EP1198711A1 - Method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions and products therefor - Google Patents

Method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions and products therefor

Info

Publication number
EP1198711A1
EP1198711A1 EP01927852A EP01927852A EP1198711A1 EP 1198711 A1 EP1198711 A1 EP 1198711A1 EP 01927852 A EP01927852 A EP 01927852A EP 01927852 A EP01927852 A EP 01927852A EP 1198711 A1 EP1198711 A1 EP 1198711A1
Authority
EP
European Patent Office
Prior art keywords
proteins
rich
protein
argmm
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01927852A
Other languages
German (de)
French (fr)
Inventor
Oliver Nayler
Stefan Stamm
Annette Hartmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Original Assignee
Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Max Planck Gesellschaft zur Foerderung der Wissenschaften eV filed Critical Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Publication of EP1198711A1 publication Critical patent/EP1198711A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates to methods for the investigation of cancer and / or neurodegenerative disease states. These include in particular diagnostic methods and methods for testing therapeutically active substances against the above-mentioned diseases.
  • the invention further relates to products which are particularly suitable for use in the abovementioned examinations or processes.
  • proteins with glutamic acid / arginm-rich domains (so-called ER proteins) or with aspartic acid / arginm-rich domains (so-called DR proteins) represent new and meaningful markers for the development of pathological conditions. It was also found that the pathological conditions affected can not only be cancerous diseases but also neurodegenerative diseases, which even further increases the diagnostic significance of the marker found.
  • ER proteins proteins with glutamic acid / arginm-rich domains
  • DR proteins proteins with aspartic acid / arginm-rich domains
  • the invention accordingly provides a method for the diagnosis of cancer and / or neurogenerative disease states in which proteins with domains rich in glutamic acid / arginm (hereinafter ER proteins) or domains rich in aspartic acid / argin ( hereinafter briefly: DR proteins) can be determined.
  • ER proteins proteins with domains rich in glutamic acid / arginm
  • DR proteins domains rich in aspartic acid / argin
  • This determination method is also suitable for examining the transcription activity, the differentiation stage and / or the cell cycle stage of a cell.
  • the invention provides a method for testing therapeutically active substances against cancer and / or neurodegenerative disease states, which the examination a change in ER proteins or DR proteins as a result of exposure to such potentially therapeutically active substances.
  • the invention further provides useful products which are particularly well suited for use in the method described above. These include, in particular, antibodies specific to an ER protein or a DR protein, as well as a mammalian cell that is transformed by a DNA that codes for an ER protein or DR protein. In further objects of the present invention, these special products are used in the above-mentioned processes.
  • Figure 1 shows examples of some ER or DR proteins that can be determined in the context of the present invention, where A is a schematic line representation of the respective protein structure (with the ER or DR domain in the form of a black box) and B the sequence -Alignment with respect to the conserved ER or DR domain region with the consensus sequence shows.
  • FIG. 2 shows the results of immunohistochemical staining of an ER protein as a marker for normal cells (A), for tumor cells (B, left column) and for treated tumor cells (B, middle and right columns).
  • FIG. 3 shows the overall domain structure of an ER protem using the example of YT521-B.
  • Figure 4 shows the results of immunocytometric studies on a mammalian cell (COS7 cells) according to the present invention is transformed with an ER or DR protein-encoding DNA and has been treated with different transcription or transplantation inhibitors.
  • ER and DR proteins are expressed in a variety of body tissues, including the brain.
  • the ER and DR-rich domains seem to be responsible for the nuclear localization of these proteins.
  • Figure 1 shows an exemplary series of ER and DR proteins that can be considered for the present invention.
  • the corresponding DNA or polypeptide sequences can be obtained from known gene banks (e.g. "GenBank”) using the names of the proteins given in FIG. 1.
  • FIG. 1A The proteins are shown as lines in FIG. 1A, the regions rich in ER or DR being shown as a black box.
  • the scale line stands for 100 amino acids long.
  • FIG. 1B shows the comparison of the areas rich in ER or DR (domains) from A).
  • the names of the respective proteins stand for:
  • Rat SAF-B "Scaffold Attachment Factor B” (0. Nayler et al., Genomics Vol. 53, pp. 191-202 (1998)). Proteins were determined using the last 60 amino acids of YT521-B and sequence (ER) 15 using the BLAST algorithm. Similar sequences were put together using the PILEUP program. The expression “consensus” means the consensus sequence of this comparison determined by means of LINE UP.
  • RNA helicases are involved in the Pra-mRNA splicing process or in the formation of the transcriptosomal Complex involved. It is assumed that the ER or DR proteins perform important functions. Certain proteins thereof interact with each other. This was by AM Hartmann et al. m Molecular Biology of the Cell 10, pp.
  • Tumor cells do not show up, as shown in FIG. 2B for the human tumor cell line MCF7. Rather, the ER or DR protein is diffusely distributed in the cell nucleus.
  • a number of neurodegenerative diseases are triggered by the expansion of triplet repeats. These include, for example, spinocerebellar ataxia type 1 and Huntmgton's disease (MIM / OMIM numbers 164400 and 143100).
  • MIM / OMIM numbers 164400 and 143100 The associated gene products, sca-1 and Huntmgtm have a formation of nuclear points (PJ Skmner et al. Nature 389, pp. 971-974 (1997) [published Erratum in Nature 391, p. 307 (1998)], L. Roizin et al. Adv. Neurol. 23, pp.
  • YT521-B DAN26 (Genbank reference number U94836) also interacts with sca-1 and leads to a translocation of the sca-1 gene product containing yT521-B core structures. Detection of core structures that can be positively detected with regard to ER or DR prototypes such as YT 521-B can thus also be advantageous for the genesis and diagnosis of neurodegenerative diseases such as spmocerebellar ataxia type 1 and Huntmgton's disease.
  • neurodegenerative diseases such as spmocerebellar ataxia type 1 and Huntmgton's disease.
  • the determination of the ER or DR proteins with regard to distribution, localization in the nuclear areas of the cell nucleus and quantification provides very useful information and diagnostic statements.
  • one or more ER or DR protems can be determined.
  • the investigation for the DR prototype YT521, in particular its splice variant YT 521-B, has proven to be particularly informative.
  • Cell cycle is regulated and changing.
  • the occurrence of the localized areas correlates very well with the beginning during the middle to late Gl phase and the subsequent continuation during the S phase with respect to the transcriptional activity, while such localizable areas during mitosis, especially G2 / M- Phase and the early Gl phase, were undetectable and thus indicated the lack of transcriptional activity.
  • the determination of the ER or DR proteins, in particular the localizable occurrence in cellular, nuclear areas, can therefore be more advantageous In this way, it can also be used to determine the transcription activity, the differentiation stage and / or the cycle stage of a cell to be examined.
  • Another possible use of the marker described above, according to the invention, i.e. of the ER or DR protein (s) described above consists in testing therapeutically active substances, in particular those against cancer and / or neurogenerative disease states.
  • Therapeutic effectiveness is shown by the fact that the appearance of the ER or DR proteins as described above changes as a result of the action of the investigated, potentially therapeutically active substance. Meaningful criteria for such a change are in turn a diffuse distribution, a visualization in defined nuclear areas or an increase in such nuclear areas on ER or DR proteins. This was demonstrated experimentally using the example of the well-known breast cancer cell MCF7.
  • Immunocytic methods are advantageously measured using the assay formats customary in the Screenmg method.
  • ELISA enzyme-linked immunosorbent assay
  • Antibodies which are directed against one or more of the ER or DR proteins described above can be mentioned as particularly useful products for use in such immunocytic processes or the like.
  • the antibodies can be directed against the entire ER or DR protein or against an oligopeptide which defines a sequence section from the ER or DR protein.
  • the antibodies can be directed against the ER or DR region, so that ER or DR proteins can generally be detected.
  • the consensus sequence shown in FIG. 1B can be used as the antigen.
  • the antibodies of the invention can take any form: monoclonal or polyclonal, also smgle chain, in hybrid or combinatorial form.
  • a further useful product is a mammalian cell which is transformed by a DNA which codes for an ER protein or DR protein as described above.
  • the mammalian cell is preferably of human origin.
  • Such a transformed cell can advantageously be used for the method described above for testing therapeutically active substances, in particular those for cancer diseases and / or neurodegenerative disease states become.
  • the transformation of the mammalian cell with the DNA encoding the ER or DR protein can be carried out using methods known per se (see, for example, J. Sa brook et al., Molecular Clonmg, Cold Spring Harbor Laboratory Press (1989)). Suitable vectors, including expression-demanding sequences, are known and are described in J. Sambrook et al. described.
  • the DNA coding for the ER protein or DR protein is preferably stably integrated into the genome of the mammalian cell.
  • the above-described methods according to the invention can be carried out without difficulty, for example after removing a suitable cell material from the patient to be examined or by using cells brought into culture.
  • RT Reverse transceptase
  • PCR Reverse transceptase
  • AM Hartmann and S. Stamm Biochem. Biophys. Res. Com. Vol. 1353, pp. 224-230 (1997)).
  • the yeast Gal4 double hybrid screen was designed according to S. Fields and 0. Song. (Nature Vol. 340, pp. 245-247 (1989)) using the HF7c strain.
  • YT521TH-B and YT521 ⁇ N10 were cloned in the form of an EcoRI / SacII fragment in pEGFP-C2 (Clontech) and in the form of an EcoRI / PstI fragment in pGBT9 (Clontech). Restriction sites were introduced by means of PCR amplification with the oligonucleotides yt521eco-fl: CCGAATTCTATGAACAGGATGAGAGAGATC (SEQ ID No.
  • yt521-sacll-r CCCCGCGGACATTATCTTCGATAACGACCTCTTTCC (SEQ IDGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
  • the overall domain structure of the ER prototype YT521-B found is shown in FIG. 3A.
  • the ammotermmal, glutammic acid-rich region, the carboxyterm ale prolm-rich region and the characteristic glutammic acid / amm-rich region are indicated by shaded boxes.
  • the boxes with Arabic numbers indicate the four nuclear localization signal sequences.
  • the letters "A” and "B” denote the insertions that are likely to be generated by alternative splicing.
  • the detailed sequences of insertions A and B are given below the representation of the overall domain structure (both DNA and letter E ammosaic sequence).
  • the protein YT521-B differs from YT521 by these insertions A and B.
  • YT521-B The total sequence of YT521-B was filed in the gene bank under the accession number AF144731.
  • Northern blot analyzes m-tu hybridization studies on brain tissue sections showed that YT521-B occurs in different types of tissue (heart, brain, kidney, lung, liver, muscle, spleen and testis), whereby different isoforms were discovered due to alternative splicing ), whereby a cell type-specific expression was characteristic in the brain.
  • Antibodies were obtained using conventional methods against antigenic structures of the ER or DR proteases.
  • a rat polyclonal antibody specific to YT521B was developed, against a mixture of two YT521-B-specific polypeptides, each of which had been fused with the keyhole limpet hemocyanin, namely polypeptide No. 1: RSARSVILIFSVRESGKFQCG (SEQ ID No. 4), and polypeptide No. 2: KDGELNVLDDILTEVPEQDDECG (SEQ ID No. 5).
  • HEK293, COS7 cells or BHK cells were kept in Dulbecco's modified Eagle's Medium (DMEM) to which 10 (v / v)% fetal calf serum (FCS) was added.
  • DMEM Dulbecco's modified Eagle's Medium
  • FCS fetal calf serum
  • the human breast cancer cell MCF7 was kept in RPMI 1640, which was supplemented with 10% (v / v) FCS.
  • RPMI 1640 was supplemented with 10% (v / v) FCS.
  • cells were grown on glass cover plates in 6 cm cell culture vessels. 2.
  • the cells were then incubated with CY3-conjugated secondary antibody (Dianova) PBS / 0.1% Triton-X 100 for 2 hours at room temperature, washed three times with PBS / 0.1% T ⁇ ton-X 100 and on glass plates with Fluormount ( Dianova) pinned.
  • the cells were examined either by laser scanning fluorescence microscopy (Leica) or by conventional microscopy, followed by a deconvolution process using Openlab software (Improvision).
  • MCF7 cells were grown as described in Example 4 and treated with different agents.
  • the MCF7 cells were incubated with t tamoxifen (5 ⁇ M), sodium butyrate (1 ⁇ M) or phorbol-12-myristate-13-acetate (PMA, 1 ⁇ g / ml) for a further 48 h. The cells were then fixed and stained with the antibody specific for YT521-B, as described in Example 4.
  • FIG. 2B shows that in the tumor cells, after treatment with the anti-tumor agent tamoxifen, the characteristic nuclear areas could be localized again by means of the ER or DR protein staining. The same thing happened after treatment with the differentiation agents sodium butyrate and PMA (Fig. 2B, middle columns). Furthermore, it was shown that nuclear ER- or DR-Protem-specific areas in cell cycle studies during the middle to late Gl phase and during the S phase, but not during the G2 / M phase and the early Gl phase were localizable. As a control, the differentiation states were verified with conventional staining using Olrot 0 after fixation of the cells with 2% formaldehyde and subsequent observation using phase contrast microscopy.
  • the ER and DR protems and their determinations could be used excellently as markers. This not only for the diagnosis of pathological conditions, but also for the identification of the differentiation state and / or the cell cycle state of a cell as well as for the testing of potentially therapeutically active substances or agents.
  • 3 ⁇ 10 5 cells (for example HEK293, COS7 or BHK cells) were sown in a 3.5 cm culture dish and with a suitable amount of plasmid construct which contained the DNA coding for the ER or DR protein , subjected to a transfection or transformation.
  • HEK293 cells with 0.5 ⁇ g - 1 ⁇ g plasmid DNA were described using the calcium precipitation method as described (0. Nayler et al.,
  • C0S7 cells which were transiently expressed according to the method EGFP-YT521-B described in Example 6 as an example of a protein which contains ER-rich domains, were used and subjected to a treatment of different inhibitors.
  • EGFP-YT521-B described in Example 6 as an example of a protein which contains ER-rich domains
  • Treatments included ⁇ -amanitm (blocks transcription by directly inhibiting RNA polymerase II; conditions: 50 ⁇ g / ml for 5 h), 5, 6-d ⁇ chloro- 1-ß-r ⁇ bofuranosyl-benz ⁇ m ⁇ dazol ("DRB", blocks the Transcription by inhibition of a kmase m in the upper one
  • RNA polymerase II Signal chain for RNA polymerase II; Conditions: 75 ⁇ m DRB for 3 h), cycloheximide ("Cyclo”, only blocks RNA polymerase I; conditions: 100 ⁇ g / ml for 5 h) and Akmomycm D ("ActD”, binds to GC-rich double-stranded DNA, allowed RNA intimation, but blocks RNA elongation;
  • the determination of the ER or DR protein according to the invention can therefore also be used very useful for determining the transcription activity of a cell.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to a method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions. According to said method, proteins with domains rich in glutaminic acid/arginine or asparaginic acid/arginine, (ER proteins or DR proteins), are determined. The concept of determining ER or DR proteins is also suitable for investigating the transcription activity, the differentiation stage and/or the cell cycle stage of a cell and for testing therapeutically active substances. The invention also relates to useful products for use in said methods.

Description

Verfahren zur Diagnose von Krebserkrankungen und/oder Neurodegenerativen Krankheitszustanden sowie Produkte dafür Methods for diagnosing cancer and / or neurodegenerative conditions and products therefor
Beschreibungdescription
Die vorliegende Erfindung betrifft Verfahren zur Untersuchung von Krebserkrankungen und/oder neurodegenerativen Krankheitszustanden. Hierzu gehören insbesondere diagnostische Verfahren sowie Verfahren zum Testen von therapeutisch wirksamen Substanzen gegen die vorstehend genannten Erkrankungen. Die Erfindung betrifft ferner Produkte, die zum Einsatz m den vorstehend genannten Untersuchungen bzw. Verfahren besonders geeignet sind.The present invention relates to methods for the investigation of cancer and / or neurodegenerative disease states. These include in particular diagnostic methods and methods for testing therapeutically active substances against the above-mentioned diseases. The invention further relates to products which are particularly suitable for use in the abovementioned examinations or processes.
Bisher bekannte Untersuchungen, Verfahren und Produkte für die eingangs genannten Krankheitszustande sind sehr heterogen und komplex. Für den Bereich der Krebserkrankungen wurden im Laufe der Zeit eine Vielzahl von so genannten Tumor-Markern entdeckt und für diagnostische Zwecke eingesetzt (siehe z.B. die Ubersichtsliteratur in J. Natl. Cancer Inst., Bd. 80, S. 722-727 (1988) sowie Cimono (Hrsg.), Human Tumor Markers, De Kreuther Verlag (Berlin) (1987),. Dabei werden in erster Linie Tumor-spezifische bzw. Tumor-assoznerte Antigene über immunologische Methoden nachgewiesen.Previously known examinations, procedures and products for the disease states mentioned at the beginning are very heterogeneous and complex. Over the course of time, a large number of so-called tumor markers for cancer have been discovered and used for diagnostic purposes (see, for example, the overview literature in J. Natl. Cancer Inst., Vol. 80, pp. 722-727 (1988) as well as Cimono (ed.), Human Tumor Markers, De Kreuther Verlag (Berlin) (1987), in which primarily tumor-specific or tumor-associated antigens are detected using immunological methods.
In jüngster Zeit wurde im Bereich von Tumor-Erkrankungen sowohl in diagnostischer als auch m therapeutischer Hinsicht besondere Aufmerksamkeit gelenkt auf die Struktur des Zellkerns und möglicherweise damit im Zusammenhang stehende, relevante Zellkernbestandteile (s. J.A. Nickerson in Journal of Cellular Biochemistry, Bd. 70, S. 172-180 (1998)). Zwei fundamentale Charakteπstika maligner Veränderungen scheinen dort besonders deutlich hervorzutreten, nämlich Veränderungen in der Architektur von Zellen und Geweben sowie die genetische Instabilität. Die Beobachtung Zelltyp-spezifischer nuklearer Matrixproteine führte zu den US-Patentschriften 4 885 236 und 4 882 268, die den Einsatz solcher nuklearer Matrixproteine zur Krebsdiagnose beschreiben. Die dort beschriebenen Verfahren sind edoch kompliziert und arbeitsaufwendig. Sie erfordern die Isolierung von internen nuklearen Matrixproteinen und deren Auftrennung, üblicherweise über zweidimensionale Gelelektrophorese, wonach das dadurch erhaltene Analysebild gegenüber normalen Standards verglichen wird, um maligne Zustande identif zieren zu können. Für routinemäßige Einsätze, beispielsweise als Screemng Assays, sind solche Verfahren daher nicht geeignet.Recently, in the field of tumor diseases, special attention has been paid, both from a diagnostic and therapeutic point of view, to the structure of the cell nucleus and possibly related, relevant cell nucleus components (see JA Nickerson in Journal of Cellular Biochemistry, Vol. 70, Pp. 172-180 (1998)). Two fundamental characteristics of malignant changes appear to stand out particularly clearly there, namely changes in the architecture of cells and tissues and the genetic instability. The observation of cell type-specific nuclear matrix proteins led to US Pat. Nos. 4,885,236 and 4,882,268, which describe the use of such nuclear matrix proteins for cancer diagnosis. However, the methods described there are complicated and labor-intensive. They require the isolation of internal nuclear matrix proteins and their separation, usually via two-dimensional gel electrophoresis, after which the analysis image obtained in this way is compared with normal standards in order to be able to identify malignant states. Such methods are therefore not suitable for routine use, for example as a screening assay.
Diagnostik-Konzepte, die sich auf die nukleare Matrix stutzen, haben daher keinen Eingang in die klinische Praxis gefunden. J.A. Nickerson (s.o.) fuhrt dies auf das bisherige Unvermögen zurück, Tumor-spezifische bzw. -assoziierte Polypeptide des Zellkerns identifizieren zu können. Auch die relativ niedrigen expnmierten Mengen solcher Polypeptide wird als problematisch angesehen. Ferner wird von J.A. Nickerson berichtet, dass ein auf dem NMP22-Antιgen beruhender Test gegen nukleare Matrixproteine neben cytologischen und endoskopischen Untersuchungen begleitend zur Verlaufskontrolle nach der Behandlung von Patienten mit Blasenkarzinomen einen Wert haben konnte. Das Zielantigen NMP22 wird jedoch nicht als spezifisch für einen malignen oder Ubergangs-Zustand von Zellen angesehen. Neben dieser fehlenden Spezifitat von bestehenden Verfahren wird ferner ein Problem darin gesehen, dass normalerweise durchgeführte Assay-Formate wie immun-cytochemische und Serum-basierte Assays dort nicht anwendbar sind.Diagnostic concepts based on the nuclear matrix have therefore not found their way into clinical practice. YES. Nickerson (see above) attributes this to the previous inability to identify tumor-specific or -associated polypeptides of the cell nucleus. The relatively low exposed amounts of such polypeptides are also considered problematic. Furthermore, J.A. Nickerson reports that a test against nuclear matrix proteins based on the NMP22 anti- gene could have a value in addition to cytological and endoscopic examinations accompanying the follow-up after the treatment of patients with bladder cancer. However, the target antigen NMP22 is not considered to be specific for a malignant or transition state of cells. In addition to this lack of specificity in existing methods, a further problem is seen in the fact that assay formats normally carried out, such as immunocytochemical and serum-based assays, cannot be used there.
Es ist daher Aufgabe vorliegender Erfindung, die Möglichkeiten zur Diagnose von Erkrankungen, insbesondere bei Krebserkrankungen zu erweitern und zu verbessern. Die Erfinder haben überraschender Weise festgestellt, dass Proteine mit Glutaminsaure/Arginm-reichen Domänen (so genannte ER-Proteine) oder mit Asparginsaure/Arginm-reichen Domänen (so genannte DR-Proteine) neue und aussagekraftige Marker für die Entwicklung krankhafter Zustande darstellen. Ferner wurde festgestellt, dass es sich bei den betroffenen krankhaften Zustanden nicht nur um Krebserkrankungen, sondern auch um neurodegenerative Krankheiten handeln kann, wodurch die diagnostische Aussagekraft des gefundenen Markers sogar noch erweitert wird. Gleichzeitig wurde überraschender Weise erkannt, dass Veränderungen an den vorstehend genannten ER- Protemen bzw. DR-Proteinen nach Einwirkung bestimmter Substanzen eine Indikation dafür sein können, dass die eingesetzten Substanzen gegenüber Erkrankungen, insbesondere gegen Krebserkrankungen und/oder neurogenerativen Krankheitszustanden, therapeutisch wirksam sind.It is therefore an object of the present invention to expand and improve the possibilities for diagnosing diseases, particularly cancer. The inventors surprisingly found that proteins with glutamic acid / arginm-rich domains (so-called ER proteins) or with aspartic acid / arginm-rich domains (so-called DR proteins) represent new and meaningful markers for the development of pathological conditions. It was also found that the pathological conditions affected can not only be cancerous diseases but also neurodegenerative diseases, which even further increases the diagnostic significance of the marker found. At the same time, it was surprisingly recognized that changes in the aforementioned ER proteins or DR proteins after exposure to certain substances can be an indication that the substances used are therapeutically effective against diseases, in particular against cancer and / or neurogenerative disease states.
Die Erfindung stellt demnach m einem ersten Gegenstand ein Verfahren zur Diagnose von Krebserkrankungen und/oder neurogenerativen Krankheitszustanden zur Verfugung, bei dem Proteine mit Glutaminsaure/Arginm-reichen Domänen (im folgenden kurz ER-Proteine) oder mit Aspargmsaure-/Argιnιn- reichen Domänen (im folgenden kurz: DR-Proteine) bestimmt werden.The invention accordingly provides a method for the diagnosis of cancer and / or neurogenerative disease states in which proteins with domains rich in glutamic acid / arginm (hereinafter ER proteins) or domains rich in aspartic acid / argin ( hereinafter briefly: DR proteins) can be determined.
Dieses Bestimmungsverfahren eignet sich ferner zur Untersuchung der Transkriptionsaktivitat , des Differenzierungsstadiums und/oder des Zellzyklusstadiums einer Zelle.This determination method is also suitable for examining the transcription activity, the differentiation stage and / or the cell cycle stage of a cell.
In einem weiteren Gegenstand stellt die Erfindung ein Verfahren zum Testen von therapeutisch wirksamen Substanzen gegen Krebserkrankungen und/oder neurodegenerativen Krankheitszustanden zur Verfugung, welches die Untersuchung einer Veränderung an ER-Proteinen oder DR-Proteinen infolge einer Einwirkung durch solche, potentiell therapeutisch wirksamen Substanzen umfasst.In a further object, the invention provides a method for testing therapeutically active substances against cancer and / or neurodegenerative disease states, which the examination a change in ER proteins or DR proteins as a result of exposure to such potentially therapeutically active substances.
Die Erfindung stellt ferner nützliche Produkte zur Verfugung, die zum Einsatz m dem vorstehend bezeichneten Verfahren besonders gut geeignet sind. Hierzu gehören insbesondere gegen ein ER-Protem oder ein DR-Prote_n spezifischer Antikörper, sowie eine Saugetierzelle, die durch eine DNA transformiert ist, die für ein ER-Protem oder DR-Protein kodiert. In weiteren Gegenstanden der vorliegenden Erfindung werden diese speziellen Produkte m den vorstehend genannten Verfahren verwendet .The invention further provides useful products which are particularly well suited for use in the method described above. These include, in particular, antibodies specific to an ER protein or a DR protein, as well as a mammalian cell that is transformed by a DNA that codes for an ER protein or DR protein. In further objects of the present invention, these special products are used in the above-mentioned processes.
Die Erfindung wird nachfolgend unter Bezugnahme auf die Figuren naher erläutert.The invention is explained in more detail below with reference to the figures.
Figur 1 zeigt Beispiele einiger ER- oder DR-Proteine, die im Rahmen der vorliegenden Erfindung bestimmt werden können, wobei A eine schematische Liniendarstellung der jeweiligen Proteinstruktur (mit der ER- bzw. DR-Domane m Form eines schwarzen Kastchens) und B das Sequenz-Alignment in Bezug auf die konservierte ER- bzw. DR-Domanenregion mit der Konsensussequenz zeigt.Figure 1 shows examples of some ER or DR proteins that can be determined in the context of the present invention, where A is a schematic line representation of the respective protein structure (with the ER or DR domain in the form of a black box) and B the sequence -Alignment with respect to the conserved ER or DR domain region with the consensus sequence shows.
Figur 2 zeigt die Ergebnisse einer lmmunhistochemischen Anfarbung eines ER-Protems als Marker für normale Zellen (A) , für Tumorzellen (B, linke Spalte) und für behandelte Tumorzellen (B, mittlere und rechte Spalten) .FIG. 2 shows the results of immunohistochemical staining of an ER protein as a marker for normal cells (A), for tumor cells (B, left column) and for treated tumor cells (B, middle and right columns).
Figur 3 zeigt die Gesamt-Domanenstruktur eines ER-Protems am Beispiel von YT521-B.FIG. 3 shows the overall domain structure of an ER protem using the example of YT521-B.
Fig. 4 zeigt die Ergebnisse von lmmuncytometrischen Untersuchungen an einer Saugetierzelle (COS7-Zellen) , die gemäß vorliegender Erfindung mit einer ER- bzw. DR-Protem- kodierenden DNA transformiert ist und mit unterschiedlichen Transskriptions- bzw. Transplantations-Inhibitoren behandelt wurde .Figure 4 shows the results of immunocytometric studies on a mammalian cell (COS7 cells) according to the present invention is transformed with an ER or DR protein-encoding DNA and has been treated with different transcription or transplantation inhibitors.
ER- und DR-Proteme mit ihren jeweiligen ER- bzw. DR- Wiederholungs-Emheiten werden in einer Reihe von Korpergeweben, einschließlich des Gehirns, exprimiert. Dabei scheinen die ER- bzw. DR-reichen Domänen für die nukleare Lokalisation dieser Proteine verantwortlich zu sein. Einige Mitglieder der Familie, wie z.B. YT 521-B, werden dort erster Linie m Zellen neuronalen Ursprungs gefunden.ER and DR proteins, with their respective ER and DR repeat units, are expressed in a variety of body tissues, including the brain. The ER and DR-rich domains seem to be responsible for the nuclear localization of these proteins. Some members of the family, such as YT 521-B, primarily m cells of neuronal origin are found there.
Figur 1 zeigt eine beispielhafte Reihe von ER- und DR- Proteinen, die für die vorliegende Erfindung Betracht gezogen werden können. Die entsprechenden DNA- bzw. Polypeptid-Sequenzen können über die in der Figur 1 angegebenen Bezeichnungen der Proteine aus bekannten Genbanken (z.B. "GenBank") entnommen werden.Figure 1 shows an exemplary series of ER and DR proteins that can be considered for the present invention. The corresponding DNA or polypeptide sequences can be obtained from known gene banks (e.g. "GenBank") using the names of the proteins given in FIG. 1.
In Figur 1A sind die Proteine als Linien dargestellt, wobei die ER- bzw. DR-reichen Bereiche als schwarze Box angezeigt sind. Der Skalierungsstrich steht für 100 Aminosäuren Lange. In Figur 1B ist die Abgleichung der ER- bzw. DR-reichen Bereiche (Domänen) aus A) angegeben. Die Bezeichnungen der jeweiligen Proteine stehen für:The proteins are shown as lines in FIG. 1A, the regions rich in ER or DR being shown as a black box. The scale line stands for 100 amino acids long. FIG. 1B shows the comparison of the areas rich in ER or DR (domains) from A). The names of the respective proteins stand for:
KIA 0182 = hypothetisches Protein (T. Nagase et al. in DNA Res. Vol. 3, S. 17-24 (1996); Disc = drosophila disconnected gene (J. S. Heilig et al., EMBO J. Vol. 10, S. 809-815 (1991)); RD-Prote = Humanes RD-Protem (C.S. Surovi et al., Gene vol. 90, S. 299-301 (1990)); RNA-Helicase I = RNA Helicase-isolo aus Arabidopsis taliana (Genbank-Zugangsnummer U78721); IK-Faktor = humaner IK-Faktor (P. Greve et al., Onkogene Vol. 9, S. 3449-3456 (1994)); U2AF = U2-Auxιlιary Factor aus Tabak (C. Domon et al., J. Biol. Chem. Vol. 273, S. 34603-34610 (1998)); Shuttle Craft = "Shuttle Craft"- Protein aus Drosophila (N.D. Stroumbakis, Mol. Cell Biol . Vol. 16, S. 192-201 (1996)); J170K = humanes Ul70K-Protem (R.A. Spritz et al., Genomics Vol. 8, S. 371-379 (1990)); YT521-B = Splic g-assoznerter Faktor (A.M. Hartmann et al., Mol. Biol. Cell, Vol. 10, S. 3909-3926 (1999); Genbank Zugangsnr. AF 144731); SRP20 = SRP20-ahnlιches Protein aus C. elegans (R. Wilson et al., Nature Vol. 368, S.32-38 (1994)); RNA Helicase-II = RNA Helicase ATP-abhangige RNA Helicase HRH1 (M. Ono und Y. Shimura, Genes De . Vol. 10, S. 997-1007 (1996)); Hei 117 = Ratten-RNA-Helicase (J. Sukigawa und G. Blobel, J. Biol. Chem. Vol. 270, 15702-15706 (1995)) Octapep- Prot . = Octapeptid-Prote aus Maus (N. Di Carlo et al., J. Submicrosk. Cytol. Pathol. Vol. 24, S. 467-472 (1992)); SAF-B = "Scaffold Attachment Factor B" aus Ratte (0. Nayler et al., Genomics Vol. 53, S. 191-202 (1998)). Die Proteine wurden ermittelt unter Verwendung der 60 letzten Aminosäuren von YT521-B sowie durch die Sequenz (ER)15 unter Verwendung des BLAST Algorithmus. Ähnliche Sequenzen wurden unter Verwendung des PILEUP-Programms zusammengestellt. Der Ausdruck "Consensus" bedeutet die mittels LINE UP ermittelte Konsensussequenz dieser Abgleichung.KIA 0182 = hypothetical protein (T. Nagase et al. In DNA Res. Vol. 3, pp. 17-24 (1996); Disc = drosophila disconnected gene (JS Heilig et al., EMBO J. Vol. 10, p. 809-815 (1991)); RD-Prote = Human RD-Protem (CS Surovi et al., Gene vol. 90, pp. 299-301 (1990)); RNA-Helicase I = RNA-Helicase-isolo from Arabidopsis taliana (Genbank accession number U78721); IK factor = human IK factor (P. Greve et al., Oncogene Vol. 9, pp. 3449-3456 (1994)); U2AF = U2 auxiliary factor from tobacco (C. Domon et al., J. Biol. Chem. Vol. 273, Pp. 34603-34610 (1998)); Shuttle Craft = "Shuttle Craft" protein from Drosophila (ND Stroumbakis, Mol. Cell Biol. Vol. 16, pp. 192-201 (1996)); J170K = human Ul70K protein (RA Spritz et al., Genomics Vol. 8, pp. 371-379 (1990)); YT521-B = Splic g-associated factor (AM Hartmann et al., Mol. Biol. Cell, Vol. 10, pp. 3909-3926 (1999); Genbank Accession No. AF 144731); SRP20 = SRP20-like protein from C. elegans (R. Wilson et al., Nature Vol. 368, pp. 32-38 (1994)); RNA Helicase-II = RNA Helicase ATP-dependent RNA Helicase HRH1 (M. Ono and Y. Shimura, Genes De. Vol. 10, pp. 997-1007 (1996)); Hei 117 = rat RNA helicase (J. Sukigawa and G. Blobel, J. Biol. Chem. Vol. 270, 15702-15706 (1995)) Octapep-Prot. = Mouse octapeptide protein (N. Di Carlo et al., J. Submicrosk. Cytol. Pathol. Vol. 24, pp. 467-472 (1992)); Rat SAF-B = "Scaffold Attachment Factor B" (0. Nayler et al., Genomics Vol. 53, pp. 191-202 (1998)). Proteins were determined using the last 60 amino acids of YT521-B and sequence (ER) 15 using the BLAST algorithm. Similar sequences were put together using the PILEUP program. The expression "consensus" means the consensus sequence of this comparison determined by means of LINE UP.
Einige dieser Proteine, wie das RD-Protem, U170K, SAF-B, das "Shuttle Craft"-Protem, SRP 20, U2-Auxιlιary Factor und mehrere RNA Helicasen sind am Pra-mRNA Spleiß-Vorgang bzw. bei der Bildung des transkriptosomalen Komplexes beteiligt. Es wird angenommen, dass die ER bzw. DR-Proteine wichtige Funktionen übernehmen. Bestimmte Proteine davon mteragieren miteinander. Dies wurde von A.M. Hartmann et al. m Molecular Biology of the Cell 10, S. 3909-3926 (1999) beschrieben am Beispiel des YT521-B-Protems, das mit der nuklearen transkriptosomalen Komponente SAF-B mteragiert, wahrend eine weitere Interaktion von YT521-B mit dem p62/SAM 68-Protem ebenfalls für seine biologische Funktion eine Rolle zu spielen scheint. Die ER- bzw. DR-reiche Region scheint für die biologische Funktion bedeutend zu sein, da Deletions- Vaπanten ohne diese Regionen die nachweisbare Bindung an andere teragierende Proteine aufhebt. Indizien sprechen ferner dafür, dass diese charakteristische Domäne für das subnukleare Auftreten und das Spleiß-Muster von Reportergenen von Bedeutung ist.Some of these proteins, such as the RD-Protem, U170K, SAF-B, the "Shuttle Craft" -protem, SRP 20, U2-Auxιlιary Factor and several RNA helicases are involved in the Pra-mRNA splicing process or in the formation of the transcriptosomal Complex involved. It is assumed that the ER or DR proteins perform important functions. Certain proteins thereof interact with each other. This was by AM Hartmann et al. m Molecular Biology of the Cell 10, pp. 3909-3926 (1999) using the example of the YT521-B proteme, which interacts with the nuclear transcriptosomal component SAF-B, while a further interaction of YT521-B with the p62 / SAM 68-Protem also plays a role in its biological function seems to be playing. The ER or DR-rich region appears to be important for the biological function, since deletion variants without these regions abolish the detectable binding to other interacting proteins. There is also evidence that this characteristic domain is important for the subnuclear occurrence and the splice pattern of reporter genes.
Als markantes Erkennungszeichen von Krankheitszustanden hat sich nunmehr die Lokalisierung der ER- bzw. DR-Proteme in konzentrierten Bereichen (Punkte, "Dots" oder "Bodies") oder der Veränderung eines solchen Zustandes herausgestellt. Als besonders aussagekraftig für das Diagnose-Verfahren bzw. das Testverfahren gemäß vorliegender Erfindung hat sich die Untersuchung danach herausgestellt, ob oder inwieweit die ER- bzw. DR-Proteme in solchen zellularen, nuklearen Bereichen lokalisierbar sind. So wurde gefunden, dass Zellen im normalen Zustand mehrere solcher lokalisierbarer Bereiche aufwiesen, wie in Figur 2A gezeigt. Demgegenüber traten solche konzentrierten Bereiche überraschender Weise mThe localization of the ER or DR proteins in concentrated areas (dots, "dots" or "bodies") or the change in such a state has now emerged as a distinctive sign of disease. The examination according to whether or to what extent the ER or DR proteins can be localized in such cellular, nuclear areas has turned out to be particularly meaningful for the diagnostic method or the test method according to the present invention. It was found that cells in the normal state had several such localizable areas, as shown in FIG. 2A. In contrast, such concentrated areas surprisingly m
Tumorzellen nicht auf, wie m Figur 2B für die humanen Tumor- Zelllmie MCF7 gezeigt. Vielmehr ist dort das ER- bzw. DR- Protem diffus im Zellkern verteilt.Tumor cells do not show up, as shown in FIG. 2B for the human tumor cell line MCF7. Rather, the ER or DR protein is diffusely distributed in the cell nucleus.
Für neurodegenerative Zustande bzw. Krankheiten wurden andererseits überraschender Weise eine Erhöhung der Anzahl von lokalisierbaren, nuklearen Bereichen m Bezug auf ER- bzw. DR-Proteme beobachtet. Eine Reihe von neurodegenerativen Erkrankungen wird durch Expansion von Triplet-repeats ausgelost. Hierzu gehören zum Beispiel spinocerebellar ataxia type 1 und Huntmgtonsche Krankheit (MIM/OMIM Nummern 164400 und 143100) . Die hierzu gehörenden Genprodukte, sca-1 und Huntmgtm weisen eine Ausbildung von nuklearen Punkten auf (P. J. Skmner et al. Nature 389, S. 971-974 (1997) [veröffentlichtes Erratum in Nature 391, S. 307 (1998)], L. Roizin et al. Adv. Neurol . 23, S. 95-122 (1979)), die den Strukturen, die von ER-Protemen ausgebildet werden, sehr ähnlich sind (E. Assier et al. Gene 230, S. 145-154 (1999)). E n mit YT521-B mteragierendes Protein, DAN26 (Genbank Referenznummer U94836) mteragiert ebenfalls mit sca-1 und fuhrt zu einer Translokation des sca- 1 Genproduktes m YT521-B enthaltenden Kernstrukturen. Ein Nachweis von Kernstrukturen, die im Hinblick auf ER- oder DR- Proteme wie YT 521-B positiv detektierbar sind, können somit also auch für die Genese und Diagnose von neurodegenerativen Erkrankungen wie spmocerebellar ataxia type 1 und Huntmgtonsche Krankheit von Vorteil sein.For neurodegenerative conditions or diseases, on the other hand, an increase in the number of localizable, nuclear areas with respect to ER or DR proteins has surprisingly been observed. A number of neurodegenerative diseases are triggered by the expansion of triplet repeats. These include, for example, spinocerebellar ataxia type 1 and Huntmgton's disease (MIM / OMIM numbers 164400 and 143100). The associated gene products, sca-1 and Huntmgtm have a formation of nuclear points (PJ Skmner et al. Nature 389, pp. 971-974 (1997) [published Erratum in Nature 391, p. 307 (1998)], L. Roizin et al. Adv. Neurol. 23, pp. 95-122 (1979)), which are very similar to the structures formed by ER protems (E. Assier et al. Gene 230, pp. 145-154 (1999)). A protein which interacts with YT521-B, DAN26 (Genbank reference number U94836) also interacts with sca-1 and leads to a translocation of the sca-1 gene product containing yT521-B core structures. Detection of core structures that can be positively detected with regard to ER or DR prototypes such as YT 521-B can thus also be advantageous for the genesis and diagnosis of neurodegenerative diseases such as spmocerebellar ataxia type 1 and Huntmgton's disease.
Somit liefert die Bestimmung der ER- bzw. DR-Proteme in Bezug auf Verteilung, Lokalisierung m nuklearen Bereichen des Zellkerns sowie Quantifizierung sehr nützliche Informationen und diagnostische Aussagen. Im erfmdungsgemaßen Verfahren können einzelne oder mehrere ER- bzw. DR-Proteme bestimmt werden. Als besonders aussagekraftig hat sich die Untersuchung auf das DR-Protem YT521, insbesondere dessen Spleißvariante YT 521-B erwiesen.Thus, the determination of the ER or DR proteins with regard to distribution, localization in the nuclear areas of the cell nucleus and quantification provides very useful information and diagnostic statements. In the method according to the invention, one or more ER or DR protems can be determined. The investigation for the DR prototype YT521, in particular its splice variant YT 521-B, has proven to be particularly informative.
Des weiteren wurde im Rahmen der vorliegenden Erfindung festgestellt, dass das Auftreten der ER- bzw. DR-Proteme in lokalisierten nuklearen Bereichen im Verlauf desFurthermore, it was found in the context of the present invention that the occurrence of the ER or DR proteins in localized nuclear areas during the course of the
Zellzyklusses reguliert ist und sich verändert. Das Auftreten der lokalisierten Bereiche korreliert dabei sehr gut mit dem Beginn wahrend der mittleren bis spaten Gl-Phase und der anschließenden Fortsetzung wahrend der S-Phase m Bezug auf die transkriptionale Aktivität, wahrend solche lokalisierbare Bereiche wahrend der Mitose, speziell der G2/M-Phase und der frühen Gl-Phase, undetektierbar waren und somit das Fehlen transkriptionaler Aktivität anzeigte. Die Bestimmung der ER- bzw. DR-Proteme, insbesondere das lokalisierbare Auftreten in zellularen, nuklearen Bereichen, kann daher vorteilhafter Weise auch zur Bestimmung der Transkπptions-Aktivitat , des Differenzierungs-Stadiums und/oder des Zyklus-Stadiums einer zu untersuchenden Zelle eingesetzt werden.Cell cycle is regulated and changing. The occurrence of the localized areas correlates very well with the beginning during the middle to late Gl phase and the subsequent continuation during the S phase with respect to the transcriptional activity, while such localizable areas during mitosis, especially G2 / M- Phase and the early Gl phase, were undetectable and thus indicated the lack of transcriptional activity. The determination of the ER or DR proteins, in particular the localizable occurrence in cellular, nuclear areas, can therefore be more advantageous In this way, it can also be used to determine the transcription activity, the differentiation stage and / or the cycle stage of a cell to be examined.
Eine weitere, erfmdungsgemaß gefundene Verwendungsmöglichkeit des vorstehend beschriebenen Markers, d.h. des bzw. der oben beschriebenen ER- bzw. DR-Protem (e) , besteht darin, ggf. therapeutisch wirksame Substanzen, insbesondere solche gegen Krebserkrankungen und/oder neurogenerative Krankheitszustande, zu testen. Eine therapeutische Wirksamkeit zeigt sich dadurch, dass das wie oben beschriebene Erscheinungsbild der ER- bzw. DR-Proteme in Folge der Einwirkung der untersuchten, potentiell therapeutisch wirksamen Substanz ändert. Aussagekraftige Kriterien für eine solche Veränderung sind wiederum eine diffuse Verteilung, eine Sichtbarmachung m definierten nuklearen Bereichen oder eine Vermehrung solcher nuklearer Bereiche an ER- bzw. DR-Protemen. Dies wurde am Beispiel der bekannten Brustkrebs-Zelllmie MCF7 experimentell belegt. Wahrend die unbehandelte Krebs-Zelllmien eine lediglich diffuse Verteilung von ER- bzw. DR-Protemen und kein Auftreten von nuklearen Bereichen zeigten, konnten solche nukleare Bereiche lokalisiert werden nach 48 Stunden Inkubationszeit mit dem bekannten Anti-Brustkrebs-Mittel Tamoxifen (s. Fig. 2B, linke und rechte Spalte). Auch die Einwirkung durch bekannte Differenzierungsagentien wie Natπumbutyrat oder Phorbol-12-myrιstat-13-acetat (PMA), veränderten das Erscheinungsbild unter Auftreten der lokalisierbaren, nuklearen Bereiche nach der Behandlung (s. Fig. 2B, die beiden mittleren Spalten).Another possible use of the marker described above, according to the invention, i.e. of the ER or DR protein (s) described above consists in testing therapeutically active substances, in particular those against cancer and / or neurogenerative disease states. Therapeutic effectiveness is shown by the fact that the appearance of the ER or DR proteins as described above changes as a result of the action of the investigated, potentially therapeutically active substance. Meaningful criteria for such a change are in turn a diffuse distribution, a visualization in defined nuclear areas or an increase in such nuclear areas on ER or DR proteins. This was demonstrated experimentally using the example of the well-known breast cancer cell MCF7. While the untreated cancer cell lines showed only a diffuse distribution of ER or DR proteins and no occurrence of nuclear areas, such nuclear areas could be localized after 48 hours of incubation with the well-known anti-breast cancer agent tamoxifen (see Fig. 2B, left and right column). The effects of known differentiation agents such as Natπumbutyrat or Phorbol-12-myrιstat-13-acetate (PMA) also changed the appearance with the appearance of the localizable, nuclear areas after the treatment (see FIG. 2B, the two middle columns).
Zur Detektion im Rahmen der Bestimmung der ER- bzw. DR- Proteme in den erfmdungsgemaßen Verfahren kommen m erster Linie lmmunocytische und verwandte Verfahren in Frage, wie dies bei den oben beschriebenen Experimenten der Fall war. lmmunocytische Verfahren sind vorteilhafter Weise ™ιt den m Screenmg-Verfahren üblichen Assay-Formaten veremßar. Jedoch kommen auch andere typische, spezifische Protein- Nachweisverfahren m Frage, beispielsweise ein Enzy - gebundener Immunosorbensassay (ELISA) . Solche Methoden sind dem Fachmann geläufig.For the detection within the framework of the determination of the ER or DR protems in the methods according to the invention, primarily immunocytic and related methods come into question, as was the case with the experiments described above. Immunocytic methods are advantageously measured using the assay formats customary in the Screenmg method. However, other typical, specific protein detection methods also come into question, for example an enzyme-linked immunosorbent assay (ELISA). Such methods are familiar to the person skilled in the art.
Als besonders nützliche Produkte zum Einsatz m solche lmmunocytische Verfahren oder dergleichen sind Antikörper, die gegen ber einzelnen oder mehrere der oben beschriebenen ER- bzw. DR-Proteme gerichtet sind, zu nennen. Die Antikörper können gegen das gesamte ER- bzw. DR-Protem oder aber gegen ein Oligopeptid, das einen Sequenzausschnitt aus dem ER- bzw. DR-Protem definiert, gerichtet werden. Je nach gewünschter Anwendung können die Antikörper gegen die ER- oder DR-Region gerichtet sein, so dass ER- bzw. DR-Proteme generell erfasst werden können. Als Antigen kann hierfür die m Fig. 1B dargestellte Konsensus-Sequenz herangezogen werden. Andererseits kann es, falls gewünscht, vorteilhaft sein, wenn die Antikörper spezifisch gegen einzelne ER- bzw. DR-Proteme gerichtet sind, um differenziertere Aussagen zu ermöglichen. Dies ist m Beispiel 2 für einen Anti-corper gegen YT521-B gezeigt. Die Antikörper der Erfindung können jegliche Formen annehmen: monoklonal oder polyklonal, ferner smgle chain, in Hybrid- oder kombinatorischer Form.Antibodies which are directed against one or more of the ER or DR proteins described above can be mentioned as particularly useful products for use in such immunocytic processes or the like. The antibodies can be directed against the entire ER or DR protein or against an oligopeptide which defines a sequence section from the ER or DR protein. Depending on the desired application, the antibodies can be directed against the ER or DR region, so that ER or DR proteins can generally be detected. For this purpose, the consensus sequence shown in FIG. 1B can be used as the antigen. On the other hand, it can, if desired, be advantageous if the antibodies are specifically directed against individual ER or DR proteins in order to enable more differentiated statements to be made. This is shown in Example 2 for an anti-body against YT521-B. The antibodies of the invention can take any form: monoclonal or polyclonal, also smgle chain, in hybrid or combinatorial form.
Als weiteres hilfreiches Produkt wird erfmdungsgemaß eine Saugetierzelle zur Verfugung gestellt, die durch eine DNA transformiert ist, welche für ein wie oben beschriebenes ER- Protein oder DR-Protem kodiert. Die Saugetierzelle ist dabei vorzugsweise menschlichen Ursprungs. Eine solche transformierte Zelle kann vorteilhafter Weise für das oben beschriebene Verfahren zum Testen von therapeutisch wirksamen Substanzen, insbesondere solche gegen Krebserkrankungen und/oder neurodegenerative Krankheitszustande, verwendet werden. Die Transformation der Saugetierzelle mit der ER- bzw. DR-Protem kodierenden DNA kann mit an sich bekannten Methoden durchgeführt werden (s. z.B. J. Sa brook et al., Molecular Clonmg, Cold Spring Harbor Laboratory Press (1989)). Dafür geeignete Vektoren, einschließlich expressionsfordernder Sequenzen, sind bekannt und bei J. Sambrook et al. beschrieben. Die für das ER-Protem oder DR- Protem kodierende DNA ist vorzugsweise stabil in das Genom der Saugetierzelle integriert.According to the invention, a further useful product is a mammalian cell which is transformed by a DNA which codes for an ER protein or DR protein as described above. The mammalian cell is preferably of human origin. Such a transformed cell can advantageously be used for the method described above for testing therapeutically active substances, in particular those for cancer diseases and / or neurodegenerative disease states become. The transformation of the mammalian cell with the DNA encoding the ER or DR protein can be carried out using methods known per se (see, for example, J. Sa brook et al., Molecular Clonmg, Cold Spring Harbor Laboratory Press (1989)). Suitable vectors, including expression-demanding sequences, are known and are described in J. Sambrook et al. described. The DNA coding for the ER protein or DR protein is preferably stably integrated into the genome of the mammalian cell.
Die vorstehend beschriebenen erfmdungsgemaßen Verfahren können ohne weiteres m vi tro, beispielsweise nach Entnahme eines geeigneten Zellmaterials aus dem zu untersuchenden Patienten oder durch Verwendung von m Kultur gebrachten Zellen, durchgeführt werden. Insbesondere für das er mdungsgemaße Testverfahren zum Screenen potentiell therapeutisch wirksamer Substanzen sind bevorzugt etablierte Zelllmien, die für den jeweiligen Krankheitszustand spezifisch sind, m geeigneter Weise einzusetzen.The above-described methods according to the invention can be carried out without difficulty, for example after removing a suitable cell material from the patient to be examined or by using cells brought into culture. In particular for the test method according to the invention for screening potentially therapeutically active substances, it is preferred to use established cell lines which are specific for the respective disease state in a suitable manner.
Die Erfindung wird nachfolgend anhand von erläuternden, jedoch nicht einschränkenden Beispielen naher beschrieben.The invention is described in more detail below with the aid of illustrative but not restrictive examples.
Beispiel 1:Example 1:
Klonierung einer ER- bzw. DR-Protem kodierenden DNACloning of an ER or DR protein encoding DNA
Die molekulare Klonierung wurde am Beispiel von YT521-B unter Verwendung von Standard-Protokollen (J. Sambrook et al., Molecular Clonmg, Cold Spring Harbor Laboratory pressThe molecular cloning was carried out using the example of YT521-B using standard protocols (J. Sambrook et al., Molecular Clonmg, Cold Spring Harbor Laboratory press
(1989)) durchgeführt. Reverse Transkπptase (RT) - PCR wurde wie von A.M. Hartmann und S. Stamm (Biochem. Biophys . Res. Com. Vol. 1353, S. 224-230 (1997)) durchgeführt. Genbanken aus Rattenhirn, und zwar zum einen postnatal (5. Tag) und zum anderen im embryonischen Zustand nach 16 Tagen, wurden einem Doppelhybπd-Screenmg unter Verwendung einer htra2-ß pGBT9- Sonde (B. Beil et al., DNA and Cell Biol., Vol. 16, S. 679- 690 (1997)) als Köder unterworfen. Der Hefe-Gal4-Doppel- hybrid-Screen wurde gemäß S. Fields und 0. Song. (Nature Vol. 340, s. 245-247 (1989)) unter Verwendung des Stamms HF7c durchgeführt. Für jeden Screen wurden etwa 6 x 106 Transformanten mit 100 μg Köder (bai t ) -DNA und 50 μg Beute (prey) -DNA gescreent. Um eine Wechselwirkung von YT521-B mit anderen Proteinen zu testen, wurde 1 μg der mit der Gal4- Aktivierungsdomane fusionierten YT521-B und 1 μg von SAF-B, htra2-beta, hnRNP-G, p62/SAM68 sowie mit der Gal4- Bmdungsdomane fusioniertes YT521-B wurden cotransformiert und auf Dreifach-Dropout-Platten, denen Leucm, Tryptophan und Hystidm fehlten, plattiert. Überlebende Kolonien wurden wiederholt auf Dreifach-Dropout-Platten abgestreift, welche mit 10 mM 3-Ammotnazol supplementiert waren.(1989)). Reverse transceptase (RT) - PCR was carried out as by AM Hartmann and S. Stamm (Biochem. Biophys. Res. Com. Vol. 1353, pp. 224-230 (1997)). Genebanks from rat brain, one postnatal (day 5) and the other in the embryonic state after 16 days, became one Doppelhybπd-Screenmg using an htra2-ß pGBT9 probe (B. Beil et al., DNA and Cell Biol., Vol. 16, pp. 679-690 (1997)) as bait. The yeast Gal4 double hybrid screen was designed according to S. Fields and 0. Song. (Nature Vol. 340, pp. 245-247 (1989)) using the HF7c strain. For each screen, approximately 6 × 10 6 transformants were screened with 100 μg bait (bai t) DNA and 50 μg prey (prey) DNA. In order to test an interaction of YT521-B with other proteins, 1 μg of the YT521-B fused with the Gal4 activation domain and 1 μg of SAF-B, htra2-beta, hnRNP-G, p62 / SAM68 and with the Gal4- Bmdungsmomane fused YT521-B were cotransformed and plated on triple dropout plates lacking Leucm, Tryptophan and Hystidm. Surviving colonies were stripped repeatedly on triple dropout plates supplemented with 10 mM 3-ammotnazole.
DNA wurde aus His-autotrophen und lacZ-positiven Kolonien (C.S. Hoffmann und F. Wmston, Gene, Vol. 57, S. 267-272 (1987)) isoliert, mittels Elektroporation m HBIOI-Zellen eingebracht, wonach auf Ampicillm-Platten selektiert wurde. Resistente Kolonien wurden auf M9-Platten ohne Leucm ruckabgestrichen, um Koder-Plasmid zu entfernen (S. M. Hollenberg et al., Mol. Cell Biol., Vol. 15, S. 3813-3822 (1995)). DNA aus den autotrophen Bakterien wurde isoliert und unterDNA was isolated from His-autotrophic and lacZ-positive colonies (CS Hoffmann and F. Wmston, Gene, Vol. 57, pp. 267-272 (1987)), introduced into HBIOI cells by electroporation, after which selection was carried out on Ampicillm plates has been. Resistant colonies were swabbed onto M9 plates without Leucm to remove Koder plasmid (S.M. Hollenberg et al., Mol. Cell Biol., Vol. 15, pp. 3813-3822 (1995)). DNA from the autotrophic bacteria was isolated and under
Verwendung eines automatischen Sequenzierers (ABI-Sequencer) sequenziert. Die DNA-Sequenzen wurden mit dem GCG-Wisconsm Software-Paket (Genetics Computer Group, Program Manual for Wisconsin Package, Version 8, Medic e, Wisconsin (1994)) analysiert.Sequenced using an automatic sequencer (ABI sequencer). The DNA sequences were analyzed with the GCG-Wisconsm software package (Genetics Computer Group, Program Manual for Wisconsin Package, Version 8, Medic e, Wisconsin (1994)).
Zwei cDNA-Klone, YT521TH-pADgal4 und YT521ΔN10-pADGal4 , wurden erhalten. Da keine der Klone eine komplette cDNA enthielt, wurde eine Schnell-Amplifikation von cDNA-Enden (RACE) zur Ampliflzierung der fehlenden 5 ' -Enden (Marathon cDNA a pliflcation kit; Clontech) durchgeführt. Ein Vergleich mit den vollständigen RACE-Klonen zeigte, dass dem erstgenannten Klon die ersten 253 Aminosäuren und dem zweitgenannten Klon die ersten 10 Aminosäuren fehlten. YT521TH-B und YT521ΔN10 wurden in Form eines EcoRI/SacII - Fragments in pEGFP-C2 (Clontech) und in Form eines EcoRI/Pstl-Fragments in pGBT9 (Clontech) geklont. Restriktions-Schmttstellen wurden eingef hrt mittels PCR- Amplifikation mit den Oligonukleotiden yt521eco-fl: CCGAATTCTATGAACAGGATGAGAGAGATC (SEQ ID Nr. 1), yt521-sacll-r : CCCCGCGGACATTATCTTCGATAACGACCTCTTTCC (SEQ ID Nr. 2) und yt521pstl-r: TCTGCAGGGTTTTTCTGGTTGACT (SEQ ID Nr. 3).Two cDNA clones, YT521TH-pADgal4 and YT521ΔN10-pADGal4, were obtained. Since none of the clones contained a complete cDNA, rapid amplification of cDNA ends (RACE) was carried out to amplify the missing 5 'ends (marathon cDNA a plication kit; Clontech). A comparison with the complete RACE clones showed that the first clone lacked the first 253 amino acids and the second clone lacked the first 10 amino acids. YT521TH-B and YT521ΔN10 were cloned in the form of an EcoRI / SacII fragment in pEGFP-C2 (Clontech) and in the form of an EcoRI / PstI fragment in pGBT9 (Clontech). Restriction sites were introduced by means of PCR amplification with the oligonucleotides yt521eco-fl: CCGAATTCTATGAACAGGATGAGAGAGATC (SEQ ID No. 1), yt521-sacll-r: CCCCGCGGACATTATCTTCGATAACGACCTCTTTCC (SEQ IDGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTt 3).
Eine ähnlich zu der obigen Prozedur durchgeführte Klonierung durch Y. Imai, et al., Mol. Brain Res. Vol. 53, S. 33-40A cloning similar to the above procedure by Y. Imai, et al., Mol. Brain Res. Vol. 53, pp. 33-40
(1998)) führte kurzlich zur Isolierung einer ahnlichen cDNA, YT521.(1998)) recently led to the isolation of a similar cDNA, YT521.
Die Gesamt-Domanenstruktur des gefundenen ER-Protems YT521-B ist m Figur 3A gezeigt. Die ammotermmale, Glutammsaure- reiche Region, die carboxyterm ale Prolm-reiche Region und die charakteristische Glutammsaure/Amm-reiche Region sind durch schattierte Kastchen angezeigt. Die Kastchen mit arabischen Nummern bezeichnen die vier nuklearen Lokalisierungssignal-Sequenzen. Die Buchstaben "A" und "B" bezeichnen die Insertionen, die wahrscheinlich mittels alternativem Spleißen generiert sind. Die detaillierten Sequenzen der Insertionen A und B sind unterhalb der Darstellung der Gesamtdomanen-Struktur angegeben (sowohl DNA- als auch Embuchstaben-Ammosauresequenz) . Das Protein YT521- B unterscheidet sich von YT521 durch diese Insertionen A und B. Die Gesamtsequenz von YT521-B wurde in der Genbank unter der Zugangsnummer AF144731 abgelegt. Northern-Blot-Analysen m -si tu Hybπdisierungsstudien an Hirngewebeschnitten zeigten, dass YT521-B m verschiedenen Gewebearten (Herz, Gehirn, Niere, Lunge, Leber, Muskel, Milz und Testis (Hoden) vorkommt, wobei verschiedenen Isoformen aufgrund alternativen Spleißens entdeckt wurden) , wobei im Gehirn eine Zelltyp-spezifische Expression charakteristisch war .The overall domain structure of the ER prototype YT521-B found is shown in FIG. 3A. The ammotermmal, glutammic acid-rich region, the carboxyterm ale prolm-rich region and the characteristic glutammic acid / amm-rich region are indicated by shaded boxes. The boxes with Arabic numbers indicate the four nuclear localization signal sequences. The letters "A" and "B" denote the insertions that are likely to be generated by alternative splicing. The detailed sequences of insertions A and B are given below the representation of the overall domain structure (both DNA and letter E ammosaic sequence). The protein YT521-B differs from YT521 by these insertions A and B. The total sequence of YT521-B was filed in the gene bank under the accession number AF144731. Northern blot analyzes m-tu hybridization studies on brain tissue sections showed that YT521-B occurs in different types of tissue (heart, brain, kidney, lung, liver, muscle, spleen and testis), whereby different isoforms were discovered due to alternative splicing ), whereby a cell type-specific expression was characteristic in the brain.
Be spiel 2Example 2
Herstellung von Antikörpern gegen ER- bzw. DR-ProtemeProduction of antibodies against ER or DR proteases
Antikörper wurden mittels herkömmlicher Methoden gegen antigene Strukturen der ER- bzw. DR-Proteme gewonnen. Beispielsweise wurde em gegen YT521B spezifischer, polyklonaler Antikörper aus Ratte entwickelt, gegen eine Mischung zweier YT521-B-spezιfischer Polypeptide, die jeweils mit dem Keyhole-Limpet-Hemocyanm fusioniert worden waren, und zwar Polypeptid Nr. 1: RSARSVILIFSVRESGKFQCG (SEQ ID Nr. 4), und Polypeptid Nr. 2: KDGELNVLDDILTEVPEQDDECG (SEQ ID Nr. 5) .Antibodies were obtained using conventional methods against antigenic structures of the ER or DR proteases. For example, a rat polyclonal antibody specific to YT521B was developed, against a mixture of two YT521-B-specific polypeptides, each of which had been fused with the keyhole limpet hemocyanin, namely polypeptide No. 1: RSARSVILIFSVRESGKFQCG (SEQ ID No. 4), and polypeptide No. 2: KDGELNVLDDILTEVPEQDDECG (SEQ ID No. 5).
Beispiel 3 Immunocytologische Bestimmung von ER- bzw. DR-ProtemenExample 3 Immunocytological Determination of ER or DR Protemen
1. Zellkultur1. Cell culture
Zellen, wie HEK293, COS7-Zellen oder BHK-Zellen, wurden in Dulbecco's modifiziertem Eagle's Medium (DMEM) , zu dem 10 (v/v)-% fötales Kalberserum (FCS) zugesetzt war, gehalten. Die humane Brustkrebs-Zelllmie MCF7 wurde in RPMI 1640, welches mit 10% (v/v) FCS supplementiert war, gehalten. Für immunologische Anfarbeexpeπmente wurden Zellen auf Glas- Abdeckplattchen m 6 cm-Zellkultur-Gefaßen wachsen gelassen. 2. Zellkern-ExtraktionCells such as HEK293, COS7 cells or BHK cells were kept in Dulbecco's modified Eagle's Medium (DMEM) to which 10 (v / v)% fetal calf serum (FCS) was added. The human breast cancer cell MCF7 was kept in RPMI 1640, which was supplemented with 10% (v / v) FCS. For immunological staining experiments, cells were grown on glass cover plates in 6 cm cell culture vessels. 2. Cell nucleus extraction
Zellkern-Extraktionen wurden wie beschrieben (s. z.B. M. Patturajan et al., Mol. Cell. Biol., Vol. 1998, S. 2406-2415) durchgeführt. Kurz gesagt wurden Zellen in Tris-gepuffertem Salz (TBS-Puffer: 10 mM Tπs-HCl, pH 7,4, 150 mM NaCl, 5 mM MgCl2) , welches 0,5% Tπton-X 100 und 0,5 mM PMSF enthielt, permeabilisiert . Die Zellen wurden dann m TBS alleine, in TBS mit 20 U/ml Benzonase oder in TBS mit 4 U/ml DNase-freier RNase kubiert (die Enzyme wurden von Sigma bezogen) . Schließlich wurden Zellen mit TBS/0, 2 M Ammoniumsulfat extrahiert, in 3,7%- Formaldehyd/Phosphat-gepuffertem Salz (PBS) für 5 Minuten fixiert und ggf. mit dem Farbstoff Hoechst Nr. 33258 in einer Konzentration von 1 μg/ml PBS mkubiert .Nuclear extractions were carried out as described (see, for example, M. Patturajan et al., Mol. Cell. Biol., Vol. 1998, pp. 2406-2415). Briefly, cells were in Tris buffered salt (TBS buffer: 10mM Tπs-HCl, pH 7.4, 150mM NaCl, 5mM MgCl 2 ) containing 0.5% Tπton-X 100 and 0.5mM PMSF contained, permeabilized. The cells were then incubated in TBS alone, in TBS with 20 U / ml benzonase or in TBS with 4 U / ml DNase-free RNase (the enzymes were obtained from Sigma). Finally, cells were extracted with TBS / 0.2 M ammonium sulfate, fixed in 3.7% formaldehyde / phosphate-buffered salt (PBS) for 5 minutes and, if necessary, with the dye Hoechst No. 33258 in a concentration of 1 μg / ml PBS incubated.
3. Zellzyklusanalyse3. Cell cycle analysis
Zellen wurden auf 60 - 80 % Konfluenz wachsen gelassen und mit 0,5 μg/ml Nocodazol für 4 Stunden in der G2/M-Phase blockiert. Mitose-Zellen wurden dann mittels Auffangen auf dem Zellkulturgefaß entfernt, gewaschen und auf Glas- Abdeckplattchen ausgesät (D.L. Spector et al. m Cells: A Laboratory Manual; Cold Spring Harbor Laboratory Press, New York (1998)). Die Zellen wurden für 6, 13, 18 und 24 Stunden vor der Fixierung mkubiert. 4. lmmunocytische AnfarbungCells were grown to 60-80% confluency and blocked with 0.5 μg / ml nocodazole for 4 hours in the G2 / M phase. Mitose cells were then collected by collecting on the cell culture vessel, washed and seeded on glass cover plates (DL Spector et al. M Cells: A Laboratory Manual; Cold Spring Harbor Laboratory Press, New York (1998)). The cells were incubated for 6, 13, 18 and 24 hours before fixation. 4. Immunocytic staining
1 x 105 zu untersuchende Zellen wurden auf einem Glas- Abdeckplattchen 3,5 cm-Kulturschalchen für 24 h vor der Fixierung und Immuno-Anfarbung wachsen gelassen. Die Zellen wurden dann in 3, 7%-Formaldehyd in PBS für 10 Minuten bei Raumtemperatur fixiert, dreimal in PBS/0,1% Tπton-XlOO gewaschen und m PBS/0,1% Tπton-X 100/3% Rinder-Serumalbumm für 30 - 60 Minuten bei Raumtemperatur blockiert. Die Zeller wurden dann mit dem entsprechenden Antikörper, hier dem gema~:> Beispiel 2 erhaltenen Antikörper gegen YT521-B, über Nacht bei 4°C in PBS/0,1% Triton-X 100/3% Rinder-Serumalbumm mkubiert und dreimal mit PBS/0,1% Triton-X 100 gewaschen. Die Zellen wurden dann mit CY3-konjugιertem Sekundar- Antikörper (Dianova) PBS/0,1% Triton-X 100 für 2 Stunden bei Raumtemperatur mkubiert, dreimal m PBS/0,1% Tπton- X 100 gewaschen und auf Glasplattchen m Fluormount (Dianova) angeheftet. Die Zellen wurden entweder durch Laserscanning- Flureszenzmikroskopie (Leica) oder durch herkömmliche Mikroskopie, gefolgt von einem Deconvolutionsvorgang unter Verwendung der Openlab-Software (Improvision) , untersucht.1 x 10 5 cells to be examined were grown on a glass cover plate 3.5 cm culture dish for 24 h before fixation and immunostaining. The cells were then fixed in 3.7% formaldehyde in PBS for 10 minutes at room temperature, washed three times in PBS / 0.1% Tπton-XlOO and m PBS / 0.1% Tπton-X 100/3% bovine serum albumin blocked for 30-60 minutes at room temperature. The cells were then incubated with the appropriate antibody, here the antibody against YT521-B obtained according to Example 2, overnight at 4 ° C. in PBS / 0.1% Triton-X 100/3% bovine serum albumin and three times washed with PBS / 0.1% Triton-X 100. The cells were then incubated with CY3-conjugated secondary antibody (Dianova) PBS / 0.1% Triton-X 100 for 2 hours at room temperature, washed three times with PBS / 0.1% Tπton-X 100 and on glass plates with Fluormount ( Dianova) pinned. The cells were examined either by laser scanning fluorescence microscopy (Leica) or by conventional microscopy, followed by a deconvolution process using Openlab software (Improvision).
Beispiel 4 Krebsdiagnose am Beispiel von BrustkrebsExample 4 Cancer diagnosis using the example of breast cancer
1 x 106 der humanen Brustkrebs-Zelllmie MCF7 wurden in 10 cm-Zellkulturschalen, die 4 Glas-Abdeckplattchen enthielten, ausgesät und für 24 h wachsen gelassen. Nach weiteren 48 h wurden die Glas-Abdeckplattchen entfernt und die Zellen wie in Beispiel 3, Punkt 4 beschrieben, fixiert und mittels dem m Beispiel 2 beschriebenen Antikörper angefärbt . Die Immunfluoreszenz-Untersuchung mittels Laserscannmg- Fluoreszenzmikroskopie zeigte eine diffuse nukleare Anfarbung des endogenen ER-Protems m den unbehandelten MCF7-Zellen; es waren keine definierte, nukleare Bereiche lokalisierbar (s. Fig. 2B links). Im Vergleich zeigten normale Zellen (hier: BHK- und COS-Zellen) die charakteristische punktuelle Anfarbung ("Dots"), die im Zellkern lokalisiert werden konnten (s. Fig. 2A) .1 x 10 6 of the human breast cancer cell MCF7 were seeded in 10 cm cell culture dishes containing 4 glass cover plates and grown for 24 h. After a further 48 h, the glass cover plates were removed and the cells were fixed as described in Example 3, item 4 and stained using the antibody described in Example 2. The immunofluorescence examination using laser scanning fluorescence microscopy showed a diffuse nuclear staining of the endogenous ER prototype in the untreated MCF7 cells; no defined nuclear areas could be localized (see FIG. 2B on the left). In comparison, normal cells (here: BHK and COS cells) showed the characteristic spot staining ("dots") that could be located in the cell nucleus (see FIG. 2A).
Beispiel 5Example 5
Zelldifferenzierung und therapeutische BehandlungCell differentiation and therapeutic treatment
Um zu zeigen, dass der Nachweis von ER- bzw. DR-Protemen zum Studium von Zell-Differenziation und zum Testen von therapeutisch wirksamen Substanzen geeignet ist, wurden MCF7- Zellen wie im Beispiel 4 beschrieben wachsen gelassen und mit unterschiedlichen Agentien behandelt.In order to show that the detection of ER or DR proteins is suitable for studying cell differentiation and for testing therapeutically active substances, MCF7 cells were grown as described in Example 4 and treated with different agents.
Hierzu wurden nach Aussäen und 24h-Wachstum die MCF7-Zellen m t Tamoxifen (5 μM) , Natriumbutyrat (1 μM) oder Phorbol-12- myrιstat-13-acetat (PMA, 1 μg/ml) f r weitere 48 h mkubiert. Dann wurden die Zellen fixiert und mit dem gegen ber YT521-B spezifischen Antikörper angefärbt, wie m Beispiel 4 beschrieben.For this purpose, after sowing and growth for 24 hours, the MCF7 cells were incubated with t tamoxifen (5 μM), sodium butyrate (1 μM) or phorbol-12-myristate-13-acetate (PMA, 1 μg / ml) for a further 48 h. The cells were then fixed and stained with the antibody specific for YT521-B, as described in Example 4.
Figur 2B (rechte Spalte) zeigt, dass m den Tumorzellen nach Behandlung durch das Antitumormittel Tamoxifen die charakteristischen nuklearen Bereiche mittels der ER- bzw. DR-Protem-Anfarbung wieder lokalisierbar waren. Dasselbe geschah nach Behandlung mit den Differenzierungs-Agentien Natriumbutyrat und PMA (Fig. 2B, mittlere Spalten) . Ferner zeigte sich, dass nukleare ER- bzw. DR-Protem- spezifische Bereiche bei Zellzyklus-Studien wahrend der mittleren bis spaten Gl-Phase sowie wahrend der S-Phase, jedoch nicht wahrend der G2/M-Phase und der frühen Gl-Phase lokalisierbar waren. Zur Kontrolle wurden die Differen- zierungszustande mit herkömmlicher Anfarbung durch Olrot 0 nach Fixierung der Zellen mit 2% Formaldehyd und anschließender Beobachtung mittels Phasenkontrastmikroskopie verifiziert .FIG. 2B (right column) shows that in the tumor cells, after treatment with the anti-tumor agent tamoxifen, the characteristic nuclear areas could be localized again by means of the ER or DR protein staining. The same thing happened after treatment with the differentiation agents sodium butyrate and PMA (Fig. 2B, middle columns). Furthermore, it was shown that nuclear ER- or DR-Protem-specific areas in cell cycle studies during the middle to late Gl phase and during the S phase, but not during the G2 / M phase and the early Gl phase were localizable. As a control, the differentiation states were verified with conventional staining using Olrot 0 after fixation of the cells with 2% formaldehyde and subsequent observation using phase contrast microscopy.
Somit konnte gezeigt werden, dass die ER- bzw. DR-Proteme sowie deren Bestimmungen ausgezeichnet als Marker nutzbar waren. Dies nicht nur zur Diagnose von krankhaften Zustanden, sondern auch zur Identifizierung des Differenzierungs- Zustandes und/oder des Zellzyklus-Zustandes einer Zelle sowie zum Testen von potentiell therapeutisch wirksamen Substanzen oder Agentien.It could thus be shown that the ER and DR protems and their determinations could be used excellently as markers. This not only for the diagnosis of pathological conditions, but also for the identification of the differentiation state and / or the cell cycle state of a cell as well as for the testing of potentially therapeutically active substances or agents.
Beispiel 6Example 6
Transfektion bzw. Transformation mit ER- bzw. DR-Protem- kodierender DNATransfection or transformation with DNA encoding ER or DR proteins
3 x 105 Zellen (z.B. HEK293-, COS7- oder BHK-Zellen) wurden in einer 3,5 cm-Kulturschale ausgesät und mit einer geeigneten Menge an Plasmid-Konstrukt , welches die ER- bzw. DR-Protem-kodierende DNA enthielt, einer Transfektion bzw. Transformation unterworfen. So wurden HEK293-Zellen mit 0,5 μg - 1 μg Plasmid-DNA unter Verwendung der Kalzium- Prazipitations-Methode wie beschrieben (0. Nayler et al.,3 × 10 5 cells (for example HEK293, COS7 or BHK cells) were sown in a 3.5 cm culture dish and with a suitable amount of plasmid construct which contained the DNA coding for the ER or DR protein , subjected to a transfection or transformation. For example, HEK293 cells with 0.5 μg - 1 μg plasmid DNA were described using the calcium precipitation method as described (0. Nayler et al.,
Bioche . J. , Vol. 326, S. 693-700 (1997)) transformiert. Die Zellen wurden 24 h nach der Transfektion geerntet. COS7- oder BHK-Zellen wurden mit 10 μl Superfect-Reagens (Qiagen, Hilden, Deutschland) gemäß den Herstellermstruktionen unter Verwendung von 1,5 μg Plasmid-DNA (0,5 μg des klonierten Konstrukts sowie 1 μg an leerem Camer-Vektor) transformiert. Als Expressions-Konstrukte wurden z.B. der m Beispiel 1 erhaltene Vektor pEGFP-YT521-B verwendet.Bioche. J., Vol. 326, pp. 693-700 (1997)). The cells were harvested 24 hours after transfection. COS7 or BHK cells were treated with 10 μl Superfect reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions using 1.5 μg plasmid DNA (0.5 μg of the cloned Construct and 1 μg of empty Camer vector). For example, the vector pEGFP-YT521-B obtained in Example 1 was used as expression constructs.
Beispiel 7Example 7
Bestimmung der Transskriptionsaktivitat einer ZelleDetermination of the transcription activity of a cell
Cytologische Untersuchungen ergaben, dass die charakteristischen nuklearen Bereiche konzentrierter ER- bzw. DR-Proteme mit fokalen Transskriptionsstellen co- lokalisierten . Um die Transskriptions-Aktivitat einer Zelle im Hinblick auf ER- bzw. DR-Proteme als Marker beurteilen zu können, wurde der Emfluss von bekannten Transskπptions- oder Translations-Inhibitoren untersucht.Cytological investigations showed that the characteristic nuclear areas of concentrated ER and DR prototypes co-localized with focal transcription sites. In order to be able to assess the transcriptional activity of a cell with regard to ER or DR proteins as markers, the outflow of known transcription or translation inhibitors was examined.
Zu diesem Zeck wurden C0S7-Zellen, die nach dem im Beispiel 6 beschriebenen Verfahren EGFP-YT521-B als Beispiel für ein Protein, welches ER-reiche Domänen enthalt, transient exprimierte, eingesetzt und einer Behandlung unterschiedlicher Inhibitoren unterworfen. Zu den einzelnenFor this purpose, C0S7 cells, which were transiently expressed according to the method EGFP-YT521-B described in Example 6 as an example of a protein which contains ER-rich domains, were used and subjected to a treatment of different inhibitors. To the individual
Behandlungsmitteln gehorten α-Amanitm (blockiert die Transskription durch dessen direkte Inhibition der RNA- Polymerase II; Bedingungen: 50 μg/ml für 5 h) , 5, 6-Dιchloro- 1-ß-rιbofuranosyl-benzιmιdazol ("DRB", blockiert die Transskription durch Inhibierung einer Kmase m der oberenTreatments included α-amanitm (blocks transcription by directly inhibiting RNA polymerase II; conditions: 50 μg / ml for 5 h), 5, 6-dιchloro- 1-ß-rιbofuranosyl-benzιmιdazol ("DRB", blocks the Transcription by inhibition of a kmase m in the upper one
Signalkette für die RNA-Polymerase II; Bedingungen: 75 μm DRB für 3 h) , Cycloheximid ("Cyclo", blockiert lediglich die RNA- Polymerase I; Bedingungen: 100 μg/ml für 5h) sowie Akmomycm D ("ActD", bindet an GC-reiche doppelstrangige DNA, erlaubt die RNA-Imtiation, blockert jedoch die RNA-Elongation;Signal chain for RNA polymerase II; Conditions: 75 μm DRB for 3 h), cycloheximide ("Cyclo", only blocks RNA polymerase I; conditions: 100 μg / ml for 5 h) and Akmomycm D ("ActD", binds to GC-rich double-stranded DNA, allowed RNA intimation, but blocks RNA elongation;
Bedingungen: (a) 0,04 μg/ml für 3h ("ActD niedrig"), (b) 50 μg/ml für 3h ("ActD hoch"), und (c) wie (b) , jedoch 2 h Inkubation nach Entfernung der hohen ActD-Konzentration ("ActD hoch + befreit"). Die Ergebnisse sind in Fig. 4 graphisch dargestellt, wobei der Prozentsatz an Zellen, bei denen ER- bzw. DR-Domanen lokalisierbar waren, aufgetragen sind m Bezug auf die Behandlung der vorstehend genannten Inhibitoren gegenüber einem unbehandelten Standard. Der Anteil positiver Zellen wurde Fluoreszenz-mikroskopisch bestimmt durch Zahlen einzelnen Zellen in drei unabhängigen Experimenten pro Standard bzw. Inhibitor-Ansatz. Die Daten zeigen die Durchschnittswerte der drei unabhängigen Experimente (+/- Standardabweichung), wobei jeweils 150 Zellen gezahlt wurden. Die Ergebnisse zeigen, dass Actmomycm D die definierten, ER- bzw. DR-Protem-spezifischen Bereiche im Zellkern auflost. Diese Empfindlichkeit gegenüber Akmomycm D ist jedoch reversibel, da eine Befreiung der Zellen von diesem Inhibitor die nuklearen, lokalisierbaren Bereiche wieder ansteigen lasst. Eine niedrige Actmomycm-Konzentration oder eine Cycloheximid-Behandlung zeigte jedoch keine Veränderung in der Zahl der Zellen, m denen nukleare Bereiche von ER- bzw. DR-Protemen lokalisierbar waren. α-Amanitm zeigte lediglich eine geringfügige Verminderung des Anteils an Zellen, die m Bezug auf nukleare, ER- bzw. DR-Protem- spezifische Bereiche positiv warn.Conditions: (a) 0.04 μg / ml for 3 h ("ActD low"), (b) 50 μg / ml for 3 h ("ActD high"), and (c) as (b), but after 2 h of incubation Removal of the high ActD concentration ("ActD high + freed"). The results are shown graphically in FIG. 4, the percentage of cells in which ER or DR domains could be located being plotted in relation to the treatment of the above-mentioned inhibitors against an untreated standard. The proportion of positive cells was determined under the fluorescence microscope by numbers of individual cells in three independent experiments per standard or inhibitor approach. The data show the averages of the three independent experiments (+/- standard deviation), with 150 cells each being paid. The results show that Actmomycm D dissolves the defined, ER- or DR-protein-specific areas in the cell nucleus. This sensitivity to Akmomycm D is reversible, however, since a release of the cells from this inhibitor increases the nuclear, localizable areas again. However, a low Actmomycm concentration or cycloheximide treatment showed no change in the number of cells in which nuclear regions of ER or DR proteins could be localized. α-Amanitm showed only a slight reduction in the proportion of cells which were positive in relation to nuclear, ER or DR protein-specific areas.
Die erfmdungsgemaße Bestimmung der ER- bzw. DR-Protem kann daher auch sehr nützlich zur Bestimmung der Transskriptions- aktivitat einer Zelle eingesetzt werden. The determination of the ER or DR protein according to the invention can therefore also be used very useful for determining the transcription activity of a cell.

Claims

Patentansprüche claims
1. Verfahren zur Diagnose von Krebserkrankungen und/oder neurodegenerativen Krankheitszustanden, dadurch gekennzeichnet, dass Proteine mit Glutammssaure/Argmm- reichen oder Asparagmsaure/Argmm-reichen Domänen (ER- Proteme bzw. DR-Proteme) bestimmt werden.1. A method for the diagnosis of cancer and / or neurodegenerative disease states, characterized in that proteins with domains rich in glutamate / Argmm or aspartic acid / Argmm rich (ER-Proteme or DR-Proteme) are determined.
2. Verfahren gemäß Anspruch 1, dadurch gekennzeichnet, dass die Bestimmung die Untersuchung einschließt, ob oder inwieweit ER- oder DR-Proteme in zellularen, nuklearen Bereichen lokalisierbar sind.2. The method according to claim 1, characterized in that the determination includes the examination of whether or to what extent ER or DR proteins can be localized in cellular, nuclear areas.
3. Verfahren gemäß Anspruch 1 oder 2, dadurch gekennzeichnet, dass die Bestimmung der ER- oder DR-Proteme lmmuncytometπsch erfolgt.3. The method according to claim 1 or 2, characterized in that the determination of the ER or DR proteins is carried out immunocytometric.
4. Verfahren gemäß einem der vorangehenden Ansprüche, dadurch gekennzeichnet, dass die im Verfahren bestimmten ER- oder DR-Proteme solche sind, die beim pre-mRNA-Spleißvorgang und/oder bei der Bildung des transkriptosomalen Komplexes beteiligt sind.4. The method according to any one of the preceding claims, characterized in that the ER or DR proteins determined in the method are those which are involved in the pre-mRNA splicing process and / or in the formation of the transcriptosomal complex.
5. Verfahren gemäß einem der vorangehenden Ansprüche, dadurch gekennzeichnet, dass das im Verfahren bestimmte ER- Protem YT521 oder dessen Spleiß-Variante YT521-B ist.5. The method according to any one of the preceding claims, characterized in that the ER Protem determined in the method is YT521 or its splice variant is YT521-B.
6. Verfahren gemäß einem der vorangehenden Ansprüche, dadurch gekennzeichnet, dass Brustkrebs diagnostiziert wird.6. The method according to any one of the preceding claims, characterized in that breast cancer is diagnosed.
7. Verfahren zur Untersuchung der Transkπptionsaktivitat, des Differenzierungsstadiums oder des Zellzyklusstadiums einer Zelle, dadurch gekennzeichnet, dass Proteine mit7. A method for examining the transcription activity, the differentiation stage or the cell cycle stage of a cell, characterized in that proteins with
Glutammssaure/Argmm-reichen oder Asparagmsaure/Argmm- reichen Domänen (ER-Proteme bzw. DR-Proteme) bestimmt werden.Glutammic acid / Argmm-rich or aspartic acid / Argmm- rich domains (ER-Proteme or DR-Proteme) can be determined.
8. Verfahren gemäß Anspruch 7, wobei die Bestimmung wie in einem der Ansprüche 2 bis 5 angegeben erfolgt.8. The method according to claim 7, wherein the determination is carried out as specified in one of claims 2 to 5.
9. Verfahren zum Testen von therapeutisch wirksamen Substanzen, umfassend die Untersuchung einer Veränderung an Proteinen mit Glutammssaure/Argmm-reichen oder Asparagmsaure/Argmm-reichen Domänen (ER-Proteme bzw. DR- Proteme) infolge einer Einwirkung durch die gegebenenfalls therapeutisch wirksame Substanz.9. A method for testing therapeutically active substances, comprising the examination of a change in proteins with domains rich in glutamate / Argmm or aspartic acid / Argmm rich (ER-Proteme or DR-Proteme) due to an action by the optionally therapeutically active substance.
10. Verfahren gemäß Anspruch 9, dadurch gekennzeichnet, dass therapeutisch wirksamen Substanzen gegen Krebserkrankungen und/oder neurodegenrative Krankheitszustande getestet werden.10. The method according to claim 9, characterized in that therapeutically active substances against cancer and / or neurodegenrative disease states are tested.
11. Verfahren gemäß Anspruch 9 oder 10, dadurch gekennzeichnet, dass untersucht wird, ob oder inwieweit sich die Lokalisation der ER- oder DR-Proteme m zellularen, nuklearen Bereichen ändert.11. The method according to claim 9 or 10, characterized in that it is examined whether or to what extent the localization of the ER or DR proteins changes in the cellular, nuclear areas.
12. Verfahren gemäß einem der Ansprüche 9 bis 11, dadurch gekennzeichnet, dass die im Verfahren untersuchten ER- oder DR-Proteme solche sind, die beim pre-mRNA-Spleißvorgang und/oder bei der Bildung des transkriptosomalen Komplexes beteiligt sind.12. The method according to any one of claims 9 to 11, characterized in that the ER or DR proteins examined in the method are those which are involved in the pre-mRNA splicing process and / or in the formation of the transcriptosomal complex.
13. Verfahren gemäß einem der Ansprüche 9 bis 12, dadurch gekennzeichnet, dass das im Verfahren untersuchte ER-Protem13. The method according to any one of claims 9 to 12, characterized in that the ER protein examined in the method
YT521 oder dessen Spleiß-Variante YT521-B ist.YT521 or its splice variant is YT521-B.
14. Antikörper, welcher spezifisch ist gegen ein Protein mit Glutammssaure/Argmm-reicher oder Asparagmsaure/ Argimn- reicher Domäne (ER-Protem bzw. DR-Protem) . 14. Antibody, which is specific against a protein with glutamic acid / Argmm-rich or aspartic acid / Argimn-rich domain (ER-Protem or DR-Protem).
15. Antikörper gemäß Anspruch 14, dadurch gekennzeichnet, dass das ER- oder DR-Protem em solches ist, welches beim pre-mRNA-Spleißvorgang und/oder bei der Bildung des transkriptosomalen Komplexes beteiligt ist.15. Antibody according to claim 14, characterized in that the ER or DR protein is one which is involved in the pre-mRNA splicing process and / or in the formation of the transcriptosomal complex.
16. Antikörper gemäß Anspruch 14, dadurch gekennzeichnet, dass das ER-Protem YT521 oder dessen Spleiß-Variante YT521-B16. Antibody according to claim 14, characterized in that the ER protein YT521 or its splice variant YT521-B
17. Verwendung eines Antikörpers gemäß einem der Ansprüche 14 bis 16 in einem Verfahren gemäß Anspruch 1, einem Verfahren gemäß Anspruch 7 oder einem Verfahren gemäß Anspruch 9.17. Use of an antibody according to one of claims 14 to 16 in a method according to claim 1, a method according to claim 7 or a method according to claim 9.
18. Saugetierzelle, die durch eine DNA transformiert ist, die für em Protein mit Glutammssaure/Argmm-reicher oder Asparag saure/Argmm-reicher Domäne (ER-Protem bzw. DR- Protem) kodiert.18. Mammalian cell which is transformed by a DNA which codes for a protein with glutamic acid / Argmm-rich or aspartic acid / Argmm-rich domain (ER-Protem or DR-Protem).
19. Saugetierzelle gemäß Anspruch 18, dadurch gekennzeichnet, dass die DNA für em ER- oder DR-Protem kodiert, welches beim pre-mRNA-Spleißvorgang und/oder bei der Bildung des transkriptosomalen Komplexes beteiligt ist.19. Mammalian cell according to claim 18, characterized in that the DNA codes for an ER or DR protein which is involved in the pre-mRNA splicing process and / or in the formation of the transcriptosomal complex.
20. Saugetierzelle gemäß Anspruch 18 oder 19, dadurch gekennzeichnet, dass die DNA für das ER-Protem YT521 oder dessen Spleiß-Variante YT521-B kodiert.20. Mammalian cell according to claim 18 or 19, characterized in that the DNA codes for the ER prototype YT521 or its splice variant YT521-B.
21. Saugetierzelle gemäß einem der Ansprüche 18 bis 20, dadurch gekennzeichnet, dass die DNA zur Transformation m einem zur Transformation geeigneten Vektor msertiert ist.21. Mammalian cell according to one of claims 18 to 20, characterized in that the DNA for transformation is merted in a vector suitable for transformation.
22. Saugetierzelle gemäß Anspruch 21, dadurch gekennzeichnet, dass in den Vektor zusätzlich eine DNA msertiert ist, die für em Detektionsmarkerprotem kodiert. 22. Mammalian cell according to claim 21, characterized in that a DNA is additionally merted in the vector, which codes for em detection marker protein.
23. Saugetierzelle gemäß einem der Ansprüche 18 bis 22, dadurch gekennzeichnet, dass sie menschlichen Ursprungs ist.23. mammalian cell according to any one of claims 18 to 22, characterized in that it is of human origin.
24. Verwendung einer Saugetierzelle gemäß einem der Ansprüche 18 bis 23 einem Verfahren zum Testen von therapeutisch wirksamen Substanzen.24. Use of a mammalian cell according to one of claims 18 to 23, a method for testing therapeutically active substances.
25. Verwendung gemäß Anspruch 24, dadurch gekennzeichnet, dass die getesteten Substanzen gegen Krebserkrankungen und/oder neurodegenrative Krankheitszustande wirksam sein sollen . 25. Use according to claim 24, characterized in that the tested substances are said to be effective against cancer and / or neurodegenrative disease states.
EP01927852A 2000-04-03 2001-04-02 Method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions and products therefor Withdrawn EP1198711A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE2000116527 DE10016527A1 (en) 2000-04-03 2000-04-03 Methods for the diagnosis of cancer and / or neurodegenerative disease states and products therefor
DE10016527 2000-04-03
PCT/EP2001/003737 WO2001075441A1 (en) 2000-04-03 2001-04-02 Method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions and products therefor

Publications (1)

Publication Number Publication Date
EP1198711A1 true EP1198711A1 (en) 2002-04-24

Family

ID=7637432

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01927852A Withdrawn EP1198711A1 (en) 2000-04-03 2001-04-02 Method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions and products therefor

Country Status (4)

Country Link
EP (1) EP1198711A1 (en)
AU (1) AU5476601A (en)
DE (1) DE10016527A1 (en)
WO (1) WO2001075441A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109310659B (en) * 2016-06-23 2021-04-16 国立研究开发法人科学技术振兴机构 Application of arginine or physiologically acceptable salt thereof in preparing pharmaceutical composition for treating or preventing PolyQ disease

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0175441A1 *

Also Published As

Publication number Publication date
AU5476601A (en) 2001-10-15
DE10016527A1 (en) 2001-10-18
WO2001075441A1 (en) 2001-10-11

Similar Documents

Publication Publication Date Title
DE69907156T2 (en) CANCER TREATMENT
Sealock et al. Localization of dystrophin relative to acetylcholine receptor domains in electric tissue and adult and cultured skeletal muscle.
Shapira et al. Unitary assembly of presynaptic active zones from Piccolo-Bassoon transport vesicles
Zhai et al. Assembling the presynaptic active zone: a characterization of an active zone precursor vesicle
DE69333969T2 (en) Interactive trap system for the isolation of proteins
DE69920885T2 (en) C-MYC-BINDING PROTEIN "C-MYC CODING REGION DETERMINANT BINDING PROTEIN (CRD-BP)"
DE60026733T2 (en) HISTONE DEACETYLASE-8 PROTEINS, NUCLEIC ACIDS AND METHODS OF USE
Peng et al. Association of cortactin with developing neuromuscular specializations
DE60033183T2 (en) TRANSPLANT DELIVERY AND ASSOCIATED STATES
EP1198711A1 (en) Method for diagnosing cancerous diseases and/or neuro-degenerative pathological conditions and products therefor
WO2007012449A1 (en) Frizzled 9 as tumour marker
DE69530261T3 (en) Cell density-stimulated protein tyrosine phosphatases
DE3924924A1 (en) METHOD FOR DETECTING AND / OR QUANTITATIVELY DETERMINING COMPLEMENT PEPTIDE C5A AND / OR C5ADESARG
WO2000017232A2 (en) Regulatory protein from human keratinocytes
Peng et al. Induction of dystrophin localization in cultured Xenopus muscle cells by latex beads
DE60113660T2 (en) G-PROTEIN COUPLED RECIPE
DE602004013320T2 (en) METHOD FOR DEMONSTRATING A MOLECULAR EVENT IN A CELL BY FLUORESCENCE MARKER PROTEINS
DE60120220T2 (en) SCREENING PROCEDURE BASED ON THE SIAH-NUMB INTERACTION
DE19856301C1 (en) Regulatory protein pKe83 from human epidermal keratinocytes and related nucleic acid, vectors and antibodies
DE60216105T2 (en) METHOD OF IDENTIFYING SUBSTANCES MODULATING THE INTERLEUKIN 4 (IL-4) SIGNAL CHAIN
EP1004668B1 (en) Regulatory protein pKe 83 derived from human keratinocytes
EP1072681B9 (en) Human-keratinocytes regulator protein pKe#165
EP3099714B1 (en) Hybridoma cell lines (my-c-cc0c2-259-1 a4) and use thereof for producing a monoclonal antibody against human cardiac myosin binding protein c (c-protein, mybpc3, cmybp-c or my-c)
WO2013170855A1 (en) Method for the specific and quantitative detection of antibodies in a sample
EP0736543A2 (en) Method for the production of monoclonal antibodies to proliferation-associated antigens of the cell nucleus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020121

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031103