EP1198572A2

EP1198572A2 - Method for generating cgmmv resistant plants, genetic constructs, and obtained cgmmv-resistant plants

Info

Publication number: EP1198572A2
Application number: EP00950079A
Authority: EP
Inventors: Bernarda Gerharda Johanna Fierens-Onstenk; Michiel Theodoor Jan De Both
Original assignee: Keygene NV
Current assignee: Keygene NV
Priority date: 1999-08-02
Filing date: 2000-07-27
Publication date: 2002-04-24
Also published as: IL147920A0; AU6322900A; WO2001009300A3; WO2001009300A2

Abstract

The present invention relates to a method for generating resistance against Cucumber Green Mottle Mosaic Virus (CGMMV) in plants, in particular in plants susceptible to infection by CGMMV, such as Cucurbitaceae species, including melon, cucumber, watermelon and bottlegourd. In the invention, the plants are provided with replicase-mediated resistance against CGMMV. For this purpose, the plants are transformed with a polynucleotide sequence that: i) has been derived from the 129 kD sequence, the 57 kD sequence, or the 186 kD readthrough sequence of native CGMMV; ii) upon (at least) transformation into the plant and transcription into RNA - and usually also translation into the corresponding encoded protein - can provide the plant with resistance against CGMMV; but iii) does not encode any replicase activity. In particular, this will be a nucleotide sequence that encodes a defective variant of the replicase of CGMMV. The invention further relates to genetic constructs containing such a polynucleotide sequence suitable for use in the above method, and to CGMMV-resistant transgenic plants obtained via said method.

Description

Method for generating resistance against CGMMV in plants, genetic constructs for use in said method, and CGMMV-resistant plants obtained via said method.

The present invention relates to a method for generating resistance against Cucumber Green Mottle Mosaic Virus (CGMMV) in plants, in particular in plants that are susceptible to infection by CGMMV, such as species of the Cucurbitaceae family.

The invention further relates to genetic constructs suitable for use in said method, and to CGMMV-resistant transgenic plants obtained via said method.

Methods of introducing DNA sequences into the genome of plants have been known for many years and have been widely used to alter the properties of plants varieties. Such methods are among others Agrobacterium-mediated transformation (Horsch et αl. 1985; Rogers et αl, 1986). protoplast transformation using electroporation or other techniques to introduce naked DNA molecules into the plant cell (Shillito et αl 1985), and particle bombardment to introduce naked DNA molecules into plant cells or tissues (Christou et αl, 1994).

Among the most important applications of plant genetic engineering are those aimed at introducing resistance genes to a wide variety of plant pests and plant pathogens, such as bacteria, fungi, nematodes, insects and viruses. Many examples of virus resistance in a wide variety of plant species have been described over the last decades (Wilson et αl. 1993). The various methods to obtain virus resistance in plants through the introduction of gene sequences are either based on the use of genes of plant origin; on the use of sequences/genes derived from the viral pathogen itself (so-called pathogen-derived resistance (Wilson et αl., 1993 ), or on the use of genes of yet different origin. Sequences originating from the viral genome can be either cloned or PCR-amplified DNA sequences obtained from the genome of DNA viruses, such as geminiviruses (Kunik et αl, 1994) or the cDNA sequences obtained from the genomes of RNA viruses through the use of cDNA cloning or RT-PCR amplification.

Examples of sequences/genes of RNA viruses that have been succesfully used in the engineering of virus resistance in plants include: 1. coat protein genes of tobamoviruses, cucumoviruses, potyviruses, potexviruses

(Beachy et α/., 1990); 2. RNA-dependent RNA polymerase genes (replicase genes) of tobamoviruses, cucumoviruses, potyviruses (Anderson et αl, 1992; Donson et αl., 1993; Audy et αl, 1994); 3. nucleoprotein genes of tospoviruses (Goldbach and De Haan. 1993; Prins et al, 1994; Vaira et α/., 1995);

4. movement protein genes of tobamoviruses and cucumoviruses (Cooper et al, 1995). Cucumber Green Mottle Mosaic Virus (CGMMV) is a member of the tobamovirus group and infects plant species of the Cucurbitaceae family: melon (Cucumis melo), cucumber (Csativus), watermelon (Citrullus vulgaris) and bottlegourd (lagenaria siceraria), but not apparently Cucurbita pepo (squash, pumpkin, courgette). The host range of the virus is basically restricted to members of the Cucurbitaceae, with the exception that some but not all strains also infect tobacco and/or the diagnostic species Datura stramonium and Chenopodium amaranticolor (Hollings et al, 1975).

Several different strains can be distinguished serologically and by their response in C. amaranticolor and D. stramonium (Hollings et al, 1975) The ""type strain^"' was originally identified in Europe and does not normally cause fruit symptoms in cucumber. Another European strain, called the cucumber aucuba mosaic strain, cucumber virus 4 or Cucumis virus 2A causes fruit symptoms in cucumber. A number of strains are known from Japan. In watermelon, the watermelon strain causes serious disease, whereas the Japanese cucumber strain (also called Kyuri Green Mottle Mosaic Virus) and the Yodo strain cause fruit distortions in cucumber. The CGMMV-C strain from India is a pathogen on bottlegourd and serious infections can cause complete crop losses.

In cucumber, CGMMV causes vein clearing, a light and dark green leaf mottle, leaf blistering and malformation and stunted growth, seriously affecting fruit yield. The East European isolates of the aucuba mosaic strain produces bright yellow leaf mottling and fruit discolouration. CGMMV is transmitted through seed, but mostly through mechanical infection via the roots in contaminated soil, and through foliage contact and handling of plants (Hollings et al, 1975). The virus particles are extremely stable and survive several months at normal temperatures. This stability combined with the very high infectivity through mechanical contact of the foliage is responsible for the economic importance of this virus, as even one or a few infected plants in a cucumber greenhouse can eventually cause the infection and loss of the total crop. Also, infection may not only spread rapidly over a current crop, but also - due to the strong persistance of the virus - affect subsequent crops. Therefore, a CGMMV infection may require sterilisation of an entire greenhouse, as well as the use of sterile tools and materials. The complete sequence of only one isolate of CGMMV has been determined (Ugaki et al, 1991 ; Genbank accession numbers D12505 and D01188). This isolate "SH" had been found in infected watermelon plants in East Asia. Furthermore, the sequence of the coat protein gene of one other isolate ("W") obtained from infected watermelon is known (Meshi et al. 1983: Genbank accession numbers V01551 and J02054), as well as the sequence of the 29 kD movement protein gene of a watermelon strain (Saito et al, 1988; Genbank accession number J04332). The nucleotide sequence of the CGMMV-SH isolate shows 55 to 56% identity with tobacco mosaic virus (TMV) and tobacco mild green mosaic virus (TMGMV), both other members of the tobamovirus group (Ugaki et al, 1991). As described by Ukagi et al. , the genome of CGMMV consists of a single-stranded

RNA molecule coding for at least four open reading frames, encoding putative proteins of 186 kD, 129 kD. 29 kD and 17.3 kD, of which the 17.3 kD ORF is known to encode the coat protein. In this respect. Ugaki et al state: "No CGMMV-encoded proteins except for the coat protein have yet been identified in vivo". The CGMMV genome is schematically shown in Figure 1. As can be seen therein, the

ORF encoding the 186 kD protein starts at the same site as the ORF encoding the 129 kD protein, and adds a putative 57 kD polypeptide to the 129 kD ORF. The presence of this 57 kD protein alone has not been detected in infected plants. Instead, the 186 kD protein has been found, being the product of a read-through translation of the 129 kD and the 57 kD ORFs.

This 186 kD protein is thought to play a role in virus replication. Also, the 129 kD ORF is thought to encode a replicase function, whereas the 29 kD ORF is thought to encode a movement protein.

Hereinbelow. the nucleotide sequence corresponding to the ORF encoding the 129 kD protein will be referred to as "129 kD sequence", the sequence corresponding to the 186 kD readthrough protein will be referred to as "186 kD sequence", and the nucleotide sequence corresponding to the ORF encoding the 57 kD readthrough part will be referred to as "57 kD sequence". These nucleotide sequences and the corresponding protein sequences are given in the sequence listings, as further described below. Object of the invention was to provide a method for protecting plants, in particular plants susceptible to infection with CGMMV such as species of the Cucurbitaceae family, against infection with CGMMV, and in particular against infection with strains of CGMMV prevalent in Europe, such as the strains encountered in the cultivation of cucumbers in greenhouses. Further objects were to provide means for use in said method, in particular a genetic construct that can be used for transforming plants or plant material so as to provide transgenic plants resistant against infection with CGMMV. Further objects of the invention will become clear from the description given hereinbelow.

For these purposes, applicant has investigated the symptomatology and the nucleotide sequence of the coat protein genes of 10 European strains of CGMMV, and compared these with the SH strain described by Ugaki et al. A list of these strains, with their geographical origin and symptoms on cucumber, is given in Table 1.

Table 1. List of collected CGMMV-isolates with their geographical origin and symptoms on cucumber.

It was found that the sequences for the 10 European isolates are highly homologous ( i.e. homology on the nucleotide level of 97%), and show about 90 % homology (on the nucleotide level) with the SH-isolate. The nucleotide sequences encoding the coat proteins of each of the isolates 1-10, as well as strain SH, are given in the sequence listings, as further described below. The corresponding phytogenetic tree is shown in Figure 2. This shows that the European isolates can be considered to constitute a subgroup of the CGMMV species.

In the sequence listings: SEQ ID no.l gives the nucleotide sequence encoding the 129 kD replicase protein of

CGMMV isolate 4, with the ORF of the coat protein starting with the ATG codon at bp

523-525;

SEQ ID no.2 gives the amino acid sequence of the 129 kD replicase protein of CGMMV isolate 4, with the ORF of the coat protein starting with the ATG codon at bp 523-525;

SEQ ID no.3 gives the nucleotide sequence encoding the 57 kD protein of CGMMV isolate 4, with the ORF of the coat protein starting with the ATG codon at bp 523-525;

SEQ ID no.4 gives the amino acid sequence of the 57 kD replicase protein of CGMMV isolate 4, with the ORF of the coat protein starting with the ATG codon at bp 523-525; - SEQ ID no.5 gives the nucleotide sequence encoding the 186 kD readthrough protein of

523-525;

SEQ ID no.6 gives the amino acid sequence of the 186 kD readthrough protein of

CGMMV isolate 4. with the ORF of the coat protein starting with the ATG codon at bp 523-525;

SEQ ID no.7 gives the nucleotide sequence encoding the coat protein of CGMMV isolate

1, with the ORF of the coat protein starting with the ATG codon at bp 523-525;

SEQ ID no.8 gives the nucleotide sequence encoding the coat protein of CGMMV isolate

2, with the ORF of the coat protein starting with the ATG codon at bp 523-525; - SEQ ID no.9 gives the nucleotide sequence encoding the coat protein of CGMMV isolate

3, with the ORF of the coat protein starting with the ATG codon at bp 523-525; SEQ ID no.10 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 4, with the ORF of the coat protein starting with the ATG codon at bp 523-525; SEQ ID no.11 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 5, with the ORF of the coat protein starting with the ATG codon at bp 523-525;

SEQ ID no.12 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 6. with the ORF of the coat protein starting with the ATG codon at bp 523-525; SEQ ID no.13 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 7, with the ORF of the coat protein starting with the ATG codon at bp 523-525; - SEQ ID no.14 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 8. with the ORF of the coat protein starting with the ATG codon at bp 523-525; SEQ ID no.15 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 9, with the ORF of the coat protein starting with the ATG codon at bp 523-525; SEQ ID no.16 gives the nucleotide sequence encoding the coat protein of CGMMV isolate 10, with the ORF of the coat protein starting with the ATG codon at bp 523-525; SEQ ID no.17 gives the nucleotide sequence encoding the 129 kD replicase protein of CGMMV isolate SH; - SEQ ID no.18 gives the amino acid sequence of the 129 kD replicase protein of CGMMV isolate SH;

SEQ ID no.19 gives the nucleotide sequence encoding the 57 kD protein of CGMMV isolate SH;

SEQ ID no.20 gives the amino acid sequence of the 57 kD replicase protein of CGMMV isolate SH;

SEQ ID no.21 gives the nucleotide sequence encoding the 186 kD readthrough protein of CGMMV isolate SH;

SEQ ID no.22 gives the amino acid sequence of the 186 kD readthrough protein of CGMMV isolate SH; - SEQ ID no.23 gives the nucleotide sequence encoding the coat protein of CGMMV isolate SH;

SEQ ID's nos. 24-40 give the nucleotide sequences of the primers used in the Examples; SEQ ID's nos. 41-44 give the nucleotide sequences used in assembling the leader sequences used in the constructs described in the Examples; In the above sequence listings, the nucleotide sequences given are DNA sequences, as the genetic constructs of the invention described below will usually contain or consist of a DNA. As CGMMV is an RNA virus, it will be clear to the skilled person that these sequences will occur in the virus as the corresponding RNA sequence (i.e. with U replacing T). Also, it will be clear to the skilled person that the nucleotide sequences given above may be followed - both in the virus as well as in a construct of the invention - with a suitable termination codon, i.e. TAA UAA, TAG/UAG or TGA/UGA (not shown).

Furthermore, as will be clear to the skilled person, the nucleotide sequence encoding the coat protein will usually start with an ATG codon. For example, in SEQ ID NOs 1 - 16, the nucleotide sequence encoding the coat protein starts at the ATG codon at base positions 523-525. (In the nucleotide sequence of SEQ ID NOs 1 - 16, the nucleotide sequence encoding the coat protein is preceded by another nucleotide sequence, e.g. encoding a movement protein. Accordingly, when hereinbelow reference is made to any nucleotide sequence of SEQ ID NOs 1 - 1 6, this also explicitly includes the nucleotide sequence starting at the ATG codon at base positions 523-525 of these SEQ ID's). A particular purpose of the invention is therefore to provide a method that can provide plants with resistance against all these strains simultaneously, and more in particular a type of resistance that is agronomically useful, i.e. that can be used to protect (crops of) plants that are cultivated under circumstances wherein the high infectivity and persistance of CGMMV can be a major problem, such as the cultivation of cucumbers in greenhouses.

In the invention, this problem is generally solved by transforming a plant with a polynucleotide sequence (e.g. as part of a genetic construct) that can provide the plant with so-called "replicase-mediated^"' resistance against CGMMV. In particular, this wil be a polynucleotide sequence that i) has been derived from the 129 kD sequence, the 57 kD sequence, or the 186 kD readthrough sequence of native CGMMV; ii) upon (at least) transformation into the plant and transcription into RNA - and usually also translation into the corresponding encoded protein - can provide the plant with resistance against CGMMV; but iii) does not encode any replicase activity.

In particular, such a polynucleotide sequence can encode a polypeptide or protein that is capable of providing a plant with resistance against GCMMV, but that by itself has no replicase activity, for instance due to one or more alterations in its amino acid sequence, compared to the amino acid sequence encoded by the 129 kD sequence, 57 kD sequence, and/or 186 kD readthrough sequence of native CGMMV.

However, according to one specific embodiment of the invention, the polynucleotide sequence may also comprise, or even consist of, the native 57 kD sequence.

In a first aspect, the invention therefore relates to a method for generating resistance in a plant against CGMMV, said method comprising at least the step of transforming said plant with a polynucleotide encoding a defective variant of the replicase gene of CGMMV.

In a further aspect, the invention also relates to a method for providing a transgenic plant and/or plant cell that is resistant against infection with CGMMV, comprising at least the step of transforming said plant or plant cell with a polynucleotide sequence encoding a defective variant of the replicase gene of CGMMV. In another aspect, the invention also relates to a genetic construct suitable for transforming a plant, said construct at least comprising a polynucleotide sequence encoding a defective variant of the replicase gene of CGMMV, and optionally further elements of genetic constructs known per se. The invention also relates to a plant, plant cell and/or plant material that has been transformed with a genetic construct of the invention. The invention also relates to transgenic plants that contain a polynucleotide sequence encoding a defective variant of the replicase gene of CGMMV, and/or that have been provided with resistance against infection with CGMMV by the method of the invention.

In the context of the invention, by the "replicase gene of CGMMV" is meant the native 129 kD sequence, the native 57 kD sequence, and/or the combined native 186 kD "readthrough" product of the native 129 kD and native 57 kD sequences.

By a "native" sequence is meant any RNA sequence that naturally occurs in CGMMV, including all isolates and strains thereof, as well as any DNA sequence that corresponds to these naturally occuring RNA sequences. Examples of such native sequences are the 129 kD nucleotide sequences given in SEQ. ID no.l and SEQ. ID no.17, the 57 kD nucleotide sequences given in SEQ. ID no.3 and SEQ. ID no.19 and the 186 kD nucleotide sequences given in SEQ. ID no.5 and SEQ. ID no.21. It will be clear to the skilled person that there may be (further) naturally occuring variants of the RNA sequence from which the DNA sequences in the sequence listings were derived, and these (and the DNA sequences corresponding thereto) are also included within the term "native sequence".

By " 'α polynucleotide sequence encoding a defective variant of the replicase gene of CGMMV' in its broadest sense is meant a polynucleotide sequence that i) upon (at least) transformation into a plant and transcription into RNA generates resistance against infection with CGMMV in said plant: and ii) upon (at least) transformation into a plant and transcription into RNA does not lead to generation of (any) replicase activity in said plant (or at least -when it does lead to expression of some replicase activity - leads to expression of a replicase activity that is severely reduced compared to expression of the native gene encoding CGMMV replicase). Herein, the terms "plant", "transformed plant" and/or "transgenic plant" include all parts or tissues of such a plant, including but not limited to individual cells of such a plant. These terms also includes material of or for such a plant, such as material that can be regenerated into a (mature) plant, including but not limited to protoplasts and/or callus tissue, or material that can be cultivated into a mature plant, such as cultivation material. The plant is preferably a plant that is susceptible to infection with CGMMV, more preferably a plant belonging to the Cucurbitaceae family, such as melon (Cucumis melo), cucumber (Csativus), watermelon (Citrullus vulgaris) and bottlegourd (Lagenaria siceraria).

Included within the term "CGMMV" are all known strains thereof, including those prevalent in Europe and Asia. In particular, the method of the invention can be used to protect plants against strains of GCMMV prevalent in Europe (including Israel), such as those which are a problem in the cultivation of melons and in particular cucumbers in greenhouses, although the invention is not limited thereto.

In doing so, a major advantage of the invention is that it can provide protection against several, and preferably all, (such) strains of CGMMV simultaneously. Another advantage of the invention is that it provides "absolute" protection against CGMMV, which means that - upon expression of a polynucleotide sequence encoding a defective replicase in a plant - essentially no viral particles can be detected in the transformed plant (material). The method of the invention therefore does not lead to a deferral or slowing down of the onset of symptoms, as may occur when so-called "coat protein-mediated" resistance is used. Also, the method of the invention leads to a high level of resistance, and may also have the advantage of a favorable temperature effect.

Usually, the "nucleotide sequence encoding a defective variant of the replicase gene of CGMM\ " will be a nucleotide sequence in which - compared to a nucleotide sequence encoding the corresponding native replicase of CGMMV - one or more nucleotides have been added, replaced and/or removed. In particular, the "nucleotide sequence encoding a defective variant of the replicase gene of CGMMV may be a nucleotide sequence that comprises, and preferably consists of:

- a nucleotide sequence corresponding to the native 129 kD sequence in which - compared to said native sequence - one or more nucleotides have been added, replaced and/or removed;

- a nucleotide sequence corresponding to the native 186 kD sequence in which - compared to said native sequence - one or more nucleotides have been added, replaced and/or removed, e.g. in the part of the native 186 kD sequence corresponding to the 129 kD sequence, to the 57 kD sequence, or both;

- a nucleotide sequence corresponding to the native 57 kD sequence;

- a nucleotide sequence corresponding to the native 57 kD sequence in which - compared to said native nucleotide - one or more nucleotides have been added, replaced and/or removed; such that said nucleotide sequence is capable - upon (at least) transformation into a plant and transcription into RNA - to confer to said plant resistance against infection with CGMMV, and such that said nucleotide sequence - upon (at least) transformation into a plant and transcription into RNA - is not capable of generating of (any) replicase activity in said plant. Usually, the "nucleotide sequence encoding the defective variant of the replicase gene of CGMMV' will encode a protein or polypeptide, more specifically a protein or polypeptide that:

1 ) upon being expressed in a plant is capable of generating resistance against CGMMV in said plant; and

2) upon being expressed in a plant has no replicase activity (or -when it has some replicase activity- has severly reduced replicase activity compared to the native CGMMV replicase).

Such a protein or polypeptide will be generally referred to hereinbelow as "defective replicase"; and a polynucleotide sequence encoding such a protein or polypeptide will be referred to as a "polynucleotide sequence encoding a defective replicase".

Usually, the defective replicase will be a derivative - such as an analog, homolog, variant, mutant, part, fragment or combination of two or more such parts or fragments, etc.- of the amino acid sequence encoded by the native 129 kD sequence, the native 186 kD sequence and/or the native 57 kD sequence, in which -compared to the amino acid sequence encoded by the corresponding native sequence- one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed, leading to loss of replicase activity (or at least an inability to generate replicase activity when expressed in the plant). In particular, the defective replicase may be a protein or polypeptide that comprises, and preferably consists of:

- an amino acid sequence corresponding to the amino acid sequence encoded by the native 129 kD sequence, in which - compared to said native sequence - one or more amino acids have been added, replaced or removed, preferably replaced or removed. more preferably removed;

- an amino acid sequence corresponding to the amino acid sequence encoded by the native 186 kD sequence, in which - compared to said native sequence - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed, leading to loss of replicase activity; - an amino acid sequence corresponding to the amino acid sequence encoded by the native 57 kD sequence;

- an amino acid sequence corresponding to the amino acid sequence encoded by the native 57 kD sequence, in which - compared to said native sequence - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed; or any combination thereof, provided that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant.

More in particular, the defective replicase may be a protein or polypeptide that comprises, and preferably consists of:

- an amino acid sequence corresponding to a part or fragment of the amino acid sequence encoded by the native 129 kD sequence, or to a combination of two or more such parts or fragments;

- an amino acid sequence corresponding to a part or fragment of the amino acid sequence encoded by the native 186 kD sequence, or to a combination of two or more such parts or fragments; or

- an amino acid sequence corresponding to the amino acid sequence encoded by the native 57 kD sequence. such that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant.

An amino acid sequence "corresponding to apart or fragment of the amino acid sequence encoded by the native 186 kD sequence, or to a combination of two or more such parts or fragments" may for instance comprise: i) at least one part or fragment of the amino acid sequence encoded by the native 129 kD sequence combined with at least one part or fragment of the amino acid sequence encoded by the native 57 kD sequence (which combination of parts or fragments may or may not correspond to a contiguous amino acid sequence encoded by the native 186 kD sequence); ii) at least one part or fragment of the amino acid sequence encoded by the native 129 kD sequence combined with the full amino acid sequence encoded by the native 57 kD sequence, and/or iii) at least one part or fragment of the amino acid sequence encoded by the full native 129 kD sequence combined with at least one part or fragment of the amino acid sequence encoded by the native 57 kD sequence. It is known, however, that expression in a plant of a nucleotide sequence encoding the full 129 kD sequence of the native replicase usually does not provide resistance against infection with CGMMV, but may even - upon infection of the plant - promote or facilitate multiplication of the virus. Therefore, in one embodiment, the invention does not comprise the expression in a plant of said replicase. nor the use of a polynucleotide sequence encoding such a replicase. Even more preferably, the defective replicase is a protein or polypeptide that consists of:

- an amino acid sequence corresponding to a part or fragment of the amino acid sequence encoded by the native 129 kD sequence, or a combination of two or more such parts or fragments; such that the resulting protein or polypeptide shows no replicase activity, but is still capable, upon expression in a plant, to generate resistance against CGMMV in said plant; or

- an amino acid sequence corresponding to the amino acid sequence encoded by the native 57 kD sequence. Any such parts or fragments may also contain one or more further amino acid substitutions, insertions or deletions compared to the native sequence, but this is not preferred.

Most preferably, the defective replicase is a so-called "truncated replicase", i.e. an amino acid sequence corresponding to the amino acid sequence encoded either by the 129 kD sequence and/or by the 186 kD sequence, from which - compared to the native amino acid sequence - one or more amino acid residues are lacking at the carboxyl-terminus, such that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant. (In case of a truncated replicase based upon the 186 kD sequence, this usually means that the resulting protein will contain the full amino acid sequence of the 129 kD sequence, as well as part of the amino acid sequence of the 57 kD sequence (i.e. that is contiguous to the 129 kD sequence in the amino acid sequence encoded by native 186 kD sequence), with one or more amino acids lacking at the carboxy-terminus of the 57 kD part, although the invention in its broadest sense is not limited thereto).

The polynucleotide sequence that encodes such a truncated replicase may either comprise, or preferably consist of. the full native 129 kD sequence or 186 kD sequence, respectively, in which a stopcodon has been introduced at a desired site, or a polynucleotide sequence from which - compared to the full native 129 kD sequence or 186 kD sequence, respectively - one or more codons coding for the carboxy-terminal amino acid residues have been removed, i.e. starting from the 3'end of the native sequence(s). As mentioned below, preferably a stopcodon is introduced in to the native sequence, in particular in the so-called GDD motiv or in the P-loop. Examples thereof are the polynucleotide sequences comprised in the vectors shown in Figures 3-8, and as described in the Experimental Part. Again, any such truncated replicase may also contain one or more amino acid substitutions, insertions or deletions compared to the native sequence, but this is not preferred. As mentioned above, (the polynucleotide sequence encoding) the defective replicase is such that - after expression in a plant or plant cell - it is still capable of generating resistance against CGMMV in said plant. Usually, this means that the defective replicase will have at least one biological function that allows the defective replicase to protect the plant against CGMMV infection, such as for example down-regulation of viral replication or interference with the replication of the wild-type CGMMV, for instance by competing with wild-type virus for the replication machinery in the plant (cell). It will be clear that in order to achieve such a biological function, the defective replicase must usually have a certain minimal level of amino acid similarity with the amino acid sequences encoded by the native 129 kD, 186 kD and/or 57 kD sequences. In so far as the defective replicase is similar to the corresponding native amino acid sequence, this may be because it contains - on the corresponding amino acid positions - the same amino acid residues as the native amino acid sequence, or amino acid residues comparable thereto. The latter will usually comprise so-called "conservative" amino acid substitutions, for instance involving replacing a given acidic or basic amino acid residue by another acidic or basic amino acid residu.

However, there will also be differences in amino acid sequence between the defective replicase and the native replicase (i.e. the 129 kD, 186 kD or 57 kD protein), such that the defective replicase will no longer provide replicase activity. The skilled person will be able to select appropriate alterations to the amino acid sequence of the native replicase. As will be clear to the skilled person, a single (amino acid or nucleotide) alteration may be sufficient, or two or more such alterations may be required, dependant upon the position and nature of the alteration(s) compared to the amino acid sequence of the native replicase. Whether a given polynucleotide sequence encodes a defective replicase according to the invention - or at least is capable of protecting a plant against infection with CGMMV - can simply be tested by transforming a plant, plant cell or plant material with a construct containing said polynucleotide sequence, and then exposing the plant, plant cell, plant material, and/or a mature plant generated therefrom, to CGMMV under conditions such that infection may occur. It can then be easily determined whether the polynucleotide sequence/construct is capable of protecting the plant, i.e. by suitably determining the presence of the virus, or simply by the presence or absence of symptoms of CGMMV-infection. In general, as a minimum, when the defective replicase contains any amino acid substitutions or insertions, it will have an amino acid homology (i.e. identity on corresponding position) with the corresponding native replicase protein of at least 80%, preferably at least 90%). more preferably at least 95%o, with amino acid deletions not being taken into account, and a single amino acid insertion being counted as a single alteration.

In general, as a minimum, when the defective replicase contains one or more amino acid deletions, it will usually contain at least 30%>, preferably at least 50%>, more preferably at least 70%), and usually 80-90%>, and may even contain as much as 95-99%), of the amino acid sequence of the corresponding native replicase protein, with any amino acid insertions or substitutions not being taken into account.

A truncated replicase based upon the 129 kD sequence will usually contain at least 50%o. preferably at least 70%>, and may contain as much as 80-95%). of the amino acid sequence of the native replicase. A truncated replicase based upon the 186 kD sequence may contain the full 129 kD protein followed by one or more amino acids from the 57 kD sequence, and usually contains the full 129 kD sequence followed by 1-95%, preferably 5- 50%). of the 57 kD sequence. The differences in amino acid sequence mentioned above can be differences compared to any of the amino acid sequences given in SEQ ID's 2, 4, 6 and/or 18, 20, 22, and/or compared to any naturally occuring variant of these amino acid sequences. These differences are at least such that the resulting protein does not correspond to a naturally occuring/native protein (including those given in SEQ ID's 2, 4, 6 and/or 18, 20, 22). The polynucleotide sequences used in the invention are such that they encode the above defective replicases. For this purpose, they may contain the same codons as in the corresponding positions on the native 129 kD, 186 kD and/or 57 kD sequence, or codons equivalent thereto due to the degeneracy of the genetic code.

The polynucleotide sequence encoding the defective replicase can be provided in a manner known per se, for instance starting from the known sequence of the native 129 kD, 57 kD and/or 186 kD sequences, and/or from a nucleic acid that encodes said sequences. Usually, this will involve introducing one or more deletions, substitutions and/or insertions of one or more nucleotides, or even of one or more codons into, or compared to, the native sequence. Such deletions, substitutions and/or insertions will be collectively referred to hereinbelow as "alterations".

Accordingly, the polynucleotide sequence encoding the defective replicase may be a sequence that contains one or more such alterations compared to any of the nucleotide sequences given in SEQ ID's 1, 3, 5 and/or 17, 19, 21, and/or compared to any naturally occuring variant of these nucleotide sequences (including DNA sequences corresponding to the RNA sequences as present in the virus). These differences are at least such that the protein encoded by the polynucleotide sequence does not correspond to a naturally occuring/native protein (including those given in SEQ ID's 2, 4, 6 and/or 16, 18, 22).

Furthermore, besides the alterations mentioned above, and compared to nucleotide sequences given in SEQ ID's 1, 3, 5 and/or 17, 19, 21 and/or compared to any naturally occuring variant of these nucleic acid sequences (including DNA sequences corresponding to the RNA sequences as present in the virus), the polynucleotide sequences may further contain one or more alterations that lead to a codon that encodes the same amino acid as the codon given for the corresponding position in SEQ ID's 1, 3, 5 and/or 17, 19, 21, and this may even lead to a fully or totally artificial and/or synthetic sequence. Also, compared to nucleotide sequences given in SEQ ID's 1, 3. 5 and/or 17, 19, 21 and/or compared to any naturally occuring variant of these nucleic acid sequences (including DNA sequences corresponding to the RNA sequences as present in the virus), the polynucleotide sequences may further contain one or more alterations that lead to a conservative amino acid substitution, i.e. as mentioned above.

Providing a polynucleotide sequence that contains the desired alterations will be within the skill of the artisan and can involve techniques such as nucleic acid synthesis using an automated nucleic acid synthesis technique; introduction of (point)mutations into a nucleic acid that comprises the native 129 kD, 57 kD, and/or 186 kD sequences; and/or using or suitably combining parts or fragments of the 129 kD, 57 kD and/or 186 kD sequences, or any combination thereof. Also, in providing such a polynucleotide sequence, the skilled person may take into account the degeneracy of the genetic code and/or conservative amino acid substitutions, as mentioned above.

In order to provide a polynucleotide sequence that encodes a truncated replicase as defined above, a technique involving the introduction of a stopcodon into the native sequence is particularly preferred.

A particularly preferred technique of introducing the above alterations - including stopcodons - involves the use of a PCR reaction, in which the desired alterations are introduced into the amplified sequence(s) by the use of modified primers, i.e. primers that contain a suitable "mismatch" compared to the template sequence, leading to the desired alteration in the amplified sequence. This PCR-based technique may also be used to introduce one or more restriction sites into the amplified sequence in order to facilitate the cloning of the amplification products into the desired transformation vectors. As further described in the Experimental Part, this may involve a single PCR-reaction, but may also involve two or more PCR reactions, each leading to a part of intended final sequence encoding the defective replicase in which the primers (e.g. with the desired alteration) form the ends of the fragments. These fragments may then be combined, for instance to provide a polynucleotide sequence that comprises a combination of such fragments, and/or to reconstitute the full 129 kD. 57 kD and/or 186 kD sequence, now containing the desired alteration compared to the native sequence, such as a stopcodon.

The PCR-reactions and the further steps following amplification, such as combining/joining the amplified sequences, can be carried out in a manner known per se, for instance as described in the Experimental Part and/or using the techniques described in US-A- 4,683,202; Saiki et al., Science 239 (1988), 487-491 or PCR Protocols, 1990, Academic Press, San Diego, California. USA.

As the template for the PCR-reaction, a nucleic sequence encoding the native 129 kD, 57 kD and/or 186 kD sequence can be used, such as a cDNA derived from the native RNA sequence, or a plasmid containing such a sequence, including those described in the

Experimental Part. The template used may itself already contain one or more alterations, compared to the corresponding native sequence.

As mentioned above, a preferred alteration involves the introduction of a stopcodon into the native 129 kD or 186 kD sequence, such that - upon transformation into a plant - the polynucleotide sequence thus obtained causes expression of a truncated replicase. In particular, such a stopcodon may be introduced into a sequence corresponding to the native 129 kD sequence, more in particular to that part of the native sequence that corresponds to the so-called GDD-motiv or to the so-called P-loop.

The polynucleotide sequence encoding the defective replicase is preferably in the form of - e.g. forms part of and/or is incoφorated within - a genetic construct. The genetic construct is preferably a construct suitable for the transformation of a plant, plant cell and/or plant material, such as a plasmid, cosmid or vector, including co-integration vectors or binary vectors. The genetic construct may be DNA or RNA, and is preferably dsDNA.

Such a construct may further contain all known elements for genetic constructs, and in particular for genetic constructs intended for the transformation of plants, as long as the presence thereof does not interfere with the CGMMV resistance to be provided by the polynucleotide sequence encoding the defective replicase. Some non-limiting examples of such elements include leader sequences, terminators, enhancers, integration factors, selection markers, reporter genes, etc., and suitable elements will be clear to the skilled person. These further elements may or may not be derived from plants, and may or may not be homologous to the plant that is to be transformed with the construct of the invention (hereinbelow referred to as the "target plant"). For instance, the further elements may also have been derived from micro-organisms, viruses, etc., and may also be elements that are natively associated with the CGMMV sequence, such as the native CGMMV leader sequence (5 '-UTR sequence).

The nucleotide sequences encoding these further elements may have been isolated and/or derived from a naturally occuring source - for instance as cDNA - and/or from known available sources (such as available plasmids, etc.), and/or may have been provided synthetically using known DNA synthesis techniques.

For instance, a construct of the invention will usually contain a suitable promoter operatively linked to the polynucleotide sequence encoding the defective replicase. e.g. such that it is capable of directing the expression of the polynucleotide sequence. Suitable promoters can be chosen from all known constitutive, inducible. tissue specific or other promoters that can direct expression of a desired nucleotide sequence in a plant and/or in part of a plant, including specific tissues and/or individual cells of the plant. In particular, promoters are used that are suitable for use in species of the Cucurbitaceae family, such as cucumber.

A specifically preferred promoter is the plastocyanine-promoter. Use of the 35S promoter is less preferred, as it may be less reliable in cucumber.

The terminator can be any terminator that is effective in plants. A particularly preferred terminator is the nos-3' terminator.

The selection marker can be any gene that can be used to select - under suitable conditions such as the use of a suitable selection medium- plants, plant material and plant cells that contain -e.g. as the result of a succesful transformation - the genetic construct containing the marker. A particularly preferred selection marker is the nptll-gene, which can be selected for using kanamycin.

The construct of the invention further preferably contains a leader sequence. Any suitable leader sequence, including those of viral origin, can be used. Preferably, a leader sequence essentially identical to the 5 ^"untranslated (5'-UTR) region of the CGMMV genome is used. This may be derived from the viral RNA, or may be provided synthetically, e.g. as described in the Experimental Part.

Although not preferred, the invention also encompasses constructs that encode a fusion of a defective replicase as mentioned above, and at least one further amino acid sequence, such as a protein or polypeptide, or a part or fragment thereof. Preferably, expression of a defective replicase as (part of) such a fusion does not detract from the desired biological activity (i.e. protection against infection with CGMMV).

The construct of the invention can be provided in a manner known per se, which generally involves techniques such as restricting and linking nucleic acids/nucleic acid sequences, for which reference is made to the standard handbooks, such as Sambrook et al, "Molecular Cloning: A Laboratory Manual" ( 2nd.ed.), Vols. 1-3, Cold Spring Harbor Laboratory (1989) of F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987). According to one embodiment, the genetic construct is preferably (also) in a form that can be stably maintained or inherited in a micro-organism, in particular a bacterium, more in particular a bacterium that can be used to transform a plant or plant material, such as Agrobacterium. In a further aspect, the invention also relates to such a micro-organism, in particular a bacterium, more in particular a bacterium that can be used to transform a plant, such as Agrobacterium, that contains a genetic construct according to the invention.

The genetic construct can be transformed into the target plant, plant cell or plant material by any suitable transformation technique known per se, including transformation with Agrobacterium, transformation with "denuded" DNA, for instance through particle bombardment or transformation of protoplasts through electroporation or treatment with PEG. Examples of suitable vectors systems for use with Agrobacterium are for instance binary vectors such as pBI121 and derivatives thereof; co-integration vectors such as pGV1500 and derivatives of pBR322. Suitable systems for transformation with denuded DNA include E. coli- vectors with high copy number, such as pUC-vectors and pBluescript II (SK+) vectors. Upon transformation, the construct may for instance be incoφorated into the genomic

DNA of the plant, or it may be maintained/inherited independantly in the plant (cell).

In a further aspect, the invention therefore comprises a method in which a plant, plant cell or plant material is transformed with a genetic construct as described above.

This method may also comprise cultivating the transformed plant cell or plant material into a mature plant, and may also comprise sexually or asexually reproducing or multiplying the transformed plant (and/or the mature plant obtained from the transformed plant cell or plant material).

The invention therefore also relates to a plant, plant cell or plant material, that has been transformed with - or more generally contains- a genetic construct as described above. Preferably, such a plant, plant cell or such plant material is resistant against infection with CGMMV as described herein.

The invention furthermore relates to cultivation material such as seed, tubers, roots, stalks, seedlings etc. for such a plant, as well as descendants of such a plant, obtained through sexual or asexual reproduction techniques. Such cultivation material and/or descendants most preferably still contain or have inherited the genetic construct of the invention, and more preferably also are resistant against infection with CGMMV as described herein.

The invention will now be illustrated by means of the following non-limiting Experimental Part and by means of the Figures, in which: - Figure 1 is a schematic representation of the genome of CGMMV;

Figure 2 gives a phylogenetic tree of CGMMV-coat protein (cp) for CGMMV-SH and the ten European isolates, using the method of J. Hein with weighted residue table. Figures 3 - 8 show examples of some preferred genetic constucts of the invention, i.e those listed in Table 6 below. Also, in the Experimental Part hereinbelow, enzymes, kits, etc. were usually used according to the instructions of the manufacturer and/or using well-established protocols, unless indicated otherwise.

Experimental Part

Example I: Cloning of the coat protein genes of 10 CGMMV-isolates

1. Collecting CGMMV isolates

To make use of coat protein-mediated protection (CPMP) strategy against CGMMV, it is necessary to clone the coat protein cistrons of the isolates, that are economically important. As the only sequence information available for CGMMV is derived from watermelon strains from the Far East, it was first decided to collect CGMMV isolates of important cucumber culture areas in Europe and the Mediterannean area. Table 1 lists the isolates collected from various geographical areas. All isolates were propagated on cucumber, and infected leaf material was stored at -80°C. The symptoms obtained after infection of cucumber cv. Hokus are listed in Table 1.

2. Design of PCR primers

The possibility of sequence divergence among the various collected isolates, and between the isolates and the published sequences of CGMMV-SH and CGMMV-W exists. In order to identify nucleotide regions with a high degree of sequence conservation, that could serve as a basis of PCR primer design, an alignment study was carried out on corresponding sequences of CGMMV-SH, CGMMV-W and of some other related members of the tobamovirus group: Sunn-Hemp Mosaic Virus (SHMV, a variant of TMV) and Pepper Mild Mottle Virus (PMMV). For this puφose. a region of 800 nucleotides just 5' of the coat protein cistron and a region of 170 nucleotides forming the far 3' of the viral genome were compared. In this sequence alignment, regions with sufficient sequence homology among all compared viruses were identified. Based on these sequences, sets of PCR primers were designed, which are listed in Table 2.

Table 2. Design of primers for the RT-PCR amplification of coat protein sequences of CGMMV-isolates.

3. Amplification of the coat protein regions

From leaf material of cucumber plants infected with each of the 11 isolates described in Tabel 1, a total RNA extraction was prepared. Using each of the 5' primers listed in Table 2 in combination with 3' primer 97G18, reverse transcription of RNA and PCR amplification of cDNA with an annealing temperature of 55°C was established using a kit manufactured by Perkin Elmer Cetus. Especially in the reactions with the 5' primer 97G03 amplification products of the correct size were obtained for each of the 11 RNA samples. The PCR amplification products were directly cloned in T/A cloning vector pCR2.1 and introduced in E.coli strain INVαF'. For each of the RNA samples, the correct size of the cloned product (1.12 kb) was verified, and the clones were stored at -80°C. The amplification products of CGMMV-isolates 1 to 10 cloned in pCR2.1 were designated pKG4301 to pKG4310, and the one of CGMMV-SH cloned in pCR2.1 was designated pKG4311.

4. Nucleotide sequence analysis of the coat protein cistrons The sequences of the complete inserts of the plasmids pKG4301 to pKG4310 were determined by reading in both directions using ml 3 forward en ml 3 reverse sequencing primers. The sequence of the insert of pKG4311 was already known, as this plasmid contains a cDNA fragment of CGMMV-SH.

Sequence analysis confirmed, that in each case indeed the correct cDNA fragment of CGMMV had been obtained and cloned. With one exception, each amplified and cloned cDNA fragment consisted of 1123 base pairs, containing the CGMMV coat protein cistron and a large part of the CGMMV movement protein cistron.

The cloned sequences of all collected European isolates (isolates 1 to 10) are approximately 97% homologous among each other, but differ on average by 10%) from the published sequence of CGMMV-SH. Comparison of each individual sequence revealed, that isolates 1 and 2. both from Eastern Europe, are extremely alike. The same very high degree of identity was found between both isolates from cucumber greenhouses in the Netherlands (isolates 4 and 5) and between both isolates obtained from the Almeria area in Spain (isolates 9 and 10). None of the cDNA sequences was 100%. identical to any of the other ones, but the differences in sequence are no more than a few nucleotides, and sometimes only one nucleotide in the coding region of the coat protein cistron. The Japanse isolate CGMMV-SH is clearly different from any of the European isolates.

5. Coat protein amino acid sequence analysis Based on the nucleotide sequences of the Open Reading Frames (ORF) of the coat protein cistrons of the 10 isolates, the amino acid sequence could be deduced. In each of the analyzed sequences, the ORF consisted of a region of 486 nucleotides, coding for a protein of 161 amino acid residues. The predicted molecular mass of this protein is 17.3 kD, corresponding to earlier published results. The homology among the predicted protein sequences of the various isolates is as high as 98.1%. The only deviations are found for amino acid residue 19 (usually valine), residue 65 (mostly serine) and residue 84 (mostly leucine).

The sequence of the coat protein of the Japanse isolate CGMMV-SH only differs by 1 amino acid (residue 65) from the consensus sequence. Example II: Cloning of the replicase gene of CGMMV

1. Strategy for replicase-mediated protection By way of example, two approaches to replicase-mediated protection (RMP) against virus infections in plants were investigated.

One approach makes use of defective replicase genes in the form of truncated Open Reading Frames (ORF), in which the sequence downstream from the GDD motif had been truncated or altered through mutation. The other approach makes use of the expression of the 'read-through^" part of the replicase gene, i.e. the 57 kD sequence. It is thought that this ORF is not translated in the plant cell, but forms part of a larger 'read-through' ORF combining the coding regions of both the 129 kD replicase gene and the putative 57 kD protein gene, resulting in a protein of 189 kD. However, expressing merely the 57 kD protein ORF in plant cells may result in a extremely strong resistance to infection by both virus particles and viral RNA. which also would be capable of resisting high temperatures, as well as high inoculum concentrations.

For either of these approaches, either the full-length CGMMV replicase gene must be cloned, or both constituting parts must be cloned separately.

2. Design of primers

Because of the high sequence homology of the coat protein genes of 1 1 CGMMV isolates it was assumed, that the sequences of the replicase genes of the various isolates would be also highly conserved. Based on the complete sequence of the CGMMV-SH isolate, primers were designed for the PCR amplification of the 57 kD ORF and of the 129 kD ORF (Tables 3 and 4). The primers were designed such, that they contain restriction sites for the future cloning of the amplification products. The 5' primers contain an Ncol-site positioned such, that it will coincide with the ATG start codon of the amplified ORF. The 3' primers contain a Sαel-site downstream from the stop codon. Table 3. Design of primers for the LR-RT-PCR amplification of the 57 kD replicase sequence of CGMMV.

Table 4. Design of primers for the LR-RT-PCR amplification of the 129 kD replicase gene sequence of CGMMV.

3. Long-Range Reverse Transcriptase Polymerase Chain Reactions

From the known sequence of CGMMV-SH it was derived that the size of the 57 kD protein gene is 1.5 kb. Such a size is at the limit of the size range that can be amplified in a PCR with standard Taq polymerase. For the amplification of this cDNA fragment, and certainly for the amplification of the cDNA fragment for the 129 kD replicase gene, a different polymerase suitable for long range amplifications must be used. In these experiments, rTth DNA polymerase was used.

For direct amplification of cDNA fragments from total RNA extractions a RT-PCR kit is normally employed, combining in one reaction the activity of the Reverse Transcriptase (RT), producing a single cDNA strand complementary to the RNA template strand beginning at one primer annealed to the 3' end of the RNA molecules, and the activity of the Polymerase. amplifying the thus produced single stranded cDNA molecule in a normal PCR fashion.

Because of the need to use long range polymerase. it was attempted to combine the RT with the long range polymerase to produce in one reaction large-size amplification products directly from total RNA extracts. This type of reaction was called a Long Range Reverse Transcriptase Polymerase Chain Reaction (LR-RT-PCR).

4. LR-RT-PCR amplification and cloning of the 57 kD protein gene Using the primers listed in Table 3 and the LR-RT-PCR described above, a specific

1.5 kb amplification product was obtained from total RNA extracts of cucumber leaves infected with CGMMV -4. This isolate was chosen, as it originated from the Dutch cucumber greenhouse cultures, and would thus represent an economically important isolate. Because long range polymerases contain a 'proof reading^" activity and do not leave A-additions on the amplification products, as does the Taq polymerase normally employed in PCR, direct cloning of the amplification products in a TA vector accomodating the A-additions was not possible. Therefore, the amplification products were briefly treated with Taq polymerase, resulting in the addition of A-overhangs on the amplified DNA molecules. These molecules could then easily be cloned in the TA vector pCR2.1 , and transformed to E.coli MCI 061. Clones with the correct insert size of 1.5 kb were stored at -80°C and are known as pKG4321.

5. Sequence analysis of the 57 kD protein gene

The nucleotide sequence of the cloned insert of pKG4321 was determined by double- stranded sequencing using ml 3 forward en ml 3 reverse primers and subsequent primer walking steps. The ORF coding for a putative 57 kD protein gene (SEQ ID no 3) showed 90%> homology at the nucleotide level to the corresponding sequence of the Japanse isolate CGMMV-SH (SEQ ID no 19). The predicted amino acid sequence (SEQ ID no 4) shows a 98.2% homology to the one predicted by the CGMMV-SH sequence (SEQ ID no 20). The GDD motif characteristic for viral replicase genes resides at amino acid residues 364- 366.

6. LR-RT-PCR amplification and cloning of the 129 kD replicase gene

Using the primers listed in Table 4 in a Long Range Reverse Transcriptase Polymerase Chain Reaction as described under 3 . one specific amplification product of 3.5 kb representing the viral 129 kD replicase gene was obtained from total RNA of cucumber leaves infected with CGMMV isolate 4 (Table 1). Because long range polymerases contain a 'proof reading' activity and do not leave A-additions on the amplification products, as does the Taq polymerase normally employed in PCR, direct cloning of the amplification products in a TA vector accomodating the A-additions was not possible. Therefore, the amplification products were briefly treated with Taq polymerase, resulting in the addition of A-overhangs on the amplified DNA molecules. These molecules could easily be cloned in the TA vector pCR2.1, and transformed to E.coli MCI 061. Clones with the correct insert size of 3.5 kb were stored at -80°C and are known as pKG4322.

7. Sequence analysis of the 129 kD protein gene

The nucleotide sequence of the amplification product cloned in pKG4322 was determined by double-stranded sequencing using ml 3 forward en ml 3 reverse primers, and a primer walking strategy. The ORF coding for the 129 kD replicase gene (SEQ ID no 1) showed 88%> homology at the nucleotide level to the corresponding sequence of the Japanse isolate CGMMV-SH (SEQ ID no 17). The ORF of the Dutch cucumber greenhouse isolate codes for a replicase protein of 1144 amino acids, which is one amino acid in extra in comparison to the CGMMV-SH strain. The predicted amino acid sequence (SEQ ID no. 2) shows a 97.1%. homology to the one predicted by the CGMMV-SH sequence (SEQ ID no 18). Two GDD motifs are found at amino acid residues 256-258 and 540-542.

8. Site-directed mutagenesis of the 129 kD ORF

As explained above, one approach to obtain RMP in plant cells was to make use of replicase genes truncated either in the GDD motif, or truncated in the P-loop of the helicase domain. In order to create gene expression cassettes carrying such truncated genes, a site- directed mutagenesis approach was followed to introduce stop codons at the required positions in the ORF. To this end, several parts of the 129 kD replicase ORF were re- amplified from pKG4322 as a template using specifically designed primers that included unique restriction sites for future re-assembling of the thus amplified products, as well as the required mutations in the form of stop codons (Table 5). These stop codons should ensure the proper truncation of the translation of the protein. Several stop codons were designed one after the other in the three reading frames in these primers, thus ensuring an effective translation-deficient mutation. Table 5. Design of primers for the site-directed mutagenesis of the 129 kD replicase gene of CGMMV.

Using primers 98L103 and 98L104, a fragment from the downstream half of the 129 kD gene from the GDD motif up to the C/αl-site was amplified, while simultaneously stop codons were introduced at the site of the GDD motif. This fragment cloned in TA vector pCR2.1 was called pKG4325.

Using primers 98L105 and 98L106. a fragment corresponding to the 5' half of the 129 kD gene up to the GDD motif was amplified, while simultaneously a stop codon was introduced at the site of the GDD motif. This fragment cloned in T/A vector pCR2.1 was called pKG4326.

Replacing anXbal-Clal fragment of pKG4322 with the combined amplified products of pKG4325 and pKG4326 reconstitutes the full-length 129 kD replicase ORF of pKG4322 with stop codons introduced at the site of the GDD motif. This construct is named pKG 4329. Using primers 98L99 and 98L107, a fragment at the far downstream end of the 129 kD gene from the P-loop to the end of the ORF was amplified, while simultaneously stop codons were introduced at the site of the P-loop. This fragment cloned in T/A vector pCR2.1 was called pKG4327. Using primers 98L108 and 98L102, a fragment corresponding to a central part of the

129 kD gene from the GDD motif up to the P-loop was amplified, while simultaneously a stop codon was introduced at the site of the P-loop. This fragment cloned in T/A vector pCR2.1 was called pKG4328. Replacing an BamHl-Clal fragment of pKG4322 with the combined amplified products of pKG4327 and pKG4328 reconstitutes the full-length 129 kD replicase ORF of pKG4322 with stop codons introduced at the site of the P-loop. This construct is named pKG4330.

Example III: Transformation of cucumber

1. Construction of a CGMMV-leader sequence

For optimal expression and stability of the replicase gene transcripts in plant cells, it was thought necessary to add a sequence identical to the 5' untranslated (5' UTR) region of the CGMMV genome upstream from the ORF sequence in the plant expression cassette. Because the 5' UTR of viral genomes contain highly repetitive RNA, this sequence could not be obtained by RT-PCR amplification, as no specific primers could be designed. Instead, a synthetic region identical to the 5' UTR of CGMMV-SH was assembled from the four oligonucleotide sequences:

97G40 (CTAGAGTTTTAATTTTTATAATTAAACAAA),

97G41 (TC AAAATTAAAAATATTAATTTGTTTGTTGTTGTTG),

97G42 (CAACAACAACAACAACAAACAATTTTAAAACAACAC) and

97G43 (TTGTTGTTTGTTAAAATTTTGTTGTGGTAC). These oligonucleotides were designed such, that outside the sequence corresponding to the 5" UTR they contain restriction sites form l and Ncol. thus facilitating further cloning. Adding the four oligonucleotides together will cause spontaneous assembling due to the design of extensive regions of overhang. Using these restriction sites, the assembled mixture was cloned in a plant expression vector containing an Arabidopsis thaliana plastocyanin promoter (Vorst et al. , 1993) and a Agrobacterium tumefaciens nopaline synthase terminator sequence (Depicker et al, 1982) in a pUC19-derived plasmid. This expression cassette was called pKG1315. The complete expression cassette consisting of the plastocyanin promoter, the CGMMV leader sequence and the nos terminator was subsequently removed from pKG1315 using H dIII and EcoRl as restriction enzymes, and recloned in the corresponding restriction sites of:

1) an intermediate type Agrobacterium transformation vector for coϊntegrate type vector systems containing an nptll selectable marker gene cassette to create pKG1575, and

2) an intermediate type Agrobacterium transformation vector for coϊntegrate type vector systems containing no selectable marker gene to create pKGl 110. 2. Construction of transformation vectors

The three cloned and modified replicase constructs of pKG4321, pKG4329 and pKG4330 were isolated from the plasmids by restriction with BamHl (filled in with Klenow) and Ncol and ligated into the Sacl (filled in with Klenow) and Ncol sites of each of the two transformation vectors pKG1575 and pKGl 110, resulting in a total of six transformation vectors, listed in Table 6.

Table 6. List of six transformation vectors for the expression in plants of parts of the CGMMV-replicase gene.

3. Transformation of cucumber

The intermediate type transformation vectors pKG4331 and pKG4333 were introduced into Agrobacterium tumefaciens strain GV2260 by tri-parental mating. Transconjugants which had incoφorated the intermediate type vector into their Ti-plasmids through homologous recombination were selected on the basis of streptomycin and spectinomycin resistance and analyzed for the correct insertion of the vector. Cucumber plants were transformed with these two strains of Agrobacterium, as well as with an Agrobacterium strain harbouring only the nptll selection marker, using published procedures. A number of transgenic cucumber plants were obtained. The plants were transferred to a greenhouse to flower and set seed. The seedlings germinating from these Rl seed were mechanically infected with CGMMV isolate 1-3 weeks post-inoculation, the plants were scored for symptoms of virus infection, as described in the assay for tolerance to virus infection set out in under 4. below. 4. Assay for tolerance to virus infection

The seedlings of transgenic cucumber germinating from these Rl seed were mechanically infected with CGMMV isolate 1. Fresh inoculum was prepared from a crude leaf extract of susceptible non-transgenic cucumber plants cv. Hokus pre-infected with this same isolate 3 weeks previously. Seedlings of non-transformed cucumber plants were used as controls in the assay. During 21 days post-inoculation the appearance of viral symptoms was scored visually every 2 days. In this assay, individual plants are scored as being tolerant when they remain free of visible symptoms for at least 7 days, and preferably more than 14 days, and more preferably more than 21 days post-inoculation. Sixty-four independent transgenic lines were assayed, with 14 to 20 seedlings for each line. Control seedlings all became diseased within 9 days post-inoculation. A number of seedlings in seventeen of the transgenic lines showed clear absence of symptoms for a prolonged period of time, and remained free of symptoms after 21 days post-inoculation. Of some transgenic lines, the number of symptom-free plants coresponded to Mendelian segregation of a transgene present in a single locus. In one particular transgenic cucumber line 4 out of 14 seedlings remained symptom-free during the assay period, which may indicate that the tolerant phenotype corresponds to the homozygous state of a transgene present in one single locus, although, as mentioned above, the invention is not limited to a specific mechanism.

Hereinabove, the invention has been described under the assumption that resistance against CGMMV is generated "at the protein level", i.e. that the "nucleotide sequence encoding a defective variant of the replicase gene of CGMMV codes for a "defective replicase". the expression of which at cellular level generates the desired resistance against CGMMV. However, the invention is not limited to any explanation or mechanism, and is not particularly limited to the use of a particular type of nucleotide sequence (i.e. encoding a "defective replicase"). For instance, an alternative mechanism is based on the assumption that the resistance to CGMMV is generated at the RNA-level, e.g. downregulation of gene expression due to RNA sequence homology. The use of any nucleotide sequence that can be used to provide resistance against CGMMV and that at the same time does not provide replicase activity, is envisaged by the invention. References

Anderson, J.M., Palukaitis, P. and M. Zaitlin (1992) A defective replicase gene induces resistance to cucumber mosaic virus in transgenic tobacco. Proc.Nat.Acad.Sci.USA 89: 8759-8763. - Audy et al. (1993) Molec.Plant-Microbe Interact. 7: 15-23.

Beachy, R.N., S. Loesch-Fries and N.E. Turner (1990) Coat-protein mediated resistance against virus infection. Ann.Rev. Phytopathology 28: 451-474.

- Christou et al. (1992) IAPTC Newsletter 2-14.

- Cooper et al. (1995) Virology 206: 307-313. - Depicker et α/. (1982) J.Mol.Appl.Genet. 561-573.

Donson, J., CM. Kearney, T.H. Tuφen, LA. Khan, G. Kurath, A.M. Tuφen, G.E. Jones, W.O. Dawson and D.J. Lewandowski (1993) Broad Resistance to Tobamoviruses is mediated by a modified Tobacco Mosaic Virus Replicase Transgene. Mol. Plant-Microbe Interact. 6: 635-642. - Goldbach, R. and P. De Haan (1993) Prospects of engineered forms of resistance against tomato spotted wilt virus. Seminars in Virology 4: 381-387.

Golemboski, D.B., G.P. Lomonosoff and M. Zaitlin (1990) Plants transformed with a toacco mosaic virus nonstructural gene sequence are resistant to the virus. Proc. Natl. Acad. Sci.USA 87: 6311-6315. - Hollings, M., Y. Komuro and H. Tochihara (1975) Cucumber Green Mottle Mosaic Virus. C.M.I./A.A.B. Descriptions of Plant Viruses, nr. 154.

- Horsch, R.B., J.G. Fry, N.L. Hoffmann, D. Eichholtz, S.G. Rogers and R.T. Fraley (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1231. Kunik, T., R. Salomon, D. Zamir, N. Navot. M. Zeidan, I. Michelson, Y. Gafni and H. Czosnek (1994) Transgenic tomato plants expressing the tomato yellow leaf curl virus capsid protein are resistant to the virus. Bio/Technology 12: 500-504. Meshi, T., R. Kiyama, T. Ohno and Y. Okada (1983) Nucleotide sequence of the coat protein cistron and the 3' noncoding region of cucumber green mottle mosaic virus (watermelon strain) RNA. Virology 127: 54-64. - Prins et al. (1994) Molec.Plant-Microbe Interact. 8: 85-91.

Ugaki, M.. M. Tomiyama, T. Kakutani, S. Hidaka, T. Kiguchi, R. Nagata, T. Sato, F. Motoyoshi and M. Nishiguchi (1991) The complete nucleotide sequence of Cucumber Green Mottle Mosaic Virus (SH strain) genomic RNA. J.Gen.Virol. 72: 1487-1495. Rogers, S.G., H.J. Klee, R.B. Horsch and R.T. Fraley (1986) Gene transfer in plants: production of transformed plants using Ti plasmid vectors. Meth. Enzymol. 118: 627-640. - Shillito, R.D., M.W. Saul, J. Paszkowski, M. Muller and I. Potrykus (1985) High efficiency direct gene transfer to plants. Bio/Technology 3: 1099-1103. - Vaira, A.M., L. Semeria, S. Crespi, V. Lisa, A. Allavena and G.P. Accotto (1995)

Resistance to Tosposviruses in Nicotiana benthamiana transformed with the N gene of tomato spotted wilt virus: correlation between transgene expression and protection in primary transformants. Molec.Plant-Microbe Interact. 8: 66-73. Vorst, O., P. Kock, A. lever, B. Weterings, P. Weisbeek and S. Smeekens (1993) The promoter of the Arabidopsis thaliana plastocyanin gene contains a far upstream enhancerlike element involved in chloroplast-dependent expression. Plant Journal 4: 933-945. Wilson, T.M.A. (1993) Strategies to protect crop plants against viruses: pathogen-derived resistance blossoms. Proc.Natl.Acad.Sci.USA 90: 3143-3141.

Claims

C L A I M S

1. Method for generating resistance in a plant or in a plant cell against infection with CGMMV, said method comprising at least the step of transforming said plant or plant cell with a polynucleotide sequence that i) upon (at least) transformation into a plant and transcription into RNA generates resistance against infection with CGMMV in said plant; and ii) upon (at least) transformation into a plant and transcription into RNA does not lead to generation of (any) replicase activity in said plant.

2. Method for providing a transgenic plant and/or a transgenic plant cell that is resistant against infection with CGMMV, comprising at least the step of transforming said plant or plant cell with a polynucleotide sequence that i) upon (at least) transformation into a plant and transcription into RNA generates resistance against infection with CGMMV in said plant; and ii) upon (at least) transformation into a plant and transcription into RNA does not lead to generation of (any) replicase activity in said plant.

3. Method according to claim 1 and/or 2, in which the polynucleotide sequence is a nucleotide sequence that comprises, and preferably consists of:

- a nucleotide sequence corresponding to the sequence given in SEQ ID no.1. to the sequence given in SEQ ID no.17 or to the nucleotide sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.l, SEQ ID no. 17 and or the naturally occuring variant thereof - one or more nucleotides have been added, replaced and/or removed;

- a nucleotide sequence corresponding to the sequence given in SEQ ID no.5, to the sequence given in SEQ ID no.21, to the nucleotide sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.5, SEQ ID no. 21 and/or the naturally occuring variant thereof - one or more nucleotides have been added, replaced and/or removed;

- a nucleotide sequence corresponding to the sequence given in SEQ ID no.3. to the sequence given in SEQ ID no.19 or to the nucleotide sequence of a naturally occuring variant thereof; - a nucleotide sequence corresponding to the sequence given in SEQ ID no.3, to the sequence given in SEQ ID no.19 or to the nucleotide sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.3, SEQ ID no. 19 and/or the naturally occuring variant thereof - one or more nucleotides have been added, replaced and/or removed; such that said nucleotide sequence is capable, upon (at least) transformation into a plant and transcription into RNA, to confer to said plant resistance against infection with CGMMV, and such that said nucleotide sequence, upon (at least) transformation into a plant and transcription into RNA, is not capable of generating of (any) replicase activity in said plant.

4. Method according to any of claims 1-3, in which the polynucleotide sequence encodes a polypeptide or protein that i) upon being expressed in a plant is capable of generating resistance against CGMMV in said plant; and ii) upon being expressed in a plant has no replicase activity.

5. Method according to claim 4, in which the polynucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of:

- an amino acid sequence corresponding to the sequence given in SEQ ID no.2, to the sequence given in SEQ ID no.18 or to the amino acid sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.2, SEQ ID no.18 and/or the naturally occuring variant thereof - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed; - an amino acid sequence corresponding to the sequence given in SEQ ID no.6. to the sequence given in SEQ ID no.22 or to the amino acid sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.6, SEQ ID no. 22 and/or the naturally occuring variant thereof - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed

- an amino acid sequence corresponding to the sequence given in SEQ ID no.4, to the sequence given in SEQ ID no.20 or to the amino acid sequence of a naturally occuring variant thereof; - an amino acid sequence corresponding to the sequence given in SEQ ID no.4, to the sequence given in SEQ ID no.20 or to the amino acid sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.4, SEQ ID no. 20 and or the naturally occuring variant thereof - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed; or any combination thereof, provided that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant.

6. Method according to claim 4 or 5, in which the polynucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of :

- an amino acid sequence corresponding to a part or fragment of the sequence given in SEQ ID no.2, to a part or fragment of the sequence given in SEQ ID no.18 and/or to a part of fragment of the amino acid sequence of a naturally occuring variant thereof, or corresponding to a combination of two or more such parts or fragments;

- an amino acid sequence corresponding to a part or fragment of the sequence given in SEQ ID no.6, to a part or fragment of the sequence given in SEQ ID no.22 and/or to a part of fragment of the amino acid sequence of a naturally occuring variant thereof, or corresponding to a combination of two or more such parts or fragments; ts;

- an amino acid sequence corresponding to the sequence given in SEQ ID no.4, to the sequence given in SEQ ID no.20, and/or to the amino acid sequence of a naturally occuring variant thereof; such that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant.

7. Method according to claim 4 or 5. in which the polynucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of :

- an amino acid sequence corresponding to a truncated variant of the sequence given in SEQ ID no.2, to a truncated variant of the sequence given in SEQ ID no.18 and/or to a truncated variant of the amino acid sequence of a naturally occuring variant thereof; - an amino acid sequence corresponding to a truncated variant of the sequence given in SEQ ID no.6, to a truncated variant of the sequence given in SEQ ID no.22 and/or to a truncated variant of the amino acid sequence of a naturally occuring variant thereof;

- an amino acid sequence corresponding to the sequence given in SEQ ID no.4, to the sequence given in SEQ ID no 20, and/or to the amino acid sequence of a naturally occuring variant thereof; such that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant.

8. Method according to claim 7, in which the polynucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of, the amino acid sequence given in SEQ ID no.2, the amino acid sequence given in SEQ ID no 18 and/or the amino acid sequence of a naturally occuring variant thereof, that has been truncated in the GDD-motif or in the P-loop.

9. Method according to any of the preceding claims, further comprising at least one step of cultivating the transformed plant cell into a mature plant

10. Method according to any of the preceding claims, further comprising at least one step of sexually or asexually reproducing or multiplying the transformed plant and/or the mature plant obtained from the transformed plant cell of claim 9.

11. Method according to any of the preceding claims, in which the plant is a plant that is susceptible to infection with CGMMV, more preferably a plant belonging to the Cucurbitaceae family, such as melon (Cucumis melo), cucumber (Csativus). watermelon (Citrullus vulgaris) and bottlegourd (Lagenaria siceraria)

12. Genetic construct suitable for transforming a plant, said construct at least comprising nucleotide sequence that i) upon (at least) transformation into a plant and transcription into RNA generates resistance against infection with CGMMV in said plant; and ii) upon (at least) transformation into a plant and transcription into RNA does not lead to generation of (any) replicase activity in said plant; and optionally comprising further elements of genetic constructs known per se.

13. Genetic construct according to claim 12. at least comprising a nucleotide sequence that comprises, and preferably consists of:

- a nucleotide sequence corresponding to the sequence given in SEQ ID no.1 , to the sequence given in SEQ ID no.17 or to the nucleotide sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.l, SEQ ID no. 17 and/or the naturally occuring variant thereof - one or more nucleotides have been added, replaced and/or removed;

- a nucleotide sequence corresponding to the sequence given in SEQ ID no.3, to the sequence given in SEQ ID no.19 or to the nucleotide sequence of a naturally occuring variant thereof:

- a nucleotide sequence corresponding to the sequence given in SEQ ID no.3, to the sequence given in SEQ ID no.19 or to the nucleotide sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.3, SEQ ID no. 19 and/or the naturally occuring variant thereof - one or more nucleotides have been added, replaced and/or removed; such that said construct is capable, upon (at least) transformation into a plant and transcription into RNA, to confer to said plant resistance against infection with CGMMV, and such that said construct, upon (at least) transformation into a plant and transcription into RNA, is not capable of generating of (any) replicase activity in said plant.

14. Genetic construct according to claim 12 or 13, at least comprising a nucleotide sequence that encodes a polypeptide or protein that i) upon being expressed in a plant is capable of generating resistance against CGMMV in said plant; and ii) upon being expressed in a plant has no replicase activity.

15. Genetic construct according to claim 14, in which the nucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of:

- an amino acid sequence corresponding to the sequence given in SEQ ID no.2, to the sequence given in SEQ ID no.18 or to the amino acid sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.2, SEQ ID no.18 and/or the naturally occuring variant thereof - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed;

- an amino acid sequence corresponding to the sequence given in SEQ ID no.6, to the sequence given in SEQ ID no.22 or to the amino acid sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.6, SEQ ID no. 22 and/or the naturally occuring variant thereof - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed - an amino acid sequence corresponding to the sequence given in SEQ ID no.4, to the sequence given in SEQ ID no.20 or to the amino acid sequence of a naturally occuring variant thereof;

- an amino acid sequence corresponding to the sequence given in SEQ ID no.4, to the sequence given in SEQ ID no.20 or to the amino acid sequence of a naturally occuring variant thereof, in which - compared to the sequence of SEQ ID no.4, SEQ ID no. 20 and/or the naturally occuring variant thereof - one or more amino acids have been added, replaced or removed, preferably replaced or removed, more preferably removed; or any combination thereof, provided that the resulting protein or polypeptide shows no replicase activity, but is still capable - upon expression in a plant - to generate resistance against CGMMV in said plant.

16. Genetic construct according to claim 14 or 15, in which the nucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of : - an amino acid sequence corresponding to a part or fragment of the sequence given in

SEQ ID no.2, to a part or fragment of the sequence given in SEQ ID no.18 and/or to a part of fragment of the amino acid sequence of a naturally occuring variant thereof, or corresponding to a combination of two or more such parts or fragments; - an amino acid sequence corresponding to a part or fragment of the sequence given in SEQ ID no.6, to a part or fragment of the sequence given in SEQ ID no.22 and/or to a part of fragment of the amino acid sequence of a naturally occuring variant thereof, or corresponding to a combination of two or more such parts or fragments; ts;

17. Genetic construct according to any of claims 14-16, in which the nucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of :

- an amino acid sequence corresponding to a truncated variant of the sequence given in SEQ ID no.2, to a truncated variant of the sequence given in SEQ ID no.l 8 and/or to a truncated variant of the amino acid sequence of a naturally occuring variant thereof;

- an amino acid sequence corresponding to a truncated variant of the sequence given in SEQ ID no.6, to a truncated variant of the sequence given in SEQ ID no.22 and/or to a truncated variant of the amino acid sequence of a naturally occuring variant thereof;

18. Genetic construct according to claim 17, in which the nucleotide sequence encodes a protein or polypeptide that comprises, and preferably consists of, the amino acid sequence given in SEQ ID no.2, the amino acid sequence given in SEQ ID no.18 and/or the amino acid sequence of a naturally occuring variant thereof, that has been truncated in the GDD-motif or in the P-loop.

19. Genetic construct according to any of claims 12-18. in which the nucleotide sequence is under control of the plastocyanine-promoter.

20. Genetic construct according to any of claims 12-19, in which the nucleotide sequence is preceded by the native CGMMV leader (5' -UTR) sequence.

21. Genetic construct according to any of claims 12-20, in a form that can be stably maintained or inherited in a micro-organism, in particular a bacterium, more in particular a bacterium that can be used to transform a plant or plant material, such as Agrobacterium.

22. Micro-organism, in particular bacterium, more in particular a bacterium that can be used to transform a plant, such as Agrobacterium, that contains a genetic construct according to any of claims 12-21, and in particular according to claim 21.

23. Transgenic plant or plant cell, obtainable or obtained by a method according to one of claims 2-11, or a descendant of such a plant.

24. Plant, plant cell or plant material that has been transformed with genetic construct according to any of claims 12-21. or a descendant of such a plant.

25. Plant according to claim 24 or 25, being a plant that is susceptible to infection with CGMMV, more preferably a plant belonging to the Cucurbitaceae family, such as melon (Cucumis melo), cucumber (Csativus), watermelon (Citrullus vulgaris) and bottlegourd (Lagenaria siceraria)

26. Cultivation material such as seed, tubers, roots, stalks, seedlings for a plant according to claim 23, 24 or 25.