EP1194572A2 - Promoter sequences derived from fusarium venenatum and uses thereof - Google Patents

Promoter sequences derived from fusarium venenatum and uses thereof

Info

Publication number
EP1194572A2
EP1194572A2 EP00919596A EP00919596A EP1194572A2 EP 1194572 A2 EP1194572 A2 EP 1194572A2 EP 00919596 A EP00919596 A EP 00919596A EP 00919596 A EP00919596 A EP 00919596A EP 1194572 A2 EP1194572 A2 EP 1194572A2
Authority
EP
European Patent Office
Prior art keywords
seq
nucleic acid
promoter
nucleotides
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00919596A
Other languages
German (de)
French (fr)
Inventor
Randy M. Berka
Michael W. Rey
Kimberly Brown
Stephen H. Brown
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes Inc
Original Assignee
Novozymes Biotech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes Biotech Inc filed Critical Novozymes Biotech Inc
Priority to DK10180302.1T priority Critical patent/DK2278016T3/en
Priority to EP10180302A priority patent/EP2278016B1/en
Publication of EP1194572A2 publication Critical patent/EP1194572A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/24Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2405Glucanases
    • C12N9/2408Glucanases acting on alpha -1,4-glucosidic bonds
    • C12N9/2411Amylases
    • C12N9/2428Glucan 1,4-alpha-glucosidase (3.2.1.3), i.e. glucoamylase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80Vectors or expression systems specially adapted for eukaryotic hosts for fungi

Definitions

  • the present invention relates to methods for producing polypeptides.
  • the present invention also relates to isolated promoters and to nucleic acid constructs, vectors, and host cells comprising the promoters operably linked to nucleic acid sequences encoding polypeptides.
  • the recombinant production of a heterologous protein in a fungal host cell may provide for a more desirable vehicle for producing the protein in commercially relevant quantities.
  • Recombinant production of a heterologous protein is accomplished by constructing an expression cassette in which the DNA coding for the protein is placed under the expression control of a promoter, excised from a regulated gene, suitable for the host cell.
  • the expression cassette is introduced into the host cell, usually by plasmid- mediated transformation.
  • Production of the heterologous protein is then achieved by culturing the transformed host cell under inducing conditions necessary for the proper functioning of the promoter contained on the expression cassette.
  • the present invention relates to methods for producing a polypeptide, comprising: (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first nucleic acid sequence encoding the polypeptide operably linked to a second nucleic acid sequence comprising a promoter foreign to the nucleic acid sequence, wherein the promoter comprises a sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and subsequences thereof; and mutant, hybrid, and tandem promoters thereof; and (b) isolating the polypeptide from the cultivation medium.
  • the present invention also relates to isolated promoters sequences and to constructs, vectors, and fungal host cells comprising one or more of the promoters operably linked to a nucleic acid sequence encoding a polypeptide.
  • the present invention also relates to methods for obtaining mutant promoters of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3.
  • the present invention also relates to isolated nucleic acid sequences, selected from the group consisting of:
  • nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least 65% identity with amino acids 22 to 581 of SEQ ID NO. 4, at least 65% identity with amino acids 19 to 200 of SEQ ID NO. 5, or at least 65% identity with amino acids 1 to 187 of SEQ ID NO. 6;
  • nucleic acid sequence having at least 65% homology with nucleotides encoding a polypeptide having an amino acid sequence which has at least 65% identity with amino acids 22 to 581 of SEQ ID NO. 4, at least 65% identity with amino acids 19 to 200 of SEQ ID NO. 5, or at least 65% identity with amino acids 1 to 187 of SEQ ID NO. 6;
  • nucleic acid sequence which hybridizes under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to
  • nucleic acid sequence encoding a variant of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID. NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids;
  • the present invention further relates to constructs, vectors, and recombinant host cells of the nucleic acid sequences.
  • Figures 1A-F shows the genomic DNA sequence and the deduced amino acid sequence of a Fusarium venenatum glucoamylase gene (SEQ ID NOs. 1 and 4, respectively).
  • Figures 2A-C shows the genomic DNA sequence and the deduced amino acid sequence of a Fusarium venenatum gene designated "Daria” (SEQ ID NOs. 2 and 5, respectively).
  • Figures 3A-D shows the genomic DNA sequence and the deduced amino acid sequence of a Fusarium venenatum gene designated "Quinn” (SEQ ID NOs. 3 and 6, respectively).
  • Figure 4 shows a restriction map of pDM181.
  • Figure 5 shows a restriction map of pSheBl .
  • Figure 6 shows a restriction map of pDM194.
  • Figure 7 shows a restriction map of pJRoy35.
  • Figure 8 shows a restriction map of pDM218.
  • Figure 9 shows a restriction map of pEJG25A.
  • Figure 10 shows a restriction map of pMWR60.
  • Figure 11 shows a restriction map of pRaMB62.
  • Figure 12 shows a restriction map of pRaMB64.
  • Figure 13 shows a restriction map of pRaMB66.
  • Figure 14 shows comparative expression of a Humicola lanuginosa lipase reporter gene in Fusarium venenatum under control of Fusarium venenatum amyloglucosidase (pAMG) and Fusarium oxysporum trypsin (pSP387) promoters.
  • pAMG Fusarium venenatum amyloglucosidase
  • pSP387 Fusarium oxysporum trypsin
  • the present invention relates to methods for producing a polypeptide, comprising (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first nucleic acid sequence encoding the polypeptide operably linked to a second nucleic acid sequence comprising a promoter foreign to the first nucleic acid sequence, wherein the promoter comprises a sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and subsequences thereof; and mutant, hybrid, and tandem promoters thereof; and (b) isolating the polypeptide from the cultivation medium.
  • the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art.
  • the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
  • the polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate.
  • the resulting polypeptide may be recovered by methods known in the art.
  • the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray- drying, evaporation, or precipitation.
  • polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS- PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS- PAGE or extraction
  • promoter is defined herein as a DNA sequence that binds RNA polymerase and directs the polymerase to the correct downstream transcriptional start site of a nucleic acid sequence encoding a polypeptide to initiate transcription. RNA polymerase effectively catalyzes the assembly of messenger RNA complementary to the appropriate DNA strand of the coding region.
  • promoter will also be understood to include the 5' non-coding region (between promoter and translation start) for translation after transcription into mRNA, cw-acting transcription control elements such as enhancers, and other nucleotide sequences capable of interacting with transcription factors.
  • mutant promoter is defined herein as a promoter having a nucleotide sequence comprising a substitution, deletion, and/or insertion of one or more nucleotides of a parent promoter, wherein the mutant promoter has more or less promoter activity than the corresponding parent promoter.
  • mutant promoter will also encompass natural variants and in vitro generated variants obtained using methods well known in the art such as classical mutagenesis, site-directed mutagenesis, and DNA shuffling.
  • hybrid promoter is defined herein as parts of two more promoters that are fused together to generate a sequence that is a fusion of the two or more promoters, which is operably linked to a coding sequence and mediates the transcription of the coding sequence into mRNA.
  • tandem promoter is defined herein as two or more promoter sequences each of which is operably linked to a coding sequence and mediates the transcription of the coding sequence into mRNA.
  • operably linked is defined herein as a configuration in which a control sequence, e.g., a promoter sequence, is appropriately placed at a position relative to a coding sequence such that the control sequence directs the production of a polypeptide encoded by the coding sequence.
  • a control sequence e.g., a promoter sequence
  • coding sequence is defined herein as a nucleic acid sequence that is transcribed into mRNA which is translated into a polypeptide when placed under the control of the appropriate control sequences.
  • the boundaries of the coding sequence are generally determined by the ATG start codon located just upstream of the open reading frame at the 5' end of the mRNA and a transcription terminator sequence located just downstream of the open reading frame at the 3' end of the mRNA.
  • a coding sequence can include, but is not limited to, genomic DNA, cDNA, semisynthetic, synthetic, and recombinant nucleic acid sequences.
  • the promoter has the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1, or a subsequence thereof.
  • the subsequence preferably contains at least about 2100 nucleotides, more preferably at least about 2400 nucleotides, and most preferably at least about 2700 nucleotides.
  • the promoter has the nucleic acid sequence of nucleotides 1 to 938 of SEQ ID NO. 2, or a subsequence thereof.
  • the subsequence preferably contains at least about 840 nucleotides, more preferably at least about 870 nucleotides, and most preferably at least about 900 nucleotides.
  • the promoter has the nucleic acid sequence of nucleotides 1 to 3060 of SEQ ID NO. 3, or a subsequence thereof.
  • the subsequence preferably contains at least about 2100 nucleotides, more preferably at least about 2400 nucleotides, and most preferably at least about 2700 nucleotides.
  • the promoter is the nucleic acid sequence contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-30067. In another preferred embodiment, the promoter is the nucleic acid sequence contained in plasmid pFAMG which is contained in Escherichia coli NRRL B-30071. In another a preferred embodiment, the promoter is the nucleic acid contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30075.
  • the promoter may also be a mutant of the promoters described above having a substitution, deletion, and/or insertion of one or more nucleotides in the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3.
  • a mutant promoter may have one or more mutations. Each mutation is an independent substitution, deletion, and/or insertion of a nucleotide.
  • the introduction of a substitution, deletion, and/or insertion of a nucleotide into the promoter may be accomplished using any of the methods known in the art such as classical mutagenesis, site-directed mutagenesis, or DNA shuffling. Particularly useful is a procedure which utilizes a supercoiled, double stranded DNA vector with an insert of interest and two synthetic primers containing the desired mutation.
  • the oligonucleotide primers each complementary to opposite strands of the vector, extend during temperature cycling by means of Pfu DNA polymerase. On incorporation of the primers, a mutated plasmid containing staggered nicks is generated. Following temperature cycling, the product is treated with Dpnl which is specific for methylated and hemimethylated DNA to digest the parental DNA template and to select for mutation-containing synthesized DNA. Other procedures known in the art may also be used.
  • the promoter is a mutant of nucleotides 1 to 3949 of SEQ ID NO. 1. In another preferred embodiment, the promoter is a mutant of nucleotides 1 to 938 of SEQ ID NO. 2. In another preferred embodiment, the promoter is a mutant of nucleotides 1 to 3060 of SEQ ID NO. 3.
  • the promoter may also be a hybrid promoter comprising a portion of one or more promoters of the present invention; a portion of a promoter of the present invention and a portion of another promoter, e.g., a leader sequence of one promoter and the transcription start site from the other promoter; or a portion of one or more promoters of the present invention and a portion of one or more other promoters.
  • the other promoter may be any promoter sequence which shows transcriptional activity in the fungal host cell of choice including a mutant, truncated, and hybrid promoter, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • the other promoter sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide and native or foreign to the cell.
  • Examples of other promoters useful in the construction of hybrid promoters with the promoters of the present invention include the promoters obtained from the genes for
  • Aspergillus oryzae TAKA amylase Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase,
  • NA2-tpi promoter a hybrid of the promoters from the genes for
  • yeast host cells Saccharomyces cerevisiae enolase
  • GAL1 Saccharomyces cerevisiae galactokinase
  • ADH2/GAP Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3 -phosphate dehydrogenase
  • Other useful promoters for yeast host cells are described by Romanos et al, 1992, Yeast 8: 423-488.
  • the promoter may also be a tandem promoter comprising two more promoters of the present invention or alternatively one or more promoters of the present invention and one or more other promoters, such as those exemplified above.
  • the two or more promoter sequences of the tandem promoter may simultaneously promote the transcription of the nucleic acid sequence.
  • one or more of the promoter sequences of the tandem promoter may promote the transcription of the nucleic acid sequence at different stages of growth of the cell.
  • the promoter is foreign to the nucleic acid sequence encoding a polypeptide of interest, but the promoter or nucleic acid sequence may be native to the fungal host cell.
  • a mutant, hybrid, or tandem promoter of the present invention will be understood to be foreign to a nucleic acid sequence encoding a polypeptide even if the wild-type promoter is native to the nucleic acid sequence.
  • a mutant, hybrid, or tandem promoter of the present invention has at least about 20%, preferably at least about 40%, more preferably at least about 60%, more preferably at least about 80%. more preferably at least about 90%, more preferably at least about 100%, even more preferably at least about 200%, most preferably at least about 300%, and even most preferably at least about 400% of the promoter activity of the promoter of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3.
  • polypeptide Encoding Nucleic Acid Sequences The polypeptide encoded by the nucleic acid sequence may be native or heterologous to the fungal host cell of interest.
  • polypeptide is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins.
  • heterologous polypeptide is defined herein as a polypeptide which is not native to the fungal cell, a native polypeptide in which modifications have been made to alter the native sequence, or a native polypeptide whose expression is quantitatively altered as a result of a manipulation of the fungal cell by recombinant DNA techniques.
  • a native polypeptide may be recombinantly produced by, e.g., placing a gene encoding the polypeptide under the control of a promoter of the present invention to enhance expression of the polypeptide, to expedite export of a native polypeptide of interest outside the cell by use of a signal sequence, and to increase the copy number of a gene encoding the polypeptide normally produced by the cell.
  • the fungal cell may contain one or more copies of the nucleic acid sequence encoding the polypeptide.
  • the polypeptide is a hormone or variant thereof, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter.
  • the polypeptide is secreted extracellularly.
  • the polypeptide is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase.
  • the polypeptide is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
  • the nucleic acid sequence encoding a polypeptide of interest may be obtained from any prokaryotic, eukaryotic, or other source.
  • the term "obtained from” as used herein in connection with a given source shall mean that the polypeptide is produced by the source or by a cell in which a gene from the source has been inserted.
  • PCR polymerase chain reaction
  • the cloning procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into the mutant fungal cell where multiple copies or clones of the nucleic acid sequence will be replicated.
  • the nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
  • the polypeptide may also include a fused or hybrid polypeptide in which another polypeptide is fused at the N-terminus or the C- terminus of the polypeptide or fragment thereof.
  • a fused polypeptide is produced by fusing a nucleic acid sequence (or a portion thereof) encoding one polypeptide to a nucleic acid sequence (or a portion thereof) encoding another polypeptide.
  • Techniques for producing fusion polypeptides are known in the art, and include, ligating the coding sequences encoding the polypeptides so that they are in frame and expression of the fused polypeptide is under control of the same promoter(s) and terminator.
  • the hybrid polypeptide may comprise a combination of partial or complete polypeptide sequences obtained from at least two different polypeptides wherein one or more may be heterologous to the mutant fungal cell.
  • the present invention also relates nucleic acid constructs comprising a nucleic acid sequence encoding a polypeptide operably linked to a promoter of the present invention and one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Nucleic acid construct is defined herein as a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid combined and juxtaposed in a manner that would not otherwise exist in nature.
  • the term nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains a coding sequence and all the control sequences required for expression of the coding sequence.
  • An isolated nucleic acid sequence encoding a polypeptide may be further manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the nucleic acid sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the nucleic acid sequence may comprise one or more native control sequences or one or more of the native control sequences may be replaced with one or more control sequences foreign to the nucleic acid sequence for improving expression of the coding sequence in a host cell.
  • control sequences is defined herein to include all components which are necessary or advantageous for the expression of a polypeptide of the present invention.
  • Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide.
  • control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter of the present invention, signal peptide sequence, and transcription terminator.
  • the control sequences include a promoter of the present invention, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
  • the control sequence may be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase,
  • Aspergillus nidulans anthranilate synthase
  • Aspergillus niger alpha-glucosidase Aspergillus niger alpha-glucosidase
  • Fusarium oxysporum trypsin-like protease Aspergillus nidulans anthranilate synthase
  • Aspergillus niger alpha-glucosidase Aspergillus niger alpha-glucosidase
  • Fusarium oxysporum trypsin-like protease Fusarium oxysporum trypsin-like protease
  • Preferred terminators for yeast host cells are obtained from the genes for
  • the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell.
  • the leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for
  • Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • Suitable leaders for yeast host cells are obtained from the genes for
  • Saccharomyces cerevisiae enolase ENO-1
  • Saccharomyces cerevisiae 3- phosphoglycerate kinase Saccharomyces cerevisiae alpha-factor
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin- like protease, and Aspergillus niger alpha-glucosidase.
  • the control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway.
  • the 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide.
  • the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence.
  • the foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region.
  • the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide.
  • any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
  • Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
  • Useful signal peptides for yeast host cells are obtained from the genes for
  • Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase are described by Romanos et al, 1992, supra.
  • the control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836). Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
  • regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell.
  • regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems.
  • yeast the ADH2 system or GAL1 system may be used.
  • filamentous fungi the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences.
  • Other examples of regulatory sequences are those which allow for gene amplification.
  • nucleic acid sequence encoding the polypeptide would be operably linked with the regulatory sequence.
  • the present invention also relates to nucleic acid constructs for altering the expression of a gene encoding a polypeptide which is endogenous to a host cell.
  • the constructs may contain the minimal number of components necessary for altering expression of the endogenous gene.
  • the nucleic acid constructs preferably contain (a) a targeting sequence, (b) a promoter of the present invention, (c) an exon, and (d) a splice-donor site.
  • the construct Upon introduction of the nucleic acid construct into a cell, the construct inserts by homologous recombination into the cellular genome at the endogenous gene site.
  • the targeting sequence directs the integration of elements (a)-(d) into the endogenous gene such that elements (b)-(d) are operably linked to the endogenous gene.
  • the nucleic acid constructs contain (a) a targeting sequence, (b) a promoter of the present invention, (c) an exon, (d) a splice- donor site, (e) an intron, and (f) a splice-acceptor site, wherein the targeting sequence directs the integration of elements (a)-(f) such that elements (b)-(f) are operably linked to the endogenous gene.
  • the constructs may contain additional components such as a selectable marker. In both embodiments, the introduction of these components results in production of a new transcription unit in which expression of the endogenous gene is altered. In essence, the new transcription unit is a fusion product of the sequences introduced by the targeting constructs and the endogenous gene.
  • the gene is activated.
  • homologous recombination is used to replace, disrupt, or disable the regulatory region normally associated with the endogenous gene of a parent cell through the insertion of a regulatory sequence which causes the gene to be expressed at higher levels than evident in the corresponding parent cell.
  • the activated gene can be further amplified by the inclusion of an amplifiable selectable marker gene in the construct using methods well known in the art (see, for example, U.S. Patent No. 5,641,670).
  • expression of the gene is reduced.
  • the targeting sequence can be within the endogenous gene, immediately adjacent to the gene, within an upstream gene, or upstream of and at a distance from the endogenous gene.
  • One or more targeting sequences can be used.
  • a circular plasmid or DNA fragment preferably employs a single targeting sequence
  • a linear plasmid or DNA fragment preferably employs two targeting sequences.
  • the constructs further contain one or more exons of the endogenous gene.
  • An exon is defined as a DNA sequence which is copied into RNA and is present in a mature mRNA molecule such that the exon sequence is in-frame with the coding region of the endogenous gene.
  • the exons can, optionally, contain DNA which encodes one or more amino acids and/or partially encodes an amino acid.
  • the exon contains DNA which corresponds to a 5' non-encoding region.
  • the exogenous exon or exons encode one or more amino acids and/or a portion of an amino acid
  • the nucleic acid construct is designed such that, upon transcription and splicing, the reading frame is in- frame with the coding region of the endogenous gene so that the appropriate reading frame of the portion of the mRNA derived from the second exon is unchanged.
  • the splice-donor site of the constructs directs the splicing of one exon to another exon.
  • the first exon lies 5' of the second exon
  • the splice-donor site overlapping and flanking the first exon on its 3' side recognizes a splice-acceptor site flanking the second exon on the 5' side of the second exon.
  • a splice-acceptor site like a splice-donor site, is a sequence which directs the splicing of one exon to another exon. Acting in conjunction with a splice-donor site, the splicing apparatus uses a splice- acceptor site to effect the removal of an intron.
  • the present invention further relates to methods for producing a polypeptide comprising (a) cultivating a homologously recombinant cell, having incorporated therein a new transcription unit comprising a promoter of the present invention, an exon, and/or a splice donor site operably linked to a second exon of an endogenous nucleic acid sequence encoding the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
  • the methods are based on the use of gene activation technology, for example, as described in U.S. Patent No. 5,641,670.
  • the present invention also relates to recombinant expression vectors comprising a promoter of the present invention, a nucleic acid sequence encoding a polypeptide, and transcriptional and translational stop signals.
  • the various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the promoter and/or nucleic acid sequence encoding the polypeptide at such sites.
  • the nucleic acid sequence may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the promoter and/or sequence into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with a promoter of the present invention and one or more appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vectors may be linear or closed circular plasmids.
  • the vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • Suitable markers for yeast host cells are ADE2,
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB
  • the vectors of the present invention preferably contain an element(s) that permits stable integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.
  • the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell.
  • the additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s).
  • the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell.
  • the integrational elements may be non-encoding or encoding nucleic acid sequences.
  • the vector may be integrated into the genome of the host cell by non- homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARSl, ARS4, the combination of ARSl and CEN3, and the combination of
  • the origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978,
  • More than one copy of a nucleic acid sequence encoding a polypeptide may be inserted into the host cell to increase production of the gene product.
  • An increase in the copy number of the nucleic acid sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the nucleic acid sequence where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the nucleic acid sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the present invention also relates to recombinant host cells, comprising a promoter of the present invention operably linked to a nucleic acid sequence encoding a polypeptide, which are advantageously used in the recombinant production of the polypeptides.
  • a vector comprising a promoter of the present invention operably linked to a nucleic acid sequence encoding a polypeptide is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier.
  • the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
  • the host cell may be any fungal cell useful in the methods of the present invention.
  • "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota,
  • Chytridiomycota, and Zygomycota as defined by Hawksworth et al, In, Ainsworth and
  • the fungal host cell is a yeast cell.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M., and
  • the yeast host cell is a Candida, Hansenula,
  • Kluyveromyces Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
  • the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell. In another most preferred embodiment, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell. In another most preferred embodiment, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Sac
  • the yeast host cell is a
  • the fungal host cell is a filamentous fungal cell.
  • Filamentous fungi include all filamentous forms of the subdivision Eumycota and
  • Oomycota (as defined by Hawksworth et al, 1995, supra).
  • the filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as
  • Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
  • the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell.
  • the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell.
  • the filamentous fungal host cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
  • the Fusarium venenatum cell is Fusarium venenatum A3/5, which was originally deposited as Fusarium graminearum ATCC 20334 and recently reclassified as Fusarium venenatum by Yoder and Christianson, 1998, Fungal Genetics and Biology 23: 62-80 and O'Donnell et al, 1998, Fungal Genetics and Biology 23: 57-67; as well as taxonomic equivalents of Fusarium venenatum regardless of the species name by which they are currently known.
  • the Fusarium venenatum cell is a mo ⁇ hological mutant of Fusarium venenatum A3/5 or Fusarium venenatum ATCC 20334, as disclosed in WO 97/26330.
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al, 1984, Proceedings of the National Academy of Sciences USA 81 : 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al, 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
  • the present invention further relates to methods for obtaining a mutant promoter, comprising (a) introducing at least one mutation into the sequence of nucleotides 1 to
  • the present invention also relates to methods for obtaining a mutant promoter by
  • the mutant promoter may be isolated using methods known in the art such as restriction enzyme digestion or PCR amplification.
  • the present invention also relates to isolated nucleic acid sequences, selected from the group consisting of: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least 65% identity with amino acids 22 to 581 of SEQ ID NO. 4, at least 65% identity with amino acids 19 to 200 of SEQ ID NO. 5, or at least 65% identity with amino acids 1 to 187 of SEQ ID NO. 6;
  • nucleic acid sequence having at least 65% homology with nucleotides 4013 to 5743 of SEQ ID NO. 1, at least 65% homology with nucleotides 993 to 1593 of
  • SEQ ID NO. 2 or at least 65% homology with nucleotides 3061 to 3678 of SEQ ID NO. 3;
  • nucleic acid sequence which hybridizes under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (iii) a subsequence of (i) or (ii) of at least 100 nucleotides, or (iv) a complementary strand of (i), (ii), or (iii);
  • nucleic acid sequence encoding a variant of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID. NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids;
  • isolated nucleic acid sequence refers to a nucleic acid sequence which is essentially free of other nucleic acid sequences, e.g., at least about 20% pure, preferably at least about 40% pure, more preferably at least about 60% pure, even more preferably at least about 80% pure, and most preferably at least about 90% pure as determined by agarose electrophoresis.
  • an isolated nucleic acid sequence can be obtained by standard cloning procedures used in genetic engineering to relocate the nucleic acid sequence from its natural location to a different site where it will be reproduced.
  • the cloning procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and inco ⁇ oration of the recombinant vector into a host cell where multiple copies or clones of the nucleic acid sequence will be replicated.
  • the nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
  • the present invention relates to isolated nucleic acid sequences encoding polypeptides having an amino acid sequence which has a degree of identity to amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6 (i.e., the mature polypeptide) of at least about 65%, preferably at least about 70%, more preferably at least about 80%, even more preferably at least about 90%, most preferably at least about 95%, and even most preferably at least about 97% (hereinafter "homologous polypeptides").
  • the homologous polypeptides have an amino acid sequence which differs by five amino acids, preferably by four amino acids, more preferably by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6.
  • nucleic acid sequences of the present invention encode polypeptides that comprise the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or
  • nucleic acid sequence of the present invention encodes a polypeptide that comprises the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6.
  • nucleic acid sequence of the present invention encodes a polypeptide that comprises amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6; or an allelic variant thereof; or a fragment thereof.
  • nucleic acid sequence of the present invention encodes a polypeptide that comprises amino acids 22 to 581 of SEQ ID NO.
  • nucleic acid sequence of the present invention encodes a polypeptide that consists of the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6; or an allelic variant thereof; or a fragment thereof.
  • nucleic acid sequence of the present invention encodes a polypeptide that consists of the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6.
  • nucleic acid sequence of the present invention encodes a polypeptide that consists of amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO.
  • nucleic acid sequence of the present invention encodes a polypeptide that consists of amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6.
  • the present invention also encompasses nucleic acid sequences which encode a polypeptide having the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6, which differ from SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, respectively, by virtue of the degeneracy of the genetic code.
  • the present invention also relates to subsequences of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 which encode fragments of SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively.
  • a subsequence is a nucleic acid sequence encompassed by SEQ ID NO. 1 , SEQ
  • a subsequence of SEQ ID NO. 1 contains at least 1410 nucleotides, more preferably at least 1500 nucleotides, and most preferably at least 1590 nucleotides.
  • a subsequence of SEQ ID NO. 2 contains at least 450 nucleotides, more preferably at least 480 nucleotides, and most preferably at least 510 nucleotides.
  • a fragment of SEQ ID NO. 4, SEQ ID NO. 6, or SEQ ID NO. 6 is a polypeptide having one or more amino acids deleted from the amino and/or carboxy terminus of this amino acid sequence.
  • a fragment of SEQ ID NO. 4 contains at least 470 amino acid residues, more preferably at least 500 amino acid residues, and most preferably at least 530 amino acid residues.
  • a fragment of SEQ ID NO. 5 contains at least 150 amino acid residues, more preferably at least 160 amino acid residues, and most preferably at least 170 amino acid residues.
  • a fragment of SEQ ID NO. 6 contains at least 155 amino acid residues, more preferably at least 165 amino acid residues, and most preferably at least 175 amino acid residues.
  • allelic variant denotes any of two or more alternative forms of a gene occupying the same chomosomal locus. Allelic variation arises naturally through mutation, and may result in polymo ⁇ hism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences.
  • the allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
  • the present invention relates to isolated nucleic acid sequences which have a degree of homology to nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 4013 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3 (i.e., mature polypeptide coding region) of at least about 65%, preferably about 70%, preferably about 80%, more preferably about 90%, even more preferably about 95%. and most preferably about 97% homology, which encode an active polypeptide; or allelic variants and subsequences thereof.
  • the degree of homology between two nucleic acid sequences is determined by the Wilbur-
  • the present invention relates to isolated nucleic acid sequences encoding polypeptides which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleic acid probe which hybridizes under the same conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO.
  • SEQ ID NO. 1 nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii) (J. Sambrook, E.F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
  • the subsequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3 may be at least 100 nucleotides or preferably at least 200 nucleotides. Moreover, the subsequence may encode a polypeptide fragment.
  • nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5. or SEQ ID NO. 6, or a fragment thereof, may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides from strains of different genera or species according to methods well known in the art.
  • probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein.
  • Such probes can be considerably shorter than the entire sequence, but should be at least 15, preferably at least 25, and more preferably at least 35 nucleotides in length. Longer probes can also be used. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32 P, 3 H, 35 S, biotin, or avidin). Such probes are encompassed by the present invention.
  • a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques.
  • DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material.
  • the carrier material is used in a Southern blot.
  • hybridization indicates that the nucleic acid sequence hybridizes to a labeled nucleic acid probe corresponding to the nucleic acid sequence shown in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, their complementary strands, or subsequences thereof, under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions are detected using X-ray film.
  • the nucleic acid probe is the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3. In another preferred embodiment, the nucleic acid probe is a nucleic acid sequence which encodes the polypeptide of SEQ ID NO.
  • nucleic acid probe is SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3.
  • the nucleic acid probe is nucleotides 4013 to 5743 of
  • nucleic acid probe is nucleotides 993 to 5743 of SEQ ID NO. 2, which encodes a mature polypeptide.
  • nucleic acid probe is nucleotides 3061 to 3678 of SEQ ID NO. 3, which encodes a mature polypeptide.
  • nucleic acid probe is the nucleic acid sequence contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-30067.
  • nucleic acid probe is the nucleic acid sequence contained in plasmid pFAMG which is contained in Escherichia coli NRRL B-30071.
  • nucleic acid probe is the nucleic acid sequence contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30076.
  • the nucleic acid probe is the mature polypeptide coding region contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-
  • the nucleic acid probe is the mature polypeptide coding region contained in plasmid pFAMG which is contained in
  • the nucleic acid probe is the mature polypeptide coding region contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30076.
  • very low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 ⁇ g/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and medium- high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures.
  • the carrier material is finally washed three times each for 15 minutes using 2 x SSC, 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50°C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at 60°C (medium-high stringency), even more preferably at least at 65°C (high stringency), and most preferably at least at 70°C (very high stringency).
  • 2 x SSC 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50°C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at 60°C (medium-high stringency), even more preferably at least at 65°C (high stringency), and most preferably at least at 70°C (very high stringency).
  • stringency conditions are defined as prehybridization, hybridization, and washing post- hybridization at 5°C to 10°C below the calculated T m using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, IX Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.
  • the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5°C to 10°C below the calculated T m .
  • the present invention also relates to isolated nucleic acid sequences produced by (a) hybridizing a DNA under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3, (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, nucleotides 3061 to 3678 of SEQ ID NO.
  • the present invention relates to isolated nucleic acid sequences which encode variants of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids.
  • the amino acid sequences of the variant polypeptides may differ from the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6, or the mature polypeptides thereof, by an insertion or deletion of one or more amino acid residues and/or the substitution of one or more amino acid residues by different amino acid residues.
  • amino acid changes are of a minor nature, that is conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain. Examples of conservative substitutions are within the group of basic amino acids
  • amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine).
  • Amino acid substitutions which do not generally alter the specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe,
  • nucleic acid sequences of the present invention may be obtained from microorganisms of any genus.
  • the term "obtained from” is used as defined herein.
  • the polypeptide encoded by a nucleic acid sequence of the present invention is secreted extracellularly.
  • the nucleic acid sequences may be obtained from a fungal source, and more preferably from a yeast strain such as a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain; or more preferably from a filamentous fungal strain such as an Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, or Trichoderma strain.
  • a yeast strain such as a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowi
  • the nucleic acid sequences are obtained from a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis strain.
  • the nucleic acid sequences are obtained from an
  • Aspergillus aculeatus Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride strain.
  • the nucleic acid sequences are obtained from a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum strain.
  • the nucleic acid sequences are obtained from a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium gramin
  • Fusarium venenatum and most preferably from Fusarium venenatum ATCC 20334, e.g., the nucleic acid sequence set forth in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3.
  • nucleic acid sequence of SEQ ID NO. 1 is the sequence contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-
  • NRRL B-30071 In another more preferred embodiment, the nucleic acid sequence of
  • SEQ ID NO. 3 is the sequence contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30076.
  • the nucleic acid sequence is nucleotides 4013 to 5743 of SEQ ID NO. 1, which encodes a mature polypeptide.
  • the nucleic acid sequence is nucleotides 993 to 1593 of SEQ ID NO. 2, which encodes a mature polypeptide.
  • the nucleic acid sequence is nucleotides 3061 to 3678 of SEQ ID NO. 3, which encodes a mature polypeptide.
  • the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamo ⁇ hs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents. Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL). Furthermore, such nucleic acid sequences may be identified and obtained from other sources including microorganisms isolated from nature (e.g.
  • the nucleic acid sequence may then be derived by similarly screening a genomic or cDNA library of another microorganism. Once a nucleic acid sequence encoding a polypeptide has been detected with the probe(s), the sequence may be isolated or cloned by utilizing techniques which are known to those of ordinary skill in the art (see, e.g., Sambrook et al, 1989, supra).
  • the present invention also relates to mutant nucleic acid sequences comprising at least one mutation in the mature polypeptide coding sequence of SEQ ID NO. 1, SEQ ID NO.
  • mutant nucleic acid sequence encodes a polypeptide which consists of amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6, respectively.
  • the present invention also relates to nucleic acid constructs, recombinant vectors, and host cells containing the nucleic acid sequences described above. The same methods may be used as described earlier for their construction.
  • the present invention further relates to the polypeptides encoded by the nucleic acid sequences described above as well as methods of production of the polypeptides using the methods described herein.
  • Chemicals used as buffers and substrates were commercial products of at least reagent grade.
  • COVE trace metals solution was composed per liter of 0.04 g of NaB 4 O 7 -10H 2 O, 0.4 g of CuSO 4 -5H 2 O, 1.2 g of FeSO 4 -7H 2 O, 0.7 g of MnSO 4 -H 2 O, 0.8 g of Na 2 MoO 2 -2H 2 0, and 10 g of ZnSO 4 -7H 2 O.
  • COVE medium was composed per liter of 342.3 g of sucrose, 20 ml of 50X COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl 2 , and 25 g of Noble agar.
  • 50X Vogels medium was composed per liter of 150 g of sodium citrate, 250 g of KH 2 PO 4 , 10 g of MgSO 4 -7H 2 O, 10 g of CaCl 2 -2H 2 O, 2.5 ml of biotin stock solution, and
  • COVE top agarose was composed per liter of 20 ml of 50X COVE salts, 0.8 M sucrose, 1.5 M cesium chloride, 1.0 M acetamide, and 10 g of low melt agarose, pH adjusted to 6.0.
  • B ASTA top agarose was composed of COVE top agarose supplemented with 10 mg/ml of the herbicide BastaTM (Hoechst Schering, Rodovre, Denmark).
  • RA sporulation medium was composed per liter of 50 g of succinic acid, 12.1 g of
  • NaNO 3 1 g of glucose, 20 ml of 50X Vogels, and 0.5 ml of a 10 mg/ml NaMoO 4 stock solution, pH to 6.0.
  • YEPG medium was composed per liter of 10 g of yeast extract, 20 g of peptone, and 20 g of glucose.
  • STC was composed of 0.8 M sorbitol, 25 mM Tris pH 8, 25 mM CaCl 2 .
  • SPTC was composed of 40% PEG 4000, 0.8 M sorbitol, 25 mM Tris pH 8, 25 mM CaCl 2 .
  • M400Da medium was composed per liter of 50 g of maltodextrin, 2 g of
  • Example 1 Production of Fusarium venenatum mycelial tissue
  • Fusarium venenatum CC1-3 a mo ⁇ hological mutant of Fusarium strain ATCC 20334 (Wiebe et al, 1991, Mycological Research 95: 1284-1288), was grown in a two- liter lab-scale fermentor using a fed-batch fermentation scheme with NUTRIOSETM (Roquette Freres, S.A., Beinheim, France) as the carbon source and yeast extract. Ammonium phosphate was provided in the feed. The pH was maintained at 6 to 6.5, and the temperature was kept at 30°C with positive dissolved oxygen.
  • Example 1 according to the method of Timberlake and Barnard (1981, Cell 26: 29-37), and the RNA samples were analyzed by Northern hybridization after blotting from 1% formaldehyde-agarose gels (Davis et al, 1986, Basic Methods in Molecular Biology,
  • Double-stranded cDNA was synthesized using approximately 5 ⁇ g of poly(A)+ mRNA according to the method of Gubler and Hoffman (1983, Gene 25: 263-269) except a N ⁇ tI-(dT)18 primer (Pharmacia Biotech, Inc., Piscataway, ⁇ J) was used to initiate first strand synthesis.
  • the cD ⁇ A was treated with mung bean nuclease (Boehringer Mannheim Co ⁇ oration, Indianapolis, IN) and the ends were made blunt with T4 DNA polymerase (New England Biolabs, Beverly, MA).
  • the cDNA was digested with Notl, size selected by agarose gel electrophoresis
  • Two independent directional cDNA libraries were constructed using the plasmid cloning vector pZ ⁇ rO-2.1.
  • Library A was made using mRNA from mycelia harvested at four days, and Library B was constructed with mRNA from the six day time point.
  • Neither cDNA library was amplified in order to examine a representative "snapshot" of the gene expression profile in the cells. Instead the libraries were plated, titered, and independent clones from each were analyzed by DNA sequencing.
  • Library A (4 day cells) consisted of about 7.5 x 10 4 independent clones and
  • the primary microtiter plates were stored frozen at -80°C.
  • the secondary deep-dish plates were incubated at 37°C overnight with vigorous agitation (300 ⁇ ra) on rotary shaker.
  • each secondary culture plate was covered with a polypropylene pad (Advanced Genetic Technologies Co ⁇ oration, Gaithersburg, MD) and a plastic microtiter dish cover. DNA was isolated from each well using the 96-well Miniprep Kit protocol of
  • Nucleotide sequence data were scrutinized for quality, and samples giving improper spacing less than or equal to 9.2 or ambiguity levels exceeding 3% were discarded or re-run.
  • Vector sequences were trimmed with assistance of FACTURATM software (Perkin-Elmer Applied Biosystems, Inc., Foster City, CA).
  • FACTURATM software Perkin-Elmer Applied Biosystems, Inc., Foster City, CA.
  • sequences were truncated at the end of each sample when the number of ambiguous base calls increased. All sequences were compared to each other to construct overlapping contigs using TIGR Assembler software (Sutton, G.G. et al, 1995, Genome Science and
  • Putative glucoamylase clones were identified by partial sequencing of random cDNA clones using an Applied Biosystems Model 377 XL Automated DNA Sequencer according to the manufacturer's instructions and comparison of the deduced amino acid sequence to the sequences in the NRDB as described in Example 4. From more than 2000 cDNA sequences analyzed, two clones from Library A and nine clones from Library B showed amino acid sequence homology to glucoamylase proteins from other fungi and yeasts.
  • glucoamylase cDNA clones discovered in this manner, one was estimated to be full-length (encoding the complete protein) on the basis of its alignment to the Neurospora crassa (Geneseq protein accession number R71034) and Humicola grisea (Trembl accession number Q 12623) glucoamylase amino acid sequences and the presence of a possible signal peptide, detected using the Signal-P computer program (Nielsen, et al, 1997, Protein Engineering 10: 1-6).
  • This clone designated E. coli FA0401 containing plasmid pFA0401 was selected for use as a probe to clone the corresponding glucoamylase genomic DNA sequence from Fusarium venenatum (see Example 7).
  • Example 6 Construction a library of Fusarium venenatum genomic DNA
  • Genomic libraries were constructed in ⁇ ZipLox as specified by the procedure of Berka et al. (1998, Appl. Environ. Microbiol. 64, 4423-4427). Briefly, Fusarium venenatum total cellular DNA was partially digested with Tsp5Q91 and size-fractionated on 1% agarose gels. DNA fragments migrating in the size range 3-7 kb were excised and eluted from the agarose gel slices using Prep-a-Gene reagents (BioRad, Hercules,
  • the eluted DNA fragments were ligated with EcoRI-cleaved and dephosphorylated ⁇ ZipLox vector arms (Life Technologies, Gaithersburg, MD), and the ligation mixtures were packaged using commercial packaging extracts (Stratagene, La Jolla, CA).
  • the packaged DNA libraries were plated and amplified on Escherichia coli Y1090ZL cells and stored at 4°C using standard methods (Davis, R.W., Botstein, D., and Roth, J.R.,
  • Example 7 Isolation, nucleotide sequencing and characterization of a genomic DNA segment encoding Fusarium venenatum glucoamylase
  • plaques from the Fusarium venenatum genomic DNA library were screened by hybridization (Davis et al, 1980, supra) with a radiolabeled probe fragment comprising the cloned cDNA insert from pFA0401 (Example 5) using high stringency conditions (i.e., hybridization at 45°C in 50%) formamide, 5 x SSPE, 0.3%> SDS, 200 ⁇ g/ml sheared and denatured salmon sperm DNA; filters washed once in 0.2 X SSPE with 0.1% SDS at 45°C followed by two washes in 0.2 X SSPE with no SDS at the same temperature).
  • high stringency conditions i.e., hybridization at 45°C in 50%
  • Plaques which gave hybridization signals were purified twice on E. coli Y1090ZL cells, and the individual clones were subsequently excised from the ⁇ ZipLox vector as pZLl -derivatives (D'Alessio et al, 1992, Focus® 14: 76).
  • DNA sequence analysis revealed that one of these clones, containing a plasmid designated pFAMG, comprised the entire glucoamylase coding region as well as 3.9 kb of 5'-flanking and 0.3 kb of 3'-flanking DNA encompassing the promoter and terminator regions, respectively (see Figure 1).
  • DNA sequencing of the cloned insert in pFAMG was done with an Applied
  • genomic sequence data By comparing the genomic sequence data to the contig of glucoamylase cDNA sequences, it was determined that the genomic DNA segment encoding Fusarium venenatum glucoamylase contained an open reading frame of 1743 bp interrupted by an intron of 51 bp and encoding a polypeptide of 581 amino acids.
  • the nucleotide sequence The nucleotide sequence
  • Example 8 Amino terminal sequence analysis of Fusarium venenatum glucoamylase
  • the PVDF membrane was stained with 0.1 % Commassie Blue R-250 in 40% methanol/1% acetic acid for 20 seconds and destained in 50% ethanol to observe the protein bands.
  • the major polypeptide species migrating at approximately 65 kDa was excised and subjected to N-terminal sequencing on an Applied Biosystems 476A Protein Sequencer (Perkin Elmer/Applied Biosystems Division, Foster City, CA) with on-line HPLC and liquid phase trifluoroacetic acid (TFA) delivery. Sequencing reagents were from Perkin Elmer/Applied Biosystems Division. (Foster City, CA).
  • Detection of phenylthiohydantoin-amino acids was accomplished by on-line HPLC using Buffer A containing 3.5% tetrahydrofuran in water with 18 ml of the Premix concentrate (Perkin Elmer/ Applied Biosystems Division, Foster City, CA) containing acetic acid, sodium acetate, and sodium hexanesulfonate and Buffer B containing Acetonitrile. Data was collected and analyzed on a Macintosh Ilsi using Applied Biosystems 610 Data Analysis
  • Example 9 Identification of abundant cDNA clones encoding an putative vacuolar associated protein and an unknown secreted gene product Two additional cDNA species were selected based on their relative abundance among the clones present in Libraries A and B (Example 2).
  • Clone FA0035 containing pFA0035, encoded a primary translation product of 200 amino acids with a possible signal peptide of 18 amino acids that was detected using the Signal-P computer program (Nielsen, et al, 1997, supra). Clone FA0035 was represented by approximately 1.9% of the cDNA clones in Library A and 0.8% of Library B. Comparison of the deduced amino acid sequence of clone FA0035 to the sequences in the NRDB as described in Example 4 revealed no significant homology to any known protein sequences, and it is therefore categorized as an unknown open reading frame (ORF). The name "Daria" was arbitrarily assigned to this clone.
  • Clone FA0759 containing plasmid pFA0759, encoded a polypeptide of 187 amino acids with 72% amino acid sequence identity to a putative subunit of the vacuolar associated protein from Neurospora crassa (Trembl accession number P87252). This gene product did not appear to be a secreted protein as no signal peptide was detected using Signal-P software. Clone FA0759 was represented by approximately 2.0% of the cDNA clones in Library A and 1.5% of Library B.
  • Example 10 Cloning and nucleotide sequence analysis of genomic DNA segments encoding unknown genes "Daria" and the putative vacuolar associated protein
  • Fusarium venenatum genomic DNA segments encoding the unknown secreted protein "Daria" and the putative vacuolar associated protein were isolated by screening the ⁇ ZipLox library described in Examples 6 and 7. Radiolabeled cDNA inserts from plasmids pFA0035 and pFA0759 were used as probes to screen the library. Plaques which hybridized strongly to either probe using the same conditions in Example 7 were purified twice on E. coli Y1090ZL cells, and the individual clones were subsequently excised from the ⁇ ZipLox vector as pZLl -derivatives (D'Alessio et al, 1992, supra).
  • DNA sequence analysis revealed that one of these clones, containing a plasmid designated as pECO3, comprised the entire "Daria" coding region as well as 0.9 kb of 5'-flanking and 0.9 kb of 3'-flanking DNA encompassing the promoter and terminator regions, respectively.
  • the nucleotide sequence (SEQ ID NO. 2) and deduced amino acid sequence (SEQ ID NO. 5) are shown in Figure 2.
  • the coding region was punctuated by a single 55 bp intron.
  • a genomic DNA clone was isolated through screening of the ⁇ ZipLox library with a radiolabeled probe derived from the cDNA insert of pFA0579.
  • the genomic clone designated as pQUINN, encoded the entire vacuolar associated protein subunit plus 3.0 kb of 5'-flanking and 0.3 kb of 3'-flanking DNA comprising the promoter and terminator regions, respectively.
  • the nucleotide sequence SEQ ID NO. 3
  • deduced amino acid sequence SEQ ID NO. 6
  • Nucleotide sequence comparisons between the genomic and cDNA clones revealed the presence of a 594 bp intron in the 5 '-untranslated region of the putative vacuolar associated protein subunit.
  • the coding region contained a 77 bp intron.
  • Plasmid pDM181 was constructed using the technique of splice overlap extension to fuse the 1.2 kb Fusarium oxysporum trypsin promoter to the 1.1 kb Fusarium oxysporum trypsin terminator.
  • a polylinker containing Swal, Kp ⁇ and Pad restriction sites was inserted between the promoter and terminator as part of the overlapping PCR strategy.
  • a Xho site was added and the native EcoRl site was preserved.
  • Hindlll and Nsil sites were inco ⁇ orated by the PCR reaction.
  • a PCR fragment containing -1208 to -1 of the Fusarium oxysporum trypsin promoter plus a 25 base pair polylinker was generated from plasmid pJRoy20 (Royer et al, 1995, Biotechnology 13: 1479-1483) using the following primers:
  • Primer 1 (sense): 5'-GAGCTCGAGGAATTCTTACAAACCTTCAAC-3' (SEQ ID NO. 7)
  • the 100 ⁇ l PCR reaction contained 10 ng of pJRoy20, 50 pmol of each primer,
  • PCR conditions were 95°C for 3 minutes followed by 25 cycles at 95°C for 30 seconds, 50°C for 1 minute, and 72°C for 1 minute. The final extension cycle was at 72°C for 5 minutes.
  • the final 2.3 kb overlapping PCR fragment which contained -1208 to -1 of the Fusarium oxysporum trypsin promoter, the 25 base pair polylinker and 1060 base pairs of the Fusarium oxysporum trypsin terminator was obtained using 0.2 ⁇ l of the first PCR
  • the Fusarium venenatum expression vector pSheBl ( Figure 5) was generated by modification of pDM181.
  • the modifications included (a) removal of two Ncol sites within the pDM181 sequence, and (b) restoration of the natural translation start of the
  • Fusarium oxysporum trypsin promoter (reconstruction of an Ncol site at the ATG start codon).
  • Example 13 Construction of pDM194 and pDM218
  • the 7.8 kb plasmid pDM194 (7.8 kb) used to obtain expression of Thermomyces lanuginosus (formerly designated Humicola lanuginosa) lipase in Fusarium venenatum has the following gene elements:
  • E. coli vector pUC19 and a 1.8 kB fragment comprising the Aspergillus nidulans amdS gene promoter (Hynes et al, 1988, Mol. Cell. Biol. 8: 2589-2596), Streptomyces hygroscopicus phosphinothricin acetyltransferase (bar) gene (Thompson et al., 1987, EMBO Journal 6: 2519-2514), and Aspergillus niger AMG terminator.
  • the Sw ⁇ llP ⁇ cl lipase fragment was generated by PCR.
  • Plasmid pMHan37 which contains the cDNA of the Thermomyces lanuginosus lipase gene (EP 305 216) was used as the template.
  • PCR primers 5 and 6 shown below were used to introduce a Swal site at the 5' end and a Pad site at the 3' end of the lipase coding region.
  • IX PCR buffer Perkin-Elmer Corp., Branchburg, NJ
  • 250 ⁇ M each of dATP, dCTP, dGTP, and dTTP, and 5 units of Taq DNA polymerase Perkin-Elmer Co ⁇ ., Branchburg, NJ
  • the PCR conditions used were one cycle at 95°C for five minutes followed by 30 cycles at 95°C for 1 minute, 55°C for one minute, and 72°C for two minutes.
  • the 0.9 kb PCR product was subcloned into pCRII of the TA Cloning Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions.
  • Plasmid DNA was isolated using a Qiagen Maxiprep Kit (Qiagen, Santa Clarita, CA), digested with Swal and Pad, and electrophoresed on a 1% agarose gel for one hour at 100 volts.
  • the 0.9 kb fragment was excised, purified using a SpinBind Kit (FMC, Rockland, ME), and cloned into pBANe ⁇
  • pBANe ⁇ was digested with Swal and Pad and the 0.9 kb lipase fragment was ligated to Swal/ Pad digested pDM181 yielding lipase expression plasmid pDM194
  • pDM218 was constructed from pJRoy35 ( Figure 7). Notl and Emel restriction sites were introduced at the 5' end of the Fusarium oxysporum trypsin promoter by PCR.
  • a 362 bp amplicon containing the 5' end of the promoter was produced using pDM194 as a template with the following primers: multil : 5'-ATAAGAATGCGGCCGCTAGTTTAAACTTACAAACCTTCAACAGTG-
  • the 100 ⁇ l PCR reaction contained 150 ng of 3 kb EcoRI fragment, 50 pmol of each primer, IX Pwo buffer, 200 ⁇ M each of dATP, dCTP, dGTP, and dTTP, and 5 units of Pwo DNA polymerase.
  • the PCR conditions used were one cycle at 95°C for 3 minutes, 30 cycles at 95°C for 1 minute, 50°C for 1 minute, and 72°C for 1.5 minutes; followed by a 5 minute extension at 72°C.
  • the amplicon was subcloned into vector pCR-Blunt (Invitrogen, Carlsbad, CA). A 0.25 kb NotllBcul fragment was electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using a QIAquick Gel Extraction Kit (Qiagen, Santa Clarita, CA).
  • Hpal, Snd&l, and PpuM sites were introduced at the 3' end of the Fusarium oxysporum trypsin terminator by PCR.
  • a 714 bp amplicon containing the 3' end of the trypsin terminator was produced using the 3 kb EcoRI fragment as template with the following primers: multi3: 5'-GTGTGCAGTGACCCAGAAT-3' (S ⁇ Q ID NO.21) multi4: 5'-GATTGGGTCCCTACGTAGTTAACACTATAGGCCATCGTTTAC-3'
  • the 100 ⁇ l PCR reaction contained 50 pmol of each primer, 150 ng of the 3 kb
  • a 2.3 kb BcullNhel fragment containing the 3' end of the Fusarium oxysporum trypsin promoter, the Humicola lanuginosa lipase gene (Geneseq nucleotide accession number N91076), and the 5' end of the Fusarium oxysporum trypsin terminator was isolated from pDM194.
  • the plasmid pMWR60 was derived from the expression vector pEJG25A.
  • pEJG25A was constructed by insertion of a phytase coding sequence from Peniophora lycii (WO 98/28408) into pDM181 (Example 11) as follows: First, two synthetic oligonucleotide primers shown below were designed to amplify the Peniophora lyci phytase coding sequence from plasmid pAlphy2 (WO
  • Reverse primer 5'-TTAATTAACTATTCCGACGGAACAAAGC-3' (SEQ ID NO.
  • Each 100 ⁇ l Pwo polymerase reaction contained 50 pmol of each primer, 1 ng of template DNA, 2 ⁇ l of 10 mM dNTPs, IX Pwo polymerase buffer, and 2.5 units of Pwo polymerase. The reactions were incubated in a Perkin Elmer Model 9600 Thermal
  • Cycler programmed as follows: One cycle at 94°C for 2 minutes, 55°C for 30 seconds, and 72°C for 1 minute; 9 cycles at 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 1 minute; 15 cycles at 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 1 minute, with an extension of 20 seconds per cycle; a final cycle at 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 7 minutes; and a soak cycle at 4°C.
  • the reaction product was electrophoresed on a 1% agarose gel for one hour at 100 volts. The 1.3 kb band was excised and purified using Qiaex II.
  • the purified PCR product was subsequently cloned into the plasmid pCR2.1 (Invitrogen, Carlsbad, CA) and used to transform E. coli TOP 10 cells (Invitrogen, Carlsbad, CA). Plasmid DNA was isolated from several of the transformant colonies and analyzed by DNA sequencing to ensure that no mutations were introduced during the PCR. Subsequently one phytase clone was digested with restriction endonucleases Swal and Pad. The fragments were electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using Qiaex II. The 1.3 kb phytase gene fragment was ligated with pDM181 (Example
  • pEJG25A was mutagenized using the Quick-ChangeTM site-directed mutagenesis kit in combination with the following oligonucleotide primers to obtain the vector pMWR60-Int2: primer A: 5'-CTCTTGGATATCTATCTCTTCACCATGGTTTCTTCGGCATTCGC-3' (SEQ ID NO. 25) primer B:
  • the purified fragment was ligated with pSheBl (described in Example 12) which had been previously digested with Notl.
  • the resulting intermediate was designated as pMWR60-Int4a.
  • pMWR60- Int4a was then cut with Bspl ⁇ Jl ll plus Nbel, and a 5.25 kb segment was purified as above.
  • This isolated segment was ligated with pSheBl, which had also been digested with -9-spLUl lI plus Nbel, and purified as above.
  • the resulting vector product was named pMWR60 ( Figure 10).
  • Example 15 Generation of a lipase reporter gene
  • the gene encoding the LIPOLASETM enzyme was obtained from pAFIL (WO 92/05249).
  • the Seal site of the ampicillin gene of pAHL was changed to a Mlul site by use of the primer 7258, thus changing the Seal site found in the ampicillin resistance gene and used for cutting to a
  • Primer 7258 5'-GAATGACTTGGTTGACGCGTCACCAGTCAC-3' (SEQ ID NO. 27)
  • the pAHL vector comprising the LIPOLASETM gene was then used as a template for DNA polymerase with oligos 7258 and 7770, thus changing the Seal site found in the
  • Primer 7770 5'-TCTAGCCCAGAATACTGGATCAAATC-3' (SEQ ID NO. 28)
  • the desired mutation (e.g., the introduction of a cysteine residue) was introduced into the LIPOLASETM gene by addition of an appropriate oligos comprising the desired mutation.
  • Primer 101782 shown below was used to introduce SPPCGRRP (-E).
  • Primer 101782 5'-GGACGGCCTTGGCTAGCCCTCCGTGCGGCCGCCGGCCGGTCTCAGGATC
  • Primer 9639 shown below was used to introduce E239C.
  • Primer 9639 5'-ATATCGTGAAGATATGCGGCATTGATGCCACC-3' (SEQ ID NO.
  • Primer 8829 5'-GGCGGCAATAACCGGCCGAACATTCCGGATATCCC-3' (SEQ ID NO: 1
  • Example 16 Construction of pRaMB60 Plasmid pRaMB60 was constructed by ligating the 6.5 kb Sful-Nhel vector fragment from pMWR60 with a 0.5 kb Sful-Nhel fragment from pSheBl . All fragments were isolated by agarose gel electrophoresis and purified from gel slices using BioRad Prep-a-Gene reagents (BioRad Laboratories, Hercules, CA).
  • Example 17 Construction of plasmid pRaMB62, an expression vector containing the glucoamylase promoter
  • a unique BspUJl ll site was generated by site-directed mutagenesis of plasmid pFAMG using the following primers in combination with the Quick-ChangeTM mutagenesis kit : primer 1 : 5'-dCACTGCTATCACCAACATGTTTACTCAAGTCC-3' (SEQ ID NO. 33) primer 2: 5'-dGGACTTGAGTAAACATGTTGGTGATAGCAGTG-3' (SEQ ID NO.
  • the lipase reporter gene described in Example 15 was amplified by PCR using plasmid pEVil l63 as template with the following primers which introduced a
  • the PCR reaction was composed of 1 ⁇ l of template DNA (10 ng), 1 ⁇ l of forward primer (77 pmol), 1 ⁇ l of reverse primer (81 pmol), 10 ⁇ l of 10X Pwo polymerase buffer, 16 ⁇ l of 1.25 mM dNTP mix, and 1 ⁇ l (2.5 units) of Pwo polymerase.
  • the reaction was incubated in a Perkin-Elmer Model 480 thermocycler using the following temperature settings: One cycle at 95°C for 5 minutes; 30 cycles at 95°C for 1 minute. 47°C for 1 minute, and 68°C for 2 minutes; and a 4°C soak cycle.
  • the amplified product was then digested with BspHl plus E ⁇ cl, purified by agarose gel electrophoresis (Example 16), and used in a three-part ligation with the 5.8 kb Pmel-Ncol fragment of pRaMB60 and the 2.1 kb Stz.I--5-.pLUl II fragment from pMWR62-intl .
  • the resulting vector, designated pRaMB62 ( Figure 11) contained the lipase reporter gene under the transcriptional control of the Fusarium venenatum glucoamylase promoter.
  • Example 18 Construction of plasmid pRaMB64, an expression vector containing the "Daria” promoter
  • the promoter region from pECO3 (Example 10), termed the "Daria” promoter, was amplified using PCR in combination with the following primer pair that were designed to introduce Sw ⁇ l and Bspl ⁇ Jl ll sites at the 5' and 3' ends of the promoter segment, respectively: primer 1 : 5'-GCATTTAAATTACTACTGTGATGTG-3 * (SEQ ID NO. 37) primer 2: 5'-GATTGATGTGAAACACATGTTGATG-3' (SEQ ID NO. 38)
  • the PCR reaction was composed of 1 ⁇ l of pECO3 (10 ng), 1 ⁇ l of forward primer (50 pmol), 1 ⁇ l of reverse primer (50 pmol), 10 ⁇ l of 10X Pwo polymerase buffer, 16 ⁇ l of 1.25 mM dNTP mix, and 1 ⁇ l (2.5 units) of Pwo polymerase.
  • the reaction was incubated in a Perkin-Elmer Model 480 thermocycler using the following temperature settings: One cycle at 95°C for 5 minutes; 30 cycles at 95°C for 1 minute, 47°C for 1 minute, and 68°C for 2 minutes; and a 4°C soak cycle.
  • the 0.9 kb PCR product was electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using Qiaex II.
  • the amplified DNA segment was subcloned into pCR2.1 (Invitrogen, Carlsbad, CA) and analyzed by restriction enzyme cleavage with Sw ⁇ l, .RspLUl lI, EcoRI, and Xhol to verify that it was correct.
  • the plasmid generated in this manner termed p ⁇ CO4, was digested with Swal plus Bspl ⁇ Jl ll, and the 0.9 kb promoter fragment was purified by gel electrophoresis as described in Example 16.
  • the purified fragment was mixed in a three-part ligation with the 5.8 kb Pmel-Ncol fragment of pRaMB60 and the 0.9 kb BspUl-Pacl segment encoding the lipase reporter gene.
  • Example 19 Construction of plasmid pRaMB66, an expression vector containing the promoter derived from the vacuolar associated protein gene
  • the promoter segment from pQUINN (Example 10), encoding a putative vacuolar associated protein, was amplified by PCR with the following primers which introduced a Sm ⁇ l site and an Ncol site at the 5'and 3' ends of the promoter, respectively: primer 1 : 5'-dCGACCCGGGAATTAGAGAGGTTAGG-3' (SEQ ID NO. 39) primer 2: 5'-dCGTATAACCCATGGTGGACTTGTCGGAC-3' (SEQ ID NO. 40)
  • the PCR reaction was composed of 1 ⁇ l of pQUINN (10 ng), 1 ⁇ l of forward primer (50 pmol), 1 ⁇ l of reverse primer (50 pmol), 10 ⁇ l of 10X Pwo polymerase buffer, 16 ⁇ l of 1.25 mM dNTP mix, and 1 ⁇ l (2.5 units) of Pw polymerase.
  • the reaction was incubated in a Perkin-Elmer Model 480 thermocycler using the following temperature settings: One cycle at 95°C for 5 minutes; 30 cycles at 95°C for 1 minute, 47°C for 1 minute, and 68°C for 2 minutes; and a 4°C soak cycle.
  • the 3.1 kb amplified DNA fragment was electrophoresed on a 1%> agarose gel for one hour at 100 volts, excised, and purified using Qiaex II.
  • the 3.1 kb amplified DNA fragment was subcloned into pCR-Script (Stratagene, La Jolla, CA) to generate the intermediate plasmid pQUINN-promoterA.
  • Two restriction fragments were isolated from this plasmid; a 2.4 kb Smal-Ndel fragment, and a 0.7 kb Ndel-Ncol fragment (together these segments span the entire promoter region).
  • the isolated fragments were combined in a four-part ligation with the 8 kb Pmel-Ncol fragment of pRaMB60 and the 0.9 kb BspHl-Pad segment encoding the lipase reporter gene described in the previous examples.
  • the product of this ligation, pRaMB66 ( Figure 13), contained the lipase reporter gene under the transcriptional control of the putative vacuolar associated protein gene promoter.
  • Example 20 Expression of the lipase reporter gene in Fusarium venenatum under control of the AMG, "Daria" and vacuolar associated protein promoters
  • Spores of Fusarium venenatum CC1-3 were generated by inoculating a flask containing 500 ml of RA sporulation medium with 10 plugs from a IX Vogels medium plate (2.5% Noble agar) supplemented with 2.5% glucose and 2.5 mM sodium nitrate and incubating at 28°C, 150 ⁇ m for 2 to 3 days. Spores were harvested through Miracloth (Calbiochem, San Diego, CA) and centrifuged 20 minutes at 7000 ⁇ m in a
  • Sorvall RC-5B centrifuge E. I. DuPont De Nemours and Co., Wilmington, DE.
  • Pelleted spores were washed twice with sterile distilled water, resuspended in a small volume of water, and then counted using a hemocytometer.
  • Protoplasts were prepared by inoculating 100 ml of YEPG medium with 4 X 10 7 spores of Fusarium venenatum CC1-3 and incubating for 16 hours at 24°C and 150 ⁇ m.
  • the culture was centrifuged for 7 minutes at 3500 ⁇ m in a Sorvall RT 6000D (E. I.
  • the pellet was resuspended, washed twice with STC, and centrifuged at 2000 ⁇ m for 10 minutes to pellet the protoplasts.
  • Protoplasts were counted with a hemocytometer and resuspended in an 8:2:0.1 solution of STC:SPTC:DMSO to a final concentration of 1.25 x 10 7 protoplasts/ml.
  • the protoplasts were stored at -80°C, after controlled-rate freezing in a Nalgene Cryo 1°C Freezing Container (VWR Scientific, Inc., San Francisco, CA).
  • Frozen protoplasts of Fusarium venenatum CC1-3 were thawed on ice.
  • Five to ten ⁇ g of pRaMB62, pRaMB64, and pRaMB66 (described in Examples 17-19) and 5 ⁇ l of heparin (5 mg per ml of STC) were added to separate 50 ml sterile polypropylene tubes.
  • One hundred ⁇ l of protoplasts was added to each tube, mixed gently, and incubated on ice for 30 minutes.
  • One ml of SPTC was added and incubated 20 minutes at room temperature.
  • BASTATM is phosphinothricin.
  • BASTATM was obtained from AgrEvo (Hoechst Schering, Rodovre, Denmark) and was extracted twice with phenol:chloroform:isoamyl alcohol (25:24:1), and once with chloroform:isoamyl alcohol (24: 1) before use.
  • the transformants were picked directly from the selection plates (COVE underlay with COVE-BASTATM overlay) into 125 ml shake flasks containing 25 ml of M400Da medium supplemented with 1 mM CaCl 2 and 100 ⁇ g/ml ampicillin (to prevent bacterial contamination) and incubated at 28°C, 200 ⁇ m on a platform shaker for 7 days.
  • the untransformed recipient strain was also included as a negative control.
  • Flasks were sampled at 7 days. Cells were removed by centrifugation, and 10 ⁇ l of each supernatant sample was heated to 95 °C for 5 minutes with an equal volume of Tris-glycine sample buffer (Novex Experimental Technology, San Diego, CA). The denatured supernatant proteins were separated on a 10-20% Tris-glycine gradient gel (Novex Experimental Technology, San Diego, CA) and stained with Coomassie blue. SDS-PAGE analysis showed that the lipase-producing transformants secrete a prominent polypeptide with an apparent molecular weight of approximately 43 kDa.
  • Example 21 Comparative expression of the Humicola lanuginosa lipase reporter gene under control of Fusarium venenatum amyloglucosidase and Fusarium oxysporum trypsin promoters Fusarium venenatum CC1-3 transformants containing either pRamB64 (Example
  • Figure 14 shows comparative expression of the Humicola lanuginosa lipase reporter gene in Fusarium venenatum under control of either the Fusarium venenatum amyloglucosidase (pAMG) promoter or Fusarium oxysporum trypsin (pSP387) promoter.
  • the results demonstrated higher levels of lipase activity with the Fusarium venenatum amyloglucosidase promoter than the Fusarium oxysporum trypsin promoter whether urea or ammonium phosphate was used as the source of nitrogen in the feed.
  • higher levels of lipase activity were observed using ammonium phosphate in the feed
  • E. coli DH10B (pQUINN) NRRL B-30076 October 27, 1998
  • E. coli TOP 10 (pFB0346) NRRL B-30073 October 27, 1998
  • the strains have been deposited under conditions that assure that access to the culture swill be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. ⁇ 1.14 and 35 U.S.C. ⁇ 122.
  • the deposits represent substantially pure cultures of the deposited strains. The deposits are available as required by foreign patent laws in countries wherein counte ⁇ arts of the subject application, or its progeny are filed.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to methods for producing a polypetide, comprising: (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first nucleic acid sequence encoding the polypeptide operably linked to a second nucleic acid sequence comprising a promoter foreign to the nucleic acid sequence, wherein the promoter comprises a sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and a subsequence thereof; and mutant, hybrid, and tandem promoters thereof; and (b) isolating the polypeptide from the cultivation medium. The present invention also relates to the isolated promoter sequences and to constructs, vectors, and fungal host cells comprising the promoter sequences operably linked to nucleic acid sequences encoding polypetides.

Description

PROMOTERS FOR EXPRESSING GENES IN A FUNGAL CELL
Background of the Invention
Field of the Invention
The present invention relates to methods for producing polypeptides. The present invention also relates to isolated promoters and to nucleic acid constructs, vectors, and host cells comprising the promoters operably linked to nucleic acid sequences encoding polypeptides.
Description of the Related Art
The recombinant production of a heterologous protein in a fungal host cell, particularly a filamentous fungal cell such as Aspergillus, may provide for a more desirable vehicle for producing the protein in commercially relevant quantities.
Recombinant production of a heterologous protein is accomplished by constructing an expression cassette in which the DNA coding for the protein is placed under the expression control of a promoter, excised from a regulated gene, suitable for the host cell. The expression cassette is introduced into the host cell, usually by plasmid- mediated transformation. Production of the heterologous protein is then achieved by culturing the transformed host cell under inducing conditions necessary for the proper functioning of the promoter contained on the expression cassette.
The development of a new fungal host cell for the recombinant production of proteins generally requires the availability of promoters that are suitable for controlling the expression of the proteins in the host cell. Fusarium venenatum has been shown to be useful as a new host cell for such expression (WO 96/00787, WO 97/26330). Moreover, the promoter from the Fusarium oxysporum trypsin-like protease gene has been described which is useful for expressing heterologous genes in Fusarium venenatum host cells (US 5,837,847). However, there is a need in the art for new promoters for controlling the expression of heterologous genes.
It is an object of the present invention to provide improved methods for producing a polypeptide in a fungal host cell and new promoters for such production. Summary of the Invention
The present invention relates to methods for producing a polypeptide, comprising: (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first nucleic acid sequence encoding the polypeptide operably linked to a second nucleic acid sequence comprising a promoter foreign to the nucleic acid sequence, wherein the promoter comprises a sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and subsequences thereof; and mutant, hybrid, and tandem promoters thereof; and (b) isolating the polypeptide from the cultivation medium.
The present invention also relates to isolated promoters sequences and to constructs, vectors, and fungal host cells comprising one or more of the promoters operably linked to a nucleic acid sequence encoding a polypeptide.
The present invention also relates to methods for obtaining mutant promoters of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3.
The present invention also relates to isolated nucleic acid sequences, selected from the group consisting of:
(a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least 65% identity with amino acids 22 to 581 of SEQ ID NO. 4, at least 65% identity with amino acids 19 to 200 of SEQ ID NO. 5, or at least 65% identity with amino acids 1 to 187 of SEQ ID NO. 6; (b) a nucleic acid sequence having at least 65% homology with nucleotides
4013 to 5743 of SEQ ID NO. 1, at least 65% homology with nucleotides 993 to 1593 of SEQ ID NO. 2, or at least 65% homology with nucleotides 3061 to 3678 of SEQ ID NO. 3;
(c) a nucleic acid sequence which hybridizes under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to
3678 of SEQ ID NO. 3; (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (iii) a subsequence of (i) or (ii) of at least 100 nucleotides, or (iv) a complementary strand of (i), (ii), or (iii);
(d) a nucleic acid sequence encoding a variant of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID. NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids;
(e) an allelic variant of (a), (b), or (c); and
(f) a subsequence of (a), (b), (c), or (e).
The present invention further relates to constructs, vectors, and recombinant host cells of the nucleic acid sequences.
Brief Description of the Figures
Figures 1A-F shows the genomic DNA sequence and the deduced amino acid sequence of a Fusarium venenatum glucoamylase gene (SEQ ID NOs. 1 and 4, respectively).
Figures 2A-C shows the genomic DNA sequence and the deduced amino acid sequence of a Fusarium venenatum gene designated "Daria" (SEQ ID NOs. 2 and 5, respectively). Figures 3A-D shows the genomic DNA sequence and the deduced amino acid sequence of a Fusarium venenatum gene designated "Quinn" (SEQ ID NOs. 3 and 6, respectively).
Figure 4 shows a restriction map of pDM181. Figure 5 shows a restriction map of pSheBl . Figure 6 shows a restriction map of pDM194.
Figure 7 shows a restriction map of pJRoy35. Figure 8 shows a restriction map of pDM218. Figure 9 shows a restriction map of pEJG25A. Figure 10 shows a restriction map of pMWR60. Figure 11 shows a restriction map of pRaMB62.
Figure 12 shows a restriction map of pRaMB64. Figure 13 shows a restriction map of pRaMB66. Figure 14 shows comparative expression of a Humicola lanuginosa lipase reporter gene in Fusarium venenatum under control of Fusarium venenatum amyloglucosidase (pAMG) and Fusarium oxysporum trypsin (pSP387) promoters.
Detailed Description of the Invention
The present invention relates to methods for producing a polypeptide, comprising (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first nucleic acid sequence encoding the polypeptide operably linked to a second nucleic acid sequence comprising a promoter foreign to the first nucleic acid sequence, wherein the promoter comprises a sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and subsequences thereof; and mutant, hybrid, and tandem promoters thereof; and (b) isolating the polypeptide from the cultivation medium.
In the production methods of the present invention, the cells are cultivated in a nutrient medium suitable for production of the polypeptide using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the polypeptide to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it can be recovered from cell lysates.
The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate.
The resulting polypeptide may be recovered by methods known in the art. For example, the polypeptide may be recovered from the nutrient medium by conventional procedures including, but not limited to, centrifugation, filtration, extraction, spray- drying, evaporation, or precipitation.
The polypeptides may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS- PAGE, or extraction (see, e.g., Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).
Promoters
The term "promoter" is defined herein as a DNA sequence that binds RNA polymerase and directs the polymerase to the correct downstream transcriptional start site of a nucleic acid sequence encoding a polypeptide to initiate transcription. RNA polymerase effectively catalyzes the assembly of messenger RNA complementary to the appropriate DNA strand of the coding region. The term "promoter" will also be understood to include the 5' non-coding region (between promoter and translation start) for translation after transcription into mRNA, cw-acting transcription control elements such as enhancers, and other nucleotide sequences capable of interacting with transcription factors.
The term "mutant promoter" is defined herein as a promoter having a nucleotide sequence comprising a substitution, deletion, and/or insertion of one or more nucleotides of a parent promoter, wherein the mutant promoter has more or less promoter activity than the corresponding parent promoter. The term "mutant promoter" will also encompass natural variants and in vitro generated variants obtained using methods well known in the art such as classical mutagenesis, site-directed mutagenesis, and DNA shuffling.
The term "hybrid promoter" is defined herein as parts of two more promoters that are fused together to generate a sequence that is a fusion of the two or more promoters, which is operably linked to a coding sequence and mediates the transcription of the coding sequence into mRNA.
The term "tandem promoter" is defined herein as two or more promoter sequences each of which is operably linked to a coding sequence and mediates the transcription of the coding sequence into mRNA.
The term "operably linked" is defined herein as a configuration in which a control sequence, e.g., a promoter sequence, is appropriately placed at a position relative to a coding sequence such that the control sequence directs the production of a polypeptide encoded by the coding sequence.
The term "coding sequence" is defined herein as a nucleic acid sequence that is transcribed into mRNA which is translated into a polypeptide when placed under the control of the appropriate control sequences. The boundaries of the coding sequence are generally determined by the ATG start codon located just upstream of the open reading frame at the 5' end of the mRNA and a transcription terminator sequence located just downstream of the open reading frame at the 3' end of the mRNA. A coding sequence can include, but is not limited to, genomic DNA, cDNA, semisynthetic, synthetic, and recombinant nucleic acid sequences. In a preferred embodiment, the promoter has the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1, or a subsequence thereof. The subsequence preferably contains at least about 2100 nucleotides, more preferably at least about 2400 nucleotides, and most preferably at least about 2700 nucleotides.
In another preferred embodiment, the promoter has the nucleic acid sequence of nucleotides 1 to 938 of SEQ ID NO. 2, or a subsequence thereof. The subsequence preferably contains at least about 840 nucleotides, more preferably at least about 870 nucleotides, and most preferably at least about 900 nucleotides.
In another preferred embodiment, the promoter has the nucleic acid sequence of nucleotides 1 to 3060 of SEQ ID NO. 3, or a subsequence thereof. The subsequence preferably contains at least about 2100 nucleotides, more preferably at least about 2400 nucleotides, and most preferably at least about 2700 nucleotides.
In another preferred embodiment, the promoter is the nucleic acid sequence contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-30067. In another preferred embodiment, the promoter is the nucleic acid sequence contained in plasmid pFAMG which is contained in Escherichia coli NRRL B-30071. In another a preferred embodiment, the promoter is the nucleic acid contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30075. In the methods of the present invention, the promoter may also be a mutant of the promoters described above having a substitution, deletion, and/or insertion of one or more nucleotides in the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3. A mutant promoter may have one or more mutations. Each mutation is an independent substitution, deletion, and/or insertion of a nucleotide. The introduction of a substitution, deletion, and/or insertion of a nucleotide into the promoter may be accomplished using any of the methods known in the art such as classical mutagenesis, site-directed mutagenesis, or DNA shuffling. Particularly useful is a procedure which utilizes a supercoiled, double stranded DNA vector with an insert of interest and two synthetic primers containing the desired mutation. The oligonucleotide primers, each complementary to opposite strands of the vector, extend during temperature cycling by means of Pfu DNA polymerase. On incorporation of the primers, a mutated plasmid containing staggered nicks is generated. Following temperature cycling, the product is treated with Dpnl which is specific for methylated and hemimethylated DNA to digest the parental DNA template and to select for mutation-containing synthesized DNA. Other procedures known in the art may also be used.
In a preferred embodiment, the promoter is a mutant of nucleotides 1 to 3949 of SEQ ID NO. 1. In another preferred embodiment, the promoter is a mutant of nucleotides 1 to 938 of SEQ ID NO. 2. In another preferred embodiment, the promoter is a mutant of nucleotides 1 to 3060 of SEQ ID NO. 3.
In the methods of the present invention, the promoter may also be a hybrid promoter comprising a portion of one or more promoters of the present invention; a portion of a promoter of the present invention and a portion of another promoter, e.g., a leader sequence of one promoter and the transcription start site from the other promoter; or a portion of one or more promoters of the present invention and a portion of one or more other promoters. The other promoter may be any promoter sequence which shows transcriptional activity in the fungal host cell of choice including a mutant, truncated, and hybrid promoter, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The other promoter sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide and native or foreign to the cell. Examples of other promoters useful in the construction of hybrid promoters with the promoters of the present invention include the promoters obtained from the genes for
Aspergillus oryzae TAKA amylase. Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase,
Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase,
Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (WO
96/00787), as well as the NA2-tpi promoter (a hybrid of the promoters from the genes for
Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triose phosphate isomerase), Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3 -phosphate dehydrogenase (ADH2/GAP), and Saccharomyces cerevisiae 3-phosphoglycerate kinase, and mutant, truncated, and hybrid promoters thereof. Other useful promoters for yeast host cells are described by Romanos et al, 1992, Yeast 8: 423-488.
The promoter may also be a tandem promoter comprising two more promoters of the present invention or alternatively one or more promoters of the present invention and one or more other promoters, such as those exemplified above. The two or more promoter sequences of the tandem promoter may simultaneously promote the transcription of the nucleic acid sequence. Alternatively, one or more of the promoter sequences of the tandem promoter may promote the transcription of the nucleic acid sequence at different stages of growth of the cell.
In the methods of the present invention, the promoter is foreign to the nucleic acid sequence encoding a polypeptide of interest, but the promoter or nucleic acid sequence may be native to the fungal host cell. A mutant, hybrid, or tandem promoter of the present invention will be understood to be foreign to a nucleic acid sequence encoding a polypeptide even if the wild-type promoter is native to the nucleic acid sequence.
A mutant, hybrid, or tandem promoter of the present invention has at least about 20%, preferably at least about 40%, more preferably at least about 60%, more preferably at least about 80%. more preferably at least about 90%, more preferably at least about 100%, even more preferably at least about 200%, most preferably at least about 300%, and even most preferably at least about 400% of the promoter activity of the promoter of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3.
Polypeptide Encoding Nucleic Acid Sequences The polypeptide encoded by the nucleic acid sequence may be native or heterologous to the fungal host cell of interest.
The term "polypeptide" is not meant herein to refer to a specific length of the encoded product and, therefore, encompasses peptides, oligopeptides, and proteins. The term "heterologous polypeptide" is defined herein as a polypeptide which is not native to the fungal cell, a native polypeptide in which modifications have been made to alter the native sequence, or a native polypeptide whose expression is quantitatively altered as a result of a manipulation of the fungal cell by recombinant DNA techniques. For example, a native polypeptide may be recombinantly produced by, e.g., placing a gene encoding the polypeptide under the control of a promoter of the present invention to enhance expression of the polypeptide, to expedite export of a native polypeptide of interest outside the cell by use of a signal sequence, and to increase the copy number of a gene encoding the polypeptide normally produced by the cell. The fungal cell may contain one or more copies of the nucleic acid sequence encoding the polypeptide.
Preferably, the polypeptide is a hormone or variant thereof, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter. In a preferred embodiment, the polypeptide is secreted extracellularly. In a more preferred embodiment, the polypeptide is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase. In an even more preferred embodiment, the polypeptide is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phospholipase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase. The nucleic acid sequence encoding a polypeptide of interest may be obtained from any prokaryotic, eukaryotic, or other source. For purposes of the present invention, the term "obtained from" as used herein in connection with a given source shall mean that the polypeptide is produced by the source or by a cell in which a gene from the source has been inserted.
The techniques used to isolate or clone a nucleic acid sequence encoding a polypeptide of interest are known in the art and include isolation from genomic DNA, preparation from cDNA, or a combination thereof. The cloning of the nucleic acid sequence from such genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR). See, for example, Innis et al., 1990, PCR Protocols: A
Guide to Methods and Application, Academic Press, New York. The cloning procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incorporation of the recombinant vector into the mutant fungal cell where multiple copies or clones of the nucleic acid sequence will be replicated. The nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof. In the methods of the present invention, the polypeptide may also include a fused or hybrid polypeptide in which another polypeptide is fused at the N-terminus or the C- terminus of the polypeptide or fragment thereof. A fused polypeptide is produced by fusing a nucleic acid sequence (or a portion thereof) encoding one polypeptide to a nucleic acid sequence (or a portion thereof) encoding another polypeptide. Techniques for producing fusion polypeptides are known in the art, and include, ligating the coding sequences encoding the polypeptides so that they are in frame and expression of the fused polypeptide is under control of the same promoter(s) and terminator. The hybrid polypeptide may comprise a combination of partial or complete polypeptide sequences obtained from at least two different polypeptides wherein one or more may be heterologous to the mutant fungal cell.
Nucleic Acid Constructs
The present invention also relates nucleic acid constructs comprising a nucleic acid sequence encoding a polypeptide operably linked to a promoter of the present invention and one or more control sequences which direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
Expression will be understood to include any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
"Nucleic acid construct" is defined herein as a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or which has been modified to contain segments of nucleic acid combined and juxtaposed in a manner that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term expression cassette when the nucleic acid construct contains a coding sequence and all the control sequences required for expression of the coding sequence. An isolated nucleic acid sequence encoding a polypeptide may be further manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the nucleic acid sequence prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying nucleic acid sequences utilizing recombinant DNA methods are well known in the art. In the methods of the present invention, the nucleic acid sequence may comprise one or more native control sequences or one or more of the native control sequences may be replaced with one or more control sequences foreign to the nucleic acid sequence for improving expression of the coding sequence in a host cell.
The term "control sequences" is defined herein to include all components which are necessary or advantageous for the expression of a polypeptide of the present invention. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter of the present invention, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter of the present invention, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleic acid sequence encoding a polypeptide.
The control sequence may be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.
Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase,
Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease.
Preferred terminators for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3 -phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al. , 1992, supra. The control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA which is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used in the present invention. Preferred leaders for filamentous fungal host cells are obtained from the genes for
Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
Suitable leaders for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3- phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3 -phosphate dehydrogenase
(ADH2/GAP).
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3' terminus of the nucleic acid sequence and which, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence which is functional in the host cell of choice may be used in the present invention.
Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin- like protease, and Aspergillus niger alpha-glucosidase.
Useful polyadenylation sequences for yeast host cells are described by Guo and
Sherman, 1995, Molecular Cellular Biology 15: 5983-5990. The control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region which encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region which is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Alternatively, the foreign signal peptide coding region may simply replace the natural signal peptide coding region in order to enhance secretion of the polypeptide. However, any signal peptide coding region which directs the expressed polypeptide into the secretory pathway of a host cell of choice may be used in the present invention.
Effective signal peptide coding regions for filamentous fungal host cells are the signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.
Useful signal peptides for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al, 1992, supra.
The control sequence may also be a propeptide coding region that codes for an amino acid sequence positioned at the amino terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila laccase (WO 95/33836). Where both signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is positioned next to the amino terminus of a polypeptide and the signal peptide region is positioned next to the amino terminus of the propeptide region.
It may also be desirable to add regulatory sequences which allow the regulation of the expression of the polypeptide relative to the growth of the host cell. Examples of regulatory systems are those which cause the expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the TAKA alpha-amylase promoter, Aspergillus niger glucoamylase promoter, and Aspergillus oryzae glucoamylase promoter may be used as regulatory sequences. Other examples of regulatory sequences are those which allow for gene amplification. In eukaryotic systems, these include the dihydrofolate reductase gene which is amplified in the presence of methotrexate, and the metallothionein genes which are amplified with heavy metals. In these cases, the nucleic acid sequence encoding the polypeptide would be operably linked with the regulatory sequence. The present invention also relates to nucleic acid constructs for altering the expression of a gene encoding a polypeptide which is endogenous to a host cell. The constructs may contain the minimal number of components necessary for altering expression of the endogenous gene. In one embodiment, the nucleic acid constructs preferably contain (a) a targeting sequence, (b) a promoter of the present invention, (c) an exon, and (d) a splice-donor site. Upon introduction of the nucleic acid construct into a cell, the construct inserts by homologous recombination into the cellular genome at the endogenous gene site. The targeting sequence directs the integration of elements (a)-(d) into the endogenous gene such that elements (b)-(d) are operably linked to the endogenous gene. In another embodiment, the nucleic acid constructs contain (a) a targeting sequence, (b) a promoter of the present invention, (c) an exon, (d) a splice- donor site, (e) an intron, and (f) a splice-acceptor site, wherein the targeting sequence directs the integration of elements (a)-(f) such that elements (b)-(f) are operably linked to the endogenous gene. However, the constructs may contain additional components such as a selectable marker. In both embodiments, the introduction of these components results in production of a new transcription unit in which expression of the endogenous gene is altered. In essence, the new transcription unit is a fusion product of the sequences introduced by the targeting constructs and the endogenous gene. In one embodiment in which the endogenous gene is altered, the gene is activated. In this embodiment, homologous recombination is used to replace, disrupt, or disable the regulatory region normally associated with the endogenous gene of a parent cell through the insertion of a regulatory sequence which causes the gene to be expressed at higher levels than evident in the corresponding parent cell. The activated gene can be further amplified by the inclusion of an amplifiable selectable marker gene in the construct using methods well known in the art (see, for example, U.S. Patent No. 5,641,670). In another embodiment in which the endogenous gene is altered, expression of the gene is reduced. The targeting sequence can be within the endogenous gene, immediately adjacent to the gene, within an upstream gene, or upstream of and at a distance from the endogenous gene. One or more targeting sequences can be used. For example, a circular plasmid or DNA fragment preferably employs a single targeting sequence, while a linear plasmid or DNA fragment preferably employs two targeting sequences. The constructs further contain one or more exons of the endogenous gene. An exon is defined as a DNA sequence which is copied into RNA and is present in a mature mRNA molecule such that the exon sequence is in-frame with the coding region of the endogenous gene. The exons can, optionally, contain DNA which encodes one or more amino acids and/or partially encodes an amino acid. Alternatively, the exon contains DNA which corresponds to a 5' non-encoding region. Where the exogenous exon or exons encode one or more amino acids and/or a portion of an amino acid, the nucleic acid construct is designed such that, upon transcription and splicing, the reading frame is in- frame with the coding region of the endogenous gene so that the appropriate reading frame of the portion of the mRNA derived from the second exon is unchanged. The splice-donor site of the constructs directs the splicing of one exon to another exon. Typically, the first exon lies 5' of the second exon, and the splice-donor site overlapping and flanking the first exon on its 3' side recognizes a splice-acceptor site flanking the second exon on the 5' side of the second exon. A splice-acceptor site, like a splice-donor site, is a sequence which directs the splicing of one exon to another exon. Acting in conjunction with a splice-donor site, the splicing apparatus uses a splice- acceptor site to effect the removal of an intron.
The present invention further relates to methods for producing a polypeptide comprising (a) cultivating a homologously recombinant cell, having incorporated therein a new transcription unit comprising a promoter of the present invention, an exon, and/or a splice donor site operably linked to a second exon of an endogenous nucleic acid sequence encoding the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide. The methods are based on the use of gene activation technology, for example, as described in U.S. Patent No. 5,641,670.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a promoter of the present invention, a nucleic acid sequence encoding a polypeptide, and transcriptional and translational stop signals. The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one or more convenient restriction sites to allow for insertion or substitution of the promoter and/or nucleic acid sequence encoding the polypeptide at such sites. Alternatively, the nucleic acid sequence may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the promoter and/or sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with a promoter of the present invention and one or more appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids.
The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Suitable markers for yeast host cells are ADE2,
HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB
(ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5 '-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are the amdS and pyrG genes of Aspergillus nidulans or Aspergillus oryzae and the bar gene of Streptomyces hygroscopicus. The vectors of the present invention preferably contain an element(s) that permits stable integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination. Alternatively, the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences. On the other hand, the vector may be integrated into the genome of the host cell by non- homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARSl, ARS4, the combination of ARSl and CEN3, and the combination of
ARS4 and CEN6. The origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e.g., Ehrlich, 1978,
Proceedings of the National Academy of Sciences USA 75: 1433).
More than one copy of a nucleic acid sequence encoding a polypeptide may be inserted into the host cell to increase production of the gene product. An increase in the copy number of the nucleic acid sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the nucleic acid sequence where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the nucleic acid sequence, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al, 1989, supra).
Host Cells
The present invention also relates to recombinant host cells, comprising a promoter of the present invention operably linked to a nucleic acid sequence encoding a polypeptide, which are advantageously used in the recombinant production of the polypeptides. A vector comprising a promoter of the present invention operably linked to a nucleic acid sequence encoding a polypeptide is introduced into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extrachromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.
The host cell may be any fungal cell useful in the methods of the present invention. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota,
Chytridiomycota, and Zygomycota (as defined by Hawksworth et al, In, Ainsworth and
Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press,
Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al, 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al, 1995, supra).
In a preferred embodiment, the fungal host cell is a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M., and
Davenport, R.R., eds, Soc. App. Bacterial Symposium Series No. 9, 1980).
In a more preferred embodiment, the yeast host cell is a Candida, Hansenula,
Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
In a most preferred embodiment, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell. In another most preferred embodiment, the yeast host cell is a
Kluyveromyces lactis cell. In another most preferred embodiment, the yeast host cell is a
Yarrowia lipolytica cell. In another preferred embodiment, the fungal host cell is a filamentous fungal cell.
"Filamentous fungi" include all filamentous forms of the subdivision Eumycota and
Oomycota (as defined by Hawksworth et al, 1995, supra). The filamentous fungi are characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as
Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
In a more preferred embodiment, the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma.
In a most preferred embodiment, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger or Aspergillus oryzae cell. In another most preferred embodiment, the filamentous fungal host cell is a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, or Fusarium venenatum cell. In another most preferred embodiment, the filamentous fungal host cell is a Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Thielavia terrestris, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
In an even most preferred embodiment, the Fusarium venenatum cell is Fusarium venenatum A3/5, which was originally deposited as Fusarium graminearum ATCC 20334 and recently reclassified as Fusarium venenatum by Yoder and Christianson, 1998, Fungal Genetics and Biology 23: 62-80 and O'Donnell et al, 1998, Fungal Genetics and Biology 23: 57-67; as well as taxonomic equivalents of Fusarium venenatum regardless of the species name by which they are currently known. In another preferred embodiment, the Fusarium venenatum cell is a moφhological mutant of Fusarium venenatum A3/5 or Fusarium venenatum ATCC 20334, as disclosed in WO 97/26330.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023 and Yelton et al, 1984, Proceedings of the National Academy of Sciences USA 81 : 1470-1474. Suitable methods for transforming Fusarium species are described by Malardier et al, 1989, Gene 78: 147-156 and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al, 1983, Journal of Bacteriology 153: 163; and Hinnen et al, 1978, Proceedings of the National Academy of Sciences USA 75: 1920. Methods For Obtaining Mutant Promoters
The present invention further relates to methods for obtaining a mutant promoter, comprising (a) introducing at least one mutation into the sequence of nucleotides 1 to
3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3, wherein the mutant promoter has promoter activity; and (b) isolating the mutant promoter.
The present invention also relates to methods for obtaining a mutant promoter by
(a) hybridizing a DNA under very low, low, medium, medium-high, high, or very high stringency conditions with (i) SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, (ii) the cDNA sequence contained in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii); and (b) isolating the mutant promoter from the DNA. Stringency and wash conditions are defined herein.
The mutant promoter may be isolated using methods known in the art such as restriction enzyme digestion or PCR amplification.
Nucleic Acid Sequences
The present invention also relates to isolated nucleic acid sequences, selected from the group consisting of: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least 65% identity with amino acids 22 to 581 of SEQ ID NO. 4, at least 65% identity with amino acids 19 to 200 of SEQ ID NO. 5, or at least 65% identity with amino acids 1 to 187 of SEQ ID NO. 6;
(b) a nucleic acid sequence having at least 65% homology with nucleotides 4013 to 5743 of SEQ ID NO. 1, at least 65% homology with nucleotides 993 to 1593 of
SEQ ID NO. 2, or at least 65% homology with nucleotides 3061 to 3678 of SEQ ID NO. 3;
(c) a nucleic acid sequence which hybridizes under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (iii) a subsequence of (i) or (ii) of at least 100 nucleotides, or (iv) a complementary strand of (i), (ii), or (iii);
(d) a nucleic acid sequence encoding a variant of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID. NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids;
(e) an allelic variant of (a), (b), or (c); and
(f) a subsequence of (a), (b), (c), or (e).
The term "isolated nucleic acid sequence" as used herein refers to a nucleic acid sequence which is essentially free of other nucleic acid sequences, e.g., at least about 20% pure, preferably at least about 40% pure, more preferably at least about 60% pure, even more preferably at least about 80% pure, and most preferably at least about 90% pure as determined by agarose electrophoresis. For example, an isolated nucleic acid sequence can be obtained by standard cloning procedures used in genetic engineering to relocate the nucleic acid sequence from its natural location to a different site where it will be reproduced. The cloning procedures may involve excision and isolation of a desired nucleic acid fragment comprising the nucleic acid sequence encoding the polypeptide, insertion of the fragment into a vector molecule, and incoφoration of the recombinant vector into a host cell where multiple copies or clones of the nucleic acid sequence will be replicated. The nucleic acid sequence may be of genomic, cDNA, RNA, semisynthetic, synthetic origin, or any combinations thereof.
In a first embodiment, the present invention relates to isolated nucleic acid sequences encoding polypeptides having an amino acid sequence which has a degree of identity to amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6 (i.e., the mature polypeptide) of at least about 65%, preferably at least about 70%, more preferably at least about 80%, even more preferably at least about 90%, most preferably at least about 95%, and even most preferably at least about 97% (hereinafter "homologous polypeptides"). In a preferred embodiment, the homologous polypeptides have an amino acid sequence which differs by five amino acids, preferably by four amino acids, more preferably by three amino acids, even more preferably by two amino acids, and most preferably by one amino acid from amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6. For puφoses of the present invention, the degree of identity between two amino acid sequences is determined by the Clustal method (Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc., Madison, WI) with an identity table and the following multiple alignment parameters: Gap penalty of 10, and gap length penalty of 10. Pairwise alignment parameters were Ktuple=l, gap penalty=3, windows=5, and diagonals=5.
Preferably, the nucleic acid sequences of the present invention encode polypeptides that comprise the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or
SEQ ID NO. 6; or an allelic variant thereof; or a fragment thereof. In a more preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that comprises the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that comprises amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6; or an allelic variant thereof; or a fragment thereof. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that comprises amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that consists of the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6; or an allelic variant thereof; or a fragment thereof. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that consists of the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that consists of amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6; or an allelic variant thereof; or a fragment thereof. In another preferred embodiment, the nucleic acid sequence of the present invention encodes a polypeptide that consists of amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6.
The present invention also encompasses nucleic acid sequences which encode a polypeptide having the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6, which differ from SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, respectively, by virtue of the degeneracy of the genetic code. The present invention also relates to subsequences of SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3 which encode fragments of SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively. A subsequence is a nucleic acid sequence encompassed by SEQ ID NO. 1 , SEQ
ID NO. 2, or SEQ ID NO. 3, except that one or more nucleotides from the 5' and/or 3' end have been deleted. Preferably, a subsequence of SEQ ID NO. 1 contains at least 1410 nucleotides, more preferably at least 1500 nucleotides, and most preferably at least 1590 nucleotides. Preferably, a subsequence of SEQ ID NO. 2 contains at least 450 nucleotides, more preferably at least 480 nucleotides, and most preferably at least 510 nucleotides. Preferably, a subsequence of SEQ ID NO. 3 contains at least 465 nucleotides, more preferably at least 495 nucleotides, and most preferably at least 525 nucleotides. A fragment of SEQ ID NO. 4, SEQ ID NO. 6, or SEQ ID NO. 6 is a polypeptide having one or more amino acids deleted from the amino and/or carboxy terminus of this amino acid sequence. Preferably, a fragment of SEQ ID NO. 4 contains at least 470 amino acid residues, more preferably at least 500 amino acid residues, and most preferably at least 530 amino acid residues. Preferably, a fragment of SEQ ID NO. 5 contains at least 150 amino acid residues, more preferably at least 160 amino acid residues, and most preferably at least 170 amino acid residues. Preferably, a fragment of SEQ ID NO. 6 contains at least 155 amino acid residues, more preferably at least 165 amino acid residues, and most preferably at least 175 amino acid residues.
An allelic variant denotes any of two or more alternative forms of a gene occupying the same chomosomal locus. Allelic variation arises naturally through mutation, and may result in polymoφhism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. The allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
In a second embodiment, the present invention relates to isolated nucleic acid sequences which have a degree of homology to nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 4013 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3 (i.e., mature polypeptide coding region) of at least about 65%, preferably about 70%, preferably about 80%, more preferably about 90%, even more preferably about 95%. and most preferably about 97% homology, which encode an active polypeptide; or allelic variants and subsequences thereof. For puφoses of the present invention, the degree of homology between two nucleic acid sequences is determined by the Wilbur-
Lipman method (Wilbur and Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730) using the LASERGENE™ MEGALIGN™ software
(DNASTAR, Inc., Madison, WI) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters were Ktuple=3, gap penalty=3, and windows=20.
In a third embodiment, the present invention relates to isolated nucleic acid sequences encoding polypeptides which hybridize under very low stringency conditions, preferably low stringency conditions, more preferably medium stringency conditions, more preferably medium-high stringency conditions, even more preferably high stringency conditions, and most preferably very high stringency conditions with a nucleic acid probe which hybridizes under the same conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii) (J. Sambrook, E.F. Fritsch, and T. Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York). The subsequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3 may be at least 100 nucleotides or preferably at least 200 nucleotides. Moreover, the subsequence may encode a polypeptide fragment.
The nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, or a subsequence thereof, as well as the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5. or SEQ ID NO. 6, or a fragment thereof, may be used to design a nucleic acid probe to identify and clone DNA encoding polypeptides from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic or cDNA of the genus or species of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, preferably at least 25, and more preferably at least 35 nucleotides in length. Longer probes can also be used. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention. Thus, a genomic DNA or cDNA library prepared from such other organisms may be screened for DNA which hybridizes with the probes described above and which encodes a polypeptide. Genomic or other DNA from such other organisms may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA which is homologous with SEQ ID NO. 1 or a subsequence thereof, the carrier material is used in a Southern blot. For puφoses of the present invention, hybridization indicates that the nucleic acid sequence hybridizes to a labeled nucleic acid probe corresponding to the nucleic acid sequence shown in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, their complementary strands, or subsequences thereof, under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions are detected using X-ray film.
In a preferred embodiment, the nucleic acid probe is the nucleic acid sequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3. In another preferred embodiment, the nucleic acid probe is a nucleic acid sequence which encodes the polypeptide of SEQ ID
NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6, or subsequences thereof. In another preferred embodiment, the nucleic acid probe is SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3.
In another preferred embodiment, the nucleic acid probe is nucleotides 4013 to 5743 of
SEQ ID NO. 1, which encodes a mature polypeptide. In another preferred embodiment, the nucleic acid probe is nucleotides 993 to 5743 of SEQ ID NO. 2, which encodes a mature polypeptide. In another preferred embodiment, the nucleic acid probe is nucleotides 3061 to 3678 of SEQ ID NO. 3, which encodes a mature polypeptide. In another preferred embodiment, the nucleic acid probe is the nucleic acid sequence contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-30067. In another preferred embodiment, the nucleic acid probe is the nucleic acid sequence contained in plasmid pFAMG which is contained in Escherichia coli NRRL B-30071. In another preferred embodiment, the nucleic acid probe is the nucleic acid sequence contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30076.
In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-
30067. In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region contained in plasmid pFAMG which is contained in
Escherichia coli NRRL B-30071. In another preferred embodiment, the nucleic acid probe is the mature polypeptide coding region contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30076.
For long probes of at least 100 nucleotides in length, very low to very high stringency conditions are defined as prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 μg/ml sheared and denatured salmon sperm DNA, and either 25% formamide for very low and low stringencies, 35% formamide for medium and medium- high stringencies, or 50% formamide for high and very high stringencies, following standard Southern blotting procedures. For long probes of at least 100 nucleotides in length, the carrier material is finally washed three times each for 15 minutes using 2 x SSC, 0.2% SDS preferably at least at 45°C (very low stringency), more preferably at least at 50°C (low stringency), more preferably at least at 55°C (medium stringency), more preferably at least at 60°C (medium-high stringency), even more preferably at least at 65°C (high stringency), and most preferably at least at 70°C (very high stringency).
For short probes which are about 15 nucleotides to about 70 nucleotides in length, stringency conditions are defined as prehybridization, hybridization, and washing post- hybridization at 5°C to 10°C below the calculated Tm using the calculation according to Bolton and McCarthy (1962, Proceedings of the National Academy of Sciences USA 48:1390) in 0.9 M NaCl, 0.09 M Tris-HCl pH 7.6, 6 mM EDTA, 0.5% NP-40, IX Denhardt's solution, 1 mM sodium pyrophosphate, 1 mM sodium monobasic phosphate, 0.1 mM ATP, and 0.2 mg of yeast RNA per ml following standard Southern blotting procedures.
For short probes which are about 15 nucleotides to about 70 nucleotides in length, the carrier material is washed once in 6X SCC plus 0.1% SDS for 15 minutes and twice each for 15 minutes using 6X SSC at 5°C to 10°C below the calculated Tm.
The present invention also relates to isolated nucleic acid sequences produced by (a) hybridizing a DNA under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3, (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, nucleotides 3061 to 3678 of SEQ ID NO. 3, (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii); and (b) isolating the nucleic acid sequence from the DNA. The subsequence is preferably a sequence of at least 100 nucleotides such as a sequence which encodes a polypeptide fragment. In a fourth embodiment, the present invention relates to isolated nucleic acid sequences which encode variants of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids.
The amino acid sequences of the variant polypeptides may differ from the amino acid sequence of SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6, or the mature polypeptides thereof, by an insertion or deletion of one or more amino acid residues and/or the substitution of one or more amino acid residues by different amino acid residues. Preferably, amino acid changes are of a minor nature, that is conservative amino acid substitutions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of one to about 30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to about 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain. Examples of conservative substitutions are within the group of basic amino acids
(arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions which do not generally alter the specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. The most commonly occurring exchanges are Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe,
Ala Pro, Lys/Arg, Asp/Asn, Leu/Ile, LeuNal, Ala/Glu, and Asp/Gly as well as these in reverse.
The nucleic acid sequences of the present invention may be obtained from microorganisms of any genus. For puφoses of the present invention, the term "obtained from" is used as defined herein. In a preferred embodiment, the polypeptide encoded by a nucleic acid sequence of the present invention is secreted extracellularly.
The nucleic acid sequences may be obtained from a fungal source, and more preferably from a yeast strain such as a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia strain; or more preferably from a filamentous fungal strain such as an Acremonium, Aspergillus, Aureobasidium, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Piromyces, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, or Trichoderma strain.
In a preferred embodiment, the nucleic acid sequences are obtained from a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis strain. In another preferred embodiment, the nucleic acid sequences are obtained from an
Aspergillus aculeatus, Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride strain.
In another preferred embodiment, the nucleic acid sequences are obtained from a Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum strain. In a more preferred embodiment, the nucleic acid sequences are obtained from
Fusarium venenatum, and most preferably from Fusarium venenatum ATCC 20334, e.g., the nucleic acid sequence set forth in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3.
In another more preferred embodiment, the nucleic acid sequence of SEQ ID NO. 1 is the sequence contained in plasmid pECO3 which is contained in Escherichia coli NRRL B-
30067. In another more preferred embodiment, the nucleic acid sequence of SEQ ID NO.
2 is the sequence contained in plasmid pFAMG which is contained in Escherichia coli
NRRL B-30071. In another more preferred embodiment, the nucleic acid sequence of
SEQ ID NO. 3 is the sequence contained in plasmid pQUINN which is contained in Escherichia coli NRRL B-30076. In another preferred embodiment, the nucleic acid sequence is nucleotides 4013 to 5743 of SEQ ID NO. 1, which encodes a mature polypeptide. In another preferred embodiment, the nucleic acid sequence is nucleotides 993 to 1593 of SEQ ID NO. 2, which encodes a mature polypeptide. In another preferred embodiment, the nucleic acid sequence is nucleotides 3061 to 3678 of SEQ ID NO. 3, which encodes a mature polypeptide.
It will be understood that for the aforementioned species, the invention encompasses both the perfect and imperfect states, and other taxonomic equivalents, e.g., anamoφhs, regardless of the species name by which they are known. Those skilled in the art will readily recognize the identity of appropriate equivalents. Strains of these species are readily accessible to the public in a number of culture collections, such as the American Type Culture Collection (ATCC), Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM), Centraalbureau Voor Schimmelcultures (CBS), and Agricultural Research Service Patent Culture Collection, Northern Regional Research Center (NRRL). Furthermore, such nucleic acid sequences may be identified and obtained from other sources including microorganisms isolated from nature (e.g. , soil, composts, water, etc.) using the above-mentioned probes. Techniques for isolating microorganisms from natural habitats are well known in the art. The nucleic acid sequence may then be derived by similarly screening a genomic or cDNA library of another microorganism. Once a nucleic acid sequence encoding a polypeptide has been detected with the probe(s), the sequence may be isolated or cloned by utilizing techniques which are known to those of ordinary skill in the art (see, e.g., Sambrook et al, 1989, supra). The present invention also relates to mutant nucleic acid sequences comprising at least one mutation in the mature polypeptide coding sequence of SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, in which the mutant nucleic acid sequence encodes a polypeptide which consists of amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6, respectively.
The techniques used to isolate or clone a nucleic acid sequence encoding a polypeptide have been described herein.
The present invention also relates to nucleic acid constructs, recombinant vectors, and host cells containing the nucleic acid sequences described above. The same methods may be used as described earlier for their construction.
The present invention further relates to the polypeptides encoded by the nucleic acid sequences described above as well as methods of production of the polypeptides using the methods described herein.
The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.
Examples
Chemicals used as buffers and substrates were commercial products of at least reagent grade.
Media and Solutions
COVE trace metals solution was composed per liter of 0.04 g of NaB4O7-10H2O, 0.4 g of CuSO4-5H2O, 1.2 g of FeSO4-7H2O, 0.7 g of MnSO4-H2O, 0.8 g of Na2MoO2-2H20, and 10 g of ZnSO4-7H2O.
5 OX COVE salts solution was composed per liter of 26 g of KC1, 26 g of MgSO4-7H2O, 76 g of KH2PO4, and 50 ml of COVE trace metals.
COVE medium was composed per liter of 342.3 g of sucrose, 20 ml of 50X COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl2, and 25 g of Noble agar.
50X Vogels medium was composed per liter of 150 g of sodium citrate, 250 g of KH2PO4, 10 g of MgSO4-7H2O, 10 g of CaCl2-2H2O, 2.5 ml of biotin stock solution, and
5.0 ml of AMG trace metals solution.
? Trace metals solution was composed per liter of 14.3 g of ZnSO4-7H2O, 2.5 g of
CuSO4-5H2O, 0.5 g of NiCl2, 13.8 g of FeSO4, 8.5 g of MnSO4, and 3.0 g of citric acid. COVE top agarose was composed per liter of 20 ml of 50X COVE salts, 0.8 M sucrose, 1.5 M cesium chloride, 1.0 M acetamide, and 10 g of low melt agarose, pH adjusted to 6.0.
B ASTA top agarose was composed of COVE top agarose supplemented with 10 mg/ml of the herbicide Basta™ (Hoechst Schering, Rodovre, Denmark). RA sporulation medium was composed per liter of 50 g of succinic acid, 12.1 g of
NaNO3, 1 g of glucose, 20 ml of 50X Vogels, and 0.5 ml of a 10 mg/ml NaMoO4 stock solution, pH to 6.0.
YEPG medium was composed per liter of 10 g of yeast extract, 20 g of peptone, and 20 g of glucose. STC was composed of 0.8 M sorbitol, 25 mM Tris pH 8, 25 mM CaCl2.
SPTC was composed of 40% PEG 4000, 0.8 M sorbitol, 25 mM Tris pH 8, 25 mM CaCl2.
M400Da medium was composed per liter of 50 g of maltodextrin, 2 g of
MgSO4-7H2O, 2 g of KH2PO4, 4 g of citric acid, 8 g of yeast extract, 2 g of urea, and 1 ml of COVE trace metals solution.
Example 1: Production of Fusarium venenatum mycelial tissue
Fusarium venenatum CC1-3, a moφhological mutant of Fusarium strain ATCC 20334 (Wiebe et al, 1991, Mycological Research 95: 1284-1288), was grown in a two- liter lab-scale fermentor using a fed-batch fermentation scheme with NUTRIOSE™ (Roquette Freres, S.A., Beinheim, France) as the carbon source and yeast extract. Ammonium phosphate was provided in the feed. The pH was maintained at 6 to 6.5, and the temperature was kept at 30°C with positive dissolved oxygen.
Mycelial samples were harvested at 2, 4, 6, and 8 days post-inoculum and quick- frozen in liquid nitrogen. The samples were stored at -80°C until they were disrupted for RNA extraction. Example 2: cDNA library construction
Total cellular RNA was extracted from the mycelial samples described in
Example 1 according to the method of Timberlake and Barnard (1981, Cell 26: 29-37), and the RNA samples were analyzed by Northern hybridization after blotting from 1% formaldehyde-agarose gels (Davis et al, 1986, Basic Methods in Molecular Biology,
Elsevier Science Publishing Co., Inc., New York). Polyadenylated mRNA fractions were isolated from total RNA with an mRNA Separator Kit™ (Clontech Laboratories, Inc.,
Palo Alto, CA) according to the manufacturer's instructions. Double-stranded cDNA was synthesized using approximately 5 μg of poly(A)+ mRNA according to the method of Gubler and Hoffman (1983, Gene 25: 263-269) except a NøtI-(dT)18 primer (Pharmacia Biotech, Inc., Piscataway, ΝJ) was used to initiate first strand synthesis. The cDΝA was treated with mung bean nuclease (Boehringer Mannheim Coφoration, Indianapolis, IN) and the ends were made blunt with T4 DNA polymerase (New England Biolabs, Beverly, MA). The cDNA was digested with Notl, size selected by agarose gel electrophoresis
(ca. 0.7-4.5 kb), and ligated with pZErO-2.1 (Invitrogen, Carlsbad, CA) which had been cleaved with Notl plus EcoRV and dephosphorylated with calf-intestine alkaline phosphatase (Boehringer Mannheim Coφoration, Indianapolis, IN). The ligation mixture was used to transform competent E. coli TOP 10 cells (Invitrogen, Carlsbad, CA). Transformants were selected on 2YT agar plates (Miller, 1992, A Short Course in Bacterial Genetics. A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Press, Cold Spring Harbor, New York) which contained kanamycin at a final concentration of 50 μg/ml.
Two independent directional cDNA libraries were constructed using the plasmid cloning vector pZΕrO-2.1. Library A was made using mRNA from mycelia harvested at four days, and Library B was constructed with mRNA from the six day time point. Neither cDNA library was amplified in order to examine a representative "snapshot" of the gene expression profile in the cells. Instead the libraries were plated, titered, and independent clones from each were analyzed by DNA sequencing. Library A (4 day cells) consisted of about 7.5 x 104 independent clones and
Library B (6 day cells) consisted of roughly 1.2 x 105 clones. Miniprep DNA was isolated from forty colonies in each library and checked for the presence and size of cDNA inserts. In this analysis 39 of 40 colonies (97.5%) from Library A contained inserts with sizes ranging from 600 bp to 2200 bp (avg. = 1050 bp). Similarly, 39 of 40 colonies (97.5%) from Library B had inserts with sizes ranging from 800 bp to 3600 bp
(avg. = 1380 bp).
Example 3: Template preparation and nucleotide sequencing
From each cDNA library described in Example 2, 1192 transformant colonies were picked directly from the transformation plates into 96-well microtiter dishes which contained 200 μl of 2YT broth (Miller, 1992, supra) with 50 μg/ml kanamycin. The plates were incubated overnight at 37°C without shaking. After incubation 100 μl of sterile 50% glycerol were added to each well. The transformants were replicated into secondary, deep-dish 96-well microculture plates (Advanced Genetic Technologies Coφoration, Gaithersburg, MD) containing 1 ml of Magnificent Broth™ (MacConnell Research, San Diego, CA) supplemented with 50 μg of kanamycin per ml in each well. The primary microtiter plates were stored frozen at -80°C. The secondary deep-dish plates were incubated at 37°C overnight with vigorous agitation (300 φra) on rotary shaker. To prevent spilling and cross-contamination, and to allow sufficient aeration, each secondary culture plate was covered with a polypropylene pad (Advanced Genetic Technologies Coφoration, Gaithersburg, MD) and a plastic microtiter dish cover. DNA was isolated from each well using the 96-well Miniprep Kit protocol of
Advanced Genetic Technologies Coφoration (Gaithersburg, MD) as modified by Utterback et al. (1995, Genome Sci. Technol. 1 : 1-8). Single-pass DNA sequencing was done with a Perkin-Elmer Applied Biosystems Model 377 XL Automatic DNA Sequencer (Perkin-Elmer Applied Biosystems, Inc., Foster City, CA) using dye- terminator chemistry (Giesecke et al, 1992, Journal of Virology Methods 38: 47-60) and the reverse lac sequencing primer.
Example 4: Analysis of DNA sequence data
Nucleotide sequence data were scrutinized for quality, and samples giving improper spacing less than or equal to 9.2 or ambiguity levels exceeding 3% were discarded or re-run. Vector sequences were trimmed with assistance of FACTURA™ software (Perkin-Elmer Applied Biosystems, Inc., Foster City, CA). In addition, sequences were truncated at the end of each sample when the number of ambiguous base calls increased. All sequences were compared to each other to construct overlapping contigs using TIGR Assembler software (Sutton, G.G. et al, 1995, Genome Science and
Technology 1 : 9019) to determine multiplicity of various cDNA species represented in each library. Lastly, all sequences were translated in three frames and searched against a non-redundant data base (NRDB) using GeneAssist™ software (Perkin-Elmer Applied
Biosystems, Inc., Foster City, CA) with a modified Smith- Waterman algorithm using the
BLOSUM 62 matrix with a threshold score of 70. The NRDB was assembled from
Genpept, Swiss-Prot, and PIR databases.
Example 5: Identification of glucoamylase cDNA clones
Putative glucoamylase clones were identified by partial sequencing of random cDNA clones using an Applied Biosystems Model 377 XL Automated DNA Sequencer according to the manufacturer's instructions and comparison of the deduced amino acid sequence to the sequences in the NRDB as described in Example 4. From more than 2000 cDNA sequences analyzed, two clones from Library A and nine clones from Library B showed amino acid sequence homology to glucoamylase proteins from other fungi and yeasts. Among several glucoamylase cDNA clones discovered in this manner, one was estimated to be full-length (encoding the complete protein) on the basis of its alignment to the Neurospora crassa (Geneseq protein accession number R71034) and Humicola grisea (Trembl accession number Q 12623) glucoamylase amino acid sequences and the presence of a possible signal peptide, detected using the Signal-P computer program (Nielsen, et al, 1997, Protein Engineering 10: 1-6). This clone designated E. coli FA0401 containing plasmid pFA0401 was selected for use as a probe to clone the corresponding glucoamylase genomic DNA sequence from Fusarium venenatum (see Example 7).
Example 6: Construction a library of Fusarium venenatum genomic DNA
Genomic libraries were constructed in λZipLox as specified by the procedure of Berka et al. (1998, Appl. Environ. Microbiol. 64, 4423-4427). Briefly, Fusarium venenatum total cellular DNA was partially digested with Tsp5Q91 and size-fractionated on 1% agarose gels. DNA fragments migrating in the size range 3-7 kb were excised and eluted from the agarose gel slices using Prep-a-Gene reagents (BioRad, Hercules,
CA). The eluted DNA fragments were ligated with EcoRI-cleaved and dephosphorylated λZipLox vector arms (Life Technologies, Gaithersburg, MD), and the ligation mixtures were packaged using commercial packaging extracts (Stratagene, La Jolla, CA). The packaged DNA libraries were plated and amplified on Escherichia coli Y1090ZL cells and stored at 4°C using standard methods (Davis, R.W., Botstein, D., and Roth, J.R.,
1980, Advanced Bacterial Genetics, A Manual for Genetic Engineering, Cold Spring
Harbor Press, Cold Spring Harbor, NY).
Example 7: Isolation, nucleotide sequencing and characterization of a genomic DNA segment encoding Fusarium venenatum glucoamylase
Approximately 50,000 plaques from the Fusarium venenatum genomic DNA library (Example 6) were screened by hybridization (Davis et al, 1980, supra) with a radiolabeled probe fragment comprising the cloned cDNA insert from pFA0401 (Example 5) using high stringency conditions (i.e., hybridization at 45°C in 50%) formamide, 5 x SSPE, 0.3%> SDS, 200 μg/ml sheared and denatured salmon sperm DNA; filters washed once in 0.2 X SSPE with 0.1% SDS at 45°C followed by two washes in 0.2 X SSPE with no SDS at the same temperature). Plaques which gave hybridization signals, were purified twice on E. coli Y1090ZL cells, and the individual clones were subsequently excised from the λZipLox vector as pZLl -derivatives (D'Alessio et al, 1992, Focus® 14: 76). DNA sequence analysis revealed that one of these clones, containing a plasmid designated pFAMG, comprised the entire glucoamylase coding region as well as 3.9 kb of 5'-flanking and 0.3 kb of 3'-flanking DNA encompassing the promoter and terminator regions, respectively (see Figure 1). DNA sequencing of the cloned insert in pFAMG was done with an Applied
Biosystems Model 377 XL Automated DNA Sequencer using dye-terminator chemistry. Contiguous sequences were generated using a transposon insertion strategy (Primer Island Transposition Kit, Perkin-Elmer/ Applied Biosystems, Inc., Foster City, CA), and the glucoamylase genomic clone from pFAMG was sequenced to an average redundancy of4.2.
By comparing the genomic sequence data to the contig of glucoamylase cDNA sequences, it was determined that the genomic DNA segment encoding Fusarium venenatum glucoamylase contained an open reading frame of 1743 bp interrupted by an intron of 51 bp and encoding a polypeptide of 581 amino acids. The nucleotide sequence
(SEQ ID NO. 1) and deduced amino acid sequence (SEQ ID NO. 4) are shown in Figure
1. Using the SignalP program (Nielsen et al, 1997, Protein Engineering 10: 1-6), a signal peptide of 21 residues was predicted, and confirmed by amino terminal sequencing of the glucoamylase protein (Example 8). Thus, the mature glucoamylase is composed of
560 amino acids.
A comparative alignment of fungal glucoamylase protein sequences was undertaken using the Clustal method (Higgins, 1989, CABIOS 5: 151-153) using the LASERGENE™ MEGALIGN™ software (DNASTAR, Inc., Madison, WI) with an identity table and the following multiple alignment parameters: Gap penalty of 10 and gap length penalty of 10. Pairwise alignment parameters were Ktuple=l, gap penalty=3, windows=5, and diagonals=5. The alignment showed that the Fusarium venenatum glucoamylase shares identity with the following glucoamylases from other fungi (percent identical residues in parentheses): Neurospora crassa [Swissprot PI 4804] (47%), Aspergillus niger [Swissprot P04064] (46%), Humicola grisea [Trembl Q 12623] (44%), Hormoconis resinae [Swissprot Q03045] (41%), Corticium rolfsii [Q12596] (41%>), Schizosaccharomyces pombe [Trembl O60087] (31%>), and Rhizopus oryzae [Swissprot P07683] (23%).
Example 8: Amino terminal sequence analysis of Fusarium venenatum glucoamylase
The proteins in a sample of Fusarium venenatum fermentation broth (Example 1 ) were separated by 8-16% Tris-glycine SDS-PAGE (Novex, San Diego, CA) and electroblotted onto a PVDF membrane (Novex, San Diego, CA) using 10 mM CAPS (3- [cyclohexylamino]-l-propanesulfonic acid) in 10%> methanol, pH=11.0 for 2 hours at 25 volts. The PVDF membrane was stained with 0.1 % Commassie Blue R-250 in 40% methanol/1% acetic acid for 20 seconds and destained in 50% ethanol to observe the protein bands. The major polypeptide species migrating at approximately 65 kDa was excised and subjected to N-terminal sequencing on an Applied Biosystems 476A Protein Sequencer (Perkin Elmer/Applied Biosystems Division, Foster City, CA) with on-line HPLC and liquid phase trifluoroacetic acid (TFA) delivery. Sequencing reagents were from Perkin Elmer/Applied Biosystems Division. (Foster City, CA). Detection of phenylthiohydantoin-amino acids was accomplished by on-line HPLC using Buffer A containing 3.5% tetrahydrofuran in water with 18 ml of the Premix concentrate (Perkin Elmer/ Applied Biosystems Division, Foster City, CA) containing acetic acid, sodium acetate, and sodium hexanesulfonate and Buffer B containing Acetonitrile. Data was collected and analyzed on a Macintosh Ilsi using Applied Biosystems 610 Data Analysis
Software. Amino acid identifications were performed by visualizing chromatograms against a light source and determined by the operator. The N-terminal analysis yielded a protein sequence of Ser-Pro-Ser-Lys-Asp-Asn-Ser-Leu-Glu-Arg-Phe-Ile-Asp-Lys-Gln-
Ala-Asp-Ile-Ser (SEQ ID NO. 4).
Example 9: Identification of abundant cDNA clones encoding an putative vacuolar associated protein and an unknown secreted gene product Two additional cDNA species were selected based on their relative abundance among the clones present in Libraries A and B (Example 2).
Clone FA0035, containing pFA0035, encoded a primary translation product of 200 amino acids with a possible signal peptide of 18 amino acids that was detected using the Signal-P computer program (Nielsen, et al, 1997, supra). Clone FA0035 was represented by approximately 1.9% of the cDNA clones in Library A and 0.8% of Library B. Comparison of the deduced amino acid sequence of clone FA0035 to the sequences in the NRDB as described in Example 4 revealed no significant homology to any known protein sequences, and it is therefore categorized as an unknown open reading frame (ORF). The name "Daria" was arbitrarily assigned to this clone. Clone FA0759, containing plasmid pFA0759, encoded a polypeptide of 187 amino acids with 72% amino acid sequence identity to a putative subunit of the vacuolar associated protein from Neurospora crassa (Trembl accession number P87252). This gene product did not appear to be a secreted protein as no signal peptide was detected using Signal-P software. Clone FA0759 was represented by approximately 2.0% of the cDNA clones in Library A and 1.5% of Library B.
Example 10: Cloning and nucleotide sequence analysis of genomic DNA segments encoding unknown genes "Daria" and the putative vacuolar associated protein
Fusarium venenatum genomic DNA segments encoding the unknown secreted protein "Daria" and the putative vacuolar associated protein were isolated by screening the λZipLox library described in Examples 6 and 7. Radiolabeled cDNA inserts from plasmids pFA0035 and pFA0759 were used as probes to screen the library. Plaques which hybridized strongly to either probe using the same conditions in Example 7 were purified twice on E. coli Y1090ZL cells, and the individual clones were subsequently excised from the λZipLox vector as pZLl -derivatives (D'Alessio et al, 1992, supra).
DNA sequence analysis revealed that one of these clones, containing a plasmid designated as pECO3, comprised the entire "Daria" coding region as well as 0.9 kb of 5'-flanking and 0.9 kb of 3'-flanking DNA encompassing the promoter and terminator regions, respectively. The nucleotide sequence (SEQ ID NO. 2) and deduced amino acid sequence (SEQ ID NO. 5) are shown in Figure 2. The coding region was punctuated by a single 55 bp intron. Similarly, a genomic DNA clone was isolated through screening of the λZipLox library with a radiolabeled probe derived from the cDNA insert of pFA0579. The genomic clone, designated as pQUINN, encoded the entire vacuolar associated protein subunit plus 3.0 kb of 5'-flanking and 0.3 kb of 3'-flanking DNA comprising the promoter and terminator regions, respectively. The nucleotide sequence (SEQ ID NO. 3) and deduced amino acid sequence (SEQ ID NO. 6) are shown in Figure 3. Nucleotide sequence comparisons between the genomic and cDNA clones revealed the presence of a 594 bp intron in the 5 '-untranslated region of the putative vacuolar associated protein subunit. In addition, the coding region contained a 77 bp intron.
Example 11: Construction of pDM181
Plasmid pDM181 was constructed using the technique of splice overlap extension to fuse the 1.2 kb Fusarium oxysporum trypsin promoter to the 1.1 kb Fusarium oxysporum trypsin terminator. A polylinker containing Swal, Kpή and Pad restriction sites was inserted between the promoter and terminator as part of the overlapping PCR strategy. At the 5' end of the promoter a Xho site was added and the native EcoRl site was preserved. At the 3' end of the terminator EcoRl, Hindlll and Nsil sites were incoφorated by the PCR reaction. A PCR fragment containing -1208 to -1 of the Fusarium oxysporum trypsin promoter plus a 25 base pair polylinker was generated from plasmid pJRoy20 (Royer et al, 1995, Biotechnology 13: 1479-1483) using the following primers:
Primer 1 (sense): 5'-GAGCTCGAGGAATTCTTACAAACCTTCAAC-3' (SEQ ID NO. 7)
Xhol EcoRl
Primer 2 (antisense):
5'-TTAATTAAGGTACCTGAATTTAAATGGTGAAGAGATAGATATCCAAG-3'
(SΕQ ID NO. 8) Pad Kpnl Swal
The 100 μl PCR reaction contained 10 ng of pJRoy20, 50 pmol of each primer,
IX Pwo buffer (Boehringer Mannheim, Indianapolis, IN), 200 μM each of dATP, dCTP, dGTP, and dTTP, and 5 units of Pwo DNA polymerase (Boehringer Mannheim,
Indianapolis, IN). PCR conditions used were 95°C for 3 minutes followed by 25 cycles at 95°C for 30 seconds, 50°C for 1 minute, and 72°C for 1 minute. The final extension cycle was at 72°C for 5 minutes.
Using the same PCR conditions, a second PCR fragment containing base pairs -5 to -1 of the Fusarium oxysporum trypsin promoter, a 25 base pair polylinker, and 1060 base pairs of the 3' untranslated region of the Fusarium oxysporum trypsin gene (terminator region) was generated from plasmid pJRoy20 using the following primers:
Primer 3 (sense):
5'-TCACCATTTAAATTCAGGTACCTTAATTAAATTCCTTGTTGGAAGCGTCGA-
3' (SΕQ ID NO. 9)
Swal Kpήl Pad Primer 4 (antisense):
5'-TGGTATGCATAAGCTTGAATTCAGGTAAACAAGATATAATTT-3' (SΕQ ID
NO. 10)
Nsil Hindlll EcoRl
The final 2.3 kb overlapping PCR fragment which contained -1208 to -1 of the Fusarium oxysporum trypsin promoter, the 25 base pair polylinker and 1060 base pairs of the Fusarium oxysporum trypsin terminator was obtained using 0.2 μl of the first PCR
(promoter) reaction and 3 μl of the second (terminator) reaction as templates and primers 1 and 4. The PCR conditions used were 95°C for 3 minutes followed by 30 cycles at
95 °C for 30 seconds, 62°C for 1 minute, and 72°C for 3 minutes. The final extension cycle was at 72°C for 5 minutes. Pwo DNA polymerase was also used for this reaction. The resulting 2.3 kb fragment containing the trypsin promoter, the polylinker, and the trypsin terminator was digested with EcoRl and ligated into the EcoRl digested vector pMT1612 containing the bar gene (WO 97/26330) to create pDM181 (Figure 4).
Example 12: Construction of plasmid pSheBl
The Fusarium venenatum expression vector pSheBl (Figure 5) was generated by modification of pDM181. The modifications included (a) removal of two Ncol sites within the pDM181 sequence, and (b) restoration of the natural translation start of the
Fusarium oxysporum trypsin promoter (reconstruction of an Ncol site at the ATG start codon).
Removal of two Ncol sites within the pDM181 sequence was accomplished using the QuikChange™ site-directed mutagenesis kit (Stratagene Cloning Systems, La Jolla,
CA) according to the manufacturer's instruction with the following pairs of mutagenesis primers:
5'-dCAGTGAATTGGCCTCGATGGCCGCGGCCGCGAATT-3' plus (SEQ ID NO. 11)
5'-dAATTCGCGGCCGCGGCCATCGAGGCCAATTCACTG-3' (SEQ ID NO. 12) 5'-dCACGAAGGAAAGACGATGGCTTTCACGGTGTCTG-3' plus (SEQ ID NO. 13)
5'-dCAGACACCGTGAAAGCCATCGTCTTTCCTTCGTG-3' (SEQ ID NO. 14)
Restoration of the natural translation start of the Fusarium oxysporum trypsin promoter was also accomplished using the Stratagene QuikChange™ site directed mutagenesis kit in conjunction with the following pair of mutagenesis primers: 5'-dCTATCTCTTCACCATGGTACCTTAATTAAATACCTTGTTGGAAGCG-3' plus
(SEQ ID NO. 15)
5'-dCGCTTCCAACAAGGTATTTAATTAAGGTACCATGGTGAAGAGATAG-3'
(SEQ ID NO. 16)
All site-directed changes were confirmed by DNA sequence analysis of the appropriate vector regions.
Example 13: Construction of pDM194 and pDM218 The 7.8 kb plasmid pDM194 (7.8 kb) used to obtain expression of Thermomyces lanuginosus (formerly designated Humicola lanuginosa) lipase in Fusarium venenatum has the following gene elements:
A 1.2 kb DNA segment containing the Fusarium oxysporum trypsin gene promoter (Royer et al. , 1995, supra).
A 0.9 kb DNA fragment containing the Thermomyces lanuginosus lipase cDNA
(EP 305 216).
A 1.1 kb DNA segment containing the Fusarium oxysporum trypsin gene terminator (Royer et al, 1995, supra). A 4.7 kb fragment of DNA from pMTl 612 (WO 98/11203) containing the 2.8 kb
E. coli vector pUC19 and a 1.8 kB fragment comprising the Aspergillus nidulans amdS gene promoter (Hynes et al, 1988, Mol. Cell. Biol. 8: 2589-2596), Streptomyces hygroscopicus phosphinothricin acetyltransferase (bar) gene (Thompson et al., 1987, EMBO Journal 6: 2519-2514), and Aspergillus niger AMG terminator. The SwαllPαcl lipase fragment was generated by PCR. Plasmid pMHan37 which contains the cDNA of the Thermomyces lanuginosus lipase gene (EP 305 216) was used as the template. PCR primers 5 and 6 shown below were used to introduce a Swal site at the 5' end and a Pad site at the 3' end of the lipase coding region. Primer 5 (sense): 5'-ATTTAAATGATGAGGAGCTCCCTTGTGCTG-3' (SEQ ID NO. 17) Swal Primer 6 (anti-sense):
5'-TTAATTAACTAGAGTCGACCCAGCCGCGC-3' (SEQ ID NO. 18) Pad The 100 μl PCR reaction contained 10 ng of pMHan37, 50 pmol of each primer,
IX PCR buffer (Perkin-Elmer Corp., Branchburg, NJ), 250 μM each of dATP, dCTP, dGTP, and dTTP, and 5 units of Taq DNA polymerase (Perkin-Elmer Coφ., Branchburg, NJ). The PCR conditions used were one cycle at 95°C for five minutes followed by 30 cycles at 95°C for 1 minute, 55°C for one minute, and 72°C for two minutes. The 0.9 kb PCR product was subcloned into pCRII of the TA Cloning Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. Plasmid DNA was isolated using a Qiagen Maxiprep Kit (Qiagen, Santa Clarita, CA), digested with Swal and Pad, and electrophoresed on a 1% agarose gel for one hour at 100 volts. The 0.9 kb fragment was excised, purified using a SpinBind Kit (FMC, Rockland, ME), and cloned into pBANeό
(WO 98/11203) to produce pBANeδ. pBANeδ was digested with Swal and Pad and the 0.9 kb lipase fragment was ligated to Swal/ Pad digested pDM181 yielding lipase expression plasmid pDM194
(Figure 6). pDM218 was constructed from pJRoy35 (Figure 7). Notl and Emel restriction sites were introduced at the 5' end of the Fusarium oxysporum trypsin promoter by PCR.
A 362 bp amplicon containing the 5' end of the promoter was produced using pDM194 as a template with the following primers: multil : 5'-ATAAGAATGCGGCCGCTAGTTTAAACTTACAAACCTTCAACAGTG-
3'
(SEQ ID NO. 19) multi 2: 5'-TAGCATCTATCTCCGTCTT-3' (SEQ ID NO. 20) The 100 μl PCR reaction contained 150 ng of 3 kb EcoRI fragment, 50 pmol of each primer, IX Pwo buffer, 200 μM each of dATP, dCTP, dGTP, and dTTP, and 5 units of Pwo DNA polymerase. The PCR conditions used were one cycle at 95°C for 3 minutes, 30 cycles at 95°C for 1 minute, 50°C for 1 minute, and 72°C for 1.5 minutes; followed by a 5 minute extension at 72°C. The amplicon was subcloned into vector pCR-Blunt (Invitrogen, Carlsbad, CA). A 0.25 kb NotllBcul fragment was electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using a QIAquick Gel Extraction Kit (Qiagen, Santa Clarita, CA).
Hpal, Snd&l, and PpuM sites were introduced at the 3' end of the Fusarium oxysporum trypsin terminator by PCR. A 714 bp amplicon containing the 3' end of the trypsin terminator was produced using the 3 kb EcoRI fragment as template with the following primers: multi3: 5'-GTGTGCAGTGACCCAGAAT-3' (SΕQ ID NO.21) multi4: 5'-GATTGGGTCCCTACGTAGTTAACACTATAGGCCATCGTTTAC-3'
(SΕQ ID NO. 22) The 100 μl PCR reaction contained 50 pmol of each primer, 150 ng of the 3 kb
EcoRI fragment, IX Pwo buffer, 200 μM each of dATP, dCTP, dGTP, and dTTP, and 5 units of Pwo DNA polymerase. The PCR conditions used were identical to those listed above. The amplicon was subcloned into vector pCR-Blunt. A 0.62 kb NhellPpuMl fragment was isolated as described above.
A 2.3 kb BcullNhel fragment containing the 3' end of the Fusarium oxysporum trypsin promoter, the Humicola lanuginosa lipase gene (Geneseq nucleotide accession number N91076), and the 5' end of the Fusarium oxysporum trypsin terminator was isolated from pDM194.
The 0.25 kb NotllBcul fragment, 2.3 kb BcullNhel fragment, and 0.62 kb NhellPpuMl fragments were cloned together into pDM194 partially digested with Notl and completely digested with PpuWll to create pDM218 (Figure 8).
Example 14: Construction of plasmid pMWR60
The plasmid pMWR60 was derived from the expression vector pEJG25A. pEJG25A was constructed by insertion of a phytase coding sequence from Peniophora lycii (WO 98/28408) into pDM181 (Example 11) as follows: First, two synthetic oligonucleotide primers shown below were designed to amplify the Peniophora lyci phytase coding sequence from plasmid pAlphy2 (WO
98/28408) as template by PCR.
Forward primer: 5'-ATTTAAATATGGTTTCTTCGGCATTCGC-3' (SEQ ID NO.
23) Reverse primer: 5'-TTAATTAACTATTCCGACGGAACAAAGC-3' (SEQ ID NO.
24)
(Bold letters represent coding sequence).
Each 100 μl Pwo polymerase reaction contained 50 pmol of each primer, 1 ng of template DNA, 2 μl of 10 mM dNTPs, IX Pwo polymerase buffer, and 2.5 units of Pwo polymerase. The reactions were incubated in a Perkin Elmer Model 9600 Thermal
Cycler programmed as follows: One cycle at 94°C for 2 minutes, 55°C for 30 seconds, and 72°C for 1 minute; 9 cycles at 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 1 minute; 15 cycles at 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 1 minute, with an extension of 20 seconds per cycle; a final cycle at 94°C for 15 seconds, 55°C for 30 seconds, and 72°C for 7 minutes; and a soak cycle at 4°C. The reaction product was electrophoresed on a 1% agarose gel for one hour at 100 volts. The 1.3 kb band was excised and purified using Qiaex II. The purified PCR product was subsequently cloned into the plasmid pCR2.1 (Invitrogen, Carlsbad, CA) and used to transform E. coli TOP 10 cells (Invitrogen, Carlsbad, CA). Plasmid DNA was isolated from several of the transformant colonies and analyzed by DNA sequencing to ensure that no mutations were introduced during the PCR. Subsequently one phytase clone was digested with restriction endonucleases Swal and Pad. The fragments were electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using Qiaex II. The 1.3 kb phytase gene fragment was ligated with pDM181 (Example
11) that had been previously cut with Swal and Pad, resulting in the expression plasmid pEJG25A (Figure 9). In order to remove extraneous linker sequences in the 5'-flanking DNA, pEJG25A was mutagenized using the Quick-Change™ site-directed mutagenesis kit in combination with the following oligonucleotide primers to obtain the vector pMWR60-Int2: primer A: 5'-CTCTTGGATATCTATCTCTTCACCATGGTTTCTTCGGCATTCGC-3' (SEQ ID NO. 25) primer B:
5'-GCGAATGCCGAAGAAACCATGGTGAAGAGTAGATATCCAAGAG-3* (SEQ ID NO. 26) The designed nucleotide changes were verified by DNA sequence analysis. pMWR60-Int2 was then digested with Sful plus Nbel, and the 1.8 kb fragment was electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using Qiaex II. The isolated fragment was ligated with the Sful-Nhel vector fragment of pDM218 to generate a new intermediate called pMWR60-Int3. This intermediate was cleaved with Notl, and a 5.35 kb fragment was purified as above. The purified fragment was ligated with pSheBl (described in Example 12) which had been previously digested with Notl. The resulting intermediate was designated as pMWR60-Int4a. pMWR60- Int4a was then cut with BsplΛJl ll plus Nbel, and a 5.25 kb segment was purified as above. This isolated segment was ligated with pSheBl, which had also been digested with -9-spLUl lI plus Nbel, and purified as above. The resulting vector product was named pMWR60 (Figure 10).
Example 15: Generation of a lipase reporter gene
For the construction of variants of a Humicola lanuginosa lipase known as LIPOLASE™ (Novo Nordisk A/S, Bagsv_erd, Denmark), the Chameleon double- stranded, site-directed mutagenesis kit was used according to the manufacturer's instructions.
The gene encoding the LIPOLASE™ enzyme was obtained from pAFIL (WO 92/05249). In accordance with the manufacturer's instructions, the Seal site of the ampicillin gene of pAHL was changed to a Mlul site by use of the primer 7258, thus changing the Seal site found in the ampicillin resistance gene and used for cutting to a
Mlul site.
Primer 7258: 5'-GAATGACTTGGTTGACGCGTCACCAGTCAC-3' (SEQ ID NO. 27) The pAHL vector comprising the LIPOLASE™ gene was then used as a template for DNA polymerase with oligos 7258 and 7770, thus changing the Seal site found in the
LIPOLASE™ gene and without changing the amino acid sequence site.
Primer 7770: 5'-TCTAGCCCAGAATACTGGATCAAATC-3' (SEQ ID NO. 28)
The desired mutation (e.g., the introduction of a cysteine residue) was introduced into the LIPOLASE™ gene by addition of an appropriate oligos comprising the desired mutation.
Site directed mutagenesis as described above was used to construct a plasmid harboring a gene encoding the LIPOLASE™ variant IS, E239C, Q249R using the following primers: Primer 106659 shown below was used to introduce E99N,N101S.
Primer 107581 :
5'-CTTAACTTTGACTTGAAAAACATATCTGACATTTGCTCC-3' (SEQ ID NO. 29) Primer 101782 shown below was used to introduce SPPCGRRP (-E).
Primer 101782: 5'-GGACGGCCTTGGCTAGCCCTCCGTGCGGCCGCCGGCCGGTCTCGCAGGATC
TGTTTAAC-3' (SEQ ID NO. 30)
Primer 9639 shown below was used to introduce E239C.
Primer 9639: 5'-ATATCGTGAAGATATGCGGCATTGATGCCACC-3' (SEQ ID NO.
31) Primer 8829 shown below was used to introduce Q249R.
Primer 8829: 5'-GGCGGCAATAACCGGCCGAACATTCCGGATATCCC-3' (SEQ ID
NO. 32) The mutations were verified by sequencing the entire gene. The resulting plasmid was designated pEVil 163.
Example 16: Construction of pRaMB60 Plasmid pRaMB60 was constructed by ligating the 6.5 kb Sful-Nhel vector fragment from pMWR60 with a 0.5 kb Sful-Nhel fragment from pSheBl . All fragments were isolated by agarose gel electrophoresis and purified from gel slices using BioRad Prep-a-Gene reagents (BioRad Laboratories, Hercules, CA).
Example 17: Construction of plasmid pRaMB62, an expression vector containing the glucoamylase promoter
A unique BspUJl ll site was generated by site-directed mutagenesis of plasmid pFAMG using the following primers in combination with the Quick-Change™ mutagenesis kit : primer 1 : 5'-dCACTGCTATCACCAACATGTTTACTCAAGTCC-3' (SEQ ID NO. 33) primer 2: 5'-dGGACTTGAGTAAACATGTTGGTGATAGCAGTG-3' (SEQ ID NO.
34)
The site-directed change was verified by DNA sequencing, and the resulting plasmid derivative was designated pMWR62-Intl . Next, the lipase reporter gene described in Example 15 was amplified by PCR using plasmid pEVil l63 as template with the following primers which introduced a
BspHl site near the start codon and a Pad site following the stop codon of the lipase coding region: forward primer: 5'-GACTCATGAGGAGCTCCCTTGTGCTGTTC-3' (SEQ ID NO. 35) reverse primer: 5'-TGATTAATTAACCTAAAGACATGTCCCAATTAAC-3' (SEQ ID
NO. 36)
The PCR reaction was composed of 1 μl of template DNA (10 ng), 1 μl of forward primer (77 pmol), 1 μl of reverse primer (81 pmol), 10 μl of 10X Pwo polymerase buffer, 16 μl of 1.25 mM dNTP mix, and 1 μl (2.5 units) of Pwo polymerase. The reaction was incubated in a Perkin-Elmer Model 480 thermocycler using the following temperature settings: One cycle at 95°C for 5 minutes; 30 cycles at 95°C for 1 minute. 47°C for 1 minute, and 68°C for 2 minutes; and a 4°C soak cycle. The amplified product was then digested with BspHl plus Eαcl, purified by agarose gel electrophoresis (Example 16), and used in a three-part ligation with the 5.8 kb Pmel-Ncol fragment of pRaMB60 and the 2.1 kb Stz.I--5-.pLUl II fragment from pMWR62-intl . The resulting vector, designated pRaMB62 (Figure 11), contained the lipase reporter gene under the transcriptional control of the Fusarium venenatum glucoamylase promoter.
Example 18: Construction of plasmid pRaMB64, an expression vector containing the "Daria" promoter The promoter region from pECO3 (Example 10), termed the "Daria" promoter, was amplified using PCR in combination with the following primer pair that were designed to introduce Swαl and BsplΛJl ll sites at the 5' and 3' ends of the promoter segment, respectively: primer 1 : 5'-GCATTTAAATTACTACTGTGATGTG-3* (SEQ ID NO. 37) primer 2: 5'-GATTGATGTGAAACACATGTTGATG-3' (SEQ ID NO. 38)
The PCR reaction was composed of 1 μl of pECO3 (10 ng), 1 μl of forward primer (50 pmol), 1 μl of reverse primer (50 pmol), 10 μl of 10X Pwo polymerase buffer, 16 μl of 1.25 mM dNTP mix, and 1 μl (2.5 units) of Pwo polymerase. The reaction was incubated in a Perkin-Elmer Model 480 thermocycler using the following temperature settings: One cycle at 95°C for 5 minutes; 30 cycles at 95°C for 1 minute, 47°C for 1 minute, and 68°C for 2 minutes; and a 4°C soak cycle.
The 0.9 kb PCR product was electrophoresed on a 1% agarose gel for one hour at 100 volts, excised, and purified using Qiaex II.
The amplified DNA segment was subcloned into pCR2.1 (Invitrogen, Carlsbad, CA) and analyzed by restriction enzyme cleavage with Swαl, .RspLUl lI, EcoRI, and Xhol to verify that it was correct. The plasmid generated in this manner, termed pΕCO4, was digested with Swal plus BsplΛJl ll, and the 0.9 kb promoter fragment was purified by gel electrophoresis as described in Example 16. The purified fragment was mixed in a three-part ligation with the 5.8 kb Pmel-Ncol fragment of pRaMB60 and the 0.9 kb BspUl-Pacl segment encoding the lipase reporter gene. The product of this ligation, pRaMB64 (Figure 12), contained the "Daria" promoter directing expression of the lipase reporter gene. Example 19: Construction of plasmid pRaMB66, an expression vector containing the promoter derived from the vacuolar associated protein gene
The promoter segment from pQUINN (Example 10), encoding a putative vacuolar associated protein, was amplified by PCR with the following primers which introduced a Smαl site and an Ncol site at the 5'and 3' ends of the promoter, respectively: primer 1 : 5'-dCGACCCGGGAATTAGAGAGGTTAGG-3' (SEQ ID NO. 39) primer 2: 5'-dCGTATAACCCATGGTGGACTTGTCGGAC-3' (SEQ ID NO. 40)
The PCR reaction was composed of 1 μl of pQUINN (10 ng), 1 μl of forward primer (50 pmol), 1 μl of reverse primer (50 pmol), 10 μl of 10X Pwo polymerase buffer, 16 μl of 1.25 mM dNTP mix, and 1 μl (2.5 units) of Pw polymerase. The reaction was incubated in a Perkin-Elmer Model 480 thermocycler using the following temperature settings: One cycle at 95°C for 5 minutes; 30 cycles at 95°C for 1 minute, 47°C for 1 minute, and 68°C for 2 minutes; and a 4°C soak cycle. The 3.1 kb amplified DNA fragment was electrophoresed on a 1%> agarose gel for one hour at 100 volts, excised, and purified using Qiaex II.
The 3.1 kb amplified DNA fragment was subcloned into pCR-Script (Stratagene, La Jolla, CA) to generate the intermediate plasmid pQUINN-promoterA. Two restriction fragments were isolated from this plasmid; a 2.4 kb Smal-Ndel fragment, and a 0.7 kb Ndel-Ncol fragment (together these segments span the entire promoter region). The isolated fragments were combined in a four-part ligation with the 8 kb Pmel-Ncol fragment of pRaMB60 and the 0.9 kb BspHl-Pad segment encoding the lipase reporter gene described in the previous examples. The product of this ligation, pRaMB66 (Figure 13), contained the lipase reporter gene under the transcriptional control of the putative vacuolar associated protein gene promoter.
Example 20: Expression of the lipase reporter gene in Fusarium venenatum under control of the AMG, "Daria" and vacuolar associated protein promoters
Spores of Fusarium venenatum CC1-3 (MLY-3) were generated by inoculating a flask containing 500 ml of RA sporulation medium with 10 plugs from a IX Vogels medium plate (2.5% Noble agar) supplemented with 2.5% glucose and 2.5 mM sodium nitrate and incubating at 28°C, 150 φm for 2 to 3 days. Spores were harvested through Miracloth (Calbiochem, San Diego, CA) and centrifuged 20 minutes at 7000 φm in a
Sorvall RC-5B centrifuge (E. I. DuPont De Nemours and Co., Wilmington, DE).
Pelleted spores were washed twice with sterile distilled water, resuspended in a small volume of water, and then counted using a hemocytometer. Protoplasts were prepared by inoculating 100 ml of YEPG medium with 4 X 107 spores of Fusarium venenatum CC1-3 and incubating for 16 hours at 24°C and 150 φm.
The culture was centrifuged for 7 minutes at 3500 φm in a Sorvall RT 6000D (E. I.
DuPont De Nemours and Co., Wilmington, DE). Pellets were washed twice with 30 ml of 1 M MgSO4 and resuspended in 15 ml of 5 mg/ml of NOVOZYME 234™ (batch PPM 4356, Novo Nordisk A/S, Bagsvasrd, Denmark) in 1 M MgSO4. Cultures were incubated at 24°C and 150 φm until protoplasts formed. A volume of 35 ml of 2 M sorbitol was added to the protoplast digest and the mixture was centrifuged at 2500 φm for 10 minutes. The pellet was resuspended, washed twice with STC, and centrifuged at 2000 φm for 10 minutes to pellet the protoplasts. Protoplasts were counted with a hemocytometer and resuspended in an 8:2:0.1 solution of STC:SPTC:DMSO to a final concentration of 1.25 x 107 protoplasts/ml. The protoplasts were stored at -80°C, after controlled-rate freezing in a Nalgene Cryo 1°C Freezing Container (VWR Scientific, Inc., San Francisco, CA).
Frozen protoplasts of Fusarium venenatum CC1-3 were thawed on ice. Five to ten μg of pRaMB62, pRaMB64, and pRaMB66 (described in Examples 17-19) and 5 μl of heparin (5 mg per ml of STC) were added to separate 50 ml sterile polypropylene tubes. One hundred μl of protoplasts was added to each tube, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and incubated 20 minutes at room temperature. After the addition of 25 ml of 40°C COVE top agarose, the mixture in each tube was poured onto an empty 150 mm diameter plate and incubated overnight at room temperature. Approximately 24 hours later, an additional 25 ml of 40°C COVE top agarose containing 10 mg of BASTA™ per ml was poured on top of the plate and incubated at room temperature for up to 14 days. The active ingredient in the herbicide BASTA™ is phosphinothricin. BASTA™ was obtained from AgrEvo (Hoechst Schering, Rodovre, Denmark) and was extracted twice with phenol:chloroform:isoamyl alcohol (25:24:1), and once with chloroform:isoamyl alcohol (24: 1) before use.
The transformants were picked directly from the selection plates (COVE underlay with COVE-BASTA™ overlay) into 125 ml shake flasks containing 25 ml of M400Da medium supplemented with 1 mM CaCl2 and 100 μg/ml ampicillin (to prevent bacterial contamination) and incubated at 28°C, 200 φm on a platform shaker for 7 days. The untransformed recipient strain was also included as a negative control.
Flasks were sampled at 7 days. Cells were removed by centrifugation, and 10 μl of each supernatant sample was heated to 95 °C for 5 minutes with an equal volume of Tris-glycine sample buffer (Novex Experimental Technology, San Diego, CA). The denatured supernatant proteins were separated on a 10-20% Tris-glycine gradient gel (Novex Experimental Technology, San Diego, CA) and stained with Coomassie blue. SDS-PAGE analysis showed that the lipase-producing transformants secrete a prominent polypeptide with an apparent molecular weight of approximately 43 kDa.
Similarly, cell-free culture broths from each transformant were assayed for lipase activity using 3-nitrophenylbutyrate as the substrate (Royer et al, 1995, supra).
The results shown in Table 1 demonstrated that active lipase was expressed and secreted using the Fusarium venenatum promoter elements present in pRaMB62, pRaMB64, and pRaMB66.
Table 1
Example 21: Comparative expression of the Humicola lanuginosa lipase reporter gene under control of Fusarium venenatum amyloglucosidase and Fusarium oxysporum trypsin promoters Fusarium venenatum CC1-3 transformants containing either pRamB64 (Example
17) or pDM218 (Example 13), prepared as described in Example 20, were cultivated for 180 hours at 29°C, 1200 φm, pH 6.25 in 2 liter fermentors containing suitable carbon, nitrogen, and trace metals sources and supplemented with either urea or ammonium phosphate as the feed. Cell-free culture broths from each fermentation were assayed at 18 to 24 hour intervals for lipase activity using >-nitrophenylbutyrate as the substrate (Royer et al, 1995, supra) for 180 hours.
Figure 14 shows comparative expression of the Humicola lanuginosa lipase reporter gene in Fusarium venenatum under control of either the Fusarium venenatum amyloglucosidase (pAMG) promoter or Fusarium oxysporum trypsin (pSP387) promoter. The results demonstrated higher levels of lipase activity with the Fusarium venenatum amyloglucosidase promoter than the Fusarium oxysporum trypsin promoter whether urea or ammonium phosphate was used as the source of nitrogen in the feed. Moreover, higher levels of lipase activity were observed using ammonium phosphate in the feed
Deposit of Biological Materials
The following biological materials have been deposited under the terms of the Budapest Treaty with the Agricultural Research Service Patent Culture Collection, Northern Regional Research Center, 1815 University Street, Peoria, Illinois, 61604, and given the following accession numbers: Deposit Accession Number Date of Deposit
E. coli TOP10 (pECO3) NRRL B-30067 October 27, 1998
E. coli TOP 10 (pFAMG) NRRL B-30071 October 27, 1998
E. coli DH10B (pQUINN) NRRL B-30076 October 27, 1998 E. coli TOP 10 (pFB0346) NRRL B-30073 October 27, 1998
The strains have been deposited under conditions that assure that access to the culture swill be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. §1.14 and 35 U.S.C. §122. The deposits represent substantially pure cultures of the deposited strains. The deposits are available as required by foreign patent laws in countries wherein counteφarts of the subject application, or its progeny are filed.
However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control. Various references are cited herein, the disclosures of which are incoφorated by reference in their entireties.
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13 t>w)
A. The indications made below relate to the microorganism referred to in the description
B. IDENTIFICATION OF Further deposits are identified on an additional sheet D
Name of depository institution
Agricultural Research Service Patent Culture Collection (NRRL)
Address of depository institution (including postal code and country)
Northern Regional Research Center 1815 University Street Peoria, IL 61604, US
Date of deposit Accession Number
October 27, 1998 NRRL B-30067
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet □
Until the publication of the mention of grant of a European patent or, where applicable, for twenty years from the date of filing if the application has been refused, withdrawn or deemed withdrawn, a sample of the deposited microorganizm is only to be provided to an independent expert nominated by the person requesting the sample (cf Rule 28(4) EPC) And as far as Australia is concerned, the expert option is likewise requested, reference being had to Regulation 3 25 of Australia Statutory Rules 1991 No 71 Also, for Canada we request that only an independent expert nominated by the Commissioner is authoπzed to have access to a sample of the microorganizm deposited
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indication listed below will be submitted to the International Bureau Later (specify the general nature of the indications e g "Accession Number of Deposit")
For International Bureau use only
This sheet was received with the International Bureau on
Authoπzed officer
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13 -.is)
A. The indications made below relate to the microorganism referred to in the description on page 53 , line 28 .
B. IDENTIFICATION OF Further deposits are identified on an additional sheet D
Name of depository institution
Agricultural Research Service Patent Culture Collection (NRRL)
Address of depository institution (including postal code and country)
Northern Regional Research Center 1815 University Street Peoria, IL 61604, US
Date of deposit Accession Number
October 27, 1998 NRRL B-30071
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet D
Until the publication of the mention of grant of a European patent or, where applicable, for twenty years from the date of filing if the application has been refused, withdrawn or deemed withdrawn, a sample of the deposited microorganizm is only to be provided to an independent expert nominated by the person requesting the sample (cf. Rule 28(4) EPC). And as far as Australia is concerned, the expert option is likewise requested, reference being had to Regulation 3.25 of Australia Statutory Rules 1991 No. 71. Also, for Canada we request that only an independent expert nominated by the Commissioner is authorized to have access to a sample of the microorganizm deposited.
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indication listed below will be submitted to the International Bureau Later (specify the general nature of the indications e.g. "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application This sheet was received with the International Bureau on:
Authorized officer Authorized officer
-.,1 0 (FΛ*
Form PCT/RO/134 (July 1992) INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
A. The indications made below relate to the microorganism referred to in the description
B. IDENTIFICATION OF Further deposits are identified on an additional sheet D
Name of depository institution
Agricultural Research Service Patent Culture Collection (NRRL)
Address of depository institution (including postal code and country)
Northern Regional Research Center 1815 University Street Peoria, IL 61604, US
Date of deposit Accession Number
October 27, 1998 NRRL B-30076
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet D
Until the publication of the mention of grant of a European patent or, where applicable, for twenty years from the date of filing if the application has been refused, withdrawn or deemed withdrawn, a sample of the deposited microorganizm is only to be provided to an independent expert nominated by the person requesting the sample (cf Rule 28(4) EPC) And as far as Australia is concerned, the expert option is likewise requested, reference being had to Regulation 3 25 of Australia Statutory Rules 1991 No 71 Also, for Canada we request that only an independent expert nominated by the Commissioner is authorized to have access to a sample of the microorganizm deposited
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indication listed below will be submitted to the International Bureau Later (specify the general nature of the indications e g "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application This sheet was received with the International Bureau on
Authorized officer^ ' Authoπzed officer ijv--
Form PCT/RO/134 (July 1992) INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13 όw)
A. The indications made below relate to the microorganism referred to m the description
B. IDENTIFICATION OF Further deposits are identified on an additional sheet D
Name of depository institution
Agricultural Research Service Patent Culture Collection (NRRL)
Address of depository institution (including postal code and country)
Northern Regional Research Center 1815 University Street Peoria, IL 61604, US
Date of deposit Accession Number
October 27, 1998 NRRL B-30073
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet D
Until the publication of the mention of grant of a European patent or, where applicable, for twenty years from the date of filing if the application has been refused, withdrawn or deemed withdrawn, a sample of the deposited microorganizm is only to be provided to an independent expert nominated by the person requesting the sample (cf Rule 28(4) EPC) And as far as Australia is concerned, the expert option is likewise requested, reference being had to Regulation 3 25 of Australia Statutory Rules 1991 No 71 Also, for Canada we request that only an independent expert nominated by the Commissioner is authorized to have access to a sample of the microorganizm deposited
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)
The indication listed below will be submitted to the International Bureau Later (specify the general nature of the indications e g "Accession Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application This sheet was received with the International Bureau on
Authoπzed office^'- WeSOOWS o Authoπzed officer
Cl Operations - lAPDTeam 1 03) 305-37 ': ttn?. anfi-Wn -
Form PCT/RO/134 (July 1992)

Claims

ClaimsWhat is claimed is:
1. A method for producing a polypeptide, comprising:
(a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a first nucleic acid sequence encoding the polypeptide operably linked to a second nucleic acid sequence comprising a promoter foreign to the first nucleic acid sequence, wherein the promoter comprises a sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and subsequences thereof; and mutant, hybrid, and tandem promoters thereof; and
(b) isolating the polypeptide from the cultivation medium.
2. The method of claim 1, wherein the promoter comprises the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1 or a mutant, hybrid, or tandem promoter thereof.
3. The method of claim 2, wherein the promoter comprises the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1.
4. The method of claim 3, wherein the promoter comprises the nucleic acid sequence contained in plasmid pECO3 which is contained in E. coli NRRL B-30067.
5. The method of claim 1, wherein the promoter comprises the nucleic acid sequence of nucleotides 1 to 938 of SEQ ID NO. 2 or a mutant, hybrid, or tandem promoter thereof.
6. The method of claim 5, wherein the promoter comprises the nucleic acid sequence of nucleotides 1 to 938 of SEQ ID NO. 2.
7. The method of claim 6, wherein the promoter comprises the nucleic acid sequence contained in plasmid pFAMG which is contained in E. coli NRRL B-30071.
8. The method of claim 1, wherein the promoter comprises the nucleic acid sequence of nucleotides 1 to 3060 of SΕQ ID NO. 3, a subsequence thereof; or a mutant, hybrid, or tandem promoter thereof.
9. The method of claim 8, wherein the promoter comprises the nucleic acid sequence of nucleotides 1 to 3060 of SΕQ ID NO. 3.
10. The method of claim 9, wherein the promoter comprises the nucleic acid sequence contained in plasmid pQUINN which is contained in E. coli NRRL B-30075.
11. The method of any of claims 1, 2, 5, and 8 wherein the mutant promoter is comprised of a substitution, deletion, and/or insertion of one or more nucleotides of a promoter selected from the group consisting of nucleotides 1 to 3949 of SΕQ ID NO. 1, nucleotides 1 to 938 of SΕQ ID NO. 2, and nucleotides 1 to 3060 of SΕQ ID NO. 3, wherein the mutant promoter has more or less promoter activity than the corresponding promoter.
12. The method of any of claims 1, 2, 5, and 8, wherein the hybrid promoter is comprised of portions of two or more promoters.
13. The method of claim 12, wherein the hybrid promoter comprises one or more portions selected from the group consisting of nucleotides 1 to 3949 of SΕQ ID NO. 1, nucleotides 1 to 938 of SΕQ ID NO. 2, and nucleotides 1 to 3060 of SΕQ ID NO. 3.
14. The method of claim 13, wherein the hybrid promoter further comprises a portion of another promoter.
15. The method of claim 1, wherein the tandem promoter is comprised of two or more promoters.
16. The method of claim 15, wherein the tandem promoter comprises two or more promoters selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3.
17. The method of claim 16, wherein the tandem promoter further comprises another promoter.
18. The method of claim 15, wherein the two or more promoters of the tandem promoter simultaneously promote the transcription of the nucleic acid sequence.
19. The method of claim 15, wherein one or more of the two or more promoters of the tandem promoter promote the transcription of the nucleic acid sequence at different stages of growth of the fungal host cell.
20. The method of any of claims 1-19, wherein the fungal host cell contains one or more copies of the nucleic acid sequence.
21. The method of any of claims 1-19, wherein the fungal host cell contains one copy of the nucleic acid sequence.
22. The method of any of claims 1-21, wherein the nucleic acid sequence encodes a polypeptide heterologous to the fungal host cell.
23. The method of any of claims 1-22, wherein the polypeptide is hormone or hormone variant, enzyme, receptor or portion thereof, antibody or portion thereof, or reporter.
24. The method of claim 23, wherein the enzyme is an oxidoreductase, transferase, hydrolase, lyase, isomerase, or ligase.
25. The method of claim 23, wherein the enzyme is an aminopeptidase, amylase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, alpha-galactosidase, beta-galactosidase, glucoamylase, alpha-glucosidase, beta-glucosidase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, a pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, proteolytic enzyme, ribonuclease, transglutaminase, or xylanase.
26. The method of any of claims 1-25, wherein the nucleic acid sequence is contained in the chromosome of the fungal host cell.
27. The method of any of claims 1-25, wherein the nucleic acid sequence is contained on an extrachromosomal element.
28. The method of any of claims 1-27, wherein the fungal host cell is a filamentous fungal or yeast cell.
29. The method of claim 28, wherein the filamentous fungal cell is an Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, or Trichoderma cell.
30. The method of claim 28, wherein the yeast cell is a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell.
31. The method of claim 28, wherein the filamentous fungal host cell is an Aspergillus cell.
32. The method of claim 28, wherein the filamentous fungal host cell is a Fusarium cell.
33. An isolated promoter sequence comprising a nucleic acid sequence selected from the group consisting of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, and nucleotides 1 to 3060 of SEQ ID NO. 3, and subsequences thereof; and mutant, hybrid, and tandem promoters thereof.
34. The promoter sequence of claim 33, comprising the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1 or a subsequence thereof; or a mutant, hybrid, or tandem promoter thereof.
35. The isolated promoter sequence of claim 34, comprising the nucleic acid sequence of nucleotides 1 to 3949 of SEQ ID NO. 1.
36. The isolated promoter sequence of claim 35, comprising the nucleic acid sequence contained in plasmid pECO3 which is contained in E. coli NRRL B-30067.
37. The isolated promoter sequence of claim 33, comprising the nucleic acid sequence of nucleotides 1 to 938 of SEQ ID NO. 2 or a subsequence thereof; or a mutant, hybrid, or tandem promoter sequence thereof.
38. The isolated promoter sequence of claim 37, comprising the nucleic acid sequence of nucleotides 1 to 938 of SEQ ID NO. 2.
39. The isolated promoter sequence of claim 38, comprising the nucleic acid sequence contained in plasmid pFAMG which is contained in E. coli NRRL B-30071.
40. The isolated promoter sequence of claim 33, comprising the nucleic acid sequence of nucleotides 1 to 3060 of SEQ ID NO. 3 or a subsequence thereof; or a mutant, hybrid, or tandem promoter sequence thereof.
41. The isolated promoter sequence of claim 40, comprising the nucleic acid sequence of nucleotides 1 to 3060 of SEQ ID NO. 3.
42. The isolated promoter sequence of claim 41, comprising the nucleic acid sequence contained in plasmid pQUINN which is contained in E. coli NRRL B-30075.
43. The isolated promoter sequence of any of claims 33-42 which has at least 20% of the promoter activity of the sequence of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3.
44. An isolated promoter sequence having the same promoter activity as the promoter sequence of any of claims 33-43.
45. An isolated promoter sequence comprising a nucleic acid sequence having at least one mutation in the sequence of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3, or a subsequence thereof; in which the mutant promoter has the promoter activity.
46. A nucleic acid construct comprising a nucleic acid sequence encoding a polypeptide operably linked to the promoter of any of claims 33-45.
47. A recombinant expression vector comprising the nucleic acid construct of claim 46.
48. A recombinant host cell comprising the nucleic acid construct of claim 46.
49. A method for producing a polypeptide, comprising (a) cultivating a homologously recombinant cell, having incoφorated therein a new transcription unit comprising a promoter of any of claims 33-45, an exon, and/or a splice donor site operably linked to a second exon of an endogenous nucleic acid sequence encoding the polypeptide, under conditions conducive for production of the polypeptide; and (b) recovering the polypeptide.
50. A method for obtaining a mutant promoter, comprising:
(a) hybridizing a DNA under low stringency conditions with a nucleic acid sequence comprising (i) SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, (ii) the cDNA sequence contained in SEQ ID NO. 1, SEQ ID NO. 2, or SEQ ID NO. 3, (iii) a subsequence of (i) or (ii), or (iv) a complementary strand of (i), (ii), or (iii); and
(b) isolating the mutant promoter from the DNA.
51. A method for obtaining a mutant promoter, comprising (a) introducing at least one mutation into the promoter of nucleotides 1 to 3949 of SEQ ID NO. 1, nucleotides 1 to 938 of SEQ ID NO. 2, or nucleotides 1 to 3060 of SEQ ID NO. 3, wherein the mutant promoter has \promoter activity; and (b) isolating the mutant promoter.
52. An isolated nucleic acid sequence, selected from the group consisting of:
(a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence which has at least 65% identity with amino acids 22 to 581 of SEQ ID NO. 4, amino acids 19 to 200 of SEQ ID NO. 5, or amino acids 1 to 187 of SEQ ID NO. 6 ; (b) a nucleic acid sequence having at least 65% homology with nucleotides
4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3;
(c) a nucleic acid sequence which hybridizes under very low, low, medium, medium-high, high, or very high stringency conditions with (i) nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (ii) the cDNA sequence contained in nucleotides 4013 to 5743 of SEQ ID NO. 1, nucleotides 993 to 1593 of SEQ ID NO. 2, or nucleotides 3061 to 3678 of SEQ ID NO. 3; (iii) a subsequence of (i) or (ii) of at least 100 nucleotides, or (iv) a complementary strand of (i), (ii), or (iii); (d) a nucleic acid sequence encoding a variant of the polypeptide having an amino acid sequence of SEQ ID NO. 4, SEQ ID. NO. 5, or SEQ ID NO. 6 comprising a substitution, deletion, and/or insertion of one or more amino acids;
(e) an allelic variant of (a), (b), or (c); and
(f) a subsequence of (a), (b), (c), or (e).
53. A nucleic acid construct comprising the nucleic acid sequence of claim 52 operably linked to one or more control sequences which direct the production of the polypeptide in a suitable expression host.
54. A recombinant expression vector comprising the nucleic acid construct of claim 53, a promoter, and transcriptional and translational stop signals.
55. A recombinant host cell comprising the nucleic acid construct of claim 53.
56. A polypeptide encoded by the nucleic acid sequence of claim 52.
EP00919596A 1999-03-22 2000-03-22 Promoter sequences derived from fusarium venenatum and uses thereof Withdrawn EP1194572A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
DK10180302.1T DK2278016T3 (en) 1999-03-22 2000-03-22 Fusarium Venenatum promoter sequences and their use
EP10180302A EP2278016B1 (en) 1999-03-22 2000-03-22 Promoter sequences derived from Fusarium Venenatum and uses thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US27444999A 1999-03-22 1999-03-22
US274449 1999-03-22
PCT/US2000/007815 WO2000056900A2 (en) 1999-03-22 2000-03-22 Promoter sequences derived from fusarium venenatum and uses thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP10180302A Division EP2278016B1 (en) 1999-03-22 2000-03-22 Promoter sequences derived from Fusarium Venenatum and uses thereof

Publications (1)

Publication Number Publication Date
EP1194572A2 true EP1194572A2 (en) 2002-04-10

Family

ID=23048245

Family Applications (2)

Application Number Title Priority Date Filing Date
EP00919596A Withdrawn EP1194572A2 (en) 1999-03-22 2000-03-22 Promoter sequences derived from fusarium venenatum and uses thereof
EP10180302A Expired - Lifetime EP2278016B1 (en) 1999-03-22 2000-03-22 Promoter sequences derived from Fusarium Venenatum and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP10180302A Expired - Lifetime EP2278016B1 (en) 1999-03-22 2000-03-22 Promoter sequences derived from Fusarium Venenatum and uses thereof

Country Status (6)

Country Link
EP (2) EP1194572A2 (en)
JP (4) JP4620253B2 (en)
CN (5) CN1940067A (en)
AU (1) AU4025700A (en)
DK (1) DK2278016T3 (en)
WO (1) WO2000056900A2 (en)

Families Citing this family (493)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7883872B2 (en) 1996-10-10 2011-02-08 Dyadic International (Usa), Inc. Construction of highly efficient cellulase compositions for enzymatic hydrolysis of cellulose
WO2000020555A2 (en) 1998-10-06 2000-04-13 Aarl Inc Transformation system in the field of filamentous fungal hosts: in chrysosporium
DE10036491A1 (en) * 2000-07-25 2002-02-07 Roche Diagnostics Gmbh Expression of alkaline phosphatase in yeast
US7063962B2 (en) * 2001-07-20 2006-06-20 Novozymes A/S DNA sequences for regulating transcription
AUPR945901A0 (en) 2001-12-13 2002-01-24 Macquarie University Gene promoters
EP1585822B1 (en) 2002-11-18 2012-01-25 Novozymes, Inc. Promoter variants for expressing genes in a fungal cell
JP4638418B2 (en) 2003-03-31 2011-02-23 ノボザイムス,インコーポレイティド Methods for producing biological material in enzyme-deletion mutants of Aspergillus niger
EP1682656B1 (en) 2003-10-28 2013-09-18 Novozymes Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
ES2468366T3 (en) 2004-01-30 2014-06-16 Novozymes Inc. Polypeptides with cellulolytic enhancement activity and polynucleotides that encode them
EP1715736A4 (en) 2004-02-12 2008-09-03 Novozymes Inc Polypeptides having xylanase activity and polynucleotides encoding same
EP1735454B1 (en) 2004-03-25 2017-05-10 Novozymes, Inc. Methods for degrading or converting plant cell wall polysaccharides
US8633006B2 (en) 2004-06-29 2014-01-21 Novozymes, Inc. Polypeptides having alpha-glucosidase activity and polynucleotides encoding same
US9045748B2 (en) 2004-05-27 2015-06-02 Novozymes, Inc. Methods for transforming and expression screening of filamentous fungal cells with a DNA library
CN1308452C (en) * 2004-09-14 2007-04-04 上海永业农科生物工程有限公司 Pichia yeast phytase expression system containing reorganized ethyl alcohol oxidase promotor
EP2298872A3 (en) 2004-09-30 2011-08-10 Novozymes A/S Polypeptides having lipase activity and polynucleotides encoding same
MX285771B (en) 2004-10-04 2011-04-07 Novozymes As Polypeptides having phytase activity and polynucleotides encoding same.
AR050895A1 (en) 2004-10-04 2006-11-29 Novozymes As POLYPEPTIDES THAT HAVE FITASA ACTIVITY AND POLYUCLEOTIDES THAT CODE THEM
WO2006053565A2 (en) 2004-11-19 2006-05-26 Novozymes A/S Polypeptides having antimicrobial activity and polynucleotides encoding same
CN106397601A (en) * 2004-12-22 2017-02-15 诺维信公司 Enzymes for starch processing
ES2543131T3 (en) 2004-12-22 2015-08-14 Novozymes North America, Inc. Enzymes for starch treatment
CN101142231A (en) 2005-03-16 2008-03-12 诺维信公司 Recombinant expression of defensins in filamentous fungi
DK1863834T3 (en) 2005-03-22 2010-11-01 Novozymes As Polypeptides and nucleic acids encoding these
EP1877551B2 (en) 2005-04-27 2014-02-26 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
ES2343586T3 (en) 2005-08-26 2010-08-04 Novozymes Adenium Biotech A/S POLYPEPTIDES WITH ANTIMICROBIAL ACTIVITY AND POLINUCLEOTIDES THAT CODIFY THE SAME.
EP2385110A3 (en) 2005-09-30 2011-11-16 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
CN101292024B (en) 2005-10-17 2012-04-18 诺维信公司 Use of fungal mutants for expression of antibodies
US8262646B2 (en) * 2006-01-20 2012-09-11 Lensar, Inc. System and method for providing the shaped structural weakening of the human lens with a laser
CN101454444A (en) 2006-03-20 2009-06-10 诺维信股份有限公司 Polypeptides having endoglucanase activity and polynucleotides encoding same
CN101460616A (en) 2006-03-30 2009-06-17 诺维信股份有限公司 Polypeptides having endoglucanase activity and polynucleotides encoding same
US8940502B2 (en) 2006-07-14 2015-01-27 Novozymes, Inc. Nucleic acid constructs and methods of making protein
US8586330B2 (en) 2006-07-14 2013-11-19 Novozymes A/S Methods for producing secreted polypeptides having biological activity
US8546106B2 (en) 2006-07-21 2013-10-01 Novozymes, Inc. Methods of increasing secretion of polypeptides having biological activity
EP2431470B1 (en) 2006-11-30 2017-11-29 Novozymes A/S Dnase expression in recombinant host cells
US8680252B2 (en) 2006-12-10 2014-03-25 Dyadic International (Usa), Inc. Expression and high-throughput screening of complex expressed DNA libraries in filamentous fungi
BRPI0719449A2 (en) * 2006-12-21 2017-06-20 Syngenta Participations Ag isolated, synthetic or recombinant nucleic acid molecule, isolated polypeptide, plant or part of plant, cloning vehicle comprising a nucleic acid, expression cassette comprising a nucleic acid molecule and method for hydrolyzing a polysaccharide, oligosaccharide or starch
WO2008116878A1 (en) 2007-03-26 2008-10-02 Novozymes A/S Hafnia phytase
DE102007016139A1 (en) 2007-03-30 2008-10-02 Jenabios Gmbh Method for regioselective oxygenation of N-heterocycles
CA2695830A1 (en) 2007-08-08 2009-02-12 Novozymes Biopharma Dk A/S Transferrin variants and conjugates
JP5769142B2 (en) * 2007-09-04 2015-08-26 独立行政法人酒類総合研究所 Method for high secretion of heterologous proteins in Pichia yeast
CA2736661A1 (en) 2007-09-07 2009-03-12 Dyadic International, Inc. Novel fungal enzymes
EP2193195B1 (en) 2007-09-18 2014-12-17 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
CN101878299A (en) 2007-11-27 2010-11-03 诺维信公司 Polypeptide with α-glucuronidase activity and polynucleotide encoding the polypeptide
EP2224822B1 (en) 2007-12-06 2014-05-21 Novozymes A/S Polypeptides having acetylxylan esterase activity and polynucleotides encoding same
AU2008343105A1 (en) 2007-12-19 2009-07-09 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
ES2667812T3 (en) 2008-11-20 2018-05-14 Novozymes Inc. Polypeptides having amylolytic enhancing activity and polynucleotides encoding them
WO2010065830A1 (en) 2008-12-04 2010-06-10 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US20110296557A1 (en) 2008-12-12 2011-12-01 Novozymes, Inc. Polypeptides Having Lipase Activity And Polynucleotides Encoding Same
US9493759B2 (en) 2008-12-12 2016-11-15 Novozymes, Inc. Polypeptides having aspartic endopeptidase activity and polynucleotides encoding same
US20110269206A1 (en) 2008-12-15 2011-11-03 Novozymes, Inc Polypeptides Having Catalase Activity And Polynucleotides Encoding Same
WO2010077775A1 (en) 2008-12-16 2010-07-08 Novozymes, Inc. Polypeptides having alpha-mannosidase activity and polynucleotides encoding same
US8633030B2 (en) 2008-12-16 2014-01-21 Novozymes, Inc. Polypeptides having carboxypeptidase activity and polynucleotides encoding same
EP2379732A2 (en) 2008-12-19 2011-10-26 Novozymes Inc. Methods for increasing enzymatic hydrolysis of cellulosic material in the presence of a peroxidase
CN102325879A (en) 2008-12-19 2012-01-18 诺维信股份有限公司 Method of increasing hydrolysis of cellulosic material in the presence of cellobiose dehydrogenase
US8338121B2 (en) 2008-12-19 2012-12-25 Novozymes, Inc. Methods for determining cellulolytic enhancing activity of a polypeptide
US8337663B2 (en) 2008-12-19 2012-12-25 Novozymes, Inc. Methods for increasing hydrolysis of cellulosic material
ES2561427T3 (en) 2008-12-23 2016-02-26 Dupont Nutrition Biosciences Aps Polypeptides with xylanase activity
AU2010206181B2 (en) 2009-01-21 2015-01-15 Novozymes A/S Polypeptides having esterase activity and nucleic acids encoding the same
US8604277B2 (en) 2009-01-28 2013-12-10 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
WO2010088447A1 (en) 2009-01-30 2010-08-05 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
US8629324B2 (en) 2009-01-30 2014-01-14 Novozymes, Inc. Polypeptides having expansin activity and polynucleotides encoding same
WO2010091221A1 (en) 2009-02-06 2010-08-12 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
WO2010089385A1 (en) 2009-02-06 2010-08-12 Novozymes Biopharma Dk A/S Purification process
WO2010092135A2 (en) 2009-02-11 2010-08-19 Novozymes Biopharma Uk Ltd. Albumin variants and conjugates
WO2010106068A1 (en) 2009-03-17 2010-09-23 Novozymes A/S Polypeptides having tyrosinase activity and polynucleotides encoding same
EP2411511B1 (en) 2009-03-24 2018-08-08 Novozymes A/S Polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
EP2248893A1 (en) 2009-05-06 2010-11-10 Novozymes A/S DFPase Enzymes from Octopus Vulgaris
WO2010138754A1 (en) 2009-05-29 2010-12-02 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
WO2010141325A1 (en) 2009-06-02 2010-12-09 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
CN102712919B (en) 2009-06-26 2017-06-23 诺维信北美公司 Heat endurance carbonic anhydrase and application thereof
US8143021B2 (en) 2009-07-07 2012-03-27 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
EP2456865A1 (en) 2009-07-24 2012-05-30 Novozymes A/S Carbohydrate oxidases
WO2011014458A1 (en) 2009-07-28 2011-02-03 Novozymes, Inc. Polypeptides having phytase activity and polynucleotides encoding same
EP2462156A1 (en) 2009-08-07 2012-06-13 Novozymes A/S Method of producing a sweet protein
US8409830B2 (en) 2009-08-21 2013-04-02 Novozymes A/S Polypeptides having isoamylase activity and methods of use
MX2012002532A (en) 2009-09-01 2012-04-11 Novozymes Inc Methods for improving malic acid production in filamentous fungi.
WO2011035027A2 (en) 2009-09-17 2011-03-24 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
WO2011035029A1 (en) 2009-09-18 2011-03-24 Novozymes, Inc. Polypeptides having beta-glucosidase activity and polynucleotides encoding same
MX339581B (en) 2009-09-25 2016-06-01 Novozymes As Subtilase variants.
CN102648277B (en) 2009-09-25 2015-05-20 诺维信公司 Use of protease variants
US8211665B2 (en) 2009-09-29 2012-07-03 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
DK2483295T3 (en) 2009-09-29 2016-02-22 Novozymes Inc Polypeptides having cellulolytic enhancing activity and polynucleotides encoding them
CN108165542A (en) 2009-09-30 2018-06-15 诺维信股份有限公司 Polypeptide with cellulolytic enhancing activity and the polynucleotides for encoding the polypeptide
CN102666846A (en) 2009-09-30 2012-09-12 诺维信公司 Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US8541651B2 (en) 2009-10-23 2013-09-24 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
CA2776336A1 (en) 2009-10-29 2011-05-19 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
MX2012005152A (en) 2009-11-06 2012-06-12 Novozymes Inc Compositions for saccharification of cellulosic material.
EP2496692B1 (en) 2009-11-06 2016-03-16 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
EP2496693B1 (en) 2009-11-06 2017-10-25 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
EP2507370B1 (en) 2009-11-30 2015-02-11 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
ES2534098T3 (en) 2009-11-30 2015-04-17 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding them
CN104169417B (en) 2009-12-01 2020-05-08 诺维信公司 Polypeptide with glucoamylase activity and its encoding polynucleotide
WO2011067349A1 (en) 2009-12-03 2011-06-09 Novozymes A/S Variants of a polypeptide with lipolytic activity and improved stability
CN102753023A (en) 2009-12-09 2012-10-24 诺维信公司 Methods of producing GH8 xylanase variants
MX350399B (en) 2009-12-18 2017-09-06 Novozymes Inc Methods for producing polypeptides in protease-deficient mutants of trichoderma.
WO2011080267A2 (en) 2009-12-29 2011-07-07 Novozymes A/S Polypetides having detergency enhancing effect
AU2011203460B2 (en) 2010-01-04 2014-09-18 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2011104284A1 (en) 2010-02-25 2011-09-01 Novozymes A/S Polypeptides having antimicrobial activity
BR112012020309A2 (en) 2010-03-03 2015-11-03 Novozymes As "isolated variant of a precursor xylanase, isolated polynucleotide, host cell, methods for producing and obtaining a variant, transgenic plant, part of the plant or plant cell, and methods for degrading a xylan-containing material to treat a pulp, and to produce xylose. "
BR112012020503A2 (en) 2010-03-31 2015-09-15 Novozymes Inc isolated cellobiohydrolase precursor variant, isolated polypeptide, nucleic acid construct, expression vector, host cell, method of producing a precursor cellobiohydrolase variant, methods to obtain the variant, to degrade precursor cellobiohydrolase variant, methods of obtaining the variant, to degrade or convert a cellulosic material, to produce a fermentation product and to ferment a cellulosic material, and an enzyme composition.
WO2011127802A1 (en) 2010-04-14 2011-10-20 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
EP2576606B1 (en) 2010-06-04 2014-12-10 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
US8835604B2 (en) 2010-06-12 2014-09-16 Adenium Biotech Aos Antimicrobial peptide variants and polynucleotides encoding same
CN102947458B (en) 2010-06-21 2016-05-04 诺维信股份有限公司 Be used for the method for the generation of the improvement of filamentous fungi C4-dicarboxylic acids
CA2803343C (en) 2010-06-21 2018-08-07 Novozymes, Inc. Aspergillus aculeatus derived polypeptides having c4-dicarboxylic acid transporter activity and polynucleotides encoding same
EP2585591B1 (en) 2010-06-25 2014-12-24 Novozymes A/S Polynucleotides having leader sequence function
DK2588604T3 (en) 2010-06-30 2016-09-26 Novozymes Inc Polypeptides having beta-glucosidase activity and polynucleotides encoding them
CA2803222A1 (en) 2010-07-01 2012-01-05 Dsm Ip Assets B.V. A method for the production of a compound of interest
US9273335B2 (en) 2010-08-12 2016-03-01 Novozymes, Inc. Compositions comprising a polypeptide having cellulolytic enhancing activity and a quinone compound and uses thereof
US20130149771A1 (en) 2010-08-24 2013-06-13 Novozymes A/S Heat-Stable Persephonella Carbonic Anhydrases and Their Use
WO2012030858A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having hemicellulolytic activity and polynucleotides encoding same
WO2012030811A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
DK2735611T3 (en) 2010-08-30 2019-01-28 Novozymes As POLYPEPTIDES WITH CELLULOLYSE INCREASING ACTIVITY AND POLYNUCLEOTIDES CODING THEM
WO2012030845A2 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
WO2012030844A1 (en) 2010-08-30 2012-03-08 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US8624082B2 (en) 2010-08-30 2014-01-07 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
CN103237891B (en) 2010-09-30 2017-07-14 诺维信股份有限公司 Polypeptide variants having cellulolytic enhancing activity and polynucleotides encoding the same
WO2012044835A1 (en) 2010-09-30 2012-04-05 Novozymes, Inc. Variants of polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN103534349B (en) 2010-10-01 2017-07-21 诺维信公司 Polypeptide with endopeptidase activity and encode its polynucleotides
ES2563209T3 (en) 2010-10-01 2016-03-11 Novozymes, Inc. Variants of beta-glucosidase and polynucleotides that encode them
BR112013009817B1 (en) 2010-10-26 2020-02-04 Novozymes As methods to degrade or convert sugar cane refuse, to produce a fermentation product, and to ferment sugar cane refuse
WO2012058566A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Polypeptides having succinyl-coa:aceto acetate transferase activity and polynucleotides encoding same
CA2810903A1 (en) 2010-10-29 2012-05-03 Novozymes A/S Recombinant n-propanol and isopropanol production
EP2635689B1 (en) 2010-11-02 2015-04-15 Novozymes, Inc. Methods of pretreating cellulosic material with a gh61 polypeptide
US9212354B2 (en) 2010-11-04 2015-12-15 Novozymes Inc. Polypeptides having cellobiohydrolase activitiy and polynucleotides encoding same
ES2649555T3 (en) 2010-11-08 2018-01-12 Novozymes A/S Polypeptides with glucoamylase activity and polynucleotides that encode them
WO2012064351A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
US9139823B2 (en) 2010-11-12 2015-09-22 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
RU2013126882A (en) 2010-11-12 2014-12-20 Новозимс А/С POLYEPEPTIDES POSSESSING THE ACTIVITY OF PHOSPHOLIPASE C, AND POLINUCLEOTIDES CODING THEM
BR112013010129A2 (en) 2010-11-18 2016-07-05 Novozymes Inc isolated chimeric gh61 polypeptide, isolated polynucleotide, host cell, methods for producing a chimeric gh61 polypeptide, for degrading or converting a cellulostic material, for synthesizing a fermentation product, for fermenting a cellulosic material and for cleaning or washing a hard surface or clothing for washing, transgenic plant, part of plant or plant cell, use of chimeric gh61 polypeptide, detergent composition, and broth formulation or whole cell culture composition
WO2012075151A2 (en) 2010-11-30 2012-06-07 Novozymes, Inc. Promoters for expressing genes in a fungal cell
EP2649188A1 (en) 2010-12-06 2013-10-16 Novozymes North America, Inc. Methods of hydrolyzing oligomers in hemicellulosic liquor
WO2012078712A2 (en) 2010-12-07 2012-06-14 Vnomics Corp. System and method for measuring and reducing vehicle fuel waste
EP2652138B1 (en) 2010-12-16 2017-11-01 Novozymes, Inc. Promoters for expressing genes in a fungal cell
MX2013007720A (en) 2011-01-26 2013-08-09 Novozymes As Polypeptides having cellobiohydrolase activity and polynucleotides encoding same.
US9080161B2 (en) 2011-01-26 2015-07-14 Novozymes, Inc. Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
CN103534348B (en) 2011-01-26 2018-04-10 诺维信公司 Polypeptide having cellobiohydrolase activity and polynucleotide encoding the polypeptide
WO2012103322A1 (en) 2011-01-26 2012-08-02 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
MX337913B (en) 2011-01-26 2016-03-28 Novozymes As Polypeptides having cellobiohydrolase activity and polynucleotides encoding same.
BR112013019324B1 (en) 2011-01-31 2021-06-08 Novozymes North America, Inc processes for enzymatic refinement of a pretreated cellulosic material
MX2013007997A (en) 2011-02-23 2013-08-21 Novozymes Inc Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same.
CA2825628A1 (en) 2011-02-23 2012-08-30 Dupont Nutrition Biosciences Aps Method
BR112013019036A2 (en) 2011-02-28 2017-04-04 Novozymes Inc recombinant host cell, and method for producing a dicarboxylic acid.
EP2683830A1 (en) 2011-03-09 2014-01-15 Novozymes A/S Methods of increasing the cellulolytic enhancing activity of a polypeptide
WO2012122477A1 (en) 2011-03-10 2012-09-13 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
CN103596970A (en) 2011-03-11 2014-02-19 帝斯曼知识产权资产管理有限公司 Vector-host system
US9879294B2 (en) 2011-03-25 2018-01-30 Novozymes A/S Methods for degrading or converting cellulosic material
WO2012135719A1 (en) 2011-03-31 2012-10-04 Novozymes, Inc. Cellulose binding domain variants and polynucleotides encoding same
US9410136B2 (en) 2011-03-31 2016-08-09 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
US9926547B2 (en) 2011-04-28 2018-03-27 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
CN103797126A (en) 2011-04-29 2014-05-14 诺维信股份有限公司 Methods for enhancing the degradation or conversion of cellulosic material
US20140141471A1 (en) 2011-05-19 2014-05-22 Novozymes, Inc. Methods for Enhancing the Degradation of Cellulosic Material with Chitin Binding Proteins
WO2012159009A1 (en) 2011-05-19 2012-11-22 Novozymes, Inc. Methods for enhancing the degradation of cellulosic material with chitin binding proteins
EP2527432A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Bi-directional cytosine deaminase-encoding selection marker
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
EP2723858B1 (en) 2011-06-24 2017-04-12 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
ES2834102T3 (en) 2011-06-30 2021-06-16 Novozymes As Alpha-amylase variants
CN103703124B (en) 2011-06-30 2021-01-15 诺维信公司 Method for screening alpha-amylase
CA2840962C (en) 2011-07-06 2021-04-13 Novozymes A/S Alpha amylase variants and polynucleotides encoding same
CN103827298A (en) 2011-07-15 2014-05-28 诺维信公司 Lipase variants and polynucleotides encoding same
DK2734633T3 (en) 2011-07-22 2019-06-11 Novozymes North America Inc PROCEDURES FOR PREPARING CELLULOSE MATERIALS AND IMPROVING HYDROLYSIS THEREOF
US8859227B2 (en) 2011-08-04 2014-10-14 Novozymes, Inc. Polypeptides having xylanase activity and polynucleotides encoding same
CN103703125B (en) 2011-08-04 2016-09-07 诺维信公司 Polypeptides with endoglucanase activity and polynucleotides encoding them
WO2013021059A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021062A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
EP2742130B1 (en) 2011-08-10 2017-11-01 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021065A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013021064A1 (en) 2011-08-10 2013-02-14 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
US9487761B2 (en) 2011-08-10 2016-11-08 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
CN103827297B (en) 2011-08-10 2018-06-22 诺维信公司 Polypeptide with peroxidase activity and the polynucleotides for encoding the polypeptide
US9000138B2 (en) 2011-08-15 2015-04-07 Novozymes A/S Expression constructs comprising a Terebella lapidaria nucleic acid encoding a cellulase, host cells, and methods of making the cellulase
DK2744904T3 (en) 2011-08-19 2016-07-25 Novozymes Inc Recombinant microorganisms for the preparation of C4 dicarboxylic acids
ES2641039T3 (en) 2011-08-19 2017-11-07 Novozymes A/S Polypeptides with protease activity
DK2748305T3 (en) 2011-08-24 2017-02-06 Novozymes Inc CELLULOLYTIC ENZYME COMPOSITIONS AND APPLICATIONS THEREOF
CA2846391A1 (en) 2011-08-24 2013-02-28 Novozymes, Inc. Aspergillus fumigatus cellulolytic enzyme compositions and uses thereof
CN103748226A (en) 2011-08-24 2014-04-23 诺维信股份有限公司 Method for obtaining positive transformants of filamentous fungal host cells
AU2012298799B2 (en) 2011-08-24 2018-02-01 Novozymes, Inc. Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell
EP2748188A4 (en) 2011-08-26 2015-03-18 Novozymes As POLYPEPTIDES HAVING GLUCOAMYLASE ACTIVITY AND POLYNUCLEOTIDES ENCODING THESE POLYPEPTIDES
WO2013036526A1 (en) 2011-09-06 2013-03-14 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
CA2847236A1 (en) 2011-09-09 2013-03-14 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
EP2756091A1 (en) 2011-09-13 2014-07-23 Novozymes North America, Inc. Methods of hydrolyzing and fermenting cellulosic material
US20140308705A1 (en) 2011-09-20 2014-10-16 Novozymes A/S Polypeptides Having Cellulolytic Enhancing Activity And Polynucleotides Encoding Same
ES2628190T3 (en) 2011-09-22 2017-08-02 Novozymes A/S Polypeptides with protease activity and polynucleotides encoding them
CA2850070A1 (en) 2011-09-30 2013-04-04 Novozymes A/S Polypeptides having alpha-amylase activity and polynucleotides encoding same
BR112014007647A2 (en) 2011-09-30 2017-04-18 Novozymes As 3-hpdh variant, polypeptide having 3-hpdh activity, isolated polynucleotide, transgenic microbial host cell, and method for producing 3-hp
WO2013089889A2 (en) 2011-09-30 2013-06-20 Novozymes, Inc. Chimeric polypeptides having beta-glucosidase activity and polynucleotides encoding same
DK2766476T3 (en) 2011-10-11 2017-08-28 Novozymes As GLUCOAMYLASE VARIETIES AND POLYNUCLEOTIDES CODING THEM
MX355356B (en) 2011-10-17 2018-04-17 Novozymes As Alpha-amylase variants and polynucleotides encoding same.
CA2852603C (en) 2011-10-17 2025-10-07 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
DK2773656T3 (en) 2011-10-31 2019-09-09 Novozymes Inc POLYPEPTIDES WITH CELLULOLYSE ENHANCING ACTIVITY AND POLYNUCLEOTIDES CODING THEM
US9562222B2 (en) 2011-11-18 2017-02-07 Novozymes A/S Polypeptides having beta-glucosidase activity, beta-xylosidase activity, or beta-glucosidase and beta-xylosidase activity and polynucleotides encoding same
EP3597736A1 (en) 2011-11-21 2020-01-22 Novozymes A/S Gh61 polypeptide variants and polynucleotides encoding same
EP2782998B1 (en) 2011-11-22 2018-01-10 Novozymes Inc. Polypeptides having beta-xylosidase activity and polynucleotides encoding same
CN103957929B (en) 2011-11-25 2017-06-30 诺维信公司 Polypeptides having lysozyme activity and polynucleotides encoding said polypeptides
DK2785732T3 (en) 2011-12-01 2017-06-19 Novozymes Inc POLYPEPTIDES WITH BETA-XYLOSIDASE ACTIVITY AND POLYNUCLEOTIDES CODING THEM
US9169469B2 (en) 2011-12-02 2015-10-27 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013079533A1 (en) 2011-12-02 2013-06-06 Novozymes A/S Polypeptides having peroxygenase activity and polynucleotides encoding same
WO2013087027A1 (en) 2011-12-16 2013-06-20 Novozymes, Inc. Polypeptides having laccase activity and polynucleotides encoding same
EP2794870A4 (en) 2011-12-19 2015-06-17 Novozymes Inc POLYPEPTIDES HAVING CATALASE ACTIVITY AND POLYNUCLEOTIDES ENCODING SAME
US10036050B2 (en) 2011-12-20 2018-07-31 Novozymes, Inc. Cellobiohydrolase variants and polynucleotides encoding same
AU2012360992B2 (en) 2011-12-28 2018-08-09 Novozymes A/S Polypeptides having protease activity
MX2014008764A (en) 2012-01-26 2014-08-27 Novozymes As Use of polypeptides having protease activity in animal feed and detergents.
WO2013116261A2 (en) 2012-02-03 2013-08-08 The Procter & Gamble Company Compositions and methods for surface treatment with lipases
DK3211074T3 (en) 2012-02-03 2020-06-02 Novozymes As LIPASE VARIETIES AND POLYNUCLEOTIDES CODING THEM
WO2013123871A1 (en) 2012-02-20 2013-08-29 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2013149858A1 (en) 2012-04-02 2013-10-10 Novozymes A/S Lipase variants and polynucleotides encoding same
CN104245930A (en) 2012-04-23 2014-12-24 诺维信公司 Polypeptides having glucuronyl esterase activity and polynucleotides encoding same
WO2013160248A2 (en) 2012-04-23 2013-10-31 Novozymes A/S Polypeptides having alpha-glucuronidase activity and polynucleotides encoding same
CN119193513A (en) 2012-04-27 2024-12-27 诺维信股份有限公司 GH61 polypeptide variants and polynucleotides encoding the same
US9458441B2 (en) 2012-05-07 2016-10-04 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
JP6449763B2 (en) 2012-05-31 2019-01-09 ノボザイムス アクティーゼルスカブ Improved selection in fungi
CN104364371B (en) 2012-05-31 2018-10-23 诺维信公司 Polypeptides with organophosphate hydrolase activity
BR112014031882A2 (en) 2012-06-20 2017-08-01 Novozymes As use of an isolated polypeptide, polypeptide, composition, isolated polynucleotide, nucleic acid construct or expression vector, recombinant expression host cell, methods for producing a polypeptide, for enhancing the nutritional value of an animal feed, and for the treatment of protein, use of at least one polypeptide, animal feed additive, animal feed, and detergent composition
MX2015000312A (en) 2012-07-12 2015-04-10 Novozymes As Polypeptides having lipase activity and polynucleotides encoding same.
MX357482B (en) 2012-07-19 2018-07-11 Dsm Ip Assets Bv Agse-deficient strain.
EP2885409A1 (en) 2012-08-17 2015-06-24 Novozymes A/S Methods for co-silencing expression of genes in filamentous fungal strains and uses thereof
BR112015003257A2 (en) 2012-08-17 2017-11-14 Novozymes As asparaginase variant, methods for producing a food product from a food material, for producing an asparaginase variant and for obtaining an asparaginase variant, isolated polynucleotide, nucleic acid construct, expression vector, and host cell
MX357022B (en) 2012-08-22 2018-06-25 Novozymes As Metalloproteases from alicyclobacillus sp.
EP2888361A1 (en) 2012-08-22 2015-07-01 Novozymes A/S Metalloprotease from exiguobacterium
AU2013311668B2 (en) 2012-09-05 2019-02-28 Novozymes A/S Polypeptides having protease activity
EP2898068A2 (en) 2012-09-19 2015-07-29 Novozymes, Inc. Methods for enhancing the degradation or conversion of cellulosic material
JP5971661B2 (en) * 2012-09-19 2016-08-17 国立大学法人 東京大学 DNA having neural activity-dependent promoter activity and vector containing the same
US10035996B2 (en) 2012-10-08 2018-07-31 Novozymes, Inc. Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
US9719072B2 (en) 2012-10-12 2017-08-01 Novozymes A/S Polypeptides having peroxygenase activity
WO2014056922A2 (en) 2012-10-12 2014-04-17 Novozymes A/S Polypeptides having peroxygenase activity
EP2906689B1 (en) 2012-10-12 2018-12-12 Novozymes A/S Polypeptides having peroxygenase activity
EP2906687B1 (en) 2012-10-12 2018-08-15 Novozymes A/S Polypeptides having peroxygenase activity
CN104704115B (en) 2012-10-12 2018-11-02 诺维信公司 With the active polypeptide of peroxygenases
US9453207B2 (en) 2012-10-12 2016-09-27 Novozymes A/S Polypeptides having peroxygenase activity
US9458435B2 (en) 2012-10-12 2016-10-04 Novozymes A/S Polypeptides having peroxygenase activity
US20150275194A1 (en) 2012-10-24 2015-10-01 Novozymes A/S Polypeptides Having Cellulolytic Enhancing Activity And Polynucleotides Encoding Same
WO2014076232A2 (en) 2012-11-19 2014-05-22 Novozymes A/S Isopropanol production by recombinant hosts using an hmg-coa intermediate
EP2929028A1 (en) 2012-12-07 2015-10-14 Novozymes A/S Method for generating site-specific mutations in filamentous fungi
BR112015013399B1 (en) 2012-12-11 2023-02-14 Novozymes A/S USE OF POLYPEPTIDE HAVING PHOSPHOLIPASE C ACTIVITY AND METHOD FOR REDUCING THE CONTENT OF PHOSPHORUS CONTAINING COMPONENTS IN AN EDIBLE OIL
WO2014093835A1 (en) 2012-12-14 2014-06-19 Novozymes A/S Polypeptides having cellulolytic enhancing activity and polynucleotides encoding same
DK2935574T3 (en) 2012-12-17 2020-02-03 Novozymes As Alpha amylases and polynucleotides encoding them
WO2014099798A1 (en) 2012-12-19 2014-06-26 Novozymes A/S Polypeptides having cellulolytic enhancinc activity and polynucleotides encoding same
US9551042B2 (en) 2012-12-21 2017-01-24 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2014101753A1 (en) 2012-12-24 2014-07-03 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US9902946B2 (en) 2013-01-03 2018-02-27 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
CN105073986A (en) 2013-02-04 2015-11-18 帝斯曼知识产权资产管理有限公司 Carbohydrate degrading polypeptides and uses thereof
US9441215B2 (en) 2013-02-06 2016-09-13 Novozymes A/S Polypeptides having protease activity
CN110628749A (en) 2013-03-08 2019-12-31 诺维信公司 Cellobiohydrolase variants and polynucleotides encoding them
WO2014145768A2 (en) 2013-03-15 2014-09-18 Bp Corporation North America Inc. Use of non-fungal 5' utrs in filamentous fungi
US9670470B2 (en) 2013-03-21 2017-06-06 Novozymes A/S Polypeptides having phospholipase A activity and polynucleotides encoding same
MX360759B (en) 2013-03-21 2018-11-15 Novozymes As Polypeptides with lipase activity and polynucleotides encoding same.
DK2986701T3 (en) 2013-04-18 2019-01-14 Novozymes As Polypeptides with protease activity and polynucleotides encoding them
CN121380029A (en) 2013-04-30 2026-01-23 诺维信公司 Glucosylamylase variants and the polynucleotides encoding them
WO2014177541A2 (en) 2013-04-30 2014-11-06 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
DK2994529T3 (en) 2013-05-10 2019-03-04 Novozymes As Polypeptides with xylanase activity and polynucleotides encoding them
MY192746A (en) 2013-05-14 2022-09-06 Novozymes As Detergent compositions
WO2014183921A1 (en) 2013-05-17 2014-11-20 Novozymes A/S Polypeptides having alpha amylase activity
US10538751B2 (en) 2013-06-06 2020-01-21 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
WO2014202622A2 (en) 2013-06-19 2014-12-24 Dsm Ip Assets B.V. Rasamsonia gene and use thereof
WO2014202624A2 (en) 2013-06-19 2014-12-24 Dsm Ip Assets B.V. Rasamsonia gene and use thereof
WO2014202620A2 (en) 2013-06-19 2014-12-24 Dsm Ip Assets B.V. Rasamsonia gene and use thereof
WO2014202621A1 (en) 2013-06-20 2014-12-24 Dsm Ip Assets B.V. Carbohydrate degrading polypeptide and uses thereof
RU2015156280A (en) 2013-07-04 2017-08-09 Новозимс А/С POLYEPEPTIDES HAVING AN EFFECT AGAINST RESETITATION AND POLYNUCLEOTIDES CODING THEM
CN105339492A (en) 2013-07-09 2016-02-17 诺维信公司 Polypeptides having lipase activity and polynucleotides encoding them
CN105339494B (en) 2013-07-17 2020-04-17 诺维信公司 Pullulanase chimeras and polynucleotides encoding same
CA2917690A1 (en) 2013-07-26 2015-01-29 Biomethodes Novel variant trichoderma reesei endoglucanases
CN104342419B (en) * 2013-08-06 2017-03-08 上海康地恩生物科技有限公司 A kind of glucoamylase from stachybotrys atra
US10010094B2 (en) 2013-08-15 2018-07-03 Novozymes A/S Polypeptides having beta-1,3-galactanase activity and polynucleotides encoding same
WO2015059133A1 (en) 2013-10-22 2015-04-30 Novozymes A/S Cellobiose dehydrogenase variants and polynucleotides encoding same
WO2015058700A1 (en) 2013-10-25 2015-04-30 Novozymes A/S Polypeptides having endoglucanase activity and polynucleotides encoding same
US20170166939A1 (en) 2013-11-26 2017-06-15 Novozymes A/S Enzyme Compositions and Uses Thereof
EP2876156A1 (en) 2013-11-26 2015-05-27 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzymes and method for preparing hydroxylated L-lysine or L-ornithine and analogs thereof
EP3074509B1 (en) 2013-11-29 2019-03-06 Novozymes A/S Peroxygenase variants
WO2015082488A1 (en) 2013-12-02 2015-06-11 Dsm Ip Assets B.V. Ice structuring protein
CN122012456A (en) 2013-12-11 2026-05-12 诺维信公司 Cutinase variants and polynucleotides encoding same
EP2886656A1 (en) 2013-12-18 2015-06-24 Commissariat A L'energie Atomique Et Aux Energies Alternatives New enzyme and method for preparing 4-hydroxyl benzyl alcohol and derivatives thereof
CN105814200A (en) 2013-12-20 2016-07-27 诺维信公司 Polypeptides having protease activity and polynucleotides encoding same
US10030237B2 (en) 2014-01-22 2018-07-24 Novozymes A/S Pullulanase variants and polynucleotides encoding same
MX2016011413A (en) 2014-03-05 2017-02-28 Novozymes As Formulations comprising polymeric xyloglucan as a carrier for agriculturally beneficial agents.
US10123535B2 (en) 2014-03-05 2018-11-13 Novozymes A/S Compositions and methods for improving post-harvest properties of agricultural crops
WO2015134773A1 (en) 2014-03-05 2015-09-11 Novozymes A/S Compositions and methods for functionalizing and linking materials
EP3114272A1 (en) 2014-03-05 2017-01-11 Novozymes A/S Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase
US20160348035A1 (en) 2014-03-05 2016-12-01 Novozymes A/S Compositions and Methods for Improving Properties of Non-Cellulosic Textile Materials with Xyloglucan Endotransglycosylase
WO2015135464A1 (en) 2014-03-12 2015-09-17 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3126479A1 (en) 2014-04-01 2017-02-08 Novozymes A/S Polypeptides having alpha amylase activity
EP3129478B1 (en) 2014-04-10 2019-03-27 Novozymes A/S Alpha-amylase variants and polynucleotides encoding same
RU2737535C2 (en) 2014-04-11 2020-12-01 Новозимс А/С Detergent composition
EP3131921B1 (en) 2014-04-15 2020-06-10 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
WO2015177152A1 (en) 2014-05-19 2015-11-26 Dsm Ip Assets B.V. Proline-specific endoprotease
WO2015177153A1 (en) 2014-05-19 2015-11-26 Dsm Ip Assets B.V. Proline-specific endoprotease
MX375798B (en) 2014-05-19 2025-03-07 Dsm Ip Assets Bv PROLINE-SPECIFIC ENDOPROTEASE.
WO2015181119A2 (en) 2014-05-27 2015-12-03 Novozymes A/S Lipase variants and polynucleotides encoding same
WO2015183710A1 (en) 2014-05-30 2015-12-03 Novozymes A/S Variants of gh family 11 xylanase and polynucleotides encoding same
WO2015187935A1 (en) 2014-06-06 2015-12-10 Novozymes A/S Enzyme compositions and uses thereof
WO2015200659A1 (en) 2014-06-25 2015-12-30 Novozymes A/S Xylanase variants and polynucleotides encoding same
EP3183339A1 (en) 2014-08-20 2017-06-28 Novozymes A/S Xyloglucan endotransglycosylase variants and polynucleotides encoding same
EP3594335B1 (en) 2014-09-05 2024-05-01 Novozymes A/S Carbohydrate binding module variants and polynucleotides encoding same
CN106795505A (en) 2014-10-23 2017-05-31 诺维信公司 Glucoamylase variant and their polynucleotides of coding
EP3215615B1 (en) 2014-11-04 2025-05-21 Novozymes A/S Polypeptides having serine protease activity and polynucleotides encoding same and their application in animal feed
WO2016079305A1 (en) 2014-11-20 2016-05-26 Novozymes A/S Alicyclobacillus variants and polynucleotides encoding same
WO2016090059A1 (en) 2014-12-02 2016-06-09 Novozymes A/S Laccase variants and polynucleotides encoding same
US10457921B2 (en) 2014-12-05 2019-10-29 Novozymes A/S Lipase variants and polynucleotides encoding same
CN107002049A (en) 2014-12-16 2017-08-01 诺维信公司 Polypeptide with N acerylglucosamine oxidase actives
US20170362613A1 (en) 2014-12-19 2017-12-21 Novozymes A/S Recombinant Host Cells For The Production Of 3-Hydroxypropionic Acid
DK3234143T5 (en) 2014-12-19 2024-10-14 Novozymes As COMPOSITIONS COMPRISING POLYPEPTIDES WITH XYLANASE ACTIVITY AND POLYPEPTIDES WITH ARABINOFURANOSIDASE ACTIVITY
DK3262165T3 (en) 2015-02-24 2020-08-24 Novozymes As CELLOBIOHYDROLASE VARIANTS AND POLYNUCLEOTIDES ENCODING THEM
CN107406821B (en) 2015-02-27 2021-10-15 诺维信公司 Mutant host cells for the production of 3-hydroxypropionic acid
WO2016145084A1 (en) 2015-03-09 2016-09-15 Novozymes A/S Methods of introducing multiple expression constructs into a eukaryotic cell
EP3280817A2 (en) 2015-04-07 2018-02-14 Novozymes A/S Methods for selecting enzymes having enhanced activity
EP3280818A2 (en) 2015-04-07 2018-02-14 Novozymes A/S Methods for selecting enzymes having lipase activity
AR104205A1 (en) 2015-04-09 2017-07-05 Dsm Ip Assets Bv PHOSPHOLIPASE C
EP3303578B1 (en) 2015-05-27 2020-07-08 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2016193292A1 (en) 2015-06-02 2016-12-08 Dsm Ip Assets B.V. Use of ice structuring protein afp19 expressed in filamentous fungal strains for preparing food
EP3310908B1 (en) 2015-06-16 2020-08-05 Novozymes A/S Polypeptides with lipase activity and polynucleotides encoding same
EP3310910A1 (en) 2015-06-18 2018-04-25 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
WO2016207373A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Polypeptides having peroxygenase activity
WO2016206621A1 (en) 2015-06-26 2016-12-29 Novozymes A/S Biofinishing system
DK3313193T3 (en) 2015-06-26 2021-06-07 Novozymes As PROCEDURE FOR PREPARING A COFFEE EXTRACT
AU2016286612B2 (en) 2015-07-02 2021-01-28 Novozymes A/S Animal feed compositions and uses thereof
EP3320089B1 (en) 2015-07-06 2021-06-16 Novozymes A/S Lipase variants and polynucleotides encoding same
US10577594B2 (en) 2015-07-24 2020-03-03 Novozymes, Inc. Polypeptides having arabinofuranosidase activity and polynucleotides encoding same
US20180216089A1 (en) 2015-07-24 2018-08-02 Novozymes, Inc. Polypeptides Having Beta-Xylosidase Activity And Polynucleotides Encoding Same
EP3330375A1 (en) 2015-07-29 2018-06-06 Abengoa Bioenergía Nuevas Tecnologías, S. A. Expression of recombinant beta-xylosidase enzymes
EP3341475A1 (en) 2015-08-24 2018-07-04 Novozymes A/S Beta-alanine aminotransferases for the production of 3-hydroxypropionic acid
WO2017046260A1 (en) 2015-09-17 2017-03-23 Novozymes A/S Polypeptides having xanthan degrading activity and polynucleotides encoding same
WO2017050242A1 (en) 2015-09-22 2017-03-30 Novozymes A/S Polypeptides having cellobiohydrolase activity and polynucleotides encoding same
WO2017050652A1 (en) 2015-09-25 2017-03-30 Dsm Ip Assets B.V. Asparaginase
WO2017060475A2 (en) 2015-10-07 2017-04-13 Novozymes A/S Polypeptides
DK3362574T3 (en) 2015-10-14 2021-10-11 Novozymes As Glucoamylase variants and polynucleotides encoding them
EP3362556B1 (en) 2015-10-14 2024-07-10 Novozymes A/S Polypeptide variants
CN108291215A (en) 2015-10-14 2018-07-17 诺维信公司 Polypeptide with proteinase activity and encode their polynucleotides
WO2017070219A1 (en) 2015-10-20 2017-04-27 Novozymes A/S Lytic polysaccharide monooxygenase (lpmo) variants and polynucleotides encoding same
CN108138188A (en) 2015-10-30 2018-06-08 诺维信公司 For the polynucleotide constructs of in vitro and in vivo expression
EP3380608A1 (en) 2015-11-24 2018-10-03 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
WO2017093318A1 (en) 2015-12-01 2017-06-08 Novozymes A/S Methods for producing lipases
CN108368158A (en) 2015-12-02 2018-08-03 法国农业科学研究院 New type of peptides with antimicrobial acivity and the novel enzyme that the L- form residues in peptide can be transformed into D-form amino acid
WO2017112847A1 (en) 2015-12-22 2017-06-29 Albumedix A/S Improved protein expression strains
JP7146637B2 (en) 2015-12-22 2022-10-04 アルブミディクス リミティド Improved protein expression strain
CN119120430A (en) 2015-12-30 2024-12-13 诺维信公司 Enzyme variants and polynucleotides encoding them
CA3007148A1 (en) 2016-01-29 2017-08-03 Novozymes A/S Beta-glucanase variants and polynucleotides encoding same
US11685911B2 (en) 2016-02-16 2023-06-27 Monaghan Mushroom S Group Fungal polypeptides having lysozyme activity
EP3420104A1 (en) 2016-02-23 2019-01-02 Novozymes A/S Improved next-generation sequencing
EP4410974A3 (en) 2016-03-02 2025-04-02 Novozymes A/S Cellobiohydrolase variants and polynucleotides encoding same
CN109072209A (en) 2016-03-24 2018-12-21 诺维信公司 Cellobiohydrolase variant and the polynucleotides for encoding it
US20190161786A1 (en) 2016-04-07 2019-05-30 Novozymes A/S Methods for selecting enzymes having protease activity
DK3445776T3 (en) 2016-04-19 2021-04-19 Novozymes As RLMA-inactivated filamentous fungal host cell
MX391044B (en) 2016-04-29 2025-03-21 Novozymes As DETERGENT COMPOSITIONS AND THEIR USES.
CN109415421B (en) 2016-05-03 2023-02-28 诺维信公司 Alpha-amylase variants and polynucleotides encoding same
US11186833B2 (en) 2016-05-09 2021-11-30 Novozymes A/S Variant polypeptides with improved performance and use of the same
EP3246401A1 (en) 2016-05-20 2017-11-22 Commissariat À L'Énergie Atomique Et Aux Énergies Alternatives New fatty acid decarboxylase and its uses
EP3462904B1 (en) 2016-05-24 2024-12-18 Novozymes A/S Gastric stable polypeptides having alpha-galactosidase activity and polynucleotides encoding same
MX2018014434A (en) 2016-05-24 2019-03-28 Novozymes As Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity.
WO2017202966A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Polypeptides having alpha-galactosidase activity and polynucleotides encoding same
WO2017202997A1 (en) 2016-05-24 2017-11-30 Novozymes A/S Compositions comprising polypeptides having galactanase activity and polypeptides having beta-galactosidase activity
WO2017205535A1 (en) 2016-05-27 2017-11-30 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
WO2017211803A1 (en) 2016-06-07 2017-12-14 Novozymes A/S Co-expression of heterologous polypeptides to increase yield
US10829748B2 (en) 2016-06-10 2020-11-10 Dsm Ip Assets B.V. Mutant lipase and use thereof
EP3263699B1 (en) 2016-06-30 2020-07-01 Fornia BioSolutions, Inc. Novel phytases and uses thereof
WO2018002261A1 (en) 2016-07-01 2018-01-04 Novozymes A/S Detergent compositions
CN109715794A (en) 2016-07-05 2019-05-03 诺维信公司 Pectin lyase enzyme variants and the polynucleotides for encoding them
CN109312353A (en) 2016-07-06 2019-02-05 诺维信公司 Improving microbes through CRISPR-inhibition
WO2018007573A1 (en) 2016-07-08 2018-01-11 Novozymes A/S Detergent compositions with galactanase
DK3481948T5 (en) 2016-07-08 2024-09-02 Novozymes As XYLANASE VARIANTS AND POLYNUCLEOTIDES ENCODING THEM
MX2019000139A (en) 2016-07-08 2019-06-10 Novozymes As Polypeptides having xylanase activity and polynucleotides encoding same.
WO2018011277A1 (en) 2016-07-13 2018-01-18 Novozymes A/S Bacillus cibi dnase variants
WO2018015295A1 (en) 2016-07-18 2018-01-25 Novozymes A/S Lipase variants, polynucleotides encoding same and the use thereof
CN109477083B (en) 2016-07-20 2023-06-06 诺维信公司 Thermostable metagenomic carbonic anhydrases and uses thereof
WO2018015304A1 (en) 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same
EP3487995B1 (en) 2016-07-21 2021-05-26 Novozymes A/S Serine protease variants and polynucleotides encoding same
CN109476714A (en) 2016-07-22 2019-03-15 诺维信公司 Improved filamentous fungal hosts
WO2018015444A1 (en) 2016-07-22 2018-01-25 Novozymes A/S Crispr-cas9 genome editing with multiple guide rnas in filamentous fungi
WO2018026868A1 (en) 2016-08-01 2018-02-08 Novozymes, Inc. Polypeptides having endoglucanase activity and polynucleotides encoding same
US11072765B2 (en) 2016-08-24 2021-07-27 Novozymes A/S GH9 endoglucanase variants and polynucleotides encoding same
WO2018037065A1 (en) 2016-08-24 2018-03-01 Henkel Ag & Co. Kgaa Detergent composition comprising gh9 endoglucanase variants i
WO2018037061A1 (en) 2016-08-24 2018-03-01 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
AU2017317563B8 (en) 2016-08-24 2023-03-23 Henkel Ag & Co. Kgaa Detergent compositions comprising xanthan lyase variants I
EP3512953A1 (en) 2016-09-15 2019-07-24 Novozymes A/S Genomic integration of dna fragments in fungal host cells
WO2018077938A1 (en) 2016-10-25 2018-05-03 Novozymes A/S Detergent compositions
US20210284991A1 (en) 2016-11-21 2021-09-16 Novozymes A/S Yeast Cell Extract Assisted Construction of DNA Molecules
US10986850B2 (en) 2016-12-21 2021-04-27 Novozymes A/S Polypeptides having lysozyme activity, polynucleotides encoding same and uses and compositions thereof
BR112019015943A2 (en) 2017-02-01 2020-04-07 Novozymes A/S alpha-amylase variants
CA3051426C (en) 2017-02-01 2023-10-17 The Procter & Gamble Company Cleaning compositions comprising amylase variants
CN110431224A (en) 2017-03-13 2019-11-08 帝斯曼知识产权资产管理有限公司 Zinc binuclear cluster transcription regulatory factor deficient strain
WO2018167153A1 (en) 2017-03-17 2018-09-20 Novozymes A/S Improved filamentous fungal host cell
WO2018172155A1 (en) 2017-03-23 2018-09-27 Novozymes A/S Improved filamentous fungal host cells
EP3601551A1 (en) 2017-03-31 2020-02-05 Novozymes A/S Polypeptides having rnase activity
US11208639B2 (en) 2017-03-31 2021-12-28 Novozymes A/S Polypeptides having DNase activity
EP3601552A4 (en) 2017-03-31 2022-01-12 Novozymes A/S POLYPEPTIDES EXHIBITING DNASE ACTIVITY
WO2018177936A1 (en) 2017-03-31 2018-10-04 Novozymes A/S Polypeptides having dnase activity
WO2018185150A1 (en) 2017-04-04 2018-10-11 Novozymes A/S Polypeptides
CN114480034A (en) 2017-04-04 2022-05-13 诺维信公司 Glycosyl hydrolase
US20200109352A1 (en) 2017-04-04 2020-04-09 Novozymes A/S Polypeptide compositions and uses thereof
CN110651048A (en) 2017-04-11 2020-01-03 诺维信公司 Glucoamylase variants and polynucleotides encoding them
CN110651038B (en) 2017-05-05 2025-02-18 诺维信公司 Composition comprising lipase and sulfite
EP3401385A1 (en) 2017-05-08 2018-11-14 Henkel AG & Co. KGaA Detergent composition comprising polypeptide comprising carbohydrate-binding domain
WO2018206535A1 (en) 2017-05-08 2018-11-15 Novozymes A/S Carbohydrate-binding domain and polynucleotides encoding the same
WO2018224035A1 (en) 2017-06-09 2018-12-13 Novozymes A/S Polypeptide, use and method for hydrolysing protein
DK3642343T3 (en) 2017-06-20 2022-03-14 Albumedix Ltd Improved protein expression strains
DK3642339T3 (en) 2017-06-22 2025-12-15 Novozymes As XYLANASE VARIANTS AND POLYNUCLEOTIDES ENCODING THEM
US11584783B2 (en) 2017-06-28 2023-02-21 Novozymes A/S Processes for producing a fermentation product
EP3658610B1 (en) 2017-07-24 2023-10-25 Novozymes A/S Gh5 and gh30 in wet milling
US10081800B1 (en) 2017-08-03 2018-09-25 Fornia Biosolutions, Inc. Lactonase enzymes and methods of using same
EP3665275A1 (en) 2017-08-08 2020-06-17 Novozymes A/S Polypeptides having trehalase activity and the use thereof in process of producing fermentation products
EP3673060A1 (en) 2017-08-24 2020-07-01 Henkel AG & Co. KGaA Detergent composition comprising xanthan lyase variants ii
CA3071078A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Xanthan lyase variants and polynucleotides encoding same
WO2019038058A1 (en) 2017-08-24 2019-02-28 Novozymes A/S Gh9 endoglucanase variants and polynucleotides encoding same
US11624059B2 (en) 2017-08-24 2023-04-11 Henkel Ag & Co. Kgaa Detergent compositions comprising GH9 endoglucanase variants II
WO2019046703A1 (en) 2017-09-01 2019-03-07 Novozymes A/S Methods for improving genome editing in fungi
HUE069804T2 (en) 2017-09-01 2025-04-28 Novozymes As Animal feed additives comprising a polypeptide having protease activity and uses thereof
AU2018322865B2 (en) 2017-09-01 2023-11-09 Novozymes A/S Animal feed additives comprising polypeptide having protease activity and uses thereof
US11447714B2 (en) 2017-09-26 2022-09-20 Bunge Global Innovation, Llc Enzymatic removal of chlorophyll substrates from triacylglycerol-based oils
CA3073362A1 (en) 2017-09-27 2019-04-04 Novozymes A/S Lipase variants and microcapsule compositions comprising such lipase variants
ES3027937T3 (en) * 2017-09-29 2025-06-17 Int N&H Denmark Aps Production of brewer's wort having increased fermentable sugars
CN111417725A (en) 2017-10-02 2020-07-14 诺维信公司 Polypeptides having mannanase activity and polynucleotides encoding same
US11732221B2 (en) 2017-10-02 2023-08-22 Novozymes A/S Polypeptides having mannanase activity and polynucleotides encoding same
CN111542604A (en) 2017-10-27 2020-08-14 诺维信公司 DNase variants
PL3476936T3 (en) 2017-10-27 2022-04-11 The Procter & Gamble Company Detergent compositions comprising polypeptide variants
DE102017125559A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE II
DE102017125560A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANSING COMPOSITIONS CONTAINING DISPERSINE III
DE102017125558A1 (en) 2017-11-01 2019-05-02 Henkel Ag & Co. Kgaa CLEANING COMPOSITIONS CONTAINING DISPERSINE I
EP3707252A1 (en) 2017-11-10 2020-09-16 Novozymes A/S Temperature-sensitive cas9 protein
WO2019096903A1 (en) 2017-11-20 2019-05-23 Novozymes A/S New galactanases (ec 3.2.1.89) for use in soy processing
EP3485734A1 (en) 2017-11-21 2019-05-22 Technische Universität München Method for preparing food products comprising rye
EP3488854A1 (en) 2017-11-22 2019-05-29 Technische Universität München Method for preparing xyloglucan-oligosaccharides
US11725197B2 (en) 2017-12-04 2023-08-15 Novozymes A/S Lipase variants and polynucleotides encoding same
EP3502242A1 (en) 2017-12-20 2019-06-26 Technische Universität München New xylanase with improved thermostability and increased enzyme activity on arabinoxylan
US20210017544A1 (en) 2017-12-22 2021-01-21 Novozymes A/S Counter-Selection by Inhibition of Conditionally Essential Genes
KR101992345B1 (en) * 2017-12-29 2019-09-27 (주)메디톡스 Promoter polynucleotide, signal polypeptide and use thereof
EP3749761A1 (en) 2018-02-08 2020-12-16 Novozymes A/S Lipases, lipase variants and compositions thereof
CN111757930A (en) 2018-02-08 2020-10-09 诺维信公司 Lipase variants and compositions thereof
DK3775222T5 (en) 2018-03-26 2024-08-19 Novozymes As Chaperone proteins from fungi
CN112105729B (en) 2018-04-09 2024-05-14 诺维信公司 Polypeptides having alpha-amylase activity and polynucleotides encoding the same
CN118460512A (en) 2018-04-19 2024-08-09 诺维信公司 Stabilized cellulase variants
CN118530973A (en) 2018-04-19 2024-08-23 诺维信公司 Stabilized cellulase variants
WO2019219903A2 (en) 2018-05-18 2019-11-21 Dsm Ip Assets B.V. Mutant lipase and use thereof
US20230250406A1 (en) 2018-05-18 2023-08-10 Dsm Ip Assets B.V. Mutant lipase and use thereof
WO2020002575A1 (en) 2018-06-28 2020-01-02 Novozymes A/S Polypeptides having pectin lyase activity and polynucleotides encoding same
CN112585267B (en) 2018-08-02 2024-07-12 诺维信公司 Preparation of combinatorial libraries of DNA constructs using introns
EP3843552A1 (en) 2018-08-31 2021-07-07 Novozymes A/S Polypeptides having protease activity and polynucleotides encoding same
CN113056476A (en) 2018-10-03 2021-06-29 诺维信公司 Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same
CN113056552A (en) 2018-10-09 2021-06-29 诺维信公司 Modified filamentous fungal host cells
US20220010305A1 (en) 2018-10-31 2022-01-13 Novozymes A/S Genome Editing by Guided Endonuclease and Single-stranded Oligonucleotide
CN113166211A (en) 2018-11-28 2021-07-23 诺维信公司 Improved filamentous fungal host cells
WO2020112881A1 (en) 2018-11-28 2020-06-04 Novozymes A/S Modified filamentous fungal host cells
US12385027B2 (en) 2018-12-12 2025-08-12 Novozymes A/S Polypeptides having xylanase activity and polynucleotides encoding same
CN109652417B (en) * 2018-12-17 2021-07-27 江南大学 A kind of method for constructing efficient Bacillus subtilis promoter
EP3898985B1 (en) 2018-12-21 2023-02-08 Novozymes A/S Tandem protein expression
US11959111B2 (en) 2018-12-21 2024-04-16 Novozymes A/S Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same
AU2020205462B2 (en) 2019-01-11 2026-03-05 River Stone Biotech Aps Recombinant host cells with improved production of L-DOPA, dopamine, (S)-Norcoclaurine or derivatives thereof.
WO2020161354A1 (en) 2019-02-08 2020-08-13 Pili Recombinant host cells to produce anthraquinone derivatives
WO2020173817A1 (en) 2019-02-28 2020-09-03 Novozymes A/S Calcite binding proteins
EP3737751A1 (en) 2019-03-21 2020-11-18 Fornia BioSolutions, Inc. Additional phytase variants and methods
WO2020198212A1 (en) 2019-03-27 2020-10-01 Bunge Global Innovation, Llc Silica adsorbent treatment for removal of chlorophyll derivatives from triacylglycerol-based oils
US20220169953A1 (en) 2019-04-03 2022-06-02 Novozymes A/S Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions
EP3953462A1 (en) 2019-04-10 2022-02-16 Novozymes A/S Polypeptide variants
MX2021012289A (en) 2019-04-12 2021-11-12 Novozymes As Stabilized glycoside hydrolase variants.
WO2020229191A1 (en) 2019-05-15 2020-11-19 Novozymes A/S Temperature-sensitive rna-guided endonuclease
EP3976769A1 (en) 2019-05-27 2022-04-06 Octarine Bio IVS Genetically modified host cells producing glycosylated cannabinoids
WO2020264552A1 (en) 2019-06-24 2020-12-30 The Procter & Gamble Company Cleaning compositions comprising amylase variants
CN113993996A (en) 2019-06-24 2022-01-28 诺维信公司 Alpha-amylase variants
EP3990629A1 (en) 2019-06-25 2022-05-04 Novozymes A/S Counter-selection by inhibition of conditionally essential genes
WO2021001400A1 (en) 2019-07-02 2021-01-07 Novozymes A/S Lipase variants and compositions thereof
EP4004211A1 (en) 2019-07-25 2022-06-01 Novozymes A/S Filamentous fungal expression system
CN114555777A (en) 2019-07-26 2022-05-27 诺维信公司 Modified filamentous fungal host cells
US20220331377A1 (en) 2019-09-09 2022-10-20 River Stone Biotech Isg Aps Delivery vehicle for in situ delivering of pharmaceutical agents
PY2055454A (en) 2019-09-16 2022-03-31 Novozymes As POLYPEPTIDES THAT POSSESS BETA-GLUCANASE ACTIVITY AND POLYNUCLEOTIDES THAT ENCODE THEM
WO2021064068A1 (en) 2019-10-03 2021-04-08 Novozymes A/S Polypeptides comprising at least two carbohydrate binding domains
AR120801A1 (en) 2019-12-19 2022-03-16 Novozymes As XYLANASE VARIANTS AND POLYNUCLEOTIDES ENCODING THEM
EP4077656A2 (en) 2019-12-20 2022-10-26 Novozymes A/S Polypeptides having proteolytic activity and use thereof
BR112022014573A2 (en) 2020-01-24 2022-10-04 Novozymes As MUTANTS OF A FILAMENTARY FUNGAL CELL WITH INCREASED PRODUCTIVITY IN THE PRODUCTION OF A POLYPEPTIDE
US12497606B2 (en) 2020-01-31 2025-12-16 Novozymes A/S Mannanase variants and polynucleotides encoding same
EP4097227A1 (en) 2020-01-31 2022-12-07 Novozymes A/S Mannanase variants and polynucleotides encoding same
WO2021163015A1 (en) 2020-02-10 2021-08-19 Novozymes A/S Process for producing ethanol from raw starch using alpha-amylase variants
CA3166233A1 (en) 2020-02-10 2021-08-19 Sarah Schultheis ELLIOTT Alpha-amylase variants and polynucleotides encoding same
PY2110525A (en) 2020-02-10 2022-05-11 Novozymes As POLYPEPTIDES WITH ALPHA AMYLASE ACTIVITY AND THE POLYNUCLEOTIDES THAT ENCODE THEM
EP4110909A1 (en) 2020-02-26 2023-01-04 Novozymes A/S Polypeptide variants
EP4118195A1 (en) 2020-03-12 2023-01-18 Novozymes A/S Crispr-aid using catalytically inactive rna-guided endonuclease
EP3892708A1 (en) 2020-04-06 2021-10-13 Henkel AG & Co. KGaA Cleaning compositions comprising dispersin variants
EP4133066A1 (en) 2020-04-08 2023-02-15 Novozymes A/S Carbohydrate binding module variants
US20230167384A1 (en) 2020-04-21 2023-06-01 Novozymes A/S Cleaning compositions comprising polypeptides having fructan degrading activity
EP4204551B1 (en) 2020-08-25 2025-09-17 Novozymes A/S Variants of a family 44 xyloglucanase
WO2022043563A1 (en) 2020-08-28 2022-03-03 Novozymes A/S Polyester degrading protease variants
CN116529375A (en) 2020-10-13 2023-08-01 诺维信公司 Glycosyltransferase variants for enhanced protein production
US20240035005A1 (en) 2020-10-29 2024-02-01 Novozymes A/S Lipase variants and compositions comprising such lipase variants
CA3199315A1 (en) 2020-11-02 2022-05-05 Novozymes A/S Glucoamylase variants and polynucleotides encoding same
EP4237430A1 (en) 2020-11-02 2023-09-06 Novozymes A/S Leader peptides and polynucleotides encoding the same
US12071644B2 (en) 2020-12-17 2024-08-27 Fornia Biosolutions, Inc. Xylanase variants and methods
WO2022175440A1 (en) 2021-02-18 2022-08-25 Novozymes A/S Inactive heme polypeptides
EP4305146A1 (en) 2021-03-12 2024-01-17 Novozymes A/S Polypeptide variants
MX2023005793A (en) 2021-03-15 2023-05-29 Procter & Gamble CLEANING COMPOSITIONS CONTAINING POLYPEPTIDE VARIANTS.
EP4060036A1 (en) 2021-03-15 2022-09-21 Novozymes A/S Polypeptide variants
US20240060061A1 (en) 2021-03-15 2024-02-22 Novozymes A/S Dnase variants
WO2022234005A1 (en) 2021-05-07 2022-11-10 River Stone Biotech Aps Glycosylated opioids
WO2022251056A1 (en) 2021-05-27 2022-12-01 Novozymes A/S Transcriptional regulators and polynucleotides encoding the same
EP4359518A1 (en) 2021-06-23 2024-05-01 Novozymes A/S Alpha-amylase polypeptides
WO2023006699A1 (en) 2021-07-30 2023-02-02 Københavns Universitet Cells and method for producing isoprenoid molecules with canonical and non-canonical structures
WO2024100063A1 (en) 2022-11-08 2024-05-16 River Stone Biotech Aps Genetically modified benzylisoquinoline alkaloid-producing host cells with modified efflux transporter gene expression
CN116675748A (en) * 2023-04-28 2023-09-01 河南农业大学 A plant immune activation protein FpCDP1 secreted by Fusarium graminearum and its application
WO2026017657A1 (en) 2024-07-15 2026-01-22 Pili Production of p-aminobenzoic acid by a recombinant microorganism

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK122686D0 (en) 1986-03-17 1986-03-17 Novo Industri As PREPARATION OF PROTEINS
DE3854249T2 (en) 1987-08-28 1996-02-29 Novonordisk As Recombinant Humicola Lipase and Process for the Production of Recombinant Humicola Lipases.
DK0548228T3 (en) 1990-09-13 1999-05-10 Novo Nordisk As lipase variants
US5641670A (en) 1991-11-05 1997-06-24 Transkaryotic Therapies, Inc. Protein production and protein delivery
GB9316883D0 (en) * 1993-08-13 1993-09-29 Univ Leeds Production of heterologous peptices
JP3649338B2 (en) 1994-06-03 2005-05-18 ノボザイムス バイオテック,インコーポレイティド Purified Myserioftra laccase and nucleic acid encoding it
ATE294871T1 (en) 1994-06-30 2005-05-15 Novozymes Biotech Inc NON-TOXIC, NON-TOXIGEN, NON-PATHOGENIC FUSARIUM EXPRESSION SYSTEM AND PROMOTORS AND TERMINATORS FOR USE THEREIN
EP1605050A3 (en) 1996-01-19 2006-03-22 Novozymes Biotech, Inc. Morphological mutants of filamentous fungi
CN1190673A (en) * 1996-04-29 1998-08-19 中国科学院微生物研究所 Filamentous fungus independently duplicated representation rector and system
EP0966521A1 (en) 1996-09-13 1999-12-29 Novo Nordisk Biotech, Inc. Cells having dna insertion mutations which produce altered amounts of a polypeptide
EP0948606B1 (en) 1996-12-20 2000-08-02 Novo Nordisk A/S Peniophora phytase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0056900A3 *

Also Published As

Publication number Publication date
CN1526820B (en) 2010-05-26
JP2010227108A (en) 2010-10-14
CN1536089A (en) 2004-10-13
CN1940067A (en) 2007-04-04
CN100532561C (en) 2009-08-26
EP2278016A1 (en) 2011-01-26
JP2013121361A (en) 2013-06-20
CN1526820A (en) 2004-09-08
CN1367838A (en) 2002-09-04
JP4620253B2 (en) 2011-01-26
JP2002539793A (en) 2002-11-26
JP5264825B2 (en) 2013-08-14
CN100510096C (en) 2009-07-08
JP2013121360A (en) 2013-06-20
CN1526821A (en) 2004-09-08
WO2000056900A2 (en) 2000-09-28
DK2278016T3 (en) 2012-11-26
AU4025700A (en) 2000-10-09
WO2000056900A3 (en) 2002-01-31
CN100482801C (en) 2009-04-29
EP2278016B1 (en) 2012-09-26

Similar Documents

Publication Publication Date Title
JP4620253B2 (en) Promoter for gene expression in fungal cells
US8512985B2 (en) Signal peptide for producing a polypeptide
CN1425068B (en) Fungal transcriptional activators effective in methods of making polypeptides
EP2044203B1 (en) Methods for increasing expression of genes in a fungal cell
CN1329667B (en) Fungal transcriptional activators effective in methods of making polypeptides
JP2011101651A (en) Oxaloacetate hydrolase deficient fungal host cell
JP2010507381A (en) Improved alpha factor signal peptide for polypeptide production
US20090239260A1 (en) Fungal Transcriptional Activator Useful In Methods for Producing Polypeptides
US6461837B1 (en) Methods for producing a polypeptide using a consensus translational initiator sequence
EP1078080A1 (en) Methods for producing polypeptides in filamentous fungal mutant cells
US6692940B2 (en) Promoters for expressing genes in a fungal cell
WO2000046375A2 (en) Methods for producing polypeptides in fungal cells
CN1969041B (en) Signal peptide for producing a polypeptide

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17P Request for examination filed

Effective date: 20020731

17Q First examination report despatched

Effective date: 20040204

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: NOVOZYMES, INC.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20101207