EP1220931A1 - Adn codant le polypeptide prost 07 - Google Patents
Adn codant le polypeptide prost 07Info
- Publication number
- EP1220931A1 EP1220931A1 EP00967319A EP00967319A EP1220931A1 EP 1220931 A1 EP1220931 A1 EP 1220931A1 EP 00967319 A EP00967319 A EP 00967319A EP 00967319 A EP00967319 A EP 00967319A EP 1220931 A1 EP1220931 A1 EP 1220931A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- polypeptide
- seq
- prost
- set forth
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/08—Drugs for disorders of the urinary system of the prostate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6445—Kallikreins (3.4.21.34; 3.4.21.35)
Definitions
- This invention relates, in part, to newly identified polynucleotides and polypeptides; variants and derivatives of the polynucleotides and polypeptides; methods of making the polynucleotides and polypeptides, and their variants and derivatives; antibodies directed toward the polypeptides, their variants and derivatives; and uses of the polynucleotides, polypeptides, variants, derivatives and antibodies.
- the invention relates to novel PROST 07 polypeptides, polynucleotides which encode these polypeptides, antibodies directed toward these polypeptides, and antisense polynucleotides that block PROST 07 expression.
- Prostate cancer is a frequently occurring disease in man, in that it is found in about one third of men over the age of 45. There is evidence for both genetic and environmental causes, with the majority of cases probably being the result of a combination of both factors. Studies of familial cancer have suggested that genetic predisposition plays a role in about 5- 10% of all prostate cancers, and in about 45% of cases in men younger than 55. There is evidence that prostate cancer develops as a multi-step disease, with one of the precursor lesions being prostatic intraepithelial neoplasia (PIN). Early stages of the disease are androgen dependent, while later stages are hormone independent. A proliferative disorder of the prostate known as benign prostatic hyperplasia is often detected clinically but is probably not a stage in the development of cancer. It is, however, frequently associated with prostate cancer. Cancers in the prostate are often multifocal, generally slow growing, and heterogeneous. Late stage cancers frequently metastasize to the lymph nodes and to the bone.
- PIN prostatic intraepithelial
- This invention discloses a new human serine protease that is a homologue to the human kallikrein gene family
- This homologue designated PROST 07
- PROST 07 is differentially expressed in prostate tissue as compared with other tissues, and may be over-expressed in prostate tumors
- the kalhkreins are a group of serine proteases that are involved in the postranslational processing of specific polypeptide precursors (Clements, Endocr Rev 10 393-419, 1989, Young et al , J Androl 16 97-99, 1995)
- the human genome contains three kallikrein members pancreatic/sahvary/renal kallikrein (hK1 ), glandular kall ⁇ kre ⁇ n-2 (hK2), and prostate specific antigen (PSA or hK3) (Young et al , J Androl 16 97-99, 1995, Carbini et al , J Hypertens 11 893-898, 1993) All three kallikre
- serine proteases Two major types are involved in a wide range of proteolytic reactions
- the first group, trypsin like enzymes includes digestive (chymotrypsin, trypsin), lysosomal (cathepsin G) and fib ⁇ nolytic (plasminogen activators) enzymes
- the second major group of serine proteases are homologous to the bacterial protease subtihsin They act within the secretory pathway and cleave polypeptide precursors at specific basic sites, generating their biologically active forms Serine protease inhibitors (serpins) constitute a family of proteins including at least 1 -antitrypsm or ⁇ 1 -antichymotrypsin
- the present invention provides a polynucleotide sequence which uniquely encodes a novel serine protease designated herein as PROST 07
- PROST 07 polypeptide is characterized by a catalytic triad composed of serine, histidine and aspartic acid as has been described for other serine proteases It shows homology to the kallikrein family of serine proteases and shows an 82 9% similarity to the newly described serine protease, EMSP1
- polypeptides inter alia, that have been identified as novel serine proteases, by homology between the am o acid sequence set out in Figure 2 (SEQ ID NO 2) and known ammo acid sequences of other serine protease polypeptides
- isolated polynucleotides encoding PROST 07 including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including fragments of the variants, analogs and derivatives
- novel polypeptides of human origin referred to herein as PROST 07 as well as biologically, diagnostically or therapeutically useful fragments, variants and derivatives thereof, variants and derivatives of the fragments, and analogs of the foregoing
- methods of producing the aforementioned PROST 07 polypeptides comprising culturing host cells having expressibly incorporated therein an exogenously-de ⁇ ved PROST 07-encod ⁇ ng polynucleotide under conditions for expression of human PROST 07 in the host and then recovering the expressed polypeptide
- products, compositions, processes and methods that utilize the aforementioned polypeptides and polynucleotides for inter alia research, biological, clinical and therapeutic purposes
- products, compositions and methods for assessing PROST 07 expression in cells by determining PROST 07 polypeptides or PROST 07-encodmg mRNA, and assaying genetic variation and aberrations, such as defects, in prost 07 genes
- antibodies are labeled in such a way as to produce a detectable signal
- Particularly preferred would be an antibody labeled with a radiolabel, an enzyme, a chromophore or a fluorescer
- antibodies which are conjugated to a therapeutic agent for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism
- therapeutic agents which are cytotoxic
- administration of such conjugated antibodies to a human patient for treatment of a disease state characterized by PROST 07 activity or expression such as prostate or ovarian cancer
- peptides and anti-idiotypic antibodies are provided which can be used to stimulate an immune response
- ⁇ bozymes and polynucleotides complementary to prost 07 polynucleotides for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism
- a disease state such as prostate cancer or benign prostatic hyperplasia
- FIGURE 1 Polynucleotide sequence of prost 07 (SEQ ID NO 1 ), which encodes the biologically or immunologically active form of PROST 07
- FIGURE 2 Deduced ammo acid sequence of the active form of PROST 07 (SEQ ID NO 2), with the catalytic triad underlined
- FIGURE 3 Am o acid alignment of PROST 07 with the full-length sequence of enamel matrix serine protease (EMSP1 ) The sequence of PROST 07 is on the bottom
- FIGURE 4 Expression of prost 07 mRNA in human tissues and cell lines by northern blot analysis RNA from human tissues, both tumor and normal, and human cell lines was examined for hybridization of prost 07 mRNA to a radiolabelled probe An mRNA species of 1 6 Kb in size was detected in human prostate tissues, both tumor and normal, in the human prostate tumor cell line LNCaP and in tumor tissue derived from LNCaP cells No expression could be detected in tissues other than prostate tissue
- FIGURE 5 Expression of prost 07 mRNA in human tissues by Taqman based PCR analysis RNA from human tissues, both tumor and normal, was isolated by standard techniques Primers and probe to detect prost 07 mRNA expression were designed using Perkin Elmer's Primer Express software and synthesized by Synthetic Genetics Prost 07 mRNA was detected in human prostate tissues, both tumor and normal, but could not be detected in other normal and tumor tissues
- FIGURE 6 Effect of specific reduction of prost 07 mRNA expression on prostate tumor cell growth
- Three antisense oligonucleotides targeted to prost 07 sequences were utilized to determine the effect of specific reduction of prost 07 mRNA in the PROST 07-express ⁇ ng human prostate cell line LNCaP Nuclear area is proportional to cell number
- FIGURE 7 PROST 07 activity measurements
- Figure 7A shows zymography of purified GST-PROST 07
- a sample of the glutathion eluate was fractionated in an SDS gel containing 10 % gelatin under non-reducing condition To re-nature the separated proteins SDS was sequestered using Triton X-100 and the gel was stained with Coomassie The zymogram identifies two enzymatic activities exhibiting apparent molecular weights of the GST-fusion protein and PROST 07 resulting from auto-catalysis Lanes 1 and 3, different preparations of GST-PROST 07, lane 5, molecular weight markers No sample was loaded in lanes 2 and 4
- Figure 7B shows enzymatic assay of GST-PROST 07 activity
- PROST 07 protease activity was determined using an enzymatic assay that follows the rate of hydrolysis of a peptide substrate (see Example 4) Proteolytic activity is shown as the percent material hydrolyzed over time
- FIGURE 8 Immunohistochemical staining of PROST 07 Polyclonal and monoclonal antibodies specific to PROST 07 were used to examine PROST 07 expression in a variety of human tissues as described in Example 3
- Figure 8A shows staining of normal and prostate tumor tissue
- Figure 8B shows staining of bone marrow containing prostate tumor metastasis
- FIGURE 9 Neutralization of PROST 07 activity by monoclonal antibodies
- FIGURE 10 Inhibition of tumor migration/invasion by monoclonal antibodies
- a mouse monoclonal antibody specific for PROST 07 (4B8) was used to block migration ( Figure 10A) or invasion (Figure 10B) of PROST 07 positive CAOV-3 cells (see Example 7)
- Control cells were either untreated or treated with non-specific IgG mouse antibody
- PROST 07 refers to the polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), variants, analogs, derivatives and fragments thereof, and fragments of the variants, analogs and derivatives
- fragment when referring to the polypeptide of Figure 2 (SEQ ID NO 2) mean a polypeptide which retains essentially the same biological and/or immunological activity as the polypeptide of Figure 2 (SEQ ID NO 2)
- prost 07 refers to the polynucleotide having the sequence set out in Figure 1 (SEQ ID NO 1 ) and polynucleotides encoding polypeptides having the ammo acid sequence of PROST 07 set out in Figure 2 (SEQ ID NO 2), and to polynucleotides encoding PROST 07 variants, analogs, derivatives and fragments, and fragments of the variants, analogs and derivatives Prost 07 also refers to such polynucleotides composed of RNA as well as to polynucleotides which are the complement of polynucleotides which encode the polypeptide sequence set out in Figure 2 (SEQ ID NO 2)
- Polynucleot ⁇ de(s) generally refers to any poly ⁇ bonucleotide or polydeoxribonudeotide, which may be unmodified RNA or DNA or modified RNA or DNA
- polynucleotides as used herein refers to, among others, smgle-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, smgle- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions
- polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA The strands in such regions may be from the same molecule or from different molecules The regions may include all of one or more of the molecules, but more typically involve only a region of
- polynucleotide includes DNAs or RNAs as described above that contain one or more modified bases
- DNAs or RNAs with backbones modified for stability or for other reasons are “polynucleotides” as that term is intended herein
- DNAs or RNAs comprising unusual bases, such as inosme, or modified bases, such as tritium-labelled bases, to name just two examples are polynucleotides as the term is used herein
- polynucleotide as it is employed herein embraces such chemically, enzymatically or metabohcally modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells, inter alia
- Polypeptides includes all polypeptides as described below The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art In this context, the term is used herein to refer to any peptide or protein comprising two or more ammo acids joined to each other in a linear chain by peptide bonds As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, ohgopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types
- polypeptides often contain ammo acids other than the 20 ammo acids commonly referred to as the 20 naturally occurring ammo acids, and that many ammo acids, including the terminal ammo acids, may be modified in a given polypeptide, either by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques which are well known in the art
- the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art
- modifications which may be present in polypeptides of the present invention are, to name an illustrative few, acetylation, acylation, ADP- ⁇ bosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a polynucleotide or polynucleotide derivative, covalent attachment of
- polypeptides are not always entirely linear
- polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing events and events brought about by human manipulation which do not occur naturally Circular, branched and branched circular polypeptides may be synthesized by non-translational natural processes and by entirely synthetic methods, as well
- Modifications can occur anywhere in a polypeptide, including the peptide backbone, the ammo acid side-chains and the ammo or carboxyl termini
- blockage of the ammo or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well
- the ammo terminal residue of polypeptides made in E coli, prior to proteolytic processing almost invariably will be N-formylmethionine
- the modifications that occur in a polypeptide often will be a function of how it is made
- the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide ammo acid sequence
- glycosylation often does not occur in bacterial hosts such as E coli Accordingly
- polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide
- Polynucleotide encoding a polypeptide encompasses polynucleotides which include a sequence encoding a polypeptide of the present invention particularly the PROST 07 polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2) The term encompasses polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by mtrons) together with additional regions "Biological activity” refers to the structural, regulatory or biochemical functions of naturally occurring PROST 07 polypeptide
- “Immunologic activity” refers to the capability of the natural, recombinant or synthetic PROST 07, or any fragment thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies
- "Ol ⁇ gonucleot ⁇ de(s)" refers to relatively short polynucleotides Often the term refers to single-stranded deoxy ⁇ bonucleotides but it can refer as well to single- or double-stranded ⁇ bonucleotides, RNA DNA hybrids and double-stranded DNAs, among others
- Oligonucleotides, such as single-stranded DNA probe oligonucleotides often are synthesized by chemical methods, such as those implemented on automated oligonucleotide synthesizers However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms "Oligonucleotides” or "o
- Nonally occurring PROST 07 refers to PROST 07 produced by human cells that have not been genetically engineered and specifically contemplates various PROST 07 forms arising from post-translational modifications of the polypeptide including but not limited to acetylation, carboxylation, glycosylation, phosphorylation, lipidation, acylation, and cleavage "Var ⁇ ant(s)" of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively Variants in this sense are described below and elsewhere in the present disclosure in greater detail
- changes in the polynucleotide sequence of the variant may be silent That is, they may not alter the ammo acids encoded by the polynucleotide Where alterations are limited to silent changes of this type a variant will encode a polypeptide with the same ammo acid sequence as the reference. Also as noted below, changes in the polynucleotide sequence of the variant may alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Such polynucleotide changes may result in ammo acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below
- a polypeptide that differs in ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical
- a variant and reference polypeptide may differ in ammo acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination
- Recombinant variants encoding these same or similar polypeptides may be synthesized or selected by making use of the "redundancy" in the genetic code
- Various codon substitutions, such as the silent changes which produce various restriction sites may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system
- Mutations may also be introduced to modify the properties of the polypeptide, to change ligand- bmding affinities, interchain affinities, or polypeptide degradation or turnover rate
- Allelic variant refers to an alternative form of the prost 07 polynucleotide Alleles result from a mutation, i e , a change in the polynucleotide sequence, and generally produce altered mRNAs or polypeptides whose structure or function may or may not be altered Any given gene may have none, one or many allelic forms Common mutational changes which give rise to alleles are generally ascribed to natural deletions, additions or substitutions of nucleotides Each of these types of changes may occur alone, or in combination with the others, or one or more times in a given sequence "Derivative” refers to polynucleotides or polypeptides derived from naturally occurring prost 07 or PROST 07, respectively, by chemical modifications such as ubiquitination, labeling (e g , with radionuchdes, various enzymatic modifications), pegylation (de ⁇ vatization with polyethylene glycol) or by insertion or substitution of am o acids such as omithme (or substitution of the nucleo
- “Deletion” is defined as a change in either polynucleotide or ammo acid sequences in which one or more polynucleotides or ammo acid residues, respectively, are absent
- “Insertion” or “addition” is that change in a polynucleotide or ammo acid sequence which has resulted in the addition of one or more polynucleotides or ammo acid residues, respectively, as compared to the naturally occurring polynucleotide or am o acid sequence "Substitution" results from the replacement of one or more polynucleotides or ammo acids by different polynucleotides or ammo acids, respectively
- ammo acid substitutions are the result of replacing one ammo acid with another am o acid having similar structural and/or chemical properties, such as the replacement of a leucme with an isoleucine or valine, an aspartate with a glutamate, or a threonme with a serine, i e conservative ammo acid replacement Insertions or deletions are typically in the range of about 1 to 5 ammo acids The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of am o acids in the polypeptide using recombinant DNA techniques and assaying the resulting recombinant variants for activity
- “Fragment” is a polypeptide having an ammo acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST 07 polypeptides and variants or derivatives thereof
- a polypeptide "fragment”, “portion”, or “segment” is a stretch of ammo acid residues of at least about 5 am o acids, often at least about 7 ammo acids, typically at least about 9 to 13 ammo acids, and in various embodiments, at least about 17 or more am o acids
- Recombinant or “recombinant DNA molecule” refers to a polynucleotide sequence which is not naturally occurring, or is made by the artificial combination of two otherwise separated segments of sequence
- recombmantly produced is meant artificial combination often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of polynucleotides, e g , by genetic engineering techniques Such manipulation is usually done to replace a codon with a redundant codon encoding the same or a conservative ammo acid, while typically introducing or removing a sequence recognition site Alternatively, it is performed to join together polynucleotide segments with desired functions to generate a single genetic entity comprising a desired combination of functions not found in the common natural forms Restriction enzyme recognition sites, regulation sequences, control sequences, or other useful features may be incorporated by design
- Recombinant DNA molecules include cloning and expression vectors
- Recombinant may also refer to a polynucleotide which encodes a polypeptide and is prepared
- isolated means altered “by the hand of man” from its natural state, i e , that, if it occurs in nature, it has been changed or removed from its original environment, or both
- a naturally occurring polynucleotide or a polypeptide naturally present in a living animal in its natural state is not “isolated”, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein
- polynucleotides the term isolated means that it is separated from the chromosome and cell in which it naturally occurs
- Polynucleotides and polypeptides may occur in a composition, such as media formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides withm the meaning of that term
- PROST 07 polypeptide, or fragments thereof, or a polynucleotide segment encoding same where such polypeptide or polynucleotide is separated from components that naturally accompany it
- a PROST 07 polypeptide or fragment thereof, or DNA segment encoding same is substantially free of naturally-associated components when it is separated from the native contaminants which accompany it in its natural state
- a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originates will be substantially free from its naturally-associated components
- a polynucleotide that is chemically synthesized or synthesized in a cellular system different from the cell in which it naturally originated will be substantially free from its naturally-associated components
- Hybridization shall include “any process by which a polynucleotide strand joins with a complementary strand through base pairing” (Coombs, J , Dictionary of
- “Therapeutically effective dose” refers to that amount of polypeptide or its antibodies, antagonists, or inhibitors, including antisense molecules and ribozymes, which ameliorate the symptoms or conditions of a disease state Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population) The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, ED S0 /LD 50
- Treating covers the treatment of a disease-state in a human patient, which disease-state is associated with prostate tumor growth and includes disease states in which the patient is in need of decreased levels of PROST 07
- the present invention relates to novel PROST 07 polypeptides, prost 07 polynucleotides, and antibodies directed toward PROST 07 polypeptides, among other things, as described in greater detail below
- the invention relates to novel PROST 07 polypeptides and the polynucleotides encoding these PROST 07 polypeptides, and relates especially to PROST 07 having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2) and prost 07 having the polynucleotide sequence set out in Figure 1 (SEQ ID NO 1 )
- the present invention also encompasses PROST 07 variants
- a preferred PROST 07 variant is one having at least 70% similarity (preferably at least 70% identity) to the polypeptide sequence shown in Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity
- the coding sequence for the predicted active form of the PROST 07 polypeptide begins 31 base pairs from the 5 end of the nucleotide sequence shown in Fig 1 (SEQ ID NO 1 )
- the first 30 base pairs code for a predicted pro-sequence and part of a signal sequence
- the present invention is based in part on the identification of a catalytic triad characteristic of serine proteases that is identifiable in the PROST 07 polypeptide sequence
- the triad is composed of a histid e residue, an aspartic acid residue, and a serine residue (positions 51 , 96, and 187, respectively, in Figure 2 (SEQ ID NO 2))
- the am o acids surrounding these residues are frequently conserved in serine proteases
- the invention is also based in part on the structural homology shown in Figure 3 between PROST 07 and EMPS 1 , another member of the serine protease family
- the ammo acid sequence of PROST 07 is approximately 77 8% identical to EMSP
- the invention is also based in part on functional studies demonstrating the effect of a reduction in the level of mRNA encoding PROST 07 on prostate tumor cell growth in culture This was demonstrated in the prostate tumor cell line, LNCaP, using antisense oligonucleotides to reduce prost 07 mRNA expression Three antisense oligonucleotide reagents were selected that reduced mRNA levels for prost 07 when administered to cells in the presence of lipids Administration of these antisense oligonucleotide reagents to LNCaP cells inhibited proliferation of the cells in a dose dependent manner In the same dose range, a control oligonucleotide mixture composed of a set of random 23mer oligonucleotides did not affect proliferation of the cells These experiments then, demonstrated that inhibition of PROST 07 expression impacted the growth of the tumor cell lines in which PROST 07 is normally expressed
- the invention is further based on studies demonstrating the ability of antibodies directed against PROST 07 to both neutralize the activity of the protein and to block tumor cell migration and invasion in vitro
- a polynucleotide of the present invention encoding a PROST 07 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA from cells of human tissue as starting material
- standard cloning and screening procedures such as those for cloning cDNAs using mRNA from cells of human tissue as starting material
- the polynucleotide sequence in Figure 1 was found in cDNA clones obtained from human prostate tissues.
- Prost 07 was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database The mRNA coding for PROST 07 was discovered using the "Transcript Imaging" feature of LifeSeq and search parameters that permitted selection of novel genes expressed in Incyte's prostate tumor cell cDNA libraries at an abundance greater than 2 copies per library This set of genes was evaluated by electronic Northern analysis to determine their distribution in other prostate tissue libraries and in all the other tissue libraries in the database Clone 1651585 was identified in library PROSTUT12 of LIFESEQ Version 4 1 SEP96 (Beta), and shown to cluster with other clones containing prost 07 polynucleotides in a prostate specific fashion by Electronic Northern analysis This prostate specific expression has been seen consistently in updated versions of the LifeSeq database All clones coding for fragments of PROST 07 were assembled into a contiguous sequence using Genetics Computer Group (GCG, Wisconsin Package) gene assembly program and the sequence of the assembled mRNA evaluated An open reading frame coding for a protein was identified and
- Polynucleotides of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof, or by methods described herein
- the DNA may be double-stranded or single-stranded Single-stranded
- DNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand
- the coding sequence which encodes the polypeptide may be identical to the coding sequence of the polynucleotide shown in Figure 1 (SEQ ID NO 1 ) It also may be a polynucleotide with a different sequence, which, as a result of the redundancy (degeneracy) of the genetic code, encodes the polypeptide of Figure 2 (SEQ ID NO 2)
- Polynucleotides of the present invention which encode the polypeptide of Figure 2 may include, but are not limited to, the coding sequence for the polypeptide itself, the coding sequence for the polypeptide and additional coding sequences, such as those encoding a leader or secretory sequence, such as a pre-, or pro- or prepro-prote sequence, the coding sequence of the polypeptide, with or without the aforementioned additional coding sequences, together with additional, non-coding sequences, including for example, but not limited to, introns and non-coding 5 and 3 sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing (for example, splicing and polyadenylation signals) or additional coding sequences which code for additional ammo acids, such as those which provide additional functionalities
- the polypeptide may be fused to a marker sequence, such as a peptide, which facilitates purification of the fused polypeptide
- a marker sequence such as a
- the polynucleotides may encode a polypeptide which is the polypeptide plus additional ammo or carboxyl-termmal ammo acids, or ammo acids interior to the polypeptide (when the active form has more than one polypeptide chain, for instance)
- Such sequences may play a role in processing of a polypeptide from precursor to final form, may facilitate polypeptide trafficking, may prolong or shorten polypeptide half-life or may facilitate manipulation of a polypeptide for assay or production, among other things
- the additional ammo acids may be processed away from the polypeptide by cellular enzymes
- a precursor polypeptide, having the final form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called propolypeptides
- the present invention further relates to variants of the herein above described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced ammo acid sequence of Figure 2 (SEQ ID NO 2)
- a variant of the polynucleotide may be a naturally occurring variant such as a naturally occurring allelic variant, or it may be a variant that is not known to occur naturally
- Such non-naturally occurring variants of the polynucleotide may be made by mutagenesis techniques, including those applied to polynucleotides, cells or organisms
- variants in this regard are variants that differ from the aforementioned polynucleotides by polynucleotide substitutions, deletions or additions
- the substitutions, deletions or additions may involve one or more polynucleotides
- the variants may be altered in coding or non-coding regions or both Alterations in the coding regions may produce conservative or non-conservative ammo acid substitutions, deletions or additions
- polypeptides having the ammo acid sequence of PROST 07 set out in Figure 2 SEQ ID NO 2
- variants, analogs, derivatives and fragments thereof variants of the variants, analogs and derivatives
- polynucleotides encoding PROST 07 variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments which have the am o acid sequence of the PROST 07 polypeptide of Figure 2 (SEQ ID NO 2) in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no ammo acid residues are substituted, deleted or added, in any combination Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the PROST 07 polypeptide Also especially preferred in this regard are conservative substitutions Most highly preferred are polynucleotides encoding polypeptides having the am o acid sequence of Figure 2 (SEQ ID NO 2) without substitutions
- polynucleotides that are at least 70% identical to a polynucleotide encoding the PROST 07 polypeptide having the ammo acid sequence set out in Figure 2 (SEQ ID NO 2), and polynucleotides which are complementary to such polynucleotides
- polynucleotides that comprise a region that is at least 80% identical to a polynucleotide encoding the PROST 07 polypeptide and polynucleotides complementary thereto
- polynucleotides at least 90% identical to the same are particularly preferred, and among these particularly preferred polynucleotides, those with at least 95% are especially preferred
- those with at least 97% are highly preferred among those with at least 95%, and among these, those with at least 98% and at least 99% are particularly highly preferred with at least 99% being the more preferred
- polynucleotides which encode polypeptides which retain substantially the same biological activity as the polypeptide encoded by the polynucleotide sequence of Figure 1 (SEQ ID NO 1 )
- the present invention further relates to polynucleotides that hybridize to the herein above-described sequences
- the present invention especially relates to polynucleotides which hybridize under stringent conditions to the herein above-described polynucleotides
- the coding region of the prost 07 gene may be isolated by screening using the known DNA sequence to synthesize an oligonucleotide probe A labeled oligonucleotide having a sequence complementary to that of a polynucleotide of the present invention is then used to screen a library of human cDNA, genomic DNA or mRNA to determine to which members of the library the probe hybridizes
- the invention also relates to, among others, polynucleotides encoding the polypeptide fragments, polynucleotides that hybridize to polynucleotides encoding polypeptide fragments, particularly those that hybridize under stringent conditions, and polynucleotides, such as PCR primers, for amplifying polynucleotides that encode polypeptide fragments
- preferred polynucleotides are those that correspond to preferred polypeptide fragments, as discussed below
- the present invention further relates to a PROST 07 polypeptide which has the deduced ammo acid sequence of Figure 2 (SEQ ID NO 2)
- the invention also relates to fragments, analogs and derivatives of these polypeptides
- fragment, derivative and analog when referring to the polypeptide of Figure 2 (SEQ ID NO 2) means a polypeptide which retains essentially the same biological activity as such a polypeptide
- an analog includes a propolypeptide which can be activated by cleavage of the propolypeptide portion to produce an active polypeptide of the invention
- polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide In certain preferred embodiments, it is a recombinant polypeptide
- the fragment, derivative or analog of the polypeptide of Figure 2 may be (i) one in which one or more of the ammo acid residues are substituted with a conserved or non-conserved am o acid residue (preferably a conserved ammo acid residue) and such substituted ammo acid residue may or may not be one encoded by the genetic code, or (n) one in which one or more of the ammo acid residues includes a substituent group, or (in) one in which the polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol) or (iv) one in which the additional ammo acids are fused to the polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the polypeptide
- a conserved or non-conserved am o acid residue preferably a conserved ammo acid residue
- substituted ammo acid residue may or may not be one encoded by the genetic code
- polypeptides having the am o acid sequence of PROST 07 set out in Figure 2 SEQ ID NO 2
- variants, analogs, derivatives and fragments thereof variants, analogs and derivatives of the fragments
- substitutions are those that vary from a reference by conservative ammo acid substitutions
- Such substitutions are those that substitute a given ammo acid in a polypeptide by another ammo acid of like characteristics
- conservative substitutions are the replacements, one for another, among the aliphatic ammo acids Ala, Val, Leu and lie, interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe and Tyr
- polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity
- polypeptides of the present invention also include the polypeptide of Figure 2 (SEQ ID NO 2) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of Figure 2 (SEQ ID NO 2) and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 ammo acids and more preferably at least 50 ammo acids
- polypeptides comprising fragments of PROST 07, most particularly fragments of the PROST 07 of Figure 2 (SEQ ID NO 2), and fragments of variants and derivatives of the PROST 07 of Figure 2 (SEQ ID NO 2)
- a fragment is a polypeptide having an am o acid sequence that entirely is the same as part but not all of the ammo acid sequence of the aforementioned PROST 07 polypeptides and variants or derivatives thereof
- fragments may be "free-standing," i e , not part of or fused to other am o acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region However, several fragments may be comprised within a single larger polypeptide
- certain preferred embodiments relate to a fragment of a PROST 07 polypeptide of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre- and propolypeptide regions fused to the am o terminus of the PROST 07 fragment and an additional region fused to the carboxyl terminus of the fragment Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fusion polypeptide or fusion protein derived from PROST 07 As representative examples of polypeptide fragments of the invention, there may be mentioned those which have from about 25 to about 145 am o acids
- ammo acids in this context means a polypeptide fragment of 25 plus or minus several, a few, 5, 4, 3, 2 or 1 ammo acids to 145 plus or minus several a few, 5, 4, 3, 2 or 1 ammo acid residues, i e , ranges as broad as 25 minus several am o acids to 145 plus several ammo acids to as narrow as 25 plus several am o acids to 145 minus several ammo acids
- fragments characterized by biological and/or immunological attributes of PROST 07 are fragments characterized by biological and/or immunological attributes of PROST 07 Most preferred are fragments containing the predicted active domain of PROST 07, which encompasses am o acids 1 1 to 234, or a fragment containing the putative proprotem sequence of PROST 07, encompassing ammo acids 4-10
- FIG. 2 Certain preferred regions in these regards are set out in Figure 2 (SEQ ID NO 2), and include, but are not limited to, regions of the aforementioned types identified by analysis of the ammo acid sequence set out in Figure 2 (SEQ ID NO 2) As set out in Figure 2 (SEQ ID NO 2), such preferred regions include the catalytic triad found in serine proteases, which encompasses ammo acids 47-52, 96-99, and 181 -192 of PROST 07
- PROST 07 including those with a similar activity or an improved activity, or with a decreased undesirable activity
- Highly preferred in this regard are fragments that contain regions that are homologs in sequence, or in position, or in both sequence and position to active regions of related polypeptides, such as the other proteins of the serine protease family, which includes PROST 07
- the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques
- vectors which include polynucleotides of the present invention
- host cells which are genetically engineered with vectors of the invention
- production of polypeptides of the invention by recombinant techniques
- Such techniques are described in Sambrook et al , Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, N Y , 1989 and Ausubel, F M et al , Current Protocols in Molecular Biology, John Wiley & Sons, New York, N Y , 1989
- Host cells can be genetically engineered to incorporate polynucleotides and express polypeptides of the present invention
- polynucleotides may be introduced into host cells using well known techniques of infection, transduction, transfection, transvection and transformation
- the polynucleotides may be introduced alone or with other polynucleotides
- Such other polynucleotides may be introduced independently, co-introduced or introduced joined to the polynucleotides of the invention
- polynucleotides of the invention may be transfected into host cells with another, separate, polynucleotide encoding a selectable marker, using standard techniques for cotransfection and selection in, for instance, mammalian cells
- the polynucleotides generally will be stably incorporated into the host cell genome
- the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host
- the vector construct may be introduced into host cells by the aforementioned techniques
- a plasmid vector is introduced as DNA in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid Electroporation also may be used to introduce polynucleotides into a host
- the vector is a virus, it may be packaged in vitro or introduced into a packaging cell and the packaged virus may be transduced into cells
- the vector may be, for example, a plasmid vector, a single plasmid vector
- the vectors provide for specific expression
- Such specific expression may be inducible expression or expression only in certain types of cells or both inducible and cell-specific
- Particularly preferred among inducible vectors are vectors that can be induced for expression by environmental factors that are easy to manipulate, such as temperature and nutrient additives
- a variety of vectors suitable to this aspect of the invention, including constitutive and inducible expression vectors for use in prokaryotic and eukaryotic hosts, are well known and employed routinely by those of skill in the art
- the engineered host cells can be cultured in conventional nutrient media, which may be modified as appropriate for, inter alia, activating promoters, selecting transformants or amplifying genes Culture conditions, such as temperature, pH and the like, previously used with the host cell selected for expression generally will be suitable for expression of polypeptides of the present invention as will be apparent to those of skill in the art
- vectors can be used to express a polypeptide of the invention
- Such vectors include chromosomal, episomal and virus-derived vectors e g , vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements such as cosmids and phagemids, all may be used for expression in accordance with this aspect of the present invention
- any vector suitable to maintain, propagate or express polynucleotides to express a polypeptide in a host may be used for expression in this regard
- a preferred vector is one derived from baculovirus
- the appropriate DNA sequence may be inserted into the vector by any of a variety of well-known and routine techniques
- a DNA sequence for expression is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction endonucleases and then joining the restriction fragments together using T4 DNA ligase Procedures for restriction and hgation that can be used to this end are well known and routine to those of skill Suitable procedures in this regard, and for constructing expression vectors using alternative techniques, which also are well known and routine to those of skill, are set forth in great detail in Sambrook et al cited elsewhere herein
- the DNA sequence in the expression vector is operatively linked to appropriate expression control sequence(s), including, for instance, a promoter to direct mRNA transcription Representatives of such promoters include the phage lambda PL promoter, the E coli lac, trp and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs to name just a few of the well-
- Vectors for propagation and expression generally will include selectable markers Such markers also may be suitable for amplification or the vectors may contain additional markers for this purpose
- the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells
- Preferred markers include dihydrofolate reductase or neomycm resistance for eukaryotic cell culture, and tetracyclme, theomycm, kanamycm or ampicillm resistance genes for culturing E coli and other bacteria
- the vector containing the appropriate DNA sequence as described elsewhere herein, as well as an appropriate promoter, and other appropriate control sequences, may be introduced into an appropriate host using a variety of well known techniques suitable to expression therein of a desired polypeptide
- appropriate hosts include bacterial cells, such as E coli Streptomyces and Salmonella typhimurium cells, fungal cells, such as yeast cells, insect cells such as Drosophila S2 and Spodoptera Sf9 cells, animal cells such as CHO, COS and Bowes melanoma cells, and plant cells, preferably insect cells BTI-TN-5B1-4 Hosts for a great variety of expression constructs are well known, and those of skill will be enabled by the present disclosure readily to select a host for expressing a polypeptides in accordance with this aspect of the present invention
- mammalian cell culture systems can be employed for expression, as well Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblast (Gluzman et al , Cell 23 175, 1991 ) Other cell lines capable of expressing a compatible vector include for example, the C127, 3T3, CHO, HeLa, human kidney 293 and BHK cell lines In mammalian host cells, a number of viral-based expression systems may be utilized In cases where an adenovirus is used as an expression vector, the polynucleotide sequence coding for PROST 07 may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence Insertion in a nonessential E1 or E3 region of the viral genome will result in a viable virus capable of expressing PROST 07 in infected host cells (Logan and Shenk, Proc Natl Acad Sci USA 81 3655-59, 1984) In addition, transcription enhancers, such as the rouse sar
- vectors preferred for use in bacteria are pQE70, pQE ⁇ O and pQE-9, available from Qiagen USA (Valencia, CA), pBS vectors, Phagescnpt® vectors, Bluescnpt® vectors, pNH8A, pNHI ⁇ a, pNHI8A, pNH46A, available from Stratagene (LaJolla, CA), and ptrc99a, pK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech (Piscataway, N J ) Most preferred is the pTrcHisB vector, available from Introgen Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, PXTI and pSG available from Stratagene, and PSVK3, pBPV, pMSG and pSVL available from Pharmacia
- Promoter regions can be selected from any desired gene using vectors that contain a reporter transcription unit lacking a promoter region, such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter
- a reporter transcription unit lacking a promoter region such as a chloramphenicol acetyl transferase ("cat") transcription unit, downstream of restriction site or sites for introducing a candidate promoter fragment, i e , a fragment that may contain a promoter
- introduction into the vector of a promoter-containing fragment at the restriction site upstream of the cat gene engenders production of CAT activity, which can be detected by standard CAT assays
- Vectors suitable to this end are well known and readily available Two such vectors are pKK232-B and pCM7
- promoters for expression of polynucleotides of the present invention include not only well known and readily available
- recombinant expression vectors will include origins of replication, a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence, and a selectable marker to permit isolation of vector containing cells after exposure to the vector
- the present invention also relates to host cells containing the above-described constructs discussed above
- the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell Constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence Polypeptides can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al , cited elsewhere herein
- Enhancers are cisactmg elements of DNA, usually about from 10 to 300 bp that act to increase transcriptional activity of a promoter in a given host cell-type
- enhancers include the SV40 enhancer, which is located on the late side of the replication origin at bp 100 to 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers
- Polynucleotides of the invention encoding the heterologous structural sequence of a polypeptide of the invention generally will be inserted into the vector using standard techniques so that it is operably linked to the promoter for expression
- the polynucleotide will be positioned so that the transcription start site is located appropriately 5 to a ribosome binding site
- the ribosome binding site will be 5 to the AUG that initiates translation of the polypeptide to be expressed
- secretion signals may be incorporated into the expressed polypeptide
- the signals may be endogenous to the polypeptide or they may be heterologous signals
- the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals but also additional heterologous fuctional regions
- a region of additional ammo acids, particularly charged am o acids may be added to the N-termmus of the polypeptide to improve stability and persistence in the host cell, during purification or during subsequent handling and storage
- special regions also may be added to the polypeptide to facilitate purification Such regions may be removed prior to final preparation of the polypeptide
- the addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art For example, when large quantities of PROST 07 are needed
- PROST 07 polypeptide can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
- HPLC high performance liquid chromatography
- Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification
- Various other methods of protein purification well known in the art include those described in Deutscher, M , Methods in Enzymology, Vol 182, Academic Press, San Diego, 1982, and Scopes, R , Protein Purification Principles and Practice
- polypeptides of the present invention can be produced by direct peptide synthesis using solid-phase techniques (Stewart et al , Solid-Phase Peptide Synthesis, W H Freeman Co , San Francisco, 1969, Mernfield, J , J Am Chem Soc
- Polypeptides of the present invention include naturally purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non- glycosylated In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes
- PROST 07 polypeptides and the polynucleotides which encode them
- Prost 07 polynucleotides and PROST 07 polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of PROST 07 Additional applications relate to diagnosis and to treatment of diseases of cell proliferation, such as prostate cancer
- PROST 07 may be used in the diagnosis and treatment of conditions, disorders or diseases associated with inappropriate growth of prostate tissue as compared with other tissues
- PROST 07 may be used in the diagnosis and treatment of conditions, disorders or diseases associated with inappropriate growth of prostate tissue
- Prost 07 polynucleotide sequences can be used as DNA probes, and as targets for antisense and ⁇ bozyme therapy, or as templates for the production of antisense polynucleotides
- PROST 07 polypeptides can be used to generate antibodies to PROST 07 which may be useful in detecting the levels of PROST 07 polypeptide in cells and tissues and in targeting drugs to primary and metastatic tumors
- PROST 07 polypeptides may be used to stimulate an immune response to PROST 07 containing cells
- Polynucleotides encoding PROST 07 may be useful in diagnostic assays for detecting the levels of polynucleotides encoding PROST 07 in cells and tissues
- PROST 07 In conditions associated with expression of PROST 07, such as prostate cancer, it may be advantageous to suppress expression or activity of PROST 07 PROST 07 expression could be suppressed by administration of antisense oligonucleotides or ⁇ bozymes Alternatively, antibodies specifically recognizing areas of the PROST 07 polypeptide which are responsible for its activity may be administered to treat diseases or conditions associated with PROST 07 activity
- This invention is also related to the use of the prost 07-related polynucleotides to detect complementary polynucleotides such as, for example, as a diagnostic reagent
- Detection of prost 07 polynucleotides associated with a disease state will provide a tool for the development of in vitro and in vivo diagnostics that can add or define a diagnosis of a disease or susceptibility to a disease which results from tissue specific expression of PROST 07
- Individuals carrying mutations in the gene encoding PROST 07 may be detected at the DNA level by a variety of techniques
- Polynucleotide samples for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material
- the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR prior to analysis (Saiki et al , Nature, 324 163-166, 1986)
- RNA or cDNA may also be used in the same ways
- PCR primers complementary to the polynucleotide sequence encoding PROST 07 can be used to identify and analyze prost 07 expression and mutations For example, deletions and insertions can be detected by a change
- Sequence differences between a reference gene and genes having mutations also may be revealed by direct DNA sequencing
- cloned DNA segments may be employed as probes to detect specific DNA segments
- the sensitivity of such methods can be greatly enhanced by appropriate use of PCR or another amplification method
- a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR
- the sequence determination is performed by conventional procedures with radiolabeled polynucleotide or by automatic sequencing procedures with fluorescent tags
- DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures
- Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e g , Catton et al , Proc Natl Acad Sci , USA, 85 4397-4401 , 1985)
- the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA)
- methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e g , restriction fragment length polymorphisms ("RFLP”) and Southern blotting of genomic DNA)
- mutations also can be detected by in situ analysis
- the present invention also relates to a diagnostic assays such as quantitative and diagnostic assays for detecting levels of PROST 07 polypeptide in cells and tissues and body fluids, including determination of normal and abnormal levels
- a diagnostic assay in accordance with the invention for detecting over-expression of PROST 07 polypeptide compared to normal control tissue samples may be used to detect the presence of neoplasia, for example, prostate cancer
- Such diagnostic tests may be used to detect metastatic tumor growth, as well
- Assay techniques that can be used to determine levels of a polypeptide, such as a PROST 07 polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art
- Such assay methods include radioimmunoassays (RIA), competitive-binding assays, western Blot analysis and enzyme- linked immunoabsorbant assays (ELISA ), and fluorescent activated cell sorting (FACS) Among these ELISAs frequently are preferred
- An ELISA assay initially comprises
- a sample is removed from a host and incubated on a solid support, e g a polystyrene dish, that binds the polypeptides in the sample Any free polypeptide binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin
- the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any PROST 07 polypeptides attached to the polystyrene dish Unbound monoclonal antibody is washed out with buffer
- the reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to PROST 07 Unattached reporter antibody is then washed out
- Reagents for peroxidase activity including a colorimet ⁇ c substrate are then added to the dish Immobilized peroxidase, linked to PROST 07 through the primary and secondary antibodies, produces a colored reaction product The amount of color developed in a given time
- a competition assay may be employed wherein antibodies specific to PROST 07 are attached to a solid support and labeled PROST 07 and a sample derived from the host are passed over the solid support and the amount of label detected attached to the solid support can be correlated to a quantity of PROST 07 in the sample
- the invention further relates to antibodies that specifically bind to PROST 07, herein referred to as PROST 07 antibodies
- PROST 07 antibodies The prostate-specificity of PROST 07 and its cell surface location represent characteristics of an excellent marker for screening, diagnosis, prognosis, follow-up assays and imaging methods In addition, these characteristics indicate that PROST 07 may be an excellent target for therapeutic methods such as targeted antibody therapy, immunotherapy, and gene therapy
- the term "specifically binds to” refers to the interaction of an antibody and a polypeptide, in which the interaction is dependent upon the presence of a particular structure (i e , the antigenic determinant or epitope) on the polypeptide, in other words, the antibody is recognizing and binding to a specific polypeptide structure rather than to proteins in general
- the PROST 07 polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto (Harlow, Antibodies, Cold Spring Harbor Press, NY (1989))
- These antibodies can be, for example, polyclonal or monoclonal antibodies
- the present invention also includes chimeric, single chain, and human antibodies, as well as Fab fragments, or the product of a Fab expression library Various procedures known in the art may be used for the production of such antibodies and fragments
- Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman The antibody so obtained will then bind the polypeptides itself In this manner even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide
- any technique which provides antibodies produced by continuous cell line cultures can be used Examples include the hybndoma technique (Kohler and Milstein, Nature 256 495-497, 1975), the human B-cell hybndoma technique (Kozbor et al , Immunology Today 4 72, I983) and the EBV-hyb ⁇ doma technique to produce human monoclonal antibodies (Cole et al , in Monoclonal Antibodies and Cancer, Alan R Liss, Inc , 77-96, 1985)
- “human” antibodies can be produced using the methods described in U S Patent Nos 5,877,397 and 5,569,825, which are incorporated herein in full by reference Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobulin libraries or panels of highly specific binding reagents as disclosed in Orlandi et al (Proc Natl Acad Sci USA 86 3833-3837, 1989) and Winter and Milstein (Nature 349 293-299, 1991 )
- Antibody fragments which contain specific binding sites for PROST 07 may also be generated
- fragments include, but are not limited to the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments
- Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse et al , Science 256 1270-1281 , 1989)
- the ammo acid sequence of PROST 07 presented herein may be used to select specific regions of the PROST 07 polypeptide for generating antibodies
- the regions or epitopes of a PROST 07 polypeptide to which an antibody is directed may vary with the intended application
- antibodies intended for use in an immunoassay for the detection of membrane-bound PROST 07 on prostate cells should be directed toward accessible epitopes on the PROST 07 polypeptide Regions of the PROST 07 polypeptide that show immunogenic structure, as well as other regions and domains, can readily be identified using various other methods known in the art, such as Chou- Fasman, Garnier-Robson, or Jameson-Wolf analysis Fragments containing these residues are particularly suited in generating anti-PROST 07 antibodies Particularly useful fragments include, but
- PROST 07 antibodies may be used to isolate PROST 07 positive cells using cell sorting and purification techniques
- PROST 07 antibodies may be used to isolate prostate cancer cells from xenograft tumor tissue, from cells in culture, etc using antibody-based cell sorting or affinity purification techniques
- Other uses of the PROST 07 antibodies of the invention include generating anti-idiotypic antibodies that mimic the PROST 07 polypeptide
- PROST 07 antibodies can be used for detecting the presence of prostate cancer or tumor metastasis
- the presence of such PROST 07-conta ⁇ n ⁇ ng cells within various biological samples, including serum, prostate and other tissue biopsy specimens, may be detected with PROST 07 antibodies
- PROST 07 antibodies may be used in various imaging methodologies such as immunoscmtigraphy with Tc-99m (or other isotope) conjugated antibody
- an imaging protocol similar to the one recently described using an ln-11 1 conjugated anti-PSMA antibody may be used to detect recurrent and metastatic prostate carcinomas (Sodee et al , Clm Nuc Med 21 759-766, 1997)
- the PROST 07 antibodies of the invention may be labeled with a detectable marker or conjugated to a second molecule, such as a cytotoxic agent, and used for targeting the second molecule to a PROST 07 positive cell (Vitetta, E S et al , Immunotoxin Therapy, in DeVita, Jr, V T et al , eds, Cancer Principles and Practice of Oncology, 4 th ed , J B
- cytotoxic agents include, but are not limited to ricm, doxorubicin, daunorubicm, taxol, ethidium bromide, mitomycin, etoposide, tenoposide, vinc ⁇ stine, vinblastme, colchicme, dihydroxy anthracm dione, actinomycin D, dipthe ⁇ a toxin, Pseudomonas exotox ⁇ n(PE) A, PE40, ab ⁇ n, and glucocorticoid and other chemotherapeutic agents, as well as radioisotopes
- Suitable detectable markers include, but are not limited to, a radioisotope, a fluorescent compound, a biolummescent compound, chemilummescent compound, a metal chelator or an enzyme
- Suitable radioisotopes include the following Ant ⁇ mony-124, Ant ⁇ mony-125, Arsen ⁇ c-74, Bar ⁇ um-103, Bar
- the invention provides various immunotherapeutic methods for treating prostate cancer, including antibody therapy, in vivo vaccines, and ex vivo immunotherapy approaches
- the invention provides PROST 07 antibodies which may be used systemically to treat prostate cancer
- unconjugated PROST 07 antibodies may be introduced into a patient such that the antibody binds to PROST 07 on or in prostate cancer cells and mediates the destruction of the cells, and the tumor, by mechanisms which may include complement-mediated cytolysis, antibody-dependent cellular cytotoxicity, altering the physiologic function of PROST 07, and/or the inhibition of ligand binding or signal transduction pathways
- PROST 07 antibodies conjugated to toxic agents such as ⁇ cin or radioisotopes may also be used therapeutically to deliver the toxic agent directly to PROST 07-bear ⁇ ng prostate tumor cells and thereby destroy the tumor cells
- viral gene delivery systems may be used to deliver a PROST 07- encoding nucleic acid molecule
- Various viral gene delivery systems which can be used in the practice of this aspect of the invention include, but are not limited to, vaccinia, fowlpox, canarypox, adenovirus, influenza, po ovirus, adeno-associated virus, lentivirus, and smdbus virus (Restifo, in Curr 0pm, Immunol 8 658-663, 1996)
- Non-viral delivery systems may also be employed by using naked DNA encoding a PROST 07 polypeptide or fragment thereof introduced into the patient (i e , intramuscularly) to induce an anti-tumor response
- the full-length human prost 07 cDNA may be employed
- human prost 07 cDNA fragments may be employed
- prost 07 nucleic acid molecules encoding specific T lymphocyte (CTL) epitopes may be employed CTL epitopes can be determined using specific algorithms (CTL)
- Dendritic cells to present a PROST 07 polypeptide as antigen to a patient's immune system
- Dend ⁇ tic cells express MHC class I and II, B7 costimulator, and IL-12, and are thus highly specialized antigen presenting cells
- PSMA prostate-specific membrane antigen
- Dendritic cells can be used to present PROST 07 polypeptides to T cells in the context of MHC class I and II molecules
- autologous dendritic cells are pulsed with PROST 07 polypeptides capable of binding to MHC molecules
- dendritic cells are pulsed with the complete PROST 07 polypeptide
- Yet another embodiment involves engineering the overexpression of the
- Anti-sense oligonucleotides antisense vectors, and ⁇ bozvmes Anti-sense polynucleotides complementary to prost 07 may be prepared synthetically Such oligonucleotides may be delivered into cells with or without lipids that may assist uptake of the anti-sense oligonucleotides into cells
- expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids may be also be used for construction and delivery of recombinant vectors which will express anti-sense prost 07 See, for example, the techniques described in Sambrook et al (supra) and Ausubel et al (supra)
- polynucleotides comprising the full length cDNA sequence and/or its regulatory elements enable researchers to use prost 07 polynucleotides as an investigative tool in sense strands (Youssoufian and Lodish, Mol Cell Biol 13 98-104, 1993) or antisense strands (Eguchi, et al , Annu Rev Biochem 60 631-652, 1991 ) for the regulation of gene function
- sense or antisense oligomers, or larger fragments can be designed from various locations along the coding or control regions
- Genes encoding PROST 07 can be turned off by transfectmg a cell or tissue with expression vectors which express high levels of a desired prost 07 polynucleotide fragment Such constructs can flood cells with untranslatable sense or antisense sequences Particularly preferred antisense sequences include, but are not limited to,
- modification of gene expression can be obtained by designing antisense molecules, DNA or RNA, to control regions of prost 07, le, the promoters, enhancers, and mtrons Oligonucleotides derived from the transcription initiation site, eg, between -10 and +10 regions of the leader sequence, are preferred.
- the antisense molecules may also be designed to block translation of mRNA by preventing the transcript from binding to ⁇ bosomes Similarly, inhibition can be achieved using "triple helix" base-pairing methodology Triple helix pairing compromises the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules Recent therapeutic advances using triplex DNA were reviewed by Gee, J E et al (In Huber and Car, Molecular and Immunologic Approaches, Futura Publishing Co , Mt Kisco, N Y , 1994)
- Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA (U S Patent No 4,987,071 , WO 93/23057)
- the mechanism of nbozyme action involves sequence-specific hybridization of the nbozyme molecule to complementary target RNA, followed by endonucleolytic cleavage
- engineered hammerhead motif nbozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of RNA encoding PROST 07
- Specific nbozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for nbozyme cleavage sites which include the following sequences, GUA, GUU and GUC
- Once identified short RNA sequences of between 15 and 20 ⁇ bonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the oligonucleotide
- Antisense molecules and nbozymes of the invention may be prepared by any method known in the art for the synthesis of RNA molecules These include techniques for chemically synthesizing oligonucleotides such as solid phase phosphoramidite chemical synthesis Alternatively, RNA molecules may be generated by in vitro and in vivo transcription or by DNA sequences encoding PROST 07 Such DNA sequences may be incorporated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6 Alternatively, antisense cDNA constructs that synthesize antisense RNA constitutively or mducibly can be introduced into cell lines, cells or tissues RNA molecules may be modified to increase mtracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecules or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule Increased stability can also be achieved by the inclusion
- antisense vectors are introduced into cells taken from the patient and clonally propagated for autologous transplant back into that same patient as presented in U S Pat Nos 5,399,493 and 5,437,994, disclosed herein by reference Delivery by transfection and by liposome or other lipid based or non-lipid based agents are well known in the art
- the present invention also relates to assays and methods which can be used to identify agents that bind to PROST 07 Specifically, agents that bind to PROST 07 can be identified by the ability of the PROST 07 ligand or other agent or constituent to bind to PROST 07 and/or the ability to inhibit stimulate PROST 07 activity Assays for PROST 07 activity (e g binding) using a PROST 07 polypeptide are suitable for use in high through-put screening methods
- the assay comprises mixing PROST 07 with a test agent or cellular extract After mixing under conditions that allow association of PROST 07 with the agent or component of the extract, the mixture is analyzed to determine if the agent component is bound to PROST 07 Binding agents/components are identified as being able to bind to PROST 07 Alternatively or consecutively, PROST 07 activity can be directly assessed as a means for identifying agonists and antagonists of PROST 07 activity, using a chromogenic assay such as that described in Example 4
- agents that bind to a PROST 07 polypeptide can be identified using a yeast two-hybrid system or a binding capture assay
- yeast two hybrid system an expression unit encoding a fusion protein made up of one subunit of a two subunit transcription factor and the PROST 07 polypeptide is introduced and expressed in a yeast cell
- the cell is further modified to contain (1 ) an expression unit encoding a detectable marker whose expression requires the two subunit transcription factor for expression and (2) an expression unit that encodes a fusion protein made up of the second subunit of the transcription factor and a cloned segment of DNA If the cloned segment of DNA encodes a protein that binds to the PROST 07 polypeptide, the expression results in the interaction of PROST 07 and the encoded protein This brings the two subunits of the transcription factor into binding proximity, allowing reconstitution of the transcription factor This results in expression of the detectable marker
- the yeast two hybrid system is particularly useful in screening a library of cDNA encoding segments for cellular binding
- PROST 07 polypeptides which may be used in the above assays include, but are not limited to, an isolated PROST 07 polypeptide, a fragment of a PROST 07 polypeptide, a cell that has been altered to express a PROST 07 polypeptide, or a fraction of a cell that has been altered to express a PROST 07 polypeptide Further, the PROST 07 polypeptide can be the entire polypeptide or a defined fragment of the PROST 07 polypeptide It will be apparent to one of ordinary skill in the art that so long as the PROST 07 polypeptide can be assayed for agent binding, e g by a shift in molecular weight or activity, the present assay can be used The method used to identify whether an agent/cellular component binds to a PROST 07 polypeptide will be based primarily on the nature of the PROST 07 polypeptide used For example, a gel retardation assay can be used to determine whether an agent binds to PROST 07 or a fragment thereof Alternatively, immunodetection and biochip
- Agents and cellular components can be further tested for the ability to modulate the activity of a PROST 07 polypeptide using a cell-free assay system or a cellular assay system As the activities of the PROST 07 polypeptide become more defined, functional assays based on the identified activity can be employed One such assay would be the assay of senne protease activity described in Example 4, using synthetic peptide substrates having a known serine protease cleavage site within their sequence
- an agent is said to antagonize PROST 07 activity when the agent reduces PROST 07 activity
- the preferred antagonist will selectively antagonize PROST 07, not affecting any other cellular proteins Further, the preferred antagonist will reduce PROST 07 activity by more than 50%, more preferably by more than 90%, most preferably eliminating all PROST 07 activity
- Agents that are assayed in the above method can be randomly selected or rationally selected or designed as used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences of the PROST 07 polypeptide
- An example of randomly selected agents is the use of a chemical library or a peptide combinatorial library, or growth broth of an organism or plant extract
- an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis that takes into account the sequence of the target site an/or its conformation in connection with the agent's action
- Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up the PROST 07 polypeptide
- a rationally selected peptide agent can be a peptide whose ammo acid sequence is identical to a fragment of a PROST 07 polypeptide
- the agents tested in the methods of the present invention can be, as examples, peptides, antibodies, oligonucleotides, small molecules and vitamin derivatives, as well as carbohydrates
- a skilled artisan can readily recognize that there is no limit as to the structural nature of the agents used in the present screening method
- One class of agents of the present invention are peptide agents whose ammo acid sequences are chosen based on the am o acid sequence of the PROST 07 polypeptide
- Peptide agents can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art
- the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems The production using solid phase peptide synthesis is necessitated if no-gene-encoded ammo acids are to be included
- Another class of agent of the present invention are antibodies immunoreactive with critical positions of the PROST 07 polypeptide As described above, antibodies are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the PROST 07 polypeptide intended to be targeted by the antibodies Such agents can be used in competitive binding studies to identify second generation inhibitory agents as well as to block PROST 07 activity
- the cellular extracts tested in the methods of the present invention can be, as examples, agueous extracts of cells or tissues, organic extracts of cells or tissues or partially purified cellular fractions A skilled artisan can readily recognize that there is no limit as to the source of the cellular extract used in the screening method of the present invention
- Agents that bind a PROST 07 polypeptide can be used to modulate the activity of PROST 07, to target anticancer agents to appropriate mammahan cells, or to identify agents that block the interaction with PROST 07 Cells expressing PROST 07 can be targeted or identified by using an agent that binds to PROST 07
- PROST 07 binding agents can be used to deliver conjugated toxins, such as diphtheria toxin, cholera toxin, ricm or pseudomonas exotoxm, to a PROST 07 expressing cell, modulate PROST 07 activity, to directly kill a PROST 07 expressing cell, or in screens to identify competitive binding agents
- conjugated toxins such as diphtheria toxin, cholera toxin, ricm or pseudomonas exotoxm
- a PROST 07 inhibitory agent can be used to directly inhibit the growth of PROST 07 expressing cells whereas a PROST 07 binding agent can be used as a diagnostic agent
- the present invention also relates to pharmaceutical compositions which may comprise prost 07 polynucleotides, PROST 07 polypeptides, antibodies, agonists, antagonists, or inhibitors, alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water Any of these molecules can be administered to a patient alone, or in combination with other agents, drugs or hormones, in pharmaceutical compositions where it is mixed with exc ⁇ p ⁇ ent(s) or pharmaceutically acceptable carriers
- the pharmaceutically acceptable carrier is pharmaceutically inert
- the present invention also relates to the administration of pharmaceutical compositions Such administration is accomplished orally or parenterally Methods of parenteral delivery include topical, intra-arte ⁇ al (directly to the tumor), intramuscular, subcutaneous, intramedullary, mtrathecal, intravent ⁇ cular, intravenous, mtraperitoneal, or mtranasal administration
- these pharmaceutical compositions may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Ed Maack Publishing Co, Easton, Pa )
- compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for. by the patient
- compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxillia ⁇ es, if desired, to obtain tablets or dragee cores
- suitable excipients are carbohydrate or protein fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol, starch from corn, wheat, rice, potatoe, or other plants, cellulose such as methyl, cellulose, hydroxypropylmethylcellulose, or sodium carboxymethylcellulose, and gums including arable and tragacanth, and proteins such as gelatin and collagen
- disintegrating or solubilizmg agents may be added, such as the cross-linked polyvinyl pyrrohdone, agar, alginic acid, or a salt thereof, such as sodium algmate
- Dragee cores are provided with suitable coatings such as concentrated sugar solutions, which may also contain gum arable, talc, polyvmylpyrrolidone, carbopol gel, polyethylene glycol and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures
- Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i ⁇ dosage
- Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating such as glycerol or sorbitol
- Push-fit capsules can contain active ingredients mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and optionally, stabilizers
- the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers
- compositions for parenteral administration include aqueous solutions of active compounds
- the pharmaceutical compositions of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiologically buffered saline
- Aqueous injection suspensions may contain substances which increase viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran
- suspensions of the active compounds may be prepared as appropriate oily injection suspensions
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or tnglycerides, or hposomes
- the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions
- penetrants appropriate to the particular barrier to be permeated are used in the formulation Such penetrants are generally known in the art
- the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention Associated with such conta ⁇ ner(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration
- compositions of the present invention may be manufactured in a manner that is known in the art, e g , by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophi zing processes
- the pharmaceutical composition may be provided as a salt and can be formed with may acids, including by not limited to hydrochloric, sulfunc, acetic, lactic, tarta ⁇ c, malic, succinic, etc Salts tend to be more soluble in aqueous or other protonic solvents that are the corresponding free base forms
- the preferred preparation may be a lyophilized powder in 1mM-50 mM histid e, 0 1%-2% sucrose, 2%-7% mannitol at a pH range of 4 5 to 5 5 that is combined with buffer prior to use
- compositions comprising a compound of the invention formulated in an acceptable carrier
- pharmaceutical compositions comprising a compound of the invention formulated in an acceptable carrier
- labeling would include amount, frequency and method of administration
- compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended purpose, i e treatment of a particular disease state characterized by PROST 07 expression
- the determination of an effective dose is well within the capability of those skilled in the art
- the therapeutically effective dose can be estimated initially either in cell culture assays, e g , neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs
- animal model is also used to achieve a desirable concentration range and route of administration Such information can then be used to determine useful doses and routes for administration in humans
- a therapeutically effective dose refers to that amount of protein or its antibodies, antagonists, or inhibitors which ameliorate the symptoms or condition
- Therapeutic efficacy and toxicity of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e g , ED 50 (the dose therapeutically effective in 50% of the population) and LD 50 (the dose lethal to 50% of the population)
- the dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio, ED 50 /LD 50
- Pharmaceutical compositions which exhibit large therapeutic indices are preferred
- the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use
- the dosage of such compounds lies preferably within a range of circulating concentrations what include the ED 50 w ⁇ th little or no toxicity
- the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration
- Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect Additional factors which may be taken into account include the severity of the disease state, eg, tumor size and location, age, weight and gender of the patient, diet, time and frequency of administration, drug comb ⁇ nat ⁇ on(s), reaction sensitivities, and tolerance/response to therapy Long acting pharmaceutical compositions might be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation
- Normal dosage amounts may vary from 0 1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration
- Guidance as to particular dosages and methods of delivery is provided in the literature See U S Pat Nos 4,657,760, 5,206,344, or 5,225,212 Those skilled in the art will employ different formulations for polynucleotides than for proteins or their inhibitors Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc
- Prost 07 was identified as a gene expressed in the prostate by mining Incyte's LifeSeq gene expression database The mRNA coding for PROST 07 polypeptide was discovered using the "Transcript Imaging" feature of LifeSeq and search parameters that permitted selection of novel genes expressed in Incyte's prostate tumor cell cDNA libraries at an abundance greater than 2 copies per library This set of genes was evaluated by electronic Northern analysis to determine their distribution in other prostate tissue libraries and in all the other tissue libraries in the database Clone 1651585 was identified in library PROSTUT12 of LIFESEQ Version 4 1SEP96 (Beta) and shown to cluster with other clones containing prost 07 polynucleotides in a prostate specific fashion by Electronic Northern analysis This prostate specific expression has been seen consistently in updated versions of the LifeSeq database All clones coding for fragments of PROST 07 were assembled into a contiguous sequence using the Genetics Computer Group (GCG, Wisconsin package) gene assembly program and the sequence of the assembled mRNA evaluated An open reading frame coding for a
- primers were selected 3 to the predicted stop codon and used together with primers and reagents in a 5 RACE PCR amplification kit obtained from Clontech to generate a cDNA product coding for PROST 07
- a sample of cDNA generated from prostate tissue RNA from Clontech Laboratories was used as a template for this synthesis
- These PCR products were cloned into a TA vector obtained from Invitrogen, and selected clones sequenced This sequence was identical to the nucleotide sequence of prost 07 predicted by assembly of the set of individual clones in LifeSeq, and contained additional sequence covering the predicted full-length coding sequence of the active form of PROST 07, as well as the putative pro-sequence and part of a putative signal sequence
- a 5' RACE (5' rapid amplification of cDNA end) 5' RACE-PCR was performed for prost 07 using the Clontech Marathon cDNA Amplification kit Normal human prostate mRNA (Clontech) was used as the template First strand cDNA synthesis was primed using either the Marathon cDNA synthesis primer or a gene-specific primer for prost 07 After second-strand synthesis and adaptor hgation, PCR amplifications were performed either with the kit Advantage KlenTaq polymerase mix, AmphTaq, or AmpliTaq-Gold Nested PCR reactions were then performed, and PCR products were gel isolated and TA cloned into pCR2 1 using the TA Cloning kit from Invitrogen Plasmid DNA was prepared from individual transformant colonies and confirmed by
- Pr7Probe3 5'-TGCCAGGGCTGCGAGTGCGGGCTGCAGTCC-3' (SEQ ID NO 9)
- An mRNA species that was 1 6Kb in size was detected This was specifically expressed in the prostate tissues and in the LNCaP prostate cell line but not in any of the other tissues evaluated Expression was generally higher in the prostate tumor tissues than in the normal tissue from the prostate
- Taqman analysis Taqman based PCR analysis was performed using the primers GGG AAC TCT TGC CTC GTT TCT (SEQ ID NO 14) and GAC ACC ACC GAC ACG TTC AC (SEQ ID NO 15) and the Taqman probe FAM- TGCTGGCGAACGGCAGAATGC-TAMRA (SEQ ID NO 16)
- PROST 07 The presence of PROST 07 in a variety of human tissues, including prostate tissue, was examined using histochemical methods Histochemical studies were conducted using a polyclonal rabbit (Prost 7 4) or a monoclonal mouse (4B8) antibody as the first antibody (see Example 5, below), followed by an alkalme-phosphatase conjugated antibody As a negative control, the staining was carried out in the absence of the first antibody or by using a nonspecific IgG antibody as a first antibody Both PROST 07 antibodies showed the same staining pattern when used to determine PROST 07 expression in prostate tissues
- PROST 07 expression in prostate tumor tissue was also performed (See Figures 8A and 8B)
- the resulting fragment was ligated into a BamHI/EcoRI restricted pAcSecG2T plasmid (Pharmmgen)
- a stock of recombinant baculovirus was produced as it is well known to those of skill
- the recombinant fusion protein, GST-PROST 07 was secreted from insect cells (BTI-TN-5B1-4) infected with the recombinant baculovirus and purified from the supernatant by glutathion chromatography
- PROST 07 activity was also measured by following the hydrolysis of synthetic peptide substrates by HPLC analysis
- 1 to 5 ⁇ M of either PROST 07 or activated PROST 07 was added to 1 mM of a peptide substrate (SDLVPRMSENLYFQ (SEQ ID NO 24) or SDLVPRGSENLYFQ (SEQ ID NO 25)) and incubated at 37° C for various lengths of time
- the buffer for this assay is 25 mM HEPES, pH 7 4
- 5 ⁇ L of 10% TFA was added to stop the reaction and then, a 10 ⁇ L sample was injected onto an analytical C18 RP-HPLC column ( Phenomenex Jupiter 5 ⁇ 300 A 150 x 4 6 mm Part No 00F-4053-E0)
- the column was initially equilibrated in 5% Solvent B, where Solvent A is 0 1 % TFA in water while Solvent B is 0 1 % TFA in
- 6X-HIS PROST 07 Construct A Expression of 6X-His PROST 07 (polyhistidme PROST 07 fusion protein) To improve expression and secretion levels of active PROST 07 protease a cDNA encoding ammo acid residues 11-234, encompassing the deduced mature PROST 07 protease domain, was amplified using the following primers
- 6X-H ⁇ s PROST 07 A stock of recombinant baculovirus was produced as it is well known to those of skill
- the recombinant fusion protein, 6X-H ⁇ s PROST 07 was secreted from insect cells (BTI-TN-5B1-4) infected with the recombinant baculovirus and purified from the supernatant B Purification of 6X-HIS PROST 07 Using a 10k MWCO tangential flow membrane, ten liters of conditioned media from insect cells expressing 6X-HIS PROST 07 was concentrated to about 200 mL Using a 14k dialysis tubing, the concentrate was dialyzed against 2 X 4 0L of Buffer A (50 mM Na 2 HP0 4 , pH 8 0, 300 mM NaCI)
- the dialysate was loaded onto a Pharmacia XK 26/20 packed with 20 mL of Qiagen Ni- NTA column at a flowrate of 5 mlJmin After loading, the column was washed with 100 mL of Buffer A followed by 100 mL of 20 mM Imidazole or 8% Buffer B (50 mM Na 2 HP0 4 , pH 8 0, 300 mM NaCI, 250 mM Imidazole) The enzyme was eluted using an imidazole gradient from 20 mM to 250 mM (8 to 100% Buffer B) Based on SDS-PAGE, western blots and activity assay, fractions containing PROST 07 were pooled
- the Ni-NTA pool was dialyzed against 2 X 1 0L of Buffer C (25 mM HEPES, pH 7 4) The dialysate was loaded onto a Pharmacia Mono-Q HR 5/5 column at a flowrate of 1 mL/min After loading, the column was washed with 10 mL of Buffer C and the enzyme eluted using a salt gradient from 0 to 500 mM NaCI or 0 to 50% Buffer D (25 mM HEPES, pH 7 4, 500 mM NaCI) Based on SDS-PAGE, western blots and activity assays, fractions containing PROST 07 were pooled To activate PROST 07, porcine pancreatic elastase (Sigma E-0258) was added to the Mono-Q pool at a ratio of 2 1 , i e 1 mg of PROST 07 and 0 5 mg of elastase, and incubated at 37° C for 60 minutes Using the
- Peptides were covalently coupled to keyhole limpet hemocyanm (KLH), via an additional ammo- terminal cysteme, for use as immunogen Similarly, a bovine serum albumin (BSA) conjugate was prepared for the analysis of antisera titers via ELISA
- Antisera were tested via Western blot for binding to a purified PROST 07 protein expressed as a 6H ⁇ s-PROST 07 fusion protein in E coli Antisera which recognized the PROST 07 fusion protein were further tested for their ability to recognize the naturally occurring protein in lysates prepared from LNCAP tumors, LNCAP cells, PC3 tumors and PC3 cells Binding specificity was determined by antibody binding in the presence and absence of the homologous and heterologous peptides Rabbit polyclonal antisera and mu ⁇ ne monoclonal antibodies were also raised against the 6H ⁇ s-PROST 07 fusion protein purified from E coli Immunogen was purified from E coli cell lysates using a metal chelating affinity resin (Ni-NTA-Sepharose) following extraction in 8 M urea Ten mu ⁇ ne hybndoma clones were obtained which recognized the PROST 07 fusion protein in a denatured state These monoclonal antibodies were tested for recognition of baculovirus expressed PROST
- Murme monoclonal antibodies raised against PROST 07 expressed in E Coli were tested for their ability to neutralize PROST 07 enzymatic activity, using a commercial chromogenic thrombm substrate obtained from American Diagnostica
- PROST 07 The ability of the PROST 07 taulizmg monoclonal antibody, 4B8, to inhibit migration and/or invasion of tumor cells in vitro was tested using a Boyden chamber (Pathology Oncology Research, Vol 4, 1998) PROST 07 positive CAOV-3 cells (ATCC) were incubated with either the PROST 07 specific monoclonal antibody 4B8 or with a non-specific IgG mouse antibody
- For the migration assay cells were seeded onto transwells whose lower side was coated with fibronectm
- For the invasion assay cells were seeded onto transwells whose upper side was coated with mat gel
- the PROST 07 neutralizing monoclonal antibody, 4B8, partially inhibits the ability of CAOV-3 cells to migrate through fibronectin coated wells (see Figure 10A) and partially inhibits the ability of CAOV-3 cells to invade through matngel coated wells (see Figure 10B), when compared to the effects of the non-specific IgG mouse antibody or to untreated cells
- Example 8 Effect of specific reduction of prost 07 mRNA on prostate tumor cell growth
- the prostate tumor cell lines, PC-3 and LNCaP were selected for evaluation of the role of PROST 07 in cell proliferation using antisense oligonucleotides to reduce mRNA expression in the selected cell lines
- the PC-3 cell line expresses extremely low levels of prost 07 mRNA while the LNCaP cells express significant levels of prost 07 mRNA
- the antisense oligonucleotides used have the sequences CAACGGGUACUUGCAGGGCCUUG (SEQ ID NO 17 ), ACCUCUGCAAAUUCACUGAGUGG (SEQ ID NO 18), and UACUUGCAGGGCCUUGUGUCUUU (SEQ ID NO 19) and are referred to as 13577, 13581 , and 13598, respectively
- These reagents are RNA/DNA hybrid molecules, 23 nucleotides in length
- the reagents chosen reduce mRNA levels for PROST 07 when administered to cells in the presence of lipids (NC388 lipid mixture provided by Atugen Corp )
Abstract
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US678940 | 1991-04-02 | ||
US15858899P | 1999-10-07 | 1999-10-07 | |
US158588P | 1999-10-07 | ||
US67894000A | 2000-10-02 | 2000-10-02 | |
PCT/US2000/027431 WO2001025446A1 (fr) | 1999-10-07 | 2000-10-05 | Adn codant le polypeptide prost 07 |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1220931A1 true EP1220931A1 (fr) | 2002-07-10 |
Family
ID=26855180
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP00967319A Withdrawn EP1220931A1 (fr) | 1999-10-07 | 2000-10-05 | Adn codant le polypeptide prost 07 |
Country Status (6)
Country | Link |
---|---|
EP (1) | EP1220931A1 (fr) |
JP (1) | JP2003528584A (fr) |
AU (1) | AU7753700A (fr) |
HK (1) | HK1048495A1 (fr) |
NO (1) | NO20021614L (fr) |
WO (1) | WO2001025446A1 (fr) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6943236B2 (en) | 1997-02-25 | 2005-09-13 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of prostate cancer |
AUPR402201A0 (en) * | 2001-03-27 | 2001-04-26 | Queensland University Of Technology | Polynucleotides and polypeptides linked to cancer and/or benign tumours |
GB201513921D0 (en) * | 2015-08-05 | 2015-09-23 | Immatics Biotechnologies Gmbh | Novel peptides and combination of peptides for use in immunotherapy against prostate cancer and other cancers |
GB201520566D0 (en) * | 2015-11-23 | 2016-01-06 | Immunocore Ltd & Adaptimmune Ltd | Peptides |
GB201520550D0 (en) | 2015-11-23 | 2016-01-06 | Immunocore Ltd & Adaptimmune Ltd | Peptides |
GB201520568D0 (en) | 2015-11-23 | 2016-01-06 | Immunocore Ltd | Peptides |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5786148A (en) * | 1996-11-05 | 1998-07-28 | Incyte Pharmaceuticals, Inc. | Polynucleotides encoding a novel prostate-specific kallikrein |
US5955306A (en) * | 1996-09-17 | 1999-09-21 | Millenium Pharmaceuticals, Inc. | Genes encoding proteins that interact with the tub protein |
TR199902053T2 (xx) * | 1997-02-25 | 2000-04-21 | Corixa Corporation | Prostat kanserinin immunoterapisine y�nelik bile�ikler ve bunlar�n kullan�lmas�na matuf metodlar. |
ATE302414T1 (de) * | 1997-02-25 | 2005-09-15 | Corixa Corp | Verbindungen zur immundiagnose von prostatakrebs und deren verwendung |
DE19805633A1 (de) * | 1998-02-12 | 1999-08-19 | Basf Ag | Neue Serinprotease aus der Prostata |
KR20070112860A (ko) * | 1998-07-14 | 2007-11-27 | 코릭사 코포레이션 | 전립선 종양 단백질의 분리된 면역원성 부위 및 이를사용하여 전립선암을 진단하는 방법 |
AU3139900A (en) * | 1999-03-11 | 2000-09-28 | Mount Sinai Hospital Corporation | Sialic acid-binding ig-like lectin (siglec) gene; ob-binding protein like (ob-bpl) |
JP2003504080A (ja) * | 1999-07-13 | 2003-02-04 | スミスクライン ビーチャム バイオロジカルズ ソシエテ アノニム | ワクチン |
-
2000
- 2000-10-05 WO PCT/US2000/027431 patent/WO2001025446A1/fr not_active Application Discontinuation
- 2000-10-05 EP EP00967319A patent/EP1220931A1/fr not_active Withdrawn
- 2000-10-05 JP JP2001528598A patent/JP2003528584A/ja active Pending
- 2000-10-05 AU AU77537/00A patent/AU7753700A/en not_active Abandoned
-
2002
- 2002-04-05 NO NO20021614A patent/NO20021614L/no not_active Application Discontinuation
-
2003
- 2003-01-09 HK HK03100221.8A patent/HK1048495A1/zh unknown
Non-Patent Citations (1)
Title |
---|
See references of WO0125446A1 * |
Also Published As
Publication number | Publication date |
---|---|
NO20021614D0 (no) | 2002-04-05 |
WO2001025446A1 (fr) | 2001-04-12 |
AU7753700A (en) | 2001-05-10 |
HK1048495A1 (zh) | 2003-04-04 |
NO20021614L (no) | 2002-06-04 |
JP2003528584A (ja) | 2003-09-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7893217B2 (en) | Isolated human antibodies that bind epitopes on RG1 | |
JP2009159975A (ja) | 新規ポリペプチドホルモンフォスファトニン | |
EP1220931A1 (fr) | Adn codant le polypeptide prost 07 | |
US20020009455A1 (en) | DNA encoding a novel PROST 03 polypeptide | |
WO2001042472A2 (fr) | Adn codant pour un nouveau polypeptide prost-ets | |
US6297359B1 (en) | Protein phosphatase 1 binding protein, R5 | |
EP0844305A2 (fr) | Hrad54 | |
AU766669B2 (en) | PSCA: prostate stem cell antigen |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20020405 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
AX | Request for extension of the european patent |
Free format text: AL PAYMENT 20020405;LT PAYMENT 20020405;LV PAYMENT 20020405;MK PAYMENT 20020405;RO PAYMENT 20020405;SI PAYMENT 20020405 |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: BRINK, JODY Inventor name: HARKINS, RICHARD Inventor name: PARRY, GORDON Inventor name: SCHNEIDER, DOUGLAS, W. Inventor name: PARKES, DEBORAH Inventor name: LIN, RICHARD, J. Inventor name: LIGHT, DAVID, R. Inventor name: BRINGMANN, PETER, W. |
|
17Q | First examination report despatched |
Effective date: 20031212 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20040414 |
|
REG | Reference to a national code |
Ref country code: HK Ref legal event code: WD Ref document number: 1048495 Country of ref document: HK |