence of nucleotides into the genome.
  • the invention further encompasses a host cell transformed with nucleic acid or a vector according to the present invention, especially a plant or a microbial cell.
  • the transgenic plant cell i.e. transgenic for the nucleic acid in question
  • the transgene may be on an extra-genomic vector or incorporated, preferably stably, into the genome.
  • heterologous is used broadly in this aspect to indicate that the gene/sequence of nucleotides in question have been introduced into said cells of the plant or an ancestor thereof, using genetic engineering, i.e. by human intervention.
  • a heterologous gene may be additional to a corresponding endogenous gene (which, clearly, will not have been modified to be an auto- activator).
  • Nucleic acid heterologous, or exogenous or foreign, to a plant cell will be non-naturally occurring in cells of that type, variety or species.
  • the heterologous nucleic acid may comprise a coding sequence of or derived from a particular type of plant cell or species or variety of plant, modified and placed within the context of a plant cell of a different type or species or variety of plant.
  • a plant may be regenerated, e.g. from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant can be entirely regenerated from cells, tissues and organs of the plant. Available techniques are reviewed in Vasil et al., Cell Cul ture and Somati c Cell Geneti cs of Plants , Vol I, II and III, Laboratory Procedures and Their Appli ca ti ons, Academic Press, 1984, and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989.
  • Plants which include a plant cell according to the invention are also provided, along with clones, selfed or hybrid progeny and other descendants.
  • a plant according to the present invention may be one which does not breed true in one or more properties. Plant varieties may be excluded, particularly registrable plant varieties according to Plant Breeders' Rights.
  • the present invention embraces any part of the plants such as cuttings etc.
  • the invention also provides a plant propagule from such a plant, that is any part which may be used in reproduction or propagation, sexual or asexual, including seed and so on.
  • Antibodies may be raised to a purified polypeptides or peptide by any method known in the art (for an overview see e.g. "Immunology - 5th Edition" by Roitt, Brostoff, Male: Pub 1998 - Mosby Press, London) .
  • the invention further provides a method of influencing or affecting a resistance trait in a plant, whereby the method includes the step of causing or allowing expression of a heterologous nucleic acid sequence as discussed above within cells of the plant.
  • the invention provides a method which includes expressing the nucleic acid of the invention within the cells of a plant (thereby producing the encoded polypeptide), following an earlier step of introduction of the nucleic acid into a cell of the plant or an ancestor thereof.
  • a method may be used to introduce pathogen resistance into the plant whereby resistance (e.g. ER or HR) is triggered by contact with an appropriate non-natural (i.e. not the original, natural, elicitor) inducer.
  • the inducer may be encoded directly by the invading pathogen. Alternatively it may be expressed by a separate construct or transgene which is itself triggered or upregulated by the pathogen infection.
  • processes for producing (or identifying, or isolating) a modified apoptosis regulator protein which is capable of activating an apoptosis response in a mammalian cell may comprise the steps of:
  • the modification may be in similar regions as those discussed above. For example, by introducing the MHD to MHV mutation (as in AT39 and ATI93; Figure 3B) into the MHD motif of APAF-1 (vanderBiezen and Jones, 1998) or similar animal proteins it is likely that there would be cell death.
  • Apoptosis may be assessed by those skilled in the art using commercial kits see e.g. Oncogene Research Products, 84 Rogers St., Cambridge, MA 02142, (1999) General Catalog pp 21-55.
  • the modified proteins used herein may be of particular interest for investigating regulators of apoptosis e.g. cellular initiators (cf. elicitors) or inhibitors.
  • Figure 1 Induction of HR by an auto-activator mutant of Rx and expression of the auto-activator Rx from a PVX vector
  • the cDNA inserts of wild type of mutant forms of Rx were inserted between Rx promoter (pR) and transcriptional terminator (ter) .
  • the black box indicates the cDNA or either wild type (wt) Rx cDNA or the cDNA of mutant (AT) forms of Rx .
  • LB and RB indicate the left and right border of the T-DNA.
  • LB and RB are the left and right borders of the T-DNA and 35S and Nos indicate the promoter and nopaline synthase transcription terminator.
  • the PVX open reading frames are shown as grey boxes with 'CP' indicating the PVX coat protein; the three boxes labeled 'mv' indicate the PVX genes required in virus movement and replicase is the replication enzyme. The diagram is not to scale.
  • PVX-AT* the coat protein gene was replaced with the coding sequence of auto-activators pR-AT25 (PVX-AT25), pR-AT39 (PVX-AT39) or by a deletion mutant of pR-AT25 (PVX-AT00) .
  • Each of the auto-activator mutant forms of Rx had several coding sequence mutations.
  • a series of Rx constructs was prepared in which wild type Rx and the auto-activator mutants were recombined using the restriction sites indicated at the top of the panel.
  • the constructs were transformed into agrobacterium and ability of these constructs to activate HR was hybrid clones were then tested by infiltration in non transformed (NT) and coat protein (CP) transgenic tobacco.
  • the ability to induce HR is indicated by '+' and '-' indicates that the construct was tested but that there was no HR.
  • the thin line indicates the wild type Rx sequence and the thick line indicates sequence derived from the auto-activators mutants .
  • the numbers above the thick lines refer to the number of amino acids that vary between Rx and the auto-activator mutant.
  • Region 1 contains the a leucine zipper -like region
  • regions 2 and 3 contain the NB-ARC domain, which is the domain containing the conserved motifs shown in upper case letters between 168 and 260 (the ARC domain is between 260 and 472);
  • region 4 includes the leucine rich repeats (each LRR is shown on a different line) and regions 5, 6 and 7 are respectively rich in amide, basic and acidic residues as described previously (Bendahmane et al., 1999).
  • the conserved NB-ARC domain residues are shown in upper case bold and the residues responsible for the autoactivation mutants is are shown as white on a black background.
  • Rx constructs in which the promoters were 35S or from Rx (pR) .
  • the transcriptional terminators were from the 35S transcript of CaMV(35 T) or Rx (Ter) and the constructs were based on the leucine zipper (LZ), NB-ARC (regions 1-3; Figure 3) and on the LRR (region 4; Figure 3) of Rx.
  • the black box represents the C terminal regions 5-7 ( Figure 3) of Rx .
  • the '+' or "-" indicates whether an HR was induced when the constructs were expressed using agrobacterium infiltration in the leaves of non transgenic tobacco.
  • A)Dim-Rx and Rx-Dim indicate constructs with an N terminal or C terminal fusion of the FKBP12 dimerizing domain (Dim) to Rx were inserted into the expression cassette of pBIN ⁇ lin which the transcription promoter (35S) and terminator (35T) were both from the 35S transcript of cauliflower mosaic virus.
  • the constructs were based on the leucine zipper (LZ) , NB-ARC (regions 1-3; Figure 3) and on the LRR (regions 4-7; Figure 3) of Rx.
  • constructs were expressed in non transgenic (NT) or coat protein transgenic tobacco leaves by agrobacterium transient expression assay either in the presence or absence of the dimerization agent AP20187 (AP) .
  • NT non transgenic
  • AP20187 dimerization agent
  • the HR phenotype was assessed using Rx constructs which were the wild type Rx (pR-Rx) or the auto-activator mutant derivative (pR-AT25).
  • Rx constructs which were the wild type Rx (pR-Rx) or the auto-activator mutant derivative (pR-AT25).
  • Agrobacterium carrying pR-Rx or pR-AT25 was infiltrated into leaves of either non transformed or transgenic tobacco expressing the PVX coat protein from the 35S promoter. The leaves were photographed 4 days after infiltration.
  • the timing of the HR was the same with the single amino acid mutant and the corresponding progenitor clone.
  • the pR-AT39 and its derivative with a single amino acid change relative to wild type Rx both induced a rapid HR.
  • the pR-AT7 mutant carried two mutations that were independently responsible for autoactivation of the HR ( Figure 2) .
  • the single amino acid mutants induced a rapid HR.
  • one or more of the other seven mutations in pR-AT7 impaired the ability of the encoded protein to activate the HR (Bendahmane et al., 1999) .
  • the distribution of the autoactivating mutations is non- random ( Figure 3A) .
  • Three out of eight of these mutations (pR-AT25, pR-AT32 and pR-AT72) were within a 6 amino acid interval close to the CFLY motif and a further two (pR-AT39 and pR-AT193) were in the MHD motif ( Figure 3A and 3B) .
  • the two mutations in the MHD motif were D to V substitutions, although with different changes at the nucleotide level.
  • Both the MHD and CFLY motifs are components of the NB-ARC domain.
  • the remaining three autoactivating mutations were in LRR2 (pR-AT7), LRR4 (pR-AT7) and LRR11 (pR-AT28) ( Figure 3A and 3B) .
  • the mutations were alanine substitutions in motifs I (pR-RxKl), III (pR-RxK2) and V (pR-RxGL) of the Ap-ATPase domain of the NB-ARC homologous region (Aravind et al., 1999) .
  • the assay of the Rx response was based on the HR following the agrobacterium infiltration assay into PVX coat protein transgenic plants. In each instance the introduction of the mutation into the wild type Rx blocked the HR in the infiltrated region of the coat protein transgenic plants.
  • the pAT39(6) construct was the derivative of pAT39 in which the only change from wild type Rx was a single D to V substitution in the MHD motif; the pAT25(33) construct was the derivative of pAT25 in which the only change from wild type Rx was the CFLY motif mutation; the pR-At7(30) construct had the with the D to E and H to R substitutions from the LRR of pR-At7 as the only differences from wild type Rx cDNA.
  • the constructs were expressed in non transgenic or coat protein transgenic tobacco leaves by agrobacterium transient expression assay.
  • the table indicates that the Ap-ATPase domains are essential for Rx function.
  • 35S cauliflower mosaic virus 35S
  • agrobacterium carrying PVX-AT25, PVX-AT39 or PVX-AT00 were infiltrated into tobacco leaves. Two days after agroinfiltration and prior to the appearance of cell death, total RNA was extracted from the infiltrated patch and PVX accumutation was tested by RNA blot analysis. Each lane of the gel was loaded with 2 ⁇ g of total RNA.
  • the hybridisation probe was a riboprobe specific for the positive strand RNA of PVX (results not shown) .
  • a key process in one of the pathways of animal cell apoptosis is the dimerization of CED4/APAF-1 (Hu et al., 1998a; Srinivasula et al., 1998; Yang et al., 1998). This dimerization activates a caspase cascade leading ultimately to cell death.
  • Dimerization of Rx regulates disease resistance in plants we used a system (Amara et al., 1997; Clackson et al . , 1998) based on a nontoxic lipid-permeable reagent, AP20187, that cross links the FKBP12 protein. The system is discussed more fully in the
  • pBl is a modified pBIN19 plasmid (Bevan, 1984) that carries a transcription cassette comprising 3 kb of theRx promoter and a 1.5 kb Rx terminator separated by an Xbal and a Sacl cloning sites (Bendahmane and Baulcombe, 1999) . All Rx derivative mutants were cloned between the Xbal and the Sacl cloning sites.
  • the Rx promoter was PCR-amplified using the primers RxP4 (TCG GGG TAC CTC TAT TGA AGA ATT GAG ATC CAA G) and RxP2 (CTC AGT ATC TAG ATG AAC AAA TTG CC) and the PCR product was digested with Xbal.
  • the Rx terminator was also PCR-amplified using primers RxTl (CAG CTG TAA GCT CGT TGA TAT AGA GG) and RxT2 (GGT GTT CTA GAG ACT AGC CAG AGC TCT GAA AT) and the PCR product was digested with Xbal and Kpnl.
  • BAC77 DNA carrying the Rxlgenomic DNA (Bendahmane et al., 1999) was used as template for the PCR.
  • the digested PCR products were ligated to a modified pBIN19 plasmid vector digested with Kpnl and Ecll36 to create pBl .
  • the modified pBIN19 plasmid is identical to the one published previously except that the unique Xbal site was deleted.
  • Rx cDNA was PCR amplified with the primers RxPl (GGC AAT TTG TTC ATC TAG ATA CTG AGA GA) and Rxac4 (TAT TTC AGA GCT CTG GCT AGT CCT CAG AAC ACC) .
  • the PCR product was digested with Xbal and Sacl and ligated to pBl digested with Xbal and Sacl to create pR-Rx.
  • pBIN61 is a modified pBIN19 binary vector that carries a transcription cassette comprising the CaMV 35S promoter and terminator.
  • the tanscription cassette containing the CaMV 35S promoter and terminator was released by digestion with Kpnl and Xhol from the plasmid pJIT61 (kindly provided by P. Mullineaux, JIC, Norwich, UK) .
  • the transcription cassette was then ligated to the pBIN19 plasmid vector digested with Kpnl and Sail to create pBIN61.
  • Rx cDNA was PCR amplified with primers RxPl (GGC AAT TTG TTC ATC TAG ATA CTG AGA GA) and Rxac4 (TAT TTC AGA GCT CTG GCT AGT CCT CAG AAC ACC) .
  • the PCR product was digested with Xbal and ligated with pBIN61 digested with Xbal and Smal .
  • Truncated forms of Rx were constructed in pBIN61 using chimaeric PCR as described previously (Ho et al., 1989).
  • the primers were designed to allow PCR amplification of the 5' part of the Rx coding sequence encoding regions 1-3 ( Figure 3) and the 3' part encoding regions 5-7 ( Figure 3) in separate reactions .
  • the second stage of the chimaeric PCR was then used to fuse the two parts in frame with the LRR deleted (region 4; Figure 3).
  • RxPl GGCAATTTGTTCATCTAGATACTGAGAGA
  • R ⁇ ac TATTTCAGAGCTCTGGCTAGTCCTCAGAACACC
  • LRR1 TTCACGTGAGATTGTTGGTTTCGAGCTTCCCTCAA
  • LRR2 CAACAATCTGTTGTGAATTCCGCC
  • the first stage PCR reactions were carried out with the primers RxPl and LRR1 (PCR1) and LRR2 and Rxac4 (PCR2) .
  • PCR1 primers for PCR
  • PCR2 primers for PCR1
  • PCR2 primers for PCR1
  • RxPl and Rxac4 primers for PCR1
  • PCR2 primers for PCR2
  • the LRR domain was PCR amplified with the primers LRR/Xbal: (GAA GCT CTA GAC ATG AAT TTT GTG AAT) and ATSal: (AAC TGT CGA CTC CTC AGA ACA CCT T) .
  • the PCR product was digested with Xbal and ligated to pBIN61 digested with Xbal and Eel 136 to create 35S-LRR.
  • the N terminal (DimRx) and C terminal (RxDim) translation fusion between Rx cDNA and a tandem repeat of the dimerizing domain FKBP12 were made by chimeric PCR (Ho et al., 1989), as described previously. Primers used to make the fusion between Rx and the dimerization domain were: a) DimRx
  • DimFl CCCATCTAGATGAGCAGAGGCGTCCAAGTC DimF2: GAAACTAGTATGGCTTATGCTGCTGTT
  • Rx8 AATTGGCCATGTATTCAAACCAAG
  • constructs were prepared in the Rx promoter cassette of pBl and in the 35S cassette of pBin61.
  • the open reading frames of auto-activators AT39 and AT25 were PCR amplified with the primers corresponding to the 5 ' and 3 ' extremes of the Rx cDNA.
  • the PCR products were digested with Sail and ligated to the PVX vector construct pgR108 digested with Smal and Xhol.
  • pRG108 is essentially the same as the previously described PVX vectors (Chapman et al . , 1992) except that it is under control of the 35S promoter in the pGreen binary vector.
  • a second modification is that the insertion site of foreign sequence has been modified so that several restriction sites including Smal can be used for insertion of sequences into the PVX vector.
  • PVX-AT25 The PVX clones that express the auto-activators AT-25 and AT-6 are referred to as PVX-AT25 and PVX-AT6, respectively.
  • PVX-AT00 is the same as PVX-AT25 except for a deletion of the first 243 amino acids of the protein containing the motif I of the Ap-ATPase domain.
  • Random mutagenesis of the Rx gene was performed under conditions similar to those previously described (Shafikhani et al . , 1997).
  • the PCR was carried out using the primers RxPl and Rxac4 which flank the Rx ORF.
  • the PCR reaction contained (100 ⁇ l final volume) 10 mM Tris (pH 8.3), 50 mM KC1, 0.05% Nonidet P-40, 7 mM MgC12, 0.15 mM MnC12, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 0.3 ⁇ M of both primers, 50 ng of template and 5 U Taq DNA polymerase (GIBCO-BRL) .
  • PCR was performed for 35 cycles: 15 s at 94 °C, 15 s at 55 °C, and 2 min at 72 °C .
  • the PCR products were digested with Xbal and Sacl, gel purified and cloned in the binary vector pBl in E. coli. Plasmid DNA was purified from 10000 colonies and electroporated into A. tumefaciens strain C58C1 carrying the virulence helper plasmid pCH32 (Hamilton et al., 1996).
  • Oligonucleotide-directed mutagenesis (Bendahmane et al., 1995) was used to introduce specific mutations into the Rx cDNA or into the auto-activators AT25(33), AT39(6) pAT7(30). The presence of mutations was confirmed by sequence analysis.
  • the mutations of the Ap-ATPase motif I were at Rx codon 175 from GGG(G) to GCG(A) and at codon 176 from AAA(K) to GCA(A).
  • the mutations of the Ap-ATPase motif III were at Rx codon 244 from GAT(D) to GCT (A) and at codon 245 from GAC(D) to GCC (A) .
  • the mutations of the Ap-ATPase motif V were at codons 330 from GGA(G) to GCA(A) and 332 from CCT(P) to GCT (A).
  • the mutations of the CFLY motif were at position 389 from TGT(C) to GCT(A) and at position 390 from TTT(F) to GCT (A) .
  • the mutations of the MHD motif were at position 175 from GGG(G) to GCG(A) and at position 176 from AAA(K) to GCA(A).
  • Agrobacterium-mediated transient expression was performed under conditions similar to those described previously (Bendahmane et al., 1999).
  • the binary Ti-plasmid vector constructs were transformed into A. tumefaciens strain C58C1 carrying the virulence helper plasmid pCH32 (Hamilton et al . , 1996).
  • the transformants were inoculated into 5 ml L-broth medium supplemented with 50 ⁇ g/ml kanamycin and 5 ⁇ g/ml tetracycline and grown at 28°C overnight.
  • the RxDim and DimRx constructs were assayed by agrobacterium infiltration, as described above but, as indicated in the text and Figure 5, with the addition of the dimerization agent AP20187 (5 ⁇ M final concentration) (Amara et al., 1997; Clackson et al., 1998) (ARIAD Pharmaceuticals, Inc. 26 Landsdowne Street Cambridge, MA 02139 ) immediately before infiltration into tobacco leaves.
  • sequencing reactions were performed using a dye terminator cycle sequencing reaction kit (Perkin-Elmer) . Sequence reactions were resolved on ABI377 automated sequencer (Applied Biosystems ABI, La Jolla, CA) . Sequence contigs were assembled using UNIX versions of the Staden programs package (Staden, 1996) .
  • FK1012 The original dimerizer used by the Crabtree and Schreiber laboratories to create the model system was FK1012, which is composed of two molecules of the immunosuppressant drug FK506 covalently joined by a flexible linker.
  • FK1012 efficiently dimerizes proteins fused to its cellular receptor FKBP12.
  • FK1012 has been used successfully to regulate receptor activity, to change the intracellular localization of proteins, and to control gene expression (3, 4, 7, 9, 10) .
  • FKCsA A related molecule, is composed of one molecule of FK506 linked to a molecule of a distinct immunosuppressant drug, cyclosporin A (CsA) (6) .
  • CsA cyclosporin A
  • FKCsA will dimerize an FKBP12-fusion protein to a second protein fused to cyclophilin A, the cellular receptor for CsA.
  • FKCsA therefore selectively promotes the formation of heterodimers .
  • the use of a heterodimerizer has potential advantages in situations where the two proteins to be joined are different, such as in transcriptional regulation. In ARIAD' s experience, however, the quantitative improvement over simple homodimerizers is relatively small.
  • ARIAD' s internal efforts also include the development of a gene regulation system for use in human gene therapy, one aspect of which is built around a third immunosuppressant drug, rapamycin (8).
  • Rapamycin efficiently links an FKBP12-fusion protein to a second protein fused to a domain of human FRAP, the target of the rapamycin/FKBP12 complex. Rapamycin itself is not optimal for use in human gene therapy because of its immunosuppressive activity. Therefore, ARIAD is developing nonimmunosuppressive derivatives of rapamycin for its human gene therapy program.
  • ARIAD has synthesized a novel, proprietary dimerizer, AP1510. This molecule acts in a manner similar to FK1012 in that it promotes the formation of
  • AP1510 works significantly better than FK1012 in both applications .
  • AP1510 is completely nontoxic to cells.
  • the other dimerizer molecules are composed of natural product compounds obtained by fermentation of microorganisms.
  • the other dimerizer molecules are composed of natural product compounds obtained by fermentation of microorganisms.
  • AP1510 is entirely synthetic and is made in bulk by ARIAD chemists.
  • ARIAD chemists continue to work toward building dimerizers of this class with improved properties.
  • the coat protein of potato virus X is a strain-specific elicitor of Rxl-mediated virus resistance in potato. Plant J. 8, 933-941.
  • Potato virus X as a vector for gene expression in plants. Plant J. 2, 549-557.
  • NB-ARC domain a novel signalling motif shared by plant resistance gene products and regulators of cell death in animals. Curr. Biol. 8, 226-227.
  • the DNA sequences are of the auto-activators 193 , 25 32 39 , 7 and 72 as indicated .
  • the start and stop codons are underlined in the sequence of auto-activator 193
  • Table III the protein seguences correspond to the cDNA of the auto-activators 193, 25 32 39, 7 and 72 as indicated.

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)
EP00968085A 1999-10-15 2000-10-12 Veränderte resistenzgene Withdrawn EP1228225A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9924483.2A GB9924483D0 (en) 1999-10-15 1999-10-15 Modified resistance genes
GB9924483 1999-10-15
PCT/GB2000/003930 WO2001029239A2 (en) 1999-10-15 2000-10-12 Modified resistance genes

Publications (1)

Publication Number Publication Date
EP1228225A2 true EP1228225A2 (de) 2002-08-07

Family

ID=10862838

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00968085A Withdrawn EP1228225A2 (de) 1999-10-15 2000-10-12 Veränderte resistenzgene

Country Status (4)

Country Link
EP (1) EP1228225A2 (de)
AU (1) AU7804300A (de)
GB (1) GB9924483D0 (de)
WO (1) WO2001029239A2 (de)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60238792D1 (de) 2002-03-27 2011-02-10 Univ Tsukuba Neues meloidogyne-resistenzgen und dessen nutzung
DE102005026045A1 (de) 2005-06-03 2007-06-14 Kws Saat Ag Nukleinsäure, die für ein autoaktiviertes Resistenzprotein zur Erzeugung einer Resistenz gegenüber Pathogenen bei Pflanzen codiert
WO2014127835A1 (en) 2013-02-22 2014-08-28 Christian-Albrechts-Universität Zu Kiel Plant-derived resistance gene

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999038989A1 (en) * 1998-01-30 1999-08-05 The Regents Of The University Of California Constitutively active plant disease resistance genes and polypeptides
EP1053241A1 (de) * 1998-02-13 2000-11-22 President And Fellows Of Harvard College Dimerisierung verbindungen, ihre herstellung und verwendung
AU759037B2 (en) * 1998-03-06 2003-04-03 Syngenta Mogen Bv Method for the induction of pathogen resistance in plants
WO1999045118A1 (en) * 1998-03-06 1999-09-10 Commonwealth Scientific And Industrial Research Organisation Genetic sequences conferring pathogen resistance in plants and uses therefor
GB9808083D0 (en) * 1998-04-16 1998-06-17 Innes John Centre Innov Ltd Plant-derived resistance gene

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0129239A3 *

Also Published As

Publication number Publication date
WO2001029239A3 (en) 2002-06-13
GB9924483D0 (en) 1999-12-15
AU7804300A (en) 2001-04-30
WO2001029239A2 (en) 2001-04-26

Similar Documents

Publication Publication Date Title
EP1682668B1 (de) Pflanzliche transkriptionsregulatoren
CA2652446C (en) Plants having enhanced yield-related traits and a method for making the same
CA2459079C (en) Plant-derived resistance gene
US20040128712A1 (en) Methods for modifying plant biomass and abiotic stress
US8283519B2 (en) Plant transcriptional regulators of abiotic stress
EP2298918A2 (de) Regulation von Biomasse und Stresstoleranz in Pflanzen
US20140033366A1 (en) Plants Having Improved Growth Characteristics and Methods for Making the Same
AU2008209677A1 (en) Plants having enhanced yield-related traits and/or increased abiotic stress resistance, and a method for making the same
CN102803291A (zh) 具有增强的产量相关性状和/或增强的非生物胁迫耐受性的植物和制备其的方法
WO2010129501A1 (en) Yield enhancement in plants by modulation of ap2 transcription factor
BG62976B1 (bg) Методи и материали за придаване на устойчивост на растенията към болести
WO2020104524A1 (en) Chimeric pattern recognition receptor kinases
EP0971579A1 (de) Gen für pflanzliche pathogenantwort
EP1228225A2 (de) Veränderte resistenzgene
WO2000008189A2 (en) Plant resistance gene
EP1078086A2 (de) Resistenzgen aus pflanzen
WO2008100112A1 (en) Transgenic plants exhibiting increased resistance to biotic and abiotic stresses or accelerated flowering time and methods for producing the same
US20130031669A1 (en) Plant transcriptional regulators of abiotic stress ii
US8410337B2 (en) Plant tubby-like proteins
US7314756B2 (en) Plant tubby-like proteins
WO2005038034A2 (en) Plant transcriptional regulators of abiotic stress
MX2007005755A (en) Cytokinin-sensing histidine kinases and methods of use

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020409

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20040810

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061215