EP1173563A1 - Zusammensetzungen und verfahren zur behandlung von tumoren - Google Patents

Zusammensetzungen und verfahren zur behandlung von tumoren

Info

Publication number
EP1173563A1
EP1173563A1 EP00907270A EP00907270A EP1173563A1 EP 1173563 A1 EP1173563 A1 EP 1173563A1 EP 00907270 A EP00907270 A EP 00907270A EP 00907270 A EP00907270 A EP 00907270A EP 1173563 A1 EP1173563 A1 EP 1173563A1
Authority
EP
European Patent Office
Prior art keywords
seq
polypeptide
pro9850
pro206
pro207
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00907270A
Other languages
English (en)
French (fr)
Inventor
Avi J. Ashkenazi
Audrey Goddard
Paul J. Godowski
Austin L. Gurney
Kenneth J. Hillan
Scot A. Marsters
James Pan
Robert M. Pitti
Margaret Ann Roy
Victoria Smith
Donna M. Stone
Colin K. Watanabe
William I. Wood
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1999/005028 external-priority patent/WO1999046281A2/en
Priority claimed from PCT/US1999/012252 external-priority patent/WO1999063088A2/en
Priority claimed from PCT/US1999/020111 external-priority patent/WO2000012708A2/en
Priority claimed from PCT/US1999/021090 external-priority patent/WO2000015796A2/en
Priority claimed from PCT/US1999/028313 external-priority patent/WO2000032221A2/en
Priority claimed from PCT/US1999/028634 external-priority patent/WO2000036102A2/en
Priority claimed from PCT/US1999/028301 external-priority patent/WO2000032776A2/en
Priority claimed from PCT/US2000/000219 external-priority patent/WO2000053753A2/en
Priority to EP05018357A priority Critical patent/EP1626058B1/de
Priority to EP05018358A priority patent/EP1623990B1/de
Priority to EP05018356A priority patent/EP1607402B1/de
Priority to EP05018354A priority patent/EP1632499B9/de
Priority to EP05018355A priority patent/EP1623989B1/de
Priority to EP05018353A priority patent/EP1626084B1/de
Application filed by Genentech Inc filed Critical Genentech Inc
Publication of EP1173563A1 publication Critical patent/EP1173563A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82—Translation products from oncogenes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/02—Preparation of peptides or proteins having a known sequence of two or more amino acids, e.g. glutathione
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57496—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving intracellular compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds

Definitions

  • the present invention relates to compositions and methods for the diagnosis and treatment of tumor.
  • Malignant tumors are the second leading cause of death in the United States, after heart disease (Boring et al, CA Cancel J. Clin.. 43:7 [1993]).
  • Cancer is characterized by an increase in the number of abnormal, or neoplastic cells derived from a normal tissue which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells, and the generation of malignant cells which eventually spread via the blood or lymphatic system to regional lymph nodes and to distant sites (metastasis).
  • a cell proliferates under conditions in which normal cells would not grow.
  • Cancer manifests itself in a wide variety of forms, characterized by different degrees of invasiveness and aggressiveness. Alteration of gene expression is intimately related to the uncontrolled cell growth and de-differentiation which are a common feature of all cancers.
  • tumor suppression genes which would normally function to prevent malignant cell growth, and/or overexpression of certain dominant genes, such as oncogenes, that act to promote malignant growth.
  • tumor suppression genes which would normally function to prevent malignant cell growth
  • oncogenes certain dominant genes, such as oncogenes, that act to promote malignant growth.
  • Each of these genetic changes appears to be responsible for importing some of the traits that, in aggregate, represent the full neoplastic phenotype (Hunter, Cell. 64: 1129 [1991] and Bishop, Cell. 64:235-248 [1991]).
  • a well known mechanism of gene (e.g., oncogene) overexpression in cancer cells is gene amplification. This is a process where in the chromosome of the ancestral cell multiple copies of a particular gene are produced. The process involves unscheduled replication of the region of chromosome comprising the gene, followed by recombination of the replicated segments back into the chromosome (Alitalo etal., Adv. Cancer Res..47:235-281 [1986]). It is believed that the overexpression of the gene parallels gene amplification, i.e., is proportionate to the number of copies made.
  • Proto-oncogenes that encode growth factors and growth factor receptors have been identified to play important roles in the pathogenesis of various human malignancies, including breast cancer.
  • the human ErbB2 gene (erbB2, also known as her2, or c-erbB-2), which encodes a 185-kd transmembrane glycoprotein receptor (p 185 HER2 ; HER2) related to the epidermal growth factor receptor EGFR)
  • erbB2 also known as her2, or c-erbB-2
  • p HER2 185-kd transmembrane glycoprotein receptor
  • a recombinant humanized anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 or HerceptinTM) has been clinically active in patients with ErbB2-overexpressing metastatic breast cancers that had received extensive prior anticancer therapy. (Baselga et al., I. Clin. Oncol.. 14:737-744 [1996]).
  • anti-HER2 humanized anti-ErbB2
  • the present invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans.
  • the present invention is based on the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the overexpression of the gene product and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act as predictors of the prognosis of tumor treatment.
  • the present invention concerns an isolated antibody which binds to a polypeptide designated herein as a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • a polypeptide designated herein as a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725
  • the isolated antibody specifically binds to a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • the antibody induces the death of a cell which expresses a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • the cell that expresses the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861,PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide is a tumor cell that overexpresses the polypeptide as compared to a normal cell of the same tissue type.
  • the antibody is a monoclonal antibody, which preferably has non-human complementarity determining region (CDR) residues and human framework region (FR) residues.
  • the antibody may be labeled and may be immobilized on a solid support.
  • the antibody is an antibody fragment, a single-chain antibody, or a humanized antibody which binds, preferably specifically, to a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861.PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • the invention concerns a composition of matter which comprises an antibody which binds, preferably specifically, to a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide in admixture with a pharmaceutically acceptable carrier.
  • the composition of matter comprises a therapeutically effective amount of the antibody.
  • the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent.
  • the composition is sterile.
  • the invention concerns isolated nucleic acid molecules which encode anti-
  • PR0197 anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-
  • PRO304 anti-PR0339, anti-PR01558, anti-PR0779, anti-PROH85, anti-PR01245, anti-PR01759, anti-
  • the invention concerns a method for producing an anti-PR0197, anti- PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti- PR0339, anti-PR01558, anti-PR0779, anti-PROH85, anti-PR01245, anti-PR01759, anti-PR05775, anti- PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti- PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibody, wherein the method comprises culturing a host cell transformed with a nucleic acid molecule which encodes the antibody under
  • the invention further concerns antagonists of aPRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide that inhibit one or more of the biological and/or immunological functions or activities of aPR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206,
  • the invention concerns an isolated nucleic acid molecule that hybridizes to a nucleic acid molecule encoding a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide or the complement thereof.
  • the isolated nucleic acid molecule is preferably DNA, and hybridization preferably occurs under stringent hybridization and wash conditions.
  • Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herein, which, in turn, can find use in the modulation of the transcription and/or translation of the respective amplified genes, or as antisense primers in amplification reactions.
  • sequences can be used as part of a ribozyme and/or a triple helix sequence which, in turn, may be used in regulation of the amplified genes.
  • the invention provides a method for determining the presence of a PRO 197,
  • PROl 185 PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264,
  • the invention provides a method for determining the presence of a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide in a cell, wherein the method comprises exposing the cell to an anti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PR01185, anti-
  • the present invention concerns a method of diagnosing tumor in a mammal, comprising detecting the level of expression of a gene encoding a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256,PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher expression level in the test sample as compared to the control sample, is indicative of the presence of tumor in the mammal from which the test
  • the present invention concerns a method of diagnosing tumor in a mammal, comprising (a) contacting an anti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROH85, anti- PR01245, anti-PR01759, anti-PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti- PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibody with a test sample of tissue cells obtained from the mammal, and
  • the detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type.
  • a larger quantity of complexes formed in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained.
  • the antibody preferably carries a detectable label. Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art.
  • the test sample is usually obtained from an individual suspected to have neoplastic cell growth or proliferation (e.g. cancerous cells).
  • the present invention concerns a cancer diagnostic kit comprising an anti-PRO 197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PR01185, anti-PR01245, anti-PR01759, anti-PR05775, anti- PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti- PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibody and a carrier (e.g., a buffer) in suitable packaging.
  • a carrier e.g., a buffer
  • the kit preferably contains instructions for using the antibody to detect the presence of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide in a sample suspected of containing the same.
  • the invention concerns a method for inhibiting the growth of tumor cells comprising exposing tumor cells which express a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide to an effective amount of an agent which inhibits a biological and/or immunological activity and/or the expression of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR0197, PRO
  • the agent preferably is an anti- PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti- PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROH85, anti-PR01245, anti-PR01759, anti- PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti- PR03562, anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibody, a small organic and inorganic molecule, peptide, phosphopeptide, antisense or ribozyme molecule, or a triple he
  • the agent e.g., the anti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti- PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROl 185, anti-PR01245, anti-PR01759, anti-PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti- PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibody, induces cell death.
  • the tumor cells are further exposed to radiation treatment and/or a cytotoxic
  • the invention concerns an article of manufacture, comprising: a container; a label on the container; and a composition comprising an active agent contained within the container; wherein the composition is effective for inhibiting the growth of tumor cells and the label on the container indicates that the composition can be used for treating conditions characterized by overexpression of a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PROI686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide as compared to a normal cell of the same tissue type.
  • the active agent in the composition is an agent which inhibits an activity and/or the expression of a PR0197; PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PRO1216,PRO1686, PRO1800,PRO3562,PRO9850,PRO539, PRO4316orPRO4980polypeptide.
  • the active agent is an anti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROH85, anti- PR01245, anti-PR01759, anti-PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti- PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, t anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibody or an antisense oligonucleotide.
  • the invention also provides a method for identifying a compound that inhibits an activity of a
  • the non-immobilized component carries a detectable label.
  • this method comprises the steps of (a) contacting cells and a candidate compound to be screened in the presence of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide under conditions suitable for the induction of a cellular response normally induced by a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05
  • the invention provides a method for identifying a compound that inhibits the expression of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide in cells that express the polypeptide, wherein the method comprises contacting the cells with a candidate compound and determining whether the expression of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR0
  • this method comprises the steps of (a) contacting cells and a candidate compound to be screened under conditions suitable for allowing expression of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide and (b) determining the inhibition of expression of said polypeptide.
  • the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95 % sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence
  • the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83 % sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99%
  • the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at
  • Another aspect of the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide which is either transmembrane domain-deleted or transmembrane domain-inactivated, or is complementary to such encoding nucleotide sequence, wherein the transmembrane domain(s) of such polypeptide are disclosed herein.
  • Another embodiment is directed to fragments of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide coding sequence, or the complement thereof, that may find use as, for example, hybridization probes, for encoding fragments of aPR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR
  • nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, yet more preferably at least about 50 nucleotides in length, yet more preferably at least about 60 nucleotides in length, yet more preferably at least about 70 nucleotides in length, yet more preferably at least about 80 nucleotides in length, yet more preferably at least about 90 nucleotides in length, yet more preferably at least about 100 nucleotides in length, yet more preferably at least about 110 nucleotides in length, yet more preferably at least about 120 nucleotides in length, yet more preferably at least about 130 nucleotides in length, yet more preferably at least about 140 nucleotides in length, yet more preferably at least about 150 nucleotides in length, yet more preferably at least about 160 nucleotides in length, yet more preferably at least about 170 nucleot
  • polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562,
  • PRO9850,PRO539,PRO4316orPRO4980polypeptide-encodingnucleotidesequencewithotherknownnucleotide sequences using any of a number of well known sequence alignment programs and determining which PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PRO 1558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PRQ313, PR0342, PR0542, PR0773, PR0861.PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539,
  • PR04316 or PRO4980 polypeptide-encoding nucleotide sequence fragment(s) are novel. All of such PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide-encoding nucleotide sequences are contemplated herein.
  • Also contemplated 0 are the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide fragments encoded by these nucleotide molecule fragments, preferably those PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, 5 PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR
  • the invention provides isolated PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775,
  • the invention concerns an isolated PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at
  • polypeptide comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet
  • the invention concerns an isolated PROl 97, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide comprising an amino acid sequence scoring at least about 80% positives, preferably at least about 81% positives, more preferably at least about 82% positives, yet more preferably at least about 83 % positives, yet more preferably at least about 84% positives, yet more preferably at least about 85% positives, yet more preferably at least about 86% positives, yet more preferably at least about 87% positives, yet more preferably
  • the invention provides an isolated PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide witliout the N-terminal signal sequence and/or the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described.
  • Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide and recovering the PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR0
  • Another aspect of the invention provides an isolated PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PRO86I, PRO1216,PRO1686,PRO1800,PRO3562,PRO9850,PRO539,PRO4316orPRO4980polypeptidewhichis either transmembrane domain-deleted or transmembrane domain-inactivated.
  • Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PRO1245,PRO1759,PRO5775,PRO7133,PRO7168, PRO5725,PRO202, PRO206,PRO264,PRO313,PRO342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide and recovering the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05
  • the invention concerns antagonists of a native PRO 197, PRO207, PR0226,
  • the antagonist is an anti-PR0197, anti-PRO207, anti- PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti- PR01558, anti-PR0779, anti-PR01185, anti-PR01245, anti-PR01759, anti-PR05775, .anti-PR07133, anti- PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti-PRO9850, anti- PR0539, anti-PR04316 or anti-PRO4980 antibody or a small molecule.
  • the invention concerns a method of identifying antagonists to a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PRO 1558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide which comprise contacting the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0339, PR0
  • the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PRO86I, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide is a native PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR
  • the invention concerns a composition of matter comprising a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide, or an antagonist of a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR
  • the carrier is a pharmaceutically acceptable carrier.
  • Another embodiment of the present invention is directed to the use of a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide, or an antagonist thereof as hereinbefore described, or an anti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROl 185, anti-PR01245, anti
  • the invention provides vectors comprising DNA encoding any of the herein described polypeptides.
  • Host cell comprising any such vector are also provided.
  • the host cells may be CHO cells, E. coli, yeast, or Baculovirus-infected insect cells.
  • a process for producing any of the herein described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.
  • the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence.
  • Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin.
  • the invention provides an antibody which specifically binds to any of the above or below described polypeptides.
  • the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
  • the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wherein those probes may be derived from any of the above or below described nucleotide sequences.
  • Figure 1 shows the nucleotide sequence (SEQ ID NO:l) of a cDNA containing a nucleotide sequence encoding native sequence PR0197, wherein the nucleotide sequence (SEQ ID NO:l) is a clone designated herein as DNA22780-1078. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 2 shows the amino acid sequence (SEQ ID NO:2) of a native sequence PR0197 polypeptide as derived from the coding sequence of SEQ ID NO:l shown in Figure 1.
  • Figure 3 shows the nucleotide sequence (SEQ ID NO:3) of a cDNA containing a nucleotide sequence encoding native sequence PRO207, wherein the nucleotide sequence (SEQ ID NO:3) is a clone designated herein as DNA30879-1152. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 4 shows the amino acid sequence (SEQ ID NO:4) of a native sequence PRO207 polypeptide as derived from the coding sequence of SEQ ID NO: 3 shown in Figure 3.
  • Figure 5 shows the nucleotide sequence (SEQ ID NO:5) of a cDNA containing a nucleotide sequence encoding native sequence PR0226, wherein the nucleotide sequence (SEQ ID NO:5) is a clone designated herein as DNA33460-1166. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 6 shows the amino acid sequence (SEQ ID NO:6) of a native sequence PR0226 polypeptide as derived from the coding sequence of SEQ ID N0:5 shown in Figure 5.
  • Figure 7 shows the nucleotide sequence (SEQ ID NO:7) of a cDNA containing a nucleotide sequence encoding native sequence PR0232, wherein the nucleotide sequence (SEQ ID NO:7) is a clone designated herein as DNA34435-1140. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 8 shows the amino acid sequence (SEQ ID NO:8) of a native sequence PR0232 polypeptide as derived from the coding sequence of SEQ ID NO:7 shown in Figure 7.
  • Figure 9 shows the nucleotide sequence (SEQ ID NO:9) of a cDNA containing a nucleotide sequence encoding native sequence PR0243, wherein the nucleotide sequence (SEQ H) NO:9) is a clone designated herein as DNA35917-1207. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 10 shows the amino acid sequence (SEQ ID NO: 10) of a native sequence PR0243 polypeptide as derived from the coding sequence of SEQ ID NO:9 shown in Figure 9.
  • Figure 11 shows the nucleotide sequence (SEQ ID NO: 11) of a cDNA containing a nucleotide sequence encoding native sequence PR0256, wherein the nucleotide sequence (SEQ ID NO: 11) is a clone designated herein as DNA35880-1160. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 13 shows the nucleotide sequence (SEQ ID NO: 13) of a cDNA containing a nucleotide sequence encoding native sequence PR0269, wherein the nucleotide sequence (SEQ ID NO: 13) is a clone designated herein as DNA38260-1180. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 14 shows the amino acid sequence (SEQ ID NO: 14) of a native sequence PR0269 polypeptide as derived from the coding sequence of SEQ ID NO:13 shown in Figure 13.
  • Figure 15 shows the nucleotide sequence (SEQ ID NO: 15) of a cDNA containing a nucleotide sequence encoding native sequence PR0274, wherein the nucleotide sequence (SEQ ID NO: 15) is a clone designated herein as DNA39987-1184. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 16 shows the amino acid sequence (SEQ ID NO: 16) of a native sequence PR0274 polypeptide as derived from the coding sequence of SEQ ID NO: 15 shown in Figure 15.
  • Figure 17 shows the nucleotide sequence (SEQ ID NO: 17) of a cDNA containing a nucleotide sequence encoding native sequence PRO304, wherein the nucleotide sequence (SEQ ID NO: 17) is a clone designated herein as DNA39520-1217. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 18 shows the amino acid sequence (SEQ ID NO: 18) of a native sequence PRO304 polypeptide as derived from the coding sequence of SEQ ID NO: 17 shown in Figure 17.
  • Figure 19 shows the nucleotide sequence (SEQ ID NO: 19) of a cDNA containing a nucleotide sequence encoding native sequence PR0339, wherein the nucleotide sequence (SEQ ID NO: 19) is a clone designated herein as DNA43466-1225. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 20 shows the amino acid sequence (SEQ ID NO:20) of a native sequence PR0339 polypeptide as derived from the coding sequence of SEQ ID NO:19 shown in Figure 19.
  • Figure 21 shows the nucleotide sequence (SEQ ID NO:21) of a cDNA containing a nucleotide sequence encoding native sequence PRO 1558, wherein the nucleotide sequence (SEQ ID NO:21) is a clone designated herein as DNA71282-1668. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 22 shows the amino acid sequence (SEQ ID NO:22) of a native sequence PR01558 polypeptide as derived from the coding sequence of SEQ ID N0:21 shown in Figure 21.
  • Figure 23 shows the nucleotide sequence (SEQ ID NO:23) of a cDNA containing a nucleotide sequence encoding native sequence PR0779, wherein the nucleotide sequence (SEQ ID NO:23) is a clone designated herein as DNA58801-1052. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 24 shows the amino acid sequence (SEQ ID NO:24) of a native sequence PR0779 polypeptide as derived from the coding sequence of SEQ ID NO:23 shown in Figure 23.
  • Figure 25 shows the nucleotide sequence (SEQ ID NO:25) of a cDNA containing a nucleotide sequence encoding native sequence PROl 185, wherein the nucleotide sequence (SEQ ID NO:25) is a clone designated herein as DNA62881-1515. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 26 shows the amino acid sequence (SEQ ID NO:26) of a native sequence PROl 185 polypeptide as derived from the coding sequence of SEQ ID NO:25 shown in Figure 25.
  • Figure 27 shows the nucleotide sequence (SEQ ID NO:27) of a cDNA containing a nucleotide sequence encoding native sequence PR01245, wherein the nucleotide sequence (SEQ ID NO:27) is a clone designated herein as DNA64884-1527. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 28 shows the amino acid sequence (SEQ ID NO:28) of a native sequence PR01245 polypeptide as derived from the coding sequence of SEQ ID NO:27 shown in Figure 27.
  • Figure 29 shows the nucleotide sequence (SEQ ID NO:29) of a cDNA containing a nucleotide sequence encoding native sequence PRO 1759, wherein the nucleotide sequence (SEQ ID NO : 29) is a clone designated herein as DNA76531 - 1701. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 31 shows the nucleotide sequence (SEQ ID NO:31) of a cDNA containing a nucleotide sequence encoding native sequence PR05775 , wherein the nucleotide sequence (SEQ ID NO:31 ) is a clone designated herein as DNA96869-2673. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 32 shows the amino acid sequence (SEQ ID NO:32) of a native sequence PR05775 polypeptide as derived from the coding sequence of SEQ ID NO:31 shown in Figure 31.
  • Figure 33 shows the nucleotide sequence (SEQ ID NO:33) of a cDNA containing a nucleotide sequence encoding native sequence PR07133, wherein the nucleotide sequence (SEQ ID NO : 33) is a clone designated herein as DNA128451-2739. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 34 shows the amino acid sequence (SEQ ID NO:34) of a native sequence PR07133 polypeptide as derived from the coding sequence of SEQ ID NO:33 shown in Figure 33.
  • Figure 35 shows the nucleotide sequence (SEQ ID NO:35) of a cDNA containing a nucleotide sequence encoding native sequence PR07168, wherein the nucleotide sequence (SEQ ID NO:35) is a clone designated herein as DNA102846-2742. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 36 shows the amino acid sequence (SEQ ID N0:36) of a native sequence PR07168 polypeptide as derived from the coding sequence of SEQ ID NO: 35 shown in Figure 35.
  • Figure 37 shows the nucleotide sequence (SEQ ID NO:37) of a cDNA containing a nucleotide sequence encoding native sequence PR05725, wherein the nucleotide sequence (SEQ ID NO:37) is a clone designated herein as DNA92265-2669. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 39 shows the nucleotide sequence (SEQ ID NO:39) of a cDNA containing a nucleotide sequence encoding native sequence PRO202, wherein the nucleotide sequence (SEQ ID NO:39) is a clone designated herein as DNA30869. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 40 shows the amino acid sequence (SEQ ID NO:40) of a native sequence PRO202 polypeptide as derived from the coding sequence of SEQ ID NO:39 shown in Figure 39.
  • Figure 41 shows the nucleotide sequence (SEQ ID NO:41) of a cDNA containing a nucleotide sequence encoding native sequence PRO206, wherein the nucleotide sequence (SEQ ID NO:41) is a clone designated herein as DNA34405. Also presented in bold font and underlined are the positions of the respective start and stop codons .
  • Figure 43 shows the nucleotide sequence (SEQ ID NO:43) of a cDNA containing a nucleotide sequence encoding native sequence PR0264, wherein the nucleotide sequence (SEQ ID NO:43) is a clone designated herein as DNA36995. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 44 shows the amino acid sequence (SEQ ID NO:44) of a native sequence PR0264 polypeptide as derived from the coding sequence of SEQ ID NO:43 shown in Figure 43.
  • Figure 46 shows the amino acid sequence (SEQ ID NO:46) of a native sequence PR0313 polypeptide as derived from the coding sequence of SEQ ID NO:45 shown in Figure 45.
  • Figure 49 shows the nucleotide sequence (SEQ ID NO:49) of a cDNA containing a nucleotide sequence encoding native sequence PR0542, wherein the nucleotide sequence (SEQ ID NO:49) is a clone designated herein as DNA56505. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 50 shows the amino acid sequence (SEQ ID NO:50) of a native sequence PR0542 polypeptide as derived from the coding sequence of SEQ ID NO:49 shown in Figure 49.
  • Figure 53 shows the nucleotide sequence (SEQ ID NO:53) of a cDNA containing a nucleotide sequence encoding native sequence PR0861 , wherein the nucleotide sequence (SEQ ID NO:53) is a clone designated herein as DNA50798. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 54 shows the amino acid sequence (SEQ ID NO:54) of a native sequence PR0861 polypeptide as derived from the coding sequence of SEQ ID NO:53 shown in Figure 53.
  • Figure 57 shows the nucleotide sequence (SEQ ID NO:57) of a cDNA containing a nucleotide sequence encoding native sequence PRO 1686, wherein the nucleotide sequence (SEQ ID NO:57) is a clone designated herein as DNA80896. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 58 shows the amino acid sequence (SEQ ID NO:58) of a native sequence PR01686 polypeptide as derived from the coding sequence of SEQ ID NO:57 shown in Figure 57.
  • Figure 59 shows the nucleotide sequence (SEQ ID NO:59) of a cDNA containing a nucleotide sequence encoding native sequence PRO 1800, wherein the nucleotide sequence (SEQ ID NO :59) is a clone designated herein as DNA35672-2508. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 60 shows the amino acid sequence (SEQ ID NO:60) of a native sequence PRO1800 polypeptide as derived from the coding sequence of SEQ ID NO:59 shown in Figure 59.
  • Figure ⁇ l shows the nucleotide sequence (SEQ ID NO:61) of a cDNA containing a nucleotide sequence encoding native sequence PR03562, wherein the nucleotide sequence (SEQ ID NO:61 ) is a clone designated herein as DNA96791. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 62 shows the amino acid sequence (SEQ ID NO:62) of a native sequence PR03562 polypeptide as derived from the coding sequence of SEQ ID NO:61 shown in Figure 61.
  • Figure 63 shows the nucleotide sequence (SEQ ID NO:63) of a cDNA containing a nucleotide sequence encoding native sequence PRO9850, wherein the nucleotide sequence (SEQ ID NO:63) is a clone designated herein r. as DNA58725. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 64 shows the amino acid sequence (SEQ ID NO:64) of a native sequence PRO9850 polypeptide as derived from the coding sequence of SEQ ID NO:63 shown in Figure 63.
  • Figure 65 shows the nucleotide sequence (SEQ ID NO:65) of a cDNA containing a nucleotide sequence encoding native sequence PR0539, wherein the nucleotide sequence (SEQ ID NO:65) is a clone designated herein as DNA47465-1561. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 66 shows the amino acid sequence (SEQ ID NO:66) of a native sequence PR0539 polypeptide as derived from the coding sequence of SEQ ID NO:65 shown in Figure 65.
  • Figure 67 shows the nucleotide sequence (SEQ ID NO:67) of a cDNA containing a nucleotide sequence encoding native sequence PR04316, wherein the nucleotide sequence (SEQ ID NO :67) is a clone designated herein as DNA94713-2561. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 68 shows the amino acid sequence (SEQ ID NO: 68) of a native sequence PR04316 polypeptide as derived from the coding sequence of SEQ ID NO:67 shown in Figure 67.
  • Figure 69 shows the nucleotide sequence (SEQ ID NO:69) of a cDNA containing a nucleotide sequence encoding native sequence PRO4980, wherein the nucleotide sequence (SEQ ID NO:69) is a clone designated herein as DNA97003-2649. Also presented in bold font and underlined are the positions of the respective start and stop codons.
  • Figure 70 shows the amino acid sequence (SEQ ID NO:70) of a native sequence PRO4980 polypeptide as derived from the coding sequence of SEQ ID NO:69 shown in Figure 69.
  • amplification and “gene duplication” are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line.
  • the duplicated region (a stretch of amplified DNA) is often referred to as "amplicon.”
  • amplicon a stretch of amplified DNA
  • the amount of the messenger RNA (mRNA) produced i. e., the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed.
  • Tuor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • cancer refers to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth.
  • cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometrial carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer.
  • Treatment is an intervention performed with the intention of preventing the development or altering the pathology of a disorder. Accordingly, “treatment” refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented.
  • a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e.g., radiation and/or chemotherapy.
  • the "pathology" of cancer includes all phenomena that compromise the well-being of the patient. This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, etc.
  • "Mammal” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cattle, pigs, sheep, etc. Preferably, the mammal is human.
  • Carriers as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution.
  • physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEENTM, polyethylene glycol (PEG), and PLURONICSTM.
  • buffers such as phosphate, citrate, and other organic acids
  • antioxidants including ascorbic acid
  • low molecular weight (less than about 10 residues) polypeptides proteins, such as serum album
  • cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes (e.g., I 131 , 1 125 , Y 90 and Re 186 ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof.
  • chemotherapeutic agent is a chemical compound useful in the treatment of cancer.
  • chemotherapeutic agents include adriamycin, doxorubicin, epirubicin, 5-fluorouracil, cytosine arabinoside ("Ara- C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e.g., paclitaxel (Taxol, Bristol-Myers Squibb Oncology, Princeton, NJ), and doxetaxel (Taxotere, Rh ⁇ ne-Poulenc Rorer, Antony, Rnace), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, car
  • a “growth inhibitory agent” when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vitro or in vivo.
  • the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase.
  • growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest.
  • Classical M-phase blockers include the vincas (vincristine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicin, etoposide, and bleomycin.
  • DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5- fluorouracil, and ara-C.
  • DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5- fluorouracil, and ara-C.
  • doxorubicin The full chemical name of doxorubicin is (8S-cis)-10-[(3- amino-2,3,6-trideoxy- ⁇ -L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydro-6,8,ll-trihydroxy-8-(hydroxyacetyl)-l- methoxy-5, 12-naphthacenedione.
  • cytokine is a generic term for proteins released by one cell population which act on another cell as intercellular mediators.
  • cytokines are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; fibroblast growth factor; prolactin; placental lactogen; tumor necrosis factor- ⁇ and - ⁇ ; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors such as NGF- ⁇ ; platelet- growth factor;
  • prodrug refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form. See, e.g., Wilman, "Prodrugs in Cancer Chemotherapy", Biochemical Society Transactions. 14:375-382, 615th Meeting, Harbor (1986), and Stella et al, “Prodrugs: A Chemical Approach to Targeted Drug Delivery”, Directed Drug Delivery. Borchardt et al, (ed.), pp. 147-267, Humana Press (1985).
  • the prodrugs of this invention include, but are not limited to, phosphate- containing prodrugs, thiophosphate-containing prodrugs, sulfate-containing prodrugs, peptide-containingprodrugs, D-amino acid-modified prodrugs, glysocylated prodrugs, ⁇ -lactam-containing prodrugs, optionally substituted phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-containing prodrugs, 5- fluorocytosine and other 5-fluorouridine prodrugs which can be converted into the more active cytotoxic free drug.
  • An "effective amount" of a polypeptide disclosed herein or an antagonist thereof, in reference to inhibition of neoplastic cell growth, tumor growth or cancer cell growth is an amount capable of inhibiting, to some extent, the growth of target cells. The term includes an amount capable of invoking a growth inhibitory, cytostatic and/or cytotoxic effect and/or apoptosis of the target cells.
  • An "effective amount" of a PRO polypeptide antagonist for purposes of inhibiting neoplastic cell growth, tumor growth or cancer cell growth may be determined empirically and in a routine manner.
  • a “therapeutically effective amount”, in reference to the treatment of tumor, refers to an amount capable of invoking one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, slowing down and complete growth arrest; (2) reduction in the number of tumor cells; (3) reduction in tumor size; (4) inhibition (i. e. , reduction, slowing down or complete stopping) of tumor cell infiltration into peripheral organs; (5) inhibition (i.e., reduction, slowing down or complete stopping) of metastasis; (6) enhancement of anti-tumor immune response, which may, but does not have to, result in the regression or rejection of the tumor; and/or (7) relief, to some extent, of one or more symptoms associated with the disorder.
  • a “therapeutically effective amount" of a PRO polypeptide antagonist for purposes of treatment of tumor may be determined empirically and in a routine manner.
  • a “growth inhibitory amount” of a PRO antagonist is an amount capable of inhibiting the growth of a cell, especially tumor, e.g. , cancer cell, either in vitro or in vivo.
  • a “growth inhibitory amount” of a PRO antagonist for purposes of inhibiting neoplastic cell growth may be determined empirically and in a routine manner.
  • a "cytotoxic amount” of a PRO antagonist is an amount capable of causing the destruction of a cell, especially tumor, e.g. , cancer cell, either in vitro or in vivo.
  • a "cytotoxic amount" of a PRO antagonist for purposes of inhibiting neoplastic cell growth may be determined empirically and in a routine manner.
  • PRO polypeptide and "PRO” as used herein and when immediately followed by a numerical designation refer to various polypeptides, wherein the complete designation (i.e., PRO/number) refers to specific polypeptide sequences as described herein.
  • PRO/number polypeptide and “PRO/number” wherein the term “number” is provided as an actual numerical designation as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein).
  • the PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.
  • a “native sequence PRO polypeptide” comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means.
  • the term "native sequence PRO polypeptide” specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e.g., an extracellular domain sequence), naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide.
  • the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full-length amino acids sequences shown in the accompanying figures. Start and stop codons are shown in bold font and underlined in the figures. However, while the PRO polypeptide disclosed in the accompanying figures are shown to begin with methionine residues designated herein as amino acid position 1 in the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the amino acid position 1 in the figures may be employed as the starting amino acid residue for the PRO polypeptides.
  • the PRO polypeptide "extracellular domain” or “ECD” refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains. Ordinarily, a PRO polypeptide ECD will have less than 1% of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0.5% of such domains. It will be understood that any transmembrane domains identified for the PRO polypeptides of the present invention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain. The exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 amino acids at either end of the domain as initially identified herein.
  • an extracellular domain of a PRO polypeptide may contain from about 5 or fewer amino acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides, with or without the associated signal peptide, and nucleic acid encoding them, are contemplated by the present invention.
  • cleavage of a signal sequence from a secreted polypeptide is not entirely uniform, resulting in more than one secreted species.
  • These mature polypeptides, where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them, are contemplated by the present invention.
  • PRO polypeptide variant means an active PRO polypeptide as defined above or below having at least about 80% amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein.
  • Such PRO polypeptide variants include, for instance, PRO polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C-terminus of the full-length native amino acid sequence.
  • a PRO polypeptide variant will have at least about 80% amino acid sequence identity, preferably at least about 81 % amino acid sequence identity, more preferably at least about 82% amino acid sequence identity, more preferably at least about 83% amino acid sequence identity, more preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, more preferably at least about 87% amino acid sequence identity, more preferably at least about 88% amino acid sequence identity, more preferably at least about 89% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, more preferably at least about 91% amino acid sequence identity, more preferably at least about 92% amino acid sequence identity, more preferably at least about 93 % amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity, more preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino
  • PRO variant polypeptides are at least about 10 amino acids in length, often at least about 20 amino acids in length, more often at least about 30 amino acids in length, more often at least about 40 amino acids in length, more often at least about 50 amino acids in length, more often at least about 60 amino acids in length, more often at least about 70 amino acids in length, more often at least about 80 amino acids in length, more often at least about 90 amino acids in length, more often at least about 100 amino acids in length, more often at least about 150 amino acids in length, more often at least about 200 amino acids in length, more often at least about 300 amino acids in length, or more.
  • Table 1 provides the complete source code for the ALIGN-2 sequence comparison computer program. This source code may be routinely compiled for use on a UNIX operating system to provide the ALIGN-2 sequence comparison computer program.
  • Tables 2A-2D show hypothetical exemplifications for using the below described method to determine % amino acid sequence identity (Tables 2A-2B) and % nucleic acid sequence identity (Tables 2C-2D) using the ALIGN-2 sequence comparison computer program, wherein "PRO” represents the amino acid sequence of a hypothetical PRO polypeptide of interest, “Comparison Protein” represents the amino acid sequence of a polypeptide against which the "PRO” polypeptide of interest is being compared, "PRO-DNA” represents a hypothetical PRO-encoding nucleic acid sequence of interest, “Comparison DNA” represents the nucleotide sequence of a nucleic acid molecule against which the "PRO-DNA” nucleic acid molecule of interest is being compared, "X”, “Y”, and “Z” each represent different hypothetical amino acid
  • filel and file2 are two dna or two protein sequences.
  • Max file length is 65535 (limited by unsigned short x in the jmp struct)
  • a sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
  • the program may create a tmp file in /tmp to hold info about traceback.
  • #defme SPC 3 #define P LINE 256 /* maximum output line */ #def ⁇ ne P_SPC 3 /* space between name or num and seq */ extern _day[26][26]; int olen; /* set output line length */
  • static nm matches in core — for checking */ static lmax; /* lengths of stripped file names */ static ij[21; /* jmp index for a path */ static nc[2]; /* number at start of current line */ static ni[2]; /* current elem number — for gapping */ static siz[2]; static char *ps[2]; /* ptr to current element */ static char *po[2]; /* ptr to next output char slot */ static char oouutt[[22]][[lP_LINE] ; /* output line */ static char starfP ] 3]; /* set by stars() *//
  • *ps[i] toupper(*ps[i]); po[i] + + ; ps[i] + + ;
  • *py+ + toupper(*px); if (index("ATGCU",*(py-l))) natgc+ + ;
  • Page2 ofnwsubr.c ...readjmps if (j ⁇ 0 && dxfdmax]. offset && fj) ⁇
  • Percent (%) amino acid sequence identity with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in a PRO sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared.
  • % amino acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1.
  • the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code shown in Table 1 has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
  • the ALIGN-2 program is publicly available through Genentech, Inc. , South San Francisco, California or may be compiled from the source code provided in Table 1.
  • the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
  • % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
  • % amino acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res.. 25:3389-3402 (1997)).
  • NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov.
  • % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
  • a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acids residues between the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (i.e., the sequence against which the PRO polypeptide of interest is being compared which may be a PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the PRO polypeptide of interest.
  • amino acid sequence A is the comparison amino acid sequence of interest and the amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest.
  • PRO variant polypeptide or "PRO variant nucleic acid sequence” means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucleic acid sequence identity with a nucleotide acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein.
  • a PRO variant polynucleotide will have at least about 80% nucleic acid sequence identity, more preferably at least about 81% nucleic acid sequence identity, more preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83 % nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% nucleic acid sequence identity, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid sequence identity, more preferably at least about 90% nucleic acid sequence identity, more preferably at least about 91% nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity,
  • PRO variant polynucleotides are at least about 30 nucleotides in length, often at least about 60 nucleotides in length, more often at least about 90 nucleotides in length, more often at least about 120 nucleotides in length, more often at least about 150 nucleotides in length, more often at least about 180 nucleotides in length, more often at least about 210 nucleotides in length, more often at least about 240 nucleotides in length, more often at least about 270 nucleotides in length, more often at least about 300 nucleotides in length, more often at least about 450 nucleotides in length, more often at least about 600 nucleotides in length, more often at least about 900 nucleotides in length, or more.
  • Percent (%) nucleic acid sequence identity with respect to the PRO polypeptide-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with die nucleotides in a PRO polypeptide-encoding nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megalign (DNASTAR) software.
  • ALIGN-2 sequence comparison computer program
  • Table 1 complete source code for the ALIGN-2 program is provided in Table 1.
  • the ALIGN-2 sequence comparison computer program was authored by Genentech, Inc., and the source code shown in Table 1 has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087.
  • the ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in Table 1.
  • the ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
  • % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows:
  • % nucleic acid sequence identity values used herein are obtained as described above using the ALIGN-2 sequence comparison computer program. However, % nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul etal., Nucleic Acids Res.. 25:3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov.
  • % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows:
  • a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (_. ⁇ ?., the sequence against which the PRO polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant PRO polynucleotide) as determined by WU-BLAST-2 by (b) the total number of nucleotides of the PRO polypeptide- encoding nucleic acid molecule of interest.
  • nucleic acid sequence A is the comparison nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest.
  • PRO variant polynucleotides are nucleic acid molecules that encode an active PRO polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding the full-length PRO polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:4), Figure 6 (SEQ ID NO:6), Figure 8 (SEQ ID NO:8), Figure 10 (SEQ ID NO: 10), Figure 12 (SEQ ID NO:12), Figure 14 (SEQ ID NO: 14), Figure 16 (SEQ ID NO:16), Figure 18 (SEQ ID NO:18), Figure 20 (SEQ ID NO:20), Figure 22 (SEQ ID NO:22), Figure 24 (SEQ ID NO:24), Figure 26 (SEQ ID NO:26), or Figure 28 (SEQ ID NO:28), Figure 30 (SEQ ID NO:30), Figure 32 (SEQ ID NO:32), Figure 34 (SEQ ID NO:34), Figure 36 (SEQ ID NO:36), Figure 38 (SEQ ID NO:
  • PRO variant polypeptides may be those that are encoded by a PRO variant polynucleotide.
  • Amino acid residues that score a positive value to an amino acid residue of interest are those that are either identical to the amino acid residue of interest or are a preferred substitution (as defined in Table 3 below) of the amino acid residue of interest.
  • the % value of positives of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows:
  • isolated when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Preferably, the isolated polypeptide is free of association with all components with which it is naturally associated. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.
  • the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
  • An "isolated" nucleic acid molecule encoding a PRO polypeptide or an “isolated” nucleic acid encoding an anti-PRO antibody is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO-encoding nucleic acid or the anti-PRO-encoding nucleic acid.
  • the isolated nucleic acid is free of association with all components with which it is naturally associated.
  • An isolated PRO-encoding nucleic acid molecule or an anti- PRO-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature.
  • Isolated nucleic acid molecules therefore are distinguished from the PRO-encoding nucleic acid molecule or the anti-PRO- encoding nucleic acid molecule as it exists in natural cells.
  • an isolated nucleic acid molecule encoding a PRO polypeptide or an anti-PRO antibody includes PRO-nucleic acid molecules and anti-PRO-nucleic acid molecules contained in cells that ordinarily express PRO polypeptides or express anti-PRO antibodies where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in aparticular host organism.
  • the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ribosome binding site.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
  • antibody is used in the broadest sense and specifically covers, for example, single anti- PRO ⁇ , anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti- PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROl 185, anti-PR01245, anti-PR01759, anti- PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti- PR03562, anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 monoclonal antibodies (including antagonist, and neutralizing antibodies), anti-PR0197, anti-PRO207, anti-PRO207,
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, .. ⁇ _., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts.
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al, Current Protocols in Molecular Biology. Wiley Interscience Publishers, (1995).
  • “Stringent conditions” or “high stringency conditions”, as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 / ig/ml), 0.1% SDS, and 10% dextran
  • Modely stringent conditions may be identified as described by Sambrook et al, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and % SDS) less stringent than those described above.
  • moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 35°C-50°C.
  • the skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
  • epitope tagged when used herein refers to a chimeric polypeptide comprising a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide fused to a "tag polypeptide".
  • the tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused.
  • the tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes.
  • Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably, between about 10 and 20 amino acid residues).
  • “Active” or “activity” for the purposes herein refers to form(s) of PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptides which retain a biological and/or an immunological activity/property of a native or naturally-occurring PR0197, PRO207, PR0226, PR0232/PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05
  • Bioactivity in the context of an antibody or another antagonist molecule that can be identified by the screening assays disclosed herein (e.g., an organic or inorganic small molecule, peptide, etc.) is used to refer to the ability of such molecules to bind or complex with the polypeptides encoded by the amplified genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins or otherwise interfere with the transcription or translation of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptid
  • biological activity in the context of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide means the ability of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342
  • immunological cross-reactivity means immunological cross-reactivity with at least one epitope of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • “Immunological cross-reactivity" as used herein means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological activity of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185,PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide having this activity with polyclonal antisera raised against the known active PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759,
  • Such antisera are prepared in conventional fashion by injecting goats or rabbits, for example, subcutaneously with the known active analogue in complete Freund's adjuvant, followed by booster intraperitoneal or subcutaneous injection in incomplete Freunds.
  • the immunological cross-reactivity preferably is "specific", which means that the binding affinity of the immunologically cross-reactive molecule (e.g., antibody) identified, to the corresponding PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PRO1216.PRO1686.PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide is significantly higher (preferably at least about 2-times
  • antagonist is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide disclosed herein or the transcription or translation thereof.
  • Suitable antagonist molecules specifically include antagonist antibodies or antibody fragments, fragments, peptides, small organic molecules, anti-sense nucleic acids, etc. Included are methods for identifying antagonists of a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide with a candidate antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR015
  • a "small molecule” is defined herein to have a molecular weight below about 500 Daltons.
  • Antibodies (Abs) and “immunoglobulins” (Igs) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity. Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas.
  • antibody is used in the broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity.
  • “Native antibodies” and “native immunoglobulins” are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains.
  • V H variable domain
  • Each light chain has a variable domain at one end (V L ) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain. Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains.
  • variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the variable domains of antibodies. It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervariable regions both in the light-chain and the heavy-chain variable domains. The more highly conserved portions of variable domains are called the framework (FR) regions.
  • CDRs complementarity-determining regions
  • FR framework regions.
  • the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
  • the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al, NIH Publ. No.91-3242, Vol. I, pages 647-669 (1991)).
  • the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity.
  • the term "hypervariable region" when used herein refers to the amino acid residues of an antibody which are responsible for antigen-binding.
  • the hypervariable region comprises amino acid residues from a "complementarity determining region" or "CDR" (i.e., residues 24-34 (Ll), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (HI), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain; Kabat et al, Sequences of Proteins of Immunological Interest. 5th Ed. Public Health Service, National Institute of Health, Bethesda, MD.
  • CDR complementarity determining region
  • Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody.
  • antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments; diabodies; linear antibodies (Zapata et ⁇ /., Protein Eng. , 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
  • Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual "Fc” fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab') 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.
  • Fv is the minimum antibody fragment which contains a complete antigen-recognition and -binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the V H -V L dimer. Collectively, the six CDRs confer antigen-binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain.
  • Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
  • F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
  • the "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda ( ⁇ ), based on the amino acid sequences of their constant domains.
  • immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, andlgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgA, andIgA2.
  • the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called a, ⁇ , e, ⁇ , and ⁇ , respectively.
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i. e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al. , Nature. 256:495 [1975], or may be made byrecombinantDNAmefhods (.see, e.g., U.S. PatentNo.4,816,567).
  • the "monoclonal antibodies” may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352:624-628 [1991] and Marks etal, J. Mol. Biol.. 222:581-597 (1991), for example.
  • the monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. PatentNo.4,816,567; Morrison etal, Proc. Natl. Acad. Sci. USA. 81:6851-6855 [1984]).
  • chimeric antibodies immunoglobulins in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a CDR of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity.
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity, and capacity.
  • Fv FR residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and maximize antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin.
  • Fc immunoglobulin constant region
  • the humanized antibody includes a PRIMA ⁇ ZEDTM antibody wherein the antigen-binding region of fheantibodyisderivedfromanantibodyproduced by immunizing macaque monkeys with the antigen of interest.
  • PRIMA ⁇ ZEDTM antibody wherein the antigen-binding region of fheantibodyisderivedfromanantibodyproduced by immunizing macaque monkeys with the antigen of interest.
  • Single-chain Fv or " sFv” antibody fragments comprise the V H and V L domains of antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding.
  • a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding.
  • the term "diabodies” refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) in the same polypeptide chain (V H - V L ).
  • Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al, Proc. Natl. Acad. Sci. USA.90:6444-6448 (1993).
  • an “isolated” antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes.
  • the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step.
  • label when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody.
  • the label may be detectable by itself (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
  • Radionuclides that can serve as detectable iabels include, for example, 1-131, 1-123, 1-125, Y-90, Re-188, Re-186, At-211, Cu-67, Bi-212, and Pd-109.
  • the label may also be a non-detectable entity such as a toxin.
  • solid phase is meant a non-aqueous matrix to which the antibody of the present invention can adhere.
  • solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones.
  • the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g., an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149.
  • a “liposome” is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PRO 1686, PRO 1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide or antibody thereto and, optionally, a chemotherapeutic agent) to a mammal.
  • the components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.
  • immunoadhesin designates antibody-like molecules which combine the binding specificity of a heterologous protein (an “adhesin”) with the effector functions of immunoglobulin constant domains.
  • the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i. e., is “heterologous”), and an immunoglobulin constant domain sequence.
  • the adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand.
  • the immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1 , IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
  • immunoglobulin such as IgG-1 , IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM.
  • PRQ197 A. Full-length PRQ197, PRO207, PRQ226, PRQ232. PRQ243. PRQ256. PRQ269. PRQ274.
  • PRO304 PRQ339. PRQ1558. PRQ779, PROl 185. PRQ1245. PRQ1759, PRQ5775. PRQ7133. PRQ7168. PRQ5725.
  • PRO202. PRO206.
  • PRQ264. PRQ313.
  • PRQ342. PRQ542. PRQ773, PRQ861, PRQ1216, PRQ1686. PRO1800, PRQ3562. PRO9850. PRQ539.
  • PRQ4316 and PRO4980 polypeptides The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 and PRO4980.
  • proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed.
  • the proteins encoded by the herein disclosed nucleic acid sequences as well as all further native homologues and variants included in the foregoing definition of PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PRO539,PRO4316andPRO4980 will be referred to as "PR0197”, "PRO207", "PR0226", “PR0232", “PR0243”, "
  • cDNA clones have been deposited with the ATCC, with the exception of known clones: DNA30869, DNA34405, DNA36995, DNA43320, DNA38649, DNA56505, DNA48303, DNA50798, DNA66489, DNA80896, DNA96791, and DNA58725.
  • the actual nucleotide sequence of the clones can readily be determined by the skilled artisan by sequencing of the deposited clone using routine methods in the art.
  • the predicted amino acid sequences can be determined from the nucleotide sequences using routine skill.
  • PRQ197 PRO207. PRQ226. PRQ232. PRQ243. PRQ256. PRQ269. PRQ274. PRO304. PRQ339.
  • PR0197 In addition to the full-length native sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133,
  • PR07168 PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216,
  • PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 and PRO4980 variants can be prepared.
  • amino acid changes may alter post-translational processes of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PRO 1686, PRO 1800, PR03562, PRO9850, PR0539, PRO4316orPRO4980, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.
  • Variations may be a substitution, deletion or insertion of one or more codons encoding the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 that results in a change in the amino acid sequence of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168
  • the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980.
  • Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology.
  • Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements.
  • Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence.
  • fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared with a full- length native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized.
  • An alternative approach involves generating PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment.
  • Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR.
  • PCR polymerase chain reaction
  • conservative substitutions of interest are shown in Table 3 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 3, or as further described below in reference to amino acid classes, are introduced and the products screened.
  • Substantial modifications in function or immunological identity of the polypeptide are accomplished by selecting substitutions that differ significantly in their effect oh maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
  • Naturally occurring residues are divided into groups based on common side-chain properties:
  • hydrophobic norleucine, met, ala, val, leu, ile
  • Non-conservative substitutions will entail exchanging a member of one of these classes for another class .
  • Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.
  • oligonucleotide-mediated (site- directed) mutagenesis alanine scanning, and PCR mutagenesis.
  • Site-directed mutagenesis Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al, Nucl. Acids Res., 10:6487 (1987)]
  • cassette mutagenesis [Wells et al, Gene, 34 315 (1985)]
  • restriction selection mutagenesis [Wells etal., Philos. Trans. R. Soc.
  • Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence.
  • preferred scanning amino acids are relatively small, neutral amino acids.
  • Such amino acids include alanine, glycine, serine, and cysteine.
  • Alanine is typically apreferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant [Cunningham and Wells, Science. 244: 1081-1085 (1989)].
  • Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used.
  • PRQ197 Modifications of PRQ197.
  • One type of covalent modification includes reacting targeted amino acid residues of a PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PRO7168,PRO5725,PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR
  • Derivatization with bifunctional agents is useful, for instance, for crosslinking PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 to a water-insoluble support matrix or surface for use in themethodfor ⁇ urifyinganti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti- PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROl 185
  • crosslinking agents include, e.g., l,l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N- hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobif unctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidyl ⁇ ropionate), bifunctional maleimides such as bis-N- maleimido-l,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio] ⁇ ropioimidate.
  • l,l-bis(diazoacetyl)-2-phenylethane glutaraldehyde
  • N- hydroxysuccinimide esters for example, esters with 4-azidosalicylic acid, homobif unctional imidoesters, including disuccinimidyl esters
  • polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide.
  • “Altering the native glycosylation pattern” is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR02
  • the alteration may be made, for example, by the addition of, or substitution by, one or more serine or fhreonine residues to the native sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 (for O-linked glycosylation sites).
  • PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PRO86I, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR
  • PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 comprises linking the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316
  • PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 of the present invention may also be modified in a way to form a chimeric molecule comprising PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR05
  • such a chimeric molecule comprises a fusion of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope tag is generally placed at the amino- or carboxyl-terminus of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980.
  • provision of the epitope tag enables the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag.
  • tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-His) or poly-histidine-glycine (poly-His-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field etal, Mol. Cell.
  • the chimeric molecule may comprise a fusion of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 with an immunoglobulin or a particular region of an immunoglobulin.
  • a bivalent form of the chimeric molecule (also referred to as an "immunoadhesin"), such a fusion could be to the Fc region of an IgG molecule.
  • the Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of aPR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PRO264, PRO313, PRO342,PRO542,PRO773,PRO861,PRO1216,PRO1686, PRO1800, PRO3562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide in place of at least one variable region within an Ig molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule.
  • PRQ197 Preparation of PRQ197.
  • PRO207 PRQ226. PRQ232. PRQ243. PRQ256. PRQ269. PRQ274.
  • PRO 197 PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773,PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980.
  • the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart et al., Solid-Phase Peptide Synthesis.
  • In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions.
  • PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304,PRO339,PRO1558, PR0779, PROl 185, PR01245, PR01759,PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264,
  • PRO304. PRQ339. PRQ1558.
  • PR05775. PRQ7133.
  • PRO202. PRO206.
  • DNA encoding PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 may be obtained from a cDNA library prepared from tissue believed to possess the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR03
  • human PR0197, human PRO207, human PR0226, human PR0232, human PR0243, human PR0256, human PR0269, humanPR0274, humanPRO304, human PR0339, humanPR01558, humanPR0779, humanPROl 185, human PR01245, human PR01759, human PR05775, human PR07133, human PR07168, human PR05725, human PRO202, human PRO206, human PR0264, human PR0313, human PR0342, human PR0542, human PR0773, human PR0861, human PR01216, human PR01686, human PRO1800, human PR03562, human PRO9850, human PR0539, human PR04316 or human PRO4980 DNA can be conveniently obtained from a cDNA library prepared fromhuman tissue, such as described in the Examples.
  • PR0197-, PRO207-, PR0226-, PR0232-, PR0243-, PR0256-, PR0269-, PR0274-, PRO304-, PR0339-, PR01558-, PR0779-, PROH85-, PR01245-, PR01759-, PR05775-, PR07133-, PR07168-, PR05725-, PRO202-, PRO206-, PR0264-, PR0313-, PR0342-, PR0542-, PR0773-, PR0861-, PR01216-, PR01686-, PRO1800-, PR03562-, PRO9850-, PR0539-, PR04316- or PRO4980-encoding gene may also be obtained from a genomic library or by oligonucleotide synthesis.
  • Probes such as antibodies to the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROH85, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide, or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it.
  • the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
  • the oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 2 P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al, supra. ' Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined using methods known in the art and as described herein.
  • Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
  • Host cells are transfected or transformed with expression or cloning vectors described herein for PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PR04980 production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation.
  • principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach. M. Butler, ed. (IRL Press, 1991) and Sambrook et al, supra.
  • Methods of eukaryotic cell transfection and prokaryotic cell transformation are known to the ordinarily skilled artisan, for example, CaCl 2 , CaP0 4 , liposome-mediated and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells.
  • the calcium treatment employing calcium chloride, as described in Sambrook et al, supra, or electroporation is generally used for prokaryotes.
  • Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al, Gene, 23 :315 (1983) and WO 89/05859 published 29 June 1989.
  • DNA into cells such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene, polyornithine, may also be used.
  • polycations e.g., polybrene, polyornithine.
  • Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells.
  • Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli.
  • Various E. coli strains are publicly available, such as E. coli KU strain MM294 (ATCC 31,446); £. coli lll ⁇ (ATCC 31,537); E. co/i strain W3110 (ATCC 27,325) and E. coli strain K5 772 (ATCC 53,635).
  • suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting.
  • Strain W3110 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes.
  • strain W3110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coliWS 110 strain 1A2, which has the complete genotype tonA ; E. coliW3H0 strain 9E4, which has the complete genotype tonA ptr3; E.
  • E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT kan r ;
  • E. coli W3110 strain 37D6 which has the complete genotype tonA ptr3 phoA E15 (argF-lac)169 degP ompT rbs7 ilvG kan r ;
  • E. coli W3110 strain 40B4 which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No.4,946,783 issued 7 August 1990.
  • in vitro methods of cloning e.g., PCR or other nucleic acid polymerase reactions
  • eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO 197-, PRO207-, PR0226-, PR0232-, PR0243-, PR0256-, PR0269-, PR0274-, PRO304, PR0339-, PR01558-, PR0779-, PROl 185-, PR01245-, PR01759-, PR05775-, PR07133-, PR07168-, PR05725-, PRO202-, PRO206-, PR0264-, PR0313-, PR0342-, PR0542-, PR0773-, PR0861-, PR01216-, PR01686-, PRO1800-,PRO3562-,PRO9850-,PRO539-,PRO4316-orPRO4980-encodingvectors.
  • Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe (Beach and Nurse, Nature. 290: 140 [1981]; EP 139,383 published 2 May 1985); Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer etal, Bio Technology.9: 968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al, J. Bacteriol.. 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K.
  • K. lactis MW98-8C, CBS683, CBS4574
  • Louvencourt et al J. Bacteriol.. 737 [1983]
  • K. fragilis ATCC 12,424)
  • K. bulgaricus ATCC 16,045)
  • wickeramii ATCC 24,178
  • K. waltii ATCC 56,500
  • K. dwsophilarum ATCC 36,906; Vanden Berg et al, Bio/Technology. 8: 135 (1990)
  • K . thermotolerans K. marxianus
  • yarrowia EP 402,226
  • Pichia pastoris EP 183,070; Sreekrishna et al, J. Basic Microbiol., 28:265-278 [1988]
  • Candida Trichoderma reesia
  • Neurospora crassa Neurospora crassa (Case etal, Proc. Natl. Acad. Sci. USA.
  • Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10 January 1991), and Aspergillus hosts such as A. nidulans (Ballance et al., Biochem. Biophys. Res. Commun.. l_12:284-289 [1983]; Tilburn et al., Gene. 26:205-221 [1983]; Yelton etal, Proc. Natl. Acad. Sci.
  • Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsis, and Rhodotorula. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).
  • Suitable host cells for the expression of glycosylated PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 are derived from multicellular organisms.
  • invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells.
  • useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham etal, J. Gen. Virol. 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO), Urlaub and Chasin, Proc. Natl. Acad. Sci. USA. 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol.
  • the vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage.
  • the appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art.
  • Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan.
  • the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
  • the signal sequence may be a component of the vector, or it may be a part of the PRO 197-, PRO207-, PR0226-, PR0232-, PR0243-, PR0256-, PR0269-, PR0274-, PRO304-, PR0339-, PR01558-, PR0779-, PR01185-, PR01245-, PR01759-, PR05775-, PR07133-, PR07168-, PR05725-, PRO202-, PRO206-, PR0264-, PR0313-, PR0342-, PR0542-, PR0773-, PR0861-, PR01216-, PR01686-, PRO1800-, PR03562-, PRO9850-, PR0539-, PR04316- or PRO4980-encoding DNA that is inserted into the vector.
  • the signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders.
  • yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces ⁇ -factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990.
  • mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses.
  • the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells.
  • Selection genes will typically contain a selection gene, also termed a selectable marker.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
  • selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PR0197-, PRO207-, PR0226-, PR0232-, PR0243-, PR0256-, PR0269-, PR0274-, PRO304-.PRO339-, PR01558-, PR0779-, PROl 185-, PR01245-,PR01759-,PR05775-, PR07133-, PR07168-, PR05725-, PRO202-, PRO206-, PR0264-, PR0313-, PR0342-, PR0542-, PR0773-, PR0861-, PR01216-, PR01686-, PRO1800-, PR03562-, PRO9850-, PR0539-, PR04316- or PRO4980-encoding nucleic acid, such as DHFR or thymidine kinase.
  • DHFR DHFR activity
  • yeast plasmid YRp7 yeast plasmid YRp7
  • the trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].
  • Expression and cloning vectors usually contain a promoter operably linked to the PROl 97-, PRO207-, PR0226-, PR0232-, PR0243-, PR0256-, PR0269-, PR0274-, PRO304-, PR0339-, PR01558-, PR0779-, PROl 185-, PR01245-, PR01759-, PR05775-, PR07133-,PR07168-, PRO5725-,PRO202-, PRO206-, PR0264-, PR0313-, PR0342-, PR0542-, PR0773-, PR0861-, PR01216-, PR01686-, PRO1800-, PR03562-, PRO9850-, PR0539-, PR04316- or PRO4980-encoding nucleic acid sequence to direct mRNA synthesis.
  • Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the ⁇ -lactamase and lactose promoter systems [Chang etal, Nature, 275:615 (1978); Goeddel etal, Nature, 281 :544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer ef al., Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)].
  • trp tryptophan
  • Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980.
  • S.D. Shine-Dalgarno
  • Suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphoglycerate kinase [Hitzeman etal, J. Biol. Chem., 255:2073 (1980)] or other glycolytic enzymes [Hess et al, J. Adv. Enzyme Reg..7: 149 (1968); Holland, Biochemistry.
  • enolase such as enolase, glyceraldehyde- 3- ⁇ hosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
  • enolase such as enolase, glyceraldehyde- 3- ⁇ hosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3- phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription.
  • enhancer sequences are now known frommammalian genes (globin, elastase, albumin, ⁇ -fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270) , the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • the enhancer may be spliced into the vector at a position 5' or 3' to the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 coding sequence, but is preferably located at a site 5' from the promoter.
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs.
  • regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168,PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980. Still other methods, vectors, and host cells suitable for adaptation to the synthesis of PR0197, PRO207,
  • PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PR04980 in recombinant vertebrate cell culture are described in Gething etal, Nature, 293: 620-625 (1981); Mantei et al, Nature. 281:40-46 (1979); EP 117,060; and EP 117,058.
  • Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
  • the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
  • Gene expression may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal.
  • the antibodies may be prepared against a native sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against an exogenous sequence fused to PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR
  • PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 may be recovered from culture medium or from host cell lysates.
  • membrane-bound it can be released from the membrane using a suitable detergent solution (e.g., Triton- X 100) or by enzymatic cleavage.
  • a suitable detergent solution e.g., Triton- X 100
  • Cells employed in expression of PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269,PR0274, PRO304,PRO339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
  • the following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850,
  • the present invention is based on the identification and characterization of genes that are amplified in certain cancer cells.
  • the genome of prokaryotic and eukaryotic organisms is subjected to two seemingly conflicting requirements.
  • One is the preservation and propagation of DNA as the genetic information in its original form, to guarantee stable inheritance through multiple generations.
  • cells or organisms must be able to adapt to lasting environmental changes.
  • the adaptive mechanisms can include qualitative or quantitative modifications of the genetic material.
  • Qualitative modifications include DNA mutations, in which coding sequences are altered resulting in a structurally and/or functionally different protein.
  • Gene amplification is a quantitative modification, whereby the actual number of complete coding sequence, i.e., a gene, increases, leading to an increased number of available templates for transcription, an increased number of translatable transcripts, and, ultimately, to an increased abundance of the protein encoded by the amplified gene.
  • MTX cytotoxic drug methotrexate
  • DHFR dihydrofolate reductase
  • Gene amplification is most commonly encountered in the development of resistance to cytotoxic drugs (antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells) and neoplastic transformation. Transformation of a eukaryotic cell as a spontaneous event or due to a viral or chemical/environmental insult is typically associated with changes in the genetic material of that cell.
  • One of the most common genetic changes observed in human malignancies are mutations of the p53 protein. ⁇ 53 controls the transition of cells from the stationary (Gl) to the replicative (S) phase and prevents this transition in the presence of DNA damage.
  • Gl stationary
  • S replicative
  • one of the main consequences of disabling p53 mutations is the accumulation and propagation of DNA damage, i.e., genetic changes.
  • Common types of genetic changes in neoplastic cells are, in addition to point mutations, amplifications and gross, structural alterations, such as translocations.
  • the amplification of DNA sequences may indicate a specific functional requirement as illustrated in the
  • the bcl-2 protein was found to be amplified in certain types of non-Hodgkin' s lymphoma. This protein inhibits apoptosis and leads to the progressive accumulation of neoplastic cells.
  • Members of the gene family of growth factor receptors have been found to be amplified in various types of cancers suggesting that overexpression of these receptors may make neoplastic cells less susceptible to limiting amounts of available growth factor.
  • Examples include the amplification of the androgen receptor in recurrent prostate cancer during androgen deprivation therapy and the amplification of the growth factor receptor homologue ERB2 in breast cancer.
  • genes involved in intracellular signaling and control of cell cycle progression can undergo amplification during malignant transformation. This is illustrated by the amplification of the bcl-I and ras genes in various epithelial and lymphoid neoplasms.
  • CGH comparative genomic hybridization
  • Tumor and normal DNA are hybridized simultaneously onto metaphases of normal cells and the entire genome can be screened by image analysis for DNA sequences that are present in the tumor at an increased frequency.
  • image analysis for DNA sequences that are present in the tumor at an increased frequency.
  • PCR-based assays The most sensitive methods to detect gene amplification are polymerase chain reaction (PCR)-based assays. These assays utilize very small amount of tumor DNA as starting material, are extremely sensitive, provide DNA that is amenable to further analysis, such as sequencing and are suitable for high-volume throughput analysis.
  • the above-mentioned assays are not mutually exclusive, but are frequently used in combination to identify amplifications in neoplasms. While cytogenetic analysis and CGH represent screening methods to survey the entire genome for amplified regions, PCR-based assays are most suitable for the final identification of coding sequences, i.e., genes in amplified regions.
  • such genes have been identified by quantitative PCR (S. Gelmini et al, Clin. Chem.. 43:752 [1997]), by comparing DNA from a variety of primary tumors, including breast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thymus, testis, ovary, uterus, etc., tumor, or tumor cell lines, with pooled DNA from healthy donors. Quantitative PCR was performed using a TaqManTM instrument (ABI). Gene-specific primers and fluorogenic probes were designed based upon the coding sequences of the DNAs.
  • Human lung carcinoma cell lines include A549 (SRCC768), Calu-1 (SRCC769), Calu-6 (SRCC770), H157 (SRCC771), H441 (SRCC772), H460 (SRCC773), SKMES-1 (SRCC774), SW900 (SRCC775), H522 (SRCC832),and H810 (SRCC833), all available from ATCC.
  • SRCC724 (adenocarcinoma, abbreviated as "AdenoCa")(LTl), SRCC725 (squamous cell carcinoma, abbreviated as "SqCCa)(LTla), SRCC726 (adenocarcinoma)(LT2), SRCC727 (adenocarcinoma)(LT3), SRCC728 (adenocarcinoma)(LT4), SRCC729 (squamous cell carcinoma)(LT6), SRCC730 (adeno/squamous cell carcinoma)(LT7), SRCC731 (adenocarcinoma)(LT9), SRCC732 (squamous cell carcinoma)(LT10), SRCC733 (squamous cell
  • human lung tumors designated SRCC1125 [HF-000631], SRCC1127 [HF-000641], SRCC1129 [HF-000643], SRCC1133 [HF-000840], SRCC1135 [HF-000842], SRCC1227 [HF-001291], SRCC1229 [HF-001293], SRCC1230 [HF-001294], SRCC1231 [HF-001295], SRCC1232 [HF-001296], SRCC1233 [HF-001297], SRCC1235 [HF-001299], and SRCC1236 [HF-001300].
  • Colon cancer cell lines include, for example, ATCC cell lines SW480 (adenocarcinoma, SRCC776),
  • SW620 lymph node metastasis of colon adenocarcinoma, SRCC777
  • Colo320 carcinoma, SRCC778
  • HM7 a high mucin producing variant of ATCC colon adenocarcinoma cell line
  • SRCC780 obtained fromDr. Robert Warren, UCSF
  • CaWiDr adenocarcinoma, SRCC781
  • HCT116 carcinoma, SRCC782
  • SKCOl adenocarcinoma, SRCC783
  • SW403 adenocarcinoma, SRCC784
  • LS174T carcinoma, SRCC785
  • Colo205 carcinoma, SRCC828
  • HCT15 carcinoma, SRCC829
  • HCC2998 carcinoma, SRCC830
  • KM 12 carcinoma, SRCC831.
  • Primary colon tumors include colon adenocarcinomas designated CT2 (SRCC742), CT3 (SRCC743) ,CT8 (SRCC744), CT10 (SRCC745), CT12 (SRCC746), CT14 (SRCC747), CT15 (SRCC748), CT16 (SRCC749), CT17 (SRCC750), CTl (SRCC751), CT4 (SRCC752), CT5 (SRCC753), CT6 (SRCC754), CT7 (SRCC755), CT9 (SRCC756), CTl 1 (SRCC757), CT18 (SRCC758), CT19 (adenocarcinoma, SRCC906), CT20 (adenocarcinoma, SRCC907), CT21 (adenocarcinoma, SRCC908), CT22 (adenocarcinoma, SRCC909), CT23 (adenocarcinoma, SRCC910), CT24 (adenocarcinoma, SRCC911), CT
  • SRCC1051 [HF-000499]
  • SRCC1052 [HF-000539]
  • SRCC1053 [HF-000575]
  • SRCC1054 [HF-000698]
  • SRCC1059 [HF-000755]
  • SRCC1060 [HF-000756]
  • SRCC1142 [HF-000762]
  • SRCC1144 [HF-000789]
  • SRCC1146 [HF-000795] and SRCC1148[HF-000811 [HF-000499]
  • SRCC1052 [HF-000539]
  • SRCC1053 [HF-000575]
  • SRCC1054 [HF-000698]
  • SRCC1059 [HF-000755]
  • SRCC1060 [HF-000756]
  • SRCC1142 [HF-000762]
  • SRCC1144 [HF-000789]
  • SRCC1146 [HF-000795
  • Human breast carcinoma cell lines include, for example, HBL100 (SRCC759), MB435s (SRCC760),T47D
  • SRCC761 SRCC761
  • MB468 SRCC762
  • MB175 SRCC763
  • MB361 SRCC764
  • BT20 SRCC765
  • MCF7 SRCC766
  • SKBR3 SRCC767
  • human breast tumor center designated SRCC1057 [HF-000545].
  • human breast tumors designated SRCC1094, SRCC1095, SRCC1096, SRCC1097, SRCC1098, SRCC1099,
  • SRCC1100, SRCC1101, and human breast-met-lung-NS tumor designated SRCC893 [LT 32].
  • Human rectum tumors include SRCC981 [HF-000550] and SRCC982 [HF-000551].
  • Human kidney tumor centers include SRCC989 [HF-000611] and SRCC1014 [HF-000613].
  • Human testis tumor center include SRCC1001 [HF-000733] and testis tumor margin SRCC999 [HF- 000716].
  • Human parathyroid tumors include SRCC1002 [HF-000831] and SRCC1003 [HF-000832].
  • Human lymph node tumors include SRCC1004 [HF-000854], SRCC1005 [HF-000855], and SRCC1006 [HF-000856].
  • gene amplification and/or gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA.77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
  • Gene expression in various tissues may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • immunological methods such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal.
  • the antibodies may be prepared against a native sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PROl 800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to sequence PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR
  • the gene can be mapped to a particular chromosome, e.g., by radiation-hybrid analysis. The amplification level is then determined at the location identified, and at the neighboring genomic region. Selective or preferential amplification at the genomic region to which the gene has been mapped is consistent with the possibility that the gene amplification observed promotes tumor growth or survival. Chromosome mapping includes both framework and epicenter mapping. For further details see, e.g., Stewart et al, Genome Research.2:422-433 (1997).
  • Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).
  • Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody.
  • the amount of target protein (encoded by a gene amplified in a tumor cell) in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies.
  • the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.
  • Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected.
  • the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex.
  • the second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay).
  • one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
  • the tumor sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.
  • Cell-based assays and animal models for tumors can be used to verify the findings of the gene amplification assay, and further understand the relationship between the genes identified herein and the development and pathogenesis of neoplastic cell growth.
  • the role of gene products identified herein in the development and pathology of tumor or cancer can be tested by using primary tumor cells or cells lines that have been identified to amplify the genes herein. Such cells include, for example, the breast, colon and lung cancer cells and cell lines listed above.
  • cells of a cell type known to be involved in a particular tumor are transfected with the cDNAs herein, and the ability of these cDNAs to induce excessive growth is analyzed.
  • Suitable cells include, for example, stable tumor cells lines such as, the B104-1-1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene) and ras-transfected NIH-3T3 cells, which can be transfected with the desired gene, and monitored for tumorogenic growth. Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit tumorogenic cell growth by exerting cytostatic or cytotoxic activity on the growth of the transformed cells, or by mediating antibody-dependent cellular cytotoxicity
  • ADCC Alzheimer's disease
  • Animal models of tumors and cancers include both non- recombinant and recombinant (transgenic) animals, Non-recombinant animal models include, for example, rodent, e.g., murine models.
  • Such models can be generated by introducing tumor cells into syngeneic mice using standard techniques, e.g., subcutaneous injection, tail vein injection, spleen implantation, intraperitoneal implantation, implantation under the renal capsule, or orthopin implantation, e.g., colon cancer cells implanted in colonic tissue.
  • standard techniques e.g., subcutaneous injection, tail vein injection, spleen implantation, intraperitoneal implantation, implantation under the renal capsule, or orthopin implantation, e.g., colon cancer cells implanted in colonic tissue.
  • mice Probably the most often used animal species in oncological studies are immunodeficient mice and, in particular, nude mice.
  • the autosomal recessive nu gene has been introduced into a very large number of distinct congenic strains of nude mouse, including, for example, AS W, A/He, AKR, BALB/c, B10.LP, C17, C3H, C57BL, C57, CBA, DBA, DDD, I/st, NC, NFR, NFS, NFS/N, NZB, NZC, NZW, P, Rill and S JL.
  • the cells introduced into such animals can be derived from known tumor/cancer cell lines, such as, any of the above-listed tumor cell lines, and, for example, the B 104-1-1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene); ras-transfected NIH-3T3 cells; Caco-2 (ATCC HTB-37); a moderately well- differentiated grade II human colon adenocarcinoma cell line, HT-29 (ATCCHTB-38), orfromtumors and cancers.
  • Samples of tumor or cancer cells can be obtained from patients undergoing surgery, using standard conditions, involving freezing and storing in liquid nitrogen (Karmali et al., Br. J. Cancer.
  • t Tumor cells can be introduced into animals, such as nude mice, by a variety of procedures.
  • the subcutaneous (s.c.) space in mice is very suitable for tumor implantation.
  • Tumors can be transplanted s.c. as solid blocks, as needle biopsies by use of a tr ' ochar, or as cell suspensions.
  • tumor tissue fragments of suitable size are introduced into the s.c. space.
  • Cell suspensions are freshly prepared from primary tumors or stable tumor cell lines, and injected subcutaneously. Tumor cells can also be injected as subdermal implants. In this location, the inoculum is deposited between the lower part of the dermal connective tissue and the s.c. tissue. Boven and Winograd (1991), supra.
  • Animal models of breast cancer can be generated, for example, by implanting rat neuroblastoma cells (from which the neu oncogen was initially isolated), or new-transformed NIH-3T3 cells into nude mice, essentially as described by Drebin et al., PNAS USA, 83:9129-9133 (1986).
  • animal models of colon cancer can be generated by passaging colon cancer cells in animals, e.g., nude mice, leading to the appearance of tumors in these animals.
  • An orthotopic transplant model of human colon cancer in nude mice has been described, for example, by Wang et al., Cancer Research, 54:4726-4728 (1994) and Too etal, Cancer Research, 55:681-684 (1995). This model is based on the so-called “METAMOUSE” sold by AntiCancer, Inc., (San Diego, California).
  • Tumors that arise in animals can be removed and cultured in vitro. Cells from the in vitro cultures can then be passaged to animals. Such tumors can serve as targets for further testing or drug screening. Alternatively, the tumors resulting from the passage can be isolated and RNA from pre-passage cells and cells isolated after one or more rounds of passage analyzed for differential expression of genes of interest. Such passaging techniques can be performed with any known tumor or cancer cell lines.
  • Mefh A, CMS4, CMS5, CMS21, and WEHI-164 are chemically induced fibrosarcomas of BALB/c female mice (DeLeo et al., J. Exp. Med.. 146:720 [1977]), which provide a highly controllable model system for studying the anti-tumor activities of various agents (Palladino et al., J. Immunol., 138:4023-4032 [1987]). Briefly, tumor cells are propagated in vitro in cell culture. Prior to injection into the animals, the cell lines are washed and suspended in buffer, at a cell density of about 10x10 s to lOxlO 7 cells/ml. The animals are then infected subcutaneously with 10 to 100 ⁇ l of the cell suspension, allowing one to three weeks for a tumor to appear.
  • the Lewis lung (3LL) carcinoma of mice which is one of the most thoroughly studied experimental tumors, can be used as an investigational tumor model. Efficacy in this tumor model has been correlated with beneficial effects in the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL).
  • SCCL small cell carcinoma of the lung
  • This tumor can be introduced in normal mice upon injection of tumor fragments from an affected mouse or of cells maintained in culture (Zupi et al., Br. J. Cancer, 41:suppl. 4:309 [1980]), and evidence indicates that tumors can be started from injection of even a single cell and that a very high proportion of infected tumor cells survive. For further information about this tumor model see, Zacharski, Haemostasis, 16:300-320 [1986]).
  • One way of evaluating the efficacy of a test compound in an animal model on an implanted tumor is to measure the size of the tumor before and after treatment.
  • the size of implanted tumors has been measured with a slide caliper in two or three dimensions.
  • the measure limited to two dimensions does not accurately reflect the size of the tumor, therefore, it is usually converted into the corresponding volume by using a mathematical formula.
  • the measurement of tumor size is very inaccurate.
  • the therapeutic effects of a drug candidate can be better described as treatment-induced growth delay and specific growth delay.
  • Another important variable in the description of tumor growth is the tumor volume doubling time.
  • Computer programs for the calculation and description of tumor growth are also available, such as the program reported by Rygaard and Spang-Thomsen, Proc. 6th Int.
  • necrosis and inflammatory responses following treatment may actually result in an increase in tumor size, at least initially. Therefore, these changes need to be carefully monitored, by a combination of a morphometric method and flow cytometric analysis.
  • Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals.
  • Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e.g., baboons, chimpanzees and monkeys.
  • Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); retrovirus-mediated gene transfer into germ lines (e.g., Van der Putten et al., Proc. Natl.
  • transgenic animals include those that carry the transgene only in part of their cells ("mosaic animals").
  • the transgene can be integrated either as a single transgene, or in concatamers, e.g., head-to-head or head-to-tail tandems. Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al, Proc. Natl. Acad. Sci. USA, 89:6232- 636 (1992).
  • the expression of the transgene in transgenic animals can be monitored by standard techniques. For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene. The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, or immunocytochemistry. The animals are further examined for signs of tumor or cancer development.
  • "knock out" animals can be constructed which have a defective or altered gene encoding a PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PRO 1216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal.
  • flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included in the vector [see, e.g., Thomas and Capecchi, Cell, 5L503 (1987) for a description of homologous recombination vectors].
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see, e.g., Li et al., Cell, 69:915 (1992)].
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see, e.g., Bradley, in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-152].
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
  • Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA.
  • Knockout animals can be characterized for instance, by their ability to defend against certain pathological conditions and by their development of pathological conditions due to absence of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • SCC feline oral squamous cell carcinoma
  • Feline oral SCC is a highly invasive, malignant tumor that is the most common oral malignancy of cats, accounting for over 60% of the oral tumors reported in this species. It rarely metastasizes to distant sites, although this low incidence of metastasis may merely be a reflection of the short survival times for cats with this tumor.
  • These tumors are usually not amenable to surgery, primarily because of the anatomy of the feline oral cavity. At present, there is no effective treatment for this tumor.
  • each cat Prior to entry into the study, each cat undergoes complete clinical examination, biopsy, and is scanned by computed tomography (CT). Cats diagnosed with sublingual oral squamous cell tumors are excluded from the study. The tongue can become paralyzed as a result of such tumor, and even if the treatment kills the tumor, the animals may not be able to feed themselves.
  • CT computed tomography
  • Each cat is treated repeatedly, over a longer period of time. Photographs of the tumors will be taken daily during the treatment period, and at each subsequent recheck.
  • CT scans and thoracic radiograms are evaluated every 8 weeks thereafter. The data are evaluated for differences in survival, response and toxicity as compared to control groups. Positive response may require evidence of tumor regression, preferably with improvement of quality of life and/or increased life span.
  • fibrosarcoma adenocarcinoma
  • lymphoma adenocarcinoma
  • chrondroma adenocarcinoma of dogs, cats
  • baboons a preferred model as its appearance and behavior are very similar to those in humans.
  • the use of this model is limited by the rare occurrence of this type of tumor in animals.
  • Screening assays for drug candidates are designed to identify compounds that bind or complex with the polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins.
  • Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
  • Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)peptide-immunoglobulin fusions, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
  • the assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art.
  • All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact.
  • the interaction is binding and the complex formed can be isolated or detected in the reaction mixture.
  • the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments.
  • Noncovalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying.
  • an immobilized antibody e.g., a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface.
  • the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component.
  • the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected.
  • the detection of label immobilized on the surface indicates that complexing occurred.
  • complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex.
  • candidate compound interacts with but does not bind to a particular PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PRO86I, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions.
  • Such assays include traditional approaches, such as, cross- linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns.
  • protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co- workers [Fields and Song, Nature, 340:245-246 (1989); Chien et al, Proc. Natl. Acad. Sci. USA, 88: 9578-9582 (1991)] as disclosed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA, 89:5789-5793 (1991)].
  • yeast GAL4 Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transcription activation domain.
  • the yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA- binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain.
  • the expression of a GALl-/ ⁇ cZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction.
  • Colonies containing interacting polypeptides are detected with a chromogenic substrate for ⁇ -galactosidase.
  • a complete kit (MATCHMAKERTM) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions. Compounds that interfere with the interaction of a PR0197-, PRO207-, PR0226-, PR0232-, PR0243-,
  • PR0256-, PR0269-, PR0274-, PRO304-, PR0339-, PR01558-, PR0779-, PR01185-, PR01245-, PR01759-, PR05775-, PR07133-, PR07168-, PR05725-, PRO202-, PRO206-, PR0264-, PR0313-, PR0342-, PR0542-, PR0773-, PR0861-, PR01216-, PR01686-, PRO1800-, PR03562-, PRO9850-, PR0539-, PR04316- or PRO4980-encoding gene identified herein and other intra- or extracellular components can be tested as follows: usually a reaction mixture is prepared containing the product of the amplified gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products.
  • test the ability of a test compound to inhibit binding the reaction is run in the absence and in the presence of the test compound.
  • a placebo may be added to a third reaction mixture, to serve as positive control.
  • the binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove.
  • the formation of a complex in the control reaction(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
  • the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861 , PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide may be added to a cell along with the compound to be screened for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133
  • antagonists may be detected by combiningthePR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, .
  • RNA is prepared from a cell responsive to the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide and a cDNA library created from this RNA is divided into pools and used to trans
  • Transfected cells that are grown on glass slides are exposed to labeled PRO 197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PRO1686,PRO1800, PR03562, PRO9850,PRO539, PR04316 or PRO4980 polypeptide.
  • polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase.
  • polypeptide can be photoaff inity-linked with cell membrane or extract preparations that express the receptor molecule.
  • Cross-linked material is resolved by PAGE and exposed to X-ray film.
  • the labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing.
  • the amino acid sequence obtained from micro-sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
  • mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide in the presence of the candidate compound. The ability of the compound to enhance or block this interaction could then be measured.
  • potential antagonists include an oligonucleotide that binds to the fusions of immunoglobulin with the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments.
  • a potential antagonist may be a closely related protein, for example, a mutated form of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PROS61, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR
  • polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e.g., an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes the mature PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 orPRO4980polypeptide herein, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see, Lee et al, Nucl. Acids Res.. 3:173 (1979); Cooney et al, Science, 241: 456 (1988); Dervan et al, Science, 251:1360 (1991)), thereby preventing transcription and the production of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773,PR0861, PR01216,PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide (antisense - Okano, Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988).
  • oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the PRQ197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PR01185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide.
  • antisense DNA oligodeoxyribonucleotides derived from the translation-initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
  • Antisense RNA or DNA molecules are generally at least about 5 bases in length, about 10 bases in length, about 15 bases in length, about 20 bases in length, about 25 bases in length, about 30 bases in length, about 35 bases in length, about 40 bases in length, about 45 bases in length, about 50 bases in length, about 55 bases in length, about 60 bases in length, about 65 bases in length, about 70 bases in length, about 75 bases in length, about 80 bases in length, about 85 bases in length, about 90 bases in length, about 95 bases in length, about 100 bases in length, or more.
  • Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686 ' , PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide, thereby blocking the normal biological activity of the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133,
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques . For further details see, e.g., Rossi, Current Biology, 4:469-471 (1994), and PCT publication No. WO 97/33551 (published
  • Nucleic acid molecules in triple-helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides.
  • the base composition of these oligonucleotides is designed such that it promotes triple-helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
  • Hoogsteen base-pairing rules which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
  • compositions and Methods for the Treatment of Tumors include, without limitation, antibodies, small organic and inorganic molecules, peptides, phosphopeptides, antisense and ribozyme molecules, triple helix molecules, etc., that inhibit the expression and/or activity of the target gene product.
  • antisense RNA and RNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation.
  • antisense DNA oligodeoxyribonucleotides derived from the translation initiation site, e.g., between about -10 and +10 positions of the target gene nucleotide sequence, are preferred.
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details see, e.g., Rossi, Current Biology, 4:469-471 (1994), and PCT publication No. WO 97/33551 (published
  • Nucleic acid molecules in triple helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides.
  • the base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of purines or pyrimidines on one strand of a duplex.
  • PCT publication No. WO 97/33551, supra These molecules can be. identified by any or any combination of the screening assays discussed hereinabove and/or by any other screening techniques well known for those skilled in the art.
  • Some of the most promising drug candidates according to the present invention are antibodies and antibody fragments which may inhibit the production or the gene product of the amplified genes identified herein and/or reduce the activity of the gene products.
  • Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant.
  • an immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
  • the immunizing agent may include thePR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized.
  • immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor.
  • adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate).
  • the immunization protocol may be selected by one skilled in the art without undue experimentation.
  • Theanti-PR0197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PR01185, anti-PR01245, anti- PR01759, anti-PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti- PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, antMPR0861, anti-PR01216, anti-PR01686, anti-PROlSOO, anti-PR03562, anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibodies may, alternatively, be monoclonal antibodies.
  • Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
  • a hybridoma method a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vitro.
  • the immunizing agent will typically include the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256,
  • PR07168 PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216,
  • PBLs peripheral blood lymphocytes
  • spleen cells or lymph node cells are used if non-human mammalian sources are desired.
  • the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice,
  • Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed.
  • the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT)
  • HGPRT or HPRT hypoxanthine guanine phosphoribosyl transferase
  • the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and fhymidine ("HAT medium”), which substances prevent the growth of HGPRT-deficient cells.
  • Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection (ATCC), Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al. Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63].
  • the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PRO1800, PR03562, PRO9850, PR0539, PR04316 or PRO4980.
  • the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
  • RIA radioimmunoassay
  • ELISA enzyme-linked immunoabsorbent assay
  • the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 107:220 (1980).
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra]. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
  • the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567.
  • DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
  • the hybridoma cells of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
  • host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein.
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S.
  • a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
  • the antibodies may be monovalent antibodies.
  • Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain.
  • the heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking.
  • the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.
  • In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art.
  • anti-PRO 197, anti-PRO207, anti-PR0226,anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROl 185, anti-PR01245, anti- PR01759, anti-PR05775, anti-PR07133, anti-PR07168, anti-PR05725, anti-PRO202, anti-PRO206, anti- PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti-PRO9850, anti-PR0539, anti-PR04316 or anti-PRO4980 antibodies may further comprise humanized antibodies or human antibodies.
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') 2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non- human immunoglobulin.
  • Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • CDR complementary determining region
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al, Nature. 321:522-525 (1986); Riechmann etal, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol..
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non- human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al, Nature.
  • humanized antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1991); Marks et al, J. Mol. Biol. 222:581 (1991)].
  • the techniques of Cole et al, and Boerner et al, are also available for the preparation of human monoclonal antibodies (Cole et al, Monoclonal Antibodies and Cancer Therapy. Alan R. Liss, p.77 (1985) and Boerner et al, J. Immunol.. 147(l):86-95 (1991)].
  • human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos.
  • the antibodies of the present invention may also be used in ADEPT by conjugating the antibody to a prodrug-activating enzyme which converts a prodrug (e.g., a peptidyl chemotherapeutic agent, see WO 81/01145) to an active anti-cancer drug. See, for example, WO 88/07378 and U. S. Patent No. 4,975,278.
  • a prodrug e.g., a peptidyl chemotherapeutic agent, see WO 81/01145
  • the enzyme component of the immunoco ⁇ jugate useful for ADEPT includes any enzyme capable of acting on a prodrug in such as way so as to convert it into its more active, cytotoxic form.
  • Enzymes that are useful in the method of this invention include, but are not limited to, glycosidase, glucose oxidase, human lysosyme, human glucuronidase, alkaline phosphatase useful for converting phosphate-containing prodrugs into free drugs; arylsulfatase useful for converting sulfate-containing prodrugs into free drugs; cytosine deaminase useful for converting non-toxic 5-fluorocytosine into the anti-cancer drug 5-fluorouracil; proteases, such as serratia protease, thermolysin, subtilisin, carboxypeptidases (e.g., carboxypeptidase G2 and carboxypeptidase A) and cathepsins (such as cathepsins
  • antibodies with enzymatic activity can be used to convert the prodrugs of the invention into free active drugs (see, e.g., Massey, Nature, 328:457-458 (1987)).
  • Antibody-abzyme conjugates can be prepared as described herein for delivery of the abzyme to a tumor cell population.
  • the enzymes of this invention can be covalently bound to the anti-PRO 197, anti-PRO207, anti-PR0226, anti-PR0232, anti-PR0243, anti-PR0256, anti-PR0269, anti-PR0274, anti-PRO304, anti-PR0339, anti-PR01558, anti-PR0779, anti-PROl 185, anti-PR01245, anti-PR01759, anti-PR05775, anti-PR07133, anti-PR07168, anti- PR05725, anti-PRO202, anti-PRO206, anti-PR0264, anti-PR0313, anti-PR0342, anti-PR0542, anti-PR0773, anti-PR0861, anti-PR01216, anti-PR01686, anti-PRO1800, anti-PR03562, anti-PRO9850, anti-PR0539, anti- PR04316 or anti-PRO4980 antibodies by techniques well known in the art such as the use of the heterobifunctional cross-linking agents discussed above.
  • fusion proteins comprising at least the antigen binding region of the antibody of the invention linked to at least a functionally active portion of an enzyme of the invention can be constructed using recombinant DNA techniques well known in the art (see, e.g., Neuberger et al, Nature, 312:604-608 (1984)).
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens.
  • one of the binding specificities is for the PR0197, PRO207, PR0226, PR0232, PR0243, PR0256, PR0269, PR0274, PRO304, PR0339, PR01558, PR0779, PROl 185, PR01245, PR01759, PR05775, PR07133, PR07168, PR05725, PRO202, PRO206, PR0264, PR0313, PR0342, PR0542, PR0773, PR0861, PR01216, PR01686, PROl 800, PR03562, PRO9850, PR0539, PR04316 or PRO4980 the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
  • bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains have different specificities (Milstein and Cuello, Nature, 305:537-539 [1983]). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker etal, EMBO J.. 10:3655-3659 (1991).
  • Antibody variable domains with the desired binding specificities can be fused to immunoglobulin constant domain sequences.
  • the fusion preferably is with an immunoglobulin heavy- chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CHI) containing the site necessary for light-chain binding present in at least one of the fusions.
  • DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain are inserted into separate expression vectors, and are co-transfected into a suitable host organism.
  • the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture.
  • the preferred interface comprises at least a part of the CH3 region of an antibody constant domain.
  • one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g., tyrosine or tryptophan).
  • Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g., F(ab') 2 bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments have been described in the literature. For example, bispecific antibodies can be prepared using chemical linkage.
  • the bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.
  • Fab' fragments may be directly recovered from E. coli and chemically coupled to form bispecific antibodies. Shalaby et al, J. Exp. Med.. 175:217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab') 2 molecule.
  • Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody.
  • the bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.
  • bispecific antibodies have been produced using leucine zippers.
  • the leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion.
  • the antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers.
  • the fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the V H and V L domains of one fragment are forced to pair with the complementary V L and V H domains of another fragment, thereby forming two antigen-binding sites.
  • V H and V L domains of one fragment are forced to pair with the complementary V L and V H domains of another fragment, thereby forming two antigen-binding sites.
  • sFv single-chain Fv
  • Antibodies with more than two valencies are contemplated.
  • trispecific antibodies can be prepared. Tutt et al, J. Immunol., 147:60 (1991).
  • bispecific antibodies may bind to two different epitopes on a given polypeptide herein.
  • an anti-polypeptide arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g., CD2, CD3, CD28, or B7), or Fc receptors for IgG (Fc ⁇ R), such as Fc ⁇ RI (CD64), Fc ⁇ RTI (CD32) and Fc ⁇ RIII (CD 16) so as to focus cellular defense mechanisms to the cell expressing the particular polypeptide.
  • Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular polypeptide.
  • These antibodies possess a polypeptide-binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA, DOTA, or TETA.
  • a cytotoxic agent or a radionuclide chelator such as EOTUBE, DPTA, DOTA, or TETA.
  • Another bispecific antibody of interest binds the polypeptide and further binds tissue factor (TF).
  • Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4- mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No.4,676,980.
  • effector function engineering It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance the effectiveness of the antibody in treating cancer, for example.
  • cysteine residue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region.
  • the homodimeric antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See, Caron et al, J. Exp. Med., 176:1191-1195 (1992) and Shopes, J. Immunol., 148:2918-2922 (1992).
  • Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobif unctional cross-linkers as described in Wolff etal, Cancer Research, 53:2560- 2565 (1993).
  • an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See, Stevenson et al, Anti-Cancer Drug Design, 3:219-230 (1989). 8. Immunoconjugates
  • the invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a small molecule toxin), or a radioactive isotope (i.e., a radioconjugate).
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof, or a small molecule toxin)
  • a radioactive isotope i.e., a radioconjugate
  • Enzymatically active protein toxins and fragments thereof which can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, cholera toxin, botulinus toxin, exotoxin A chain (from Pseudomonas aeruginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, saporin, mitogellin, restrictocin, phenomycin, enomycin and the tricothecenes.
  • diphtheria A chain nonbinding active fragments of diphtheria toxin, cholera toxin, botulinus toxin, exotoxin A chain (from Ps
  • Small molecule toxins include, for example, calicheamicins, maytansinoids, palytoxin and CC1065.
  • a variety of radionuclides are available for the production of radioconjugated antibodies. Examples include 212 Bi, 13 T, 131 In, 90 Y and 186 Re.
  • Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), and bis- active fluorine compounds (such as l,5-difluoro-2,4-dinitrobenzene).
  • SPDP N-succinimidyl-3
  • a ricin immunotoxin can be prepared as described in Vitetta et al, Science, 238:1098 (1987).
  • Carbon-14-labeled l-isothiocyanatobenzyl-3- methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See, WO94/11026.
  • the antibody may be conjugated to a "receptor” (such as streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand” (e.g., avidin) which is conjugated to a cytotoxic agent (e.g., a radionucleotide).
  • a receptor such as streptavidin
  • a ligand e.g., avidin
  • cytotoxic agent e.g., a radionucleotide
  • the antibodies disclosed herein may also be formulated as immunoliposomes.
  • Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et al., Proc. Natl. Acad. Sci. USA, 82:3688 (1985); Hwang et al, Proc. Natl. Acad. Sci. USA, 22:4030 (1980); and U.S. Patent Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556.
  • Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG- PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
  • Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al, J. Biol. Chem.. 257:286-288 (1982) via a disulfide interchange reaction.
  • a chemotherapeutic agent such as Doxorubicin is optionally contained within the liposome. See, Gabizon etal, J. National Cancer Inst, 81(19): 1484 (1989).
  • Antibodies specifically binding the product of an amplified gene identified herein, as well as other molecules identified by the screening assays disclosed hereinbefore, can be administered for the treatment of tumors, including cancers, in the form of pharmaceutical compositions.
  • the protein encoded by the amplified gene is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred.
  • lipofections or liposomes can also be used to deliver the antibody, or an antibody fragment, into cells. Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred.
  • peptide molecules can be designed which retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e.g., Marasco etal, Proc. Natl. Acad. Sci. USA, 90:7889-7893 [1993]).
  • Therapeutic formulations of the antibody are prepared for storage by mixing the antibody having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences. 16fh edition, Osol, A. ed. [1980]), in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzetlionium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine,
  • Non-antibody compounds identified by the screening assays of the present invention can be formulated in an analogous manner, using standard techniques well known in the art.
  • the formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other.
  • the composition may comprise a cytotoxic agent, c tokine or growth inhibitory agent.
  • cytotoxic agent e.g., IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, IL-12, or growth inhibitory agent.
  • Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
  • the active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interf acial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, ⁇ oly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and efhyl-L-glutamate non-degradable ethylene-vinyl acetate
  • degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT TM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate)
  • poly-D-(-)-3-hydroxybutyric acid While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods.
  • encapsulated antibodies When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
  • the antibodies and other anti-tumor compounds of the present invention may be used to treat various conditions, including those characterized by overexpression and/or activation of the amplified genes identified herein.
  • Exemplary conditions or disorders to be treated with such antibodies and other compounds include benign or malignant tumors (e.g., renal, liver, kidney, bladder, breast, gastric, ovarian, colorectal, prostate, pancreatic, lung, vulval, thyroid, hepatic carcinomas; sarcomas; glioblastomas; and various head and neck tumors); leukemias and lymphoid malignancies; other disorders such as neuronal, glial, astrocytal, hypothalamic and other glandular, macrophagal, epithelial, stromal and blastocoelic disorders; and inflammatory, angiogenic and immunologic disorders.
  • benign or malignant tumors e.g., renal, liver, kidney, bladder, breast, gastric, ovarian, colorectal, prostate, pancreatic, lung
  • the anti-tumor agents of the present invention are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical, or inhalation routes. Intravenous administration of the antibody is preferred.
  • chemotherapeutic agents may be administered to the patient. Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service Ed.. M.C. Perry, Williams & Wilkins, Baltimore, MD (1992).
  • the chemotherapeutic agent may precede, or follow administration of the anti-tumor agent, e.g., antibody, or may be given simultaneously therewith.
  • the antibody may be combined with an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapristone (see, EP 616812) in dosages known for such molecules. It may be desirable to also administer antibodies against other tumor associated antigens, such as antibodies which bind to the ErbB2, EGFR, ErbB3, ErbB4, or vascular endothelial factor (VEGF). Alternatively, or in addition, two or more antibodies binding the same or two or more different antigens disclosed herein may be co- administered to the patient. Sometimes, it may be beneficial to also administer one or more cytokines to the patient. In a preferred embodiment, the antibodies herein are co-administered with a growth inhibitory agent.
  • an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapristone (see, EP 616812) in dosages known for such molecules. It may be desirable to also administer antibodies against other tumor associated antigens, such as antibodies which
  • the growth inhibitory agent may be administered first, followed by an antibody of the present invention.
  • simultaneous administration or administration of the antibody of the present invention first is also contemplated.
  • Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the antibody herein.
  • an anti-tumor agent e.g., an antibody herein
  • the appropriate dosage of an anti-tumor agent will depend on the type of disease to be treated, as defined above, the severity and course of the disease, whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, and the discretion of the attending physician.
  • the agent is suitably administered to the patient at one time or over a series of treatments.
  • ⁇ g/kg to 15 mg/kg (e.g., 0.1-20 mg/kg) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
  • a typical daily dosage might range from about 1 ⁇ gfag to 100 mg/kg or more, depending on the factors mentioned above.
  • the treatment is sustained until a desired suppression of disease symptoms occurs.
  • other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays. ⁇
  • an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above comprises a container and a label.
  • Suitable containers include, for example, bottles, vials, syringes, and test tubes.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • the container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the active agent in the composition is usually an anti-tumor agent capable of interfering with the activity of a gene product identified herein, e.g., an antibody.
  • the label on, or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice.
  • the article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
  • antibodies directed against the protein products of genes amplified in tumor cells can be used as tumor diagnostics or prognostics.
  • antibodies can be used to qualitatively or quantitatively detect the expression of proteins encoded by the amplified genes ("marker gene products").
  • the antibody preferably is equipped with a detectable, e.g., fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluorimetry, or other techniques known in the art. These techniques are particularly suitable, if the amplified gene encodes a cell surface protein, e.g., a growth factor.
  • binding assays are performed essentially as described in section 5 above.
  • In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or immunoelectron microscopy.
  • a histological specimen is removed from the patient, and a labeled antibody is applied to it, preferably by overlaying the antibody on a biological sample.
  • This procedure also allows for determining the distribution of the marker gene product in the tissue examined. It will be apparent for those skilled in the art that a wide variety of histological methods are readily available for in situ detection. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
  • the present invention uses standard procedures of recombinant DNA technology, such as those described hereinabove and in the following textbooks: Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press N.Y., 1989; Ausubel etal, Current Protocols in Molecular Biology. Green Publishing Associates and Wiley Interscience, N.Y., 1989; Innis etal., PCR Protocols: A Guide to Methods and Applications. Academic Press, Inc., N.Y., 1990; Harlow etal, Antibodies: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, 1988; Gait, Oligonucleotide Synthesis. IRL Press, Oxford, 1984; R.I. Freshney, Animal Cell Culture, 1987; Coligan etal, Current Protocols in Immunology, 1991.
  • the extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss'-Prot public database were used to search EST databases.
  • the EST databases included public databases (e.g., Dayhoff, GenBank), and proprietary databases (e.g. LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA).
  • the search was performed using the computer program BLAST or BLAST-2 (Altschul ef al. , Methods in Enzymology, 266:460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons with a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap” (Phil Green, University of Washington, Seattle, Washington).
  • consensus DNA sequences were assembled relative to the other identified EST sequences using phrap.
  • consensus DNA sequences obtained were often (but not always) extended using repeated cycles of BLAST or BLAST-2 and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above.
  • oligonucleotides were then synthesized and used to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the full-length coding sequence for a PRO polypeptide.
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length.
  • the probe sequences are typically 40-55 bp in length.
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp.
  • DNA from the libraries was screened by PCR amplification, as per Ausubel et al. , Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
  • the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; ⁇ RK5B is aprecursor of pRK5D that does not contain the Sfil site; see, Holmes etal, Science, 253:1278-1280 (1991)) in the unique Xhol and Notl sites.
  • a suitable cloning vector such as pRKB or pRKD; ⁇ RK5B is aprecursor of pRK5D that does not contain the Sfil site; see, Holmes etal, Science
  • EXAMPLE 2 Isolation of cDNA Clones Using Signal Algorithm Analysis
  • Various polypeptide-encoding nucleic acid sequences were identified by applying a proprietary signal sequence finding algorithm developed by Genentech, Inc., (South San Francisco, CA) upon ESTs as well as clustered and assembled EST fragments from public (e.g., GenBank) and/or private (LIFESEQ ® , Incyte Pharmaceuticals, Inc., Palo Alto, CA) databases.
  • the signal sequence algorithm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration.
  • the nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required amino acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored.
  • the DNA and corresponding amino acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals. Use of this algorithm resulted in the identification of numerous polypeptide-encoding nucleic acid sequences.
  • PR0197 Isolation of cDNA clones encoding Human PRQ197 PR0197 was identified by screening the GenBank database using the computer programBLAST (Altschul et al., Methods in Enzymology, 266:460-480 (1996)). The PR0197 sequence was shown to have homology with known EST sequences T08223, AA122061, andM62290. None of the known EST sequences have been identified as full-length sequences, or described as ligands associated with TEE receptors. Following identification, PR0197 was cloned from a human fetal lung library prepared frommRNA purchased from Clontech, Inc., (Palo Alto, CA), catalog # 6528-1, following the manufacturer's instructions. The library was screened by hybridization with synthetic oligonucleotide probes.
  • oligonucleotide sequences were as follows: 5'-ATGAGGTGGCCAAGCCTGCCCGAAGAAAGAGGC-3' (SEQ ID NO:71)
  • TIE tyrosine kinase containing Ig and EGF homology domains
  • EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST was identified which showed homology to human Apo-2 ligand.
  • a human fetal kidney cDNA library was then screened.
  • mRNAisolated fromhuman fetal kidney tissue (Clontech) was used to prepare the cDNA library. This RNA was used to generate an oligo dT primed cDNA library in the vector pRK5D using reagents and protocols fromLife Technologies, Gaithersburg, MD (Super Script Plasmid System).
  • the double stranded cDNA was sized to greater than 1000 bp and the Sall/Notl linkered cDNA was cloned into Xhol/Notl cleaved vector.
  • pRK5D is a cloning vector that has an sp6 transcription initiation site followed by an Sf il restriction enzyme site preceding the Xhol/Notl cDNA cloning sites.
  • the library was screened by hybridization with a synthetic oligonucleotide probe: 5'-CCAGCCCTCTGCGCTACAACCGCCAGATCGGGGAGTTTATAGTCACCCGG-3' (SEQ ID N0:74) based on the EST.
  • a cDNA clone was sequenced in entirety.
  • a nucleotide sequence of the full-length DNA30879-1152 is shown in Figure 3 (SEQ ID NO:3).
  • Clone DNA30879-1152 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 58-60 ( Figure 3; SEQ ID NO:3) and an apparent stop codon at nucleotide positions 805-807.
  • the predicted polypeptide precursor is 249 amino acids long.
  • Analysis of the full-length PRO207 sequence shown in Figure 4 evidences the presence of important polypeptide domains, wherein the locations given for those important polypeptide domains are approximate as described above.
  • Analysis of the full-length PRO207 sequence shown in Figure 4 evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 40; an N-glycosylation site from about amino acid 139 to about amino acid 143; N-myristoylation sites from about amino acid 27 to about amino acid 33, from about amino acid 29 to about amino acid 35, from about amino acid 36 to about amino acid 42, from about amino acid 45 to about amino acid 51, from about amino acid 118 to about amino acid 124, from about amino acid 121 to about amino acid 127, from about amino acid 125 to about amino acid 131, and from about amino acid 128 to about amino acid 134; amidation sites from about amino acid 10 to about amino acid 14 and from about amino acid 97 to about amino acid 101; and a prokaryotic membrane lipoprotein lipid attachment site
  • PRO207 shows amino acid sequence identity to several members of the TNF cytokine family, and particularly, to human lymphotoxin-beta (23.4%) and human CD40 ligand (19.8%).
  • PCR primers forward and reverse were synthesized: forward PCR primer (28744.fl (OLI556):
  • a synthetic oligonucleotide hybridization probe was constructed from the DNA28744 consensus sequence which had the following nucleotide sequence: hybridization probe (28744.p) (OLI555): 5'-CCTGGCTATCAGCAGGTGGGCTCCAAGTGTCTCGATGTGGATGAGTGTGA-3' (SEQ ID NO:77)
  • hybridization probe (28744.p) OLI555: 5'-CCTGGCTATCAGCAGGTGGGCTCCAAGTGTCTCGATGTGGATGAGTGTGA-3' (SEQ ID NO:77)
  • DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0226 gene using the probe oligonucleotide and one of the PCR primers.
  • RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. DNA sequencing of the isolated clones isolated as described above gave the full-length DNA sequence for DNA33460-1166 [ Figure 5, S
  • DNA33460-1166 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 62-64, and an apparent stop codon at nucleotide positions 1391-1393.
  • the predicted polypeptide precursor is 443 amino acids long.
  • SEQ ID NO:6 Analysis of the full-length PR0226 sequence shown in Figure 6 (SEQ ID NO:6) evidences the presence of a variety of important polypeptide domains, wherein the locations given for those important polypeptide domains are approximate as described above.
  • EGF-like homolog DNA33460-1166 shows amino acid sequence identity to HT protein and/or Fibulin (49% and 38%, respectively).
  • Example 1 above This assembled consensus sequence is herein identified as DNA30935, wherein the polypeptide showed similarity to one or more stem cell antigens.
  • oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0232.
  • hybridization probe 5'-AGCAACGAGGACTGCCTGCAGGTGGAGAACTGCACCCAGCTGGG-3' (SEQ ID NO: 80)
  • DNA from the libraries was screened by PCR amplification with the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PR0232 gene using the probe oligonucleotide and one of the PCR primers.
  • RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue. DNA sequencing of the isolated clones isolated as described above gave the full-length DNA sequence for DNA34435-1140 [ Figure 7, SEQ ID NO:7] ; and the derived protein sequence for PR0232.
  • THPO Human thrombopoietin
  • the gene for thrombopoietin (THPO) maps to human chromosome 3q27- q28 where the six exons of this gene span 7 kilobase base pairs of genomic DNA (Gurney etal. Blood, 85:981-988 (1995). In order to determine whether there were any genes encoding THPO homologues located in close proximity to THPO, genomic DNA fragments from this region were identified and sequenced.
  • PI clones and one PAC clone (Genome Systems, Inc., St. Louis, MO; cat. Nos. Pl-2535 and PAC-6539) encompassing the THPO locus were isolated and a 140 kb region was sequenced using the ordered shotgun strategy (Chen et al Genomics, 17:651- 656 (1993)), coupled with a PCR-based gap filling approach. Analysis reveals that the region is gene-rich with four additional genes located very close to THPO: tumor necrosis factor-receptor type 1 associated protein 2 (TRAP2) and elongation initiation factor gamma (elF4g), chloride channel 2 (CLCN2) and RNA polymerase II subunit hRPB17.
  • TRIP2 tumor necrosis factor-receptor type 1 associated protein 2
  • elF4g elongation initiation factor gamma
  • CLCN2 chloride channel 2
  • RNA polymerase II subunit hRPB17 RNA polymerase II sub
  • the initial human PI clone was isolated from a genomic PI library (Genome Systems, Inc., St. Louis, MO; cat no.: Pl-2535) screened with PCR primers designed from the THPO genomic sequence (A. L. Gurney, et al,
  • PCR primers were designed from the end sequences derived from this PI clone were then used to screen PI and PAC libraries (Genome Systems, Cat Nos.: Pl-2535 & PAC-6539) to identify overlapping clones. Ordered Shotgun Strategy:
  • the Ordered Shotgun Strategy (Chen etal, Genomics, 17:651-656 (1993)) Involves the mapping and sequencing of large genomic DNA clones with a hierarchical approach.
  • the PI or PAC clone was sonicated and the fragments subcloned into lambda vector ( ⁇ Bluestar) (Novagen, Inc., Madison, WI; cat no. 69242-3).
  • the lambda subclone inserts were isolated by long-range PCR (Barnes, W., Proc. Natl. Acad. Sci. USA.91:2216-2220 (1994) and the ends sequenced.
  • the lambda-end sequences were overlapped to create a partial map of the original clone.
  • ABI DYE-primerTM chemistry PE Applied Biosystems, Foster City, CA; Cat. No.: 402112 was used to end-sequence the lambda and plasmid subclones.
  • ABI DYE-terminatorTMchemistry PE Applied Biosystems, Foster City, CA, Cat. No: 4030444 was used to sequence the PCR products with their respective PCR primers. The sequences were collected with an ABI377 instrument. For PCR products larger than lkb, walking primers were used. The sequences of contigs generated by the OSS strategy in AutoAssemblerTM (PE Applied Biosystems, Foster City, CA; Cat. No: 903227) and the gap-filling sequencing trace files were imported into SequencherTM (Gene Codes Corp., Ann Arbor, MI) for overlapping and editing.
  • Primers were designed based on the 5'- and 3 '-end sequence of each contig, avoiding repetitive and low quality sequence regions. All primers were designed to be 19-24-mers with 50%-70% G/C content. Oligos were synthesized and gel-purified by standard methods. Since the orientation and order of the contigs were unknown, permutations of the primers were used in the amplification reactions. Two PCR kits were used: first, XL PCR kit (Perkin Elmer, Norwalk, CT; Cat No.: N8080205), with extension times of approximately 10 minutes; and second, the Taq polymerase PCR kit (Qiagen, Inc., Valencia, CA; Cat.
  • CpG islands S. Cross & Bird, A., Curr. Opin. Genet. Dev., 5:109-314 (1995)
  • CpG islands were used to define promoter regions and were identified as clusters of sites cleaved by enzymes recognizing GC-rich, 6 or 8-mer palindromic sequences.
  • CpG islands are usually associated with promoter regions of genes.
  • GRAIL2 ApoCom, Inc., Knoxville, TN, command line version for the DEC alpha
  • Chordin cDNA clones were isolated from an oligo-dT-primed human fetal lung library.
  • Human fetal lung polyA + RNA was purchased from Clontech (cat#6528-l, lot#43777) and 5 mg used to construct a cDNA library in pRK5B (Genentech, LIB26).
  • the 3'-primer: pGACTAGTTCTAGATCGCGAGCGGCCGCCCllTTT'lTTTlT'lT'lT'lT (SEQ ID NO:81) and the 5'-linker: pCGGACGCGTGGGGCCTGCGCACCCAGCT (SEQ ID NO:82) ' were designed to introduce Sail and Notl restriction sites.
  • Clones were screened with oligonucleotide probes designed from the putative human chordin cDNA sequence (DNA34415) deduced by manually "splicing" together the proposed genomic exons of the gene. PCR primers flanking the probes were used to confirm the identity of the cDNA clones prior to sequencing.
  • the screening oligonucleotide probes were the following:
  • DNA35917-1207 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 137-139 and with apparent stop codon at nucleotide positions 2999-3001.
  • the predicted polypeptide precursor is 954 amino acids long.
  • Analysis of the full-length PR0243 sequence shown in Figure 10 evidences the presence of a variety of important polypeptide domains, wherein the locations given for those important polypeptide domains are approximate as described above.
  • a signal peptide from about amino acid 1 to about amino acid 23; N-glycosylation sites from about amino acid 217 to about amino acid 221, from about amino acid 351 to about amino acid 355, from about amino acid 365 to about amino acid 369, and from about amino acid 434 to about amino acid 438; tyrosine kinase phosphorylation sites from about amino acid 145 to about amino acid 153 and from about amino acid 778 to about amino acid 786; N-myristoylation sites from about amino acid 20 to about amino acid 26, from about amino acid 47 to about amino acid 53, from about amino acid 50 to about amino acid 56, from about amino acid 69 to about amino acid 75, from about amino acid 73 to about amino acid 79, from about amino acid 232 to about amino acid 238, from about amino acid 236 to about amino acid 242, from about amino acid 390 to about amino acid 396, from about amino acid 422 to about amino acid 428, from
  • DNA28725 consensus sequence oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0256.
  • hybridization probes Two synthetic oligonucleotide hybridization probes were constructed from the consensus DNA28725 sequence which had the following nucleotide sequences: hybridization probes:
  • DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0256 gene using one of the probe oligonucleotides and one of the PCR primers.
  • RNA for construction of the cDNA libraries was isolated from human placenta tissue.
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA.
  • the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Nod, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; ⁇ RK5B is a precursor of ⁇ RK5D that does not contain the Sfil site; see, Holmes et al., Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0256, herein designated as DNA35880- 1160 [ Figure
  • a signal peptide from about amino acid 1 to about amino acid 35; a transmembrane domain from about amino acid 466 to about amino acid 483; N- glycosylation sites from about amino acid 66 to about amino acid 70, from about amino acid 235 to about amino acid 239, and from about amino acid 523 to about amino acid 527; N-myristoylation sites from about amino acid 29 to about amino acid 35, from about amino acid 43 to about amino acid 49, from about amino acid 161 to about amino acid 167, from about amino acid 212 to about amino acid 218, from about amino acid 281 to about amino acid 287, from about amino acid 282 to about amino acid 288, from about amino acid 285 to about amino acid 291 , from about amino acid 310 to about amino acid 316, from about amino acid 313 to about amino acid 319, from about amino acid 422 to about amino acid 428, from about amino acid 423 to about amino acid 429, and from
  • PR0256 may be a novel proteinase inhibitor.
  • forward PCR primer 2 5'-TGACCAGTGGGGAAGGACAG-3' (SEQ ID NO:92) forward PCR primer 3:
  • hybridization probe 5'-ACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCT-3' (SEQ ID NO:96)
  • DNA from the libraries was screened by PCR amplification with the PCR primers identified above. A positive library was then used to isolate clones encoding the PR0269 gene using the probe oligonucleotide and one of the PCR primers.
  • RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue. DNA sequencing of the isolated clones isolated as described above gave the full-length DNA sequence for DNA38260-1180 [ Figure 13, SEQ ID NO:13]; and the derived protein sequence for PR0269.
  • a signal peptide from about amino acid 1 to about amino acid 16; a transmembrane domain from about amino acid 397 to about amino acid 418; N-glycosylation sites from about amino acid 189 to about amino acid 193, and from about amino acid 381 to about amino acid 385; a glycosaminoglycan attachment site from about amino acid 289 to about amino acid 293; cAMP- and cGMP-dependent protein kinase phosphorylation sites from about amino acid 98 to about amino acid 102, and from about amino acid 434 to about amino acid 438; N-myristoylation sites from about amino acid 30 to about amino acid 36, from about amino acid 35 to about amino acid 41, from about amino acid 58 to about amino acid 64, from about amino acid 59 to about amino acid 65, from about amino acid 121 to about amino acid 127, from about amino acid 151 to about amino acid 157, from about amino acid 185 to
  • the DNA36469 consensus sequence was then extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above.
  • the extended assembly consensus sequence is herein designated ⁇ consen01>.
  • ESTs proprietary to Genentech were employed in the second consensus assembly and are herein designated DNA17873, DNA36157 and DNA28929. Based on the assembled DNA36469 and
  • oligonucleotides were synthesized: 1) to identify by PCR acDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0274.
  • forward PCR primer 1 (36469.fl):
  • hybridization probe 5'-TCGGGGAGCAGGCCTTGAACCGGGGCATTGCTGCTGTCAAGGAGG-3' (SEQ ID NO: 103)
  • RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229).
  • DNA sequencing of the isolated clones isolated as described above gave the full-length DNA sequence for DNA39987-1184 [ Figure 15, SEQ ID NO:15]; and the derived protein sequence for PR0274.
  • N- glycosylation sites from about amino acid 347 to about amino acid 351, and from about amino acid 461 to about amino acid 465; a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 325 to about amino acid 329; and N-myristoylation sites from about amino acid 53 to about amino acid 59, from about amino acid 94 to about amino acid 100, from about amino acid 229 to about amino acid 235, from about amino acid
  • Clone DNA39987-1184 has been deposited with the ATCC on April 21, 1998 and is assigned ATCC deposit no. 209786.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Urology & Nephrology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Analytical Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Oncology (AREA)
  • Pathology (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hospice & Palliative Care (AREA)
  • Food Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
EP00907270A 1999-03-08 2000-02-11 Zusammensetzungen und verfahren zur behandlung von tumoren Withdrawn EP1173563A1 (de)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP05018353A EP1626084B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Methoden zur Diagnose von Tumoren
EP05018355A EP1623989B1 (de) 1999-03-08 2000-02-11 Verfahren und Zusammensetzungen zur Diagnose von Tumoren
EP05018354A EP1632499B9 (de) 1999-03-08 2000-02-11 In Tumoren vervielfältigte Gensequenzen und deren diagnostische Verwendungen
EP05018356A EP1607402B1 (de) 1999-03-08 2000-02-11 Methode zum Nachweis von Tumoren
EP05018357A EP1626058B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Diagnose von Tumoren
EP05018358A EP1623990B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Behandlung von Tumoren

Applications Claiming Priority (35)

Application Number Priority Date Filing Date Title
WOPCT/US99/05028 1999-03-08
PCT/US1999/005028 WO1999046281A2 (en) 1998-03-10 1999-03-08 Novel polypeptides and nucleic acids encoding the same
US12397299P 1999-03-11 1999-03-11
US123972P 1999-03-11
US13345999P 1999-05-11 1999-05-11
US133459P 1999-05-11
WOPCT/US99/12252 1999-06-02
PCT/US1999/012252 WO1999063088A2 (en) 1998-06-02 1999-06-02 Membrane-bound proteins and nucleic acids encoding the same
US14065099P 1999-06-22 1999-06-22
US14065399P 1999-06-22 1999-06-22
US140653P 1999-06-22
US140650P 1999-06-22
US14475899P 1999-07-20 1999-07-20
US144758P 1999-07-20
US14569899P 1999-07-26 1999-07-26
US145698P 1999-07-26
US14622299P 1999-07-28 1999-07-28
US146222P 1999-07-28
US14939599P 1999-08-17 1999-08-17
US149395P 1999-08-17
US15168999P 1999-08-31 1999-08-31
US151689P 1999-08-31
WOPCT/US99/20100 1999-09-01
PCT/US1999/020111 WO2000012708A2 (en) 1998-09-01 1999-09-01 Further pro polypeptides and sequences thereof
PCT/US1999/021090 WO2000015796A2 (en) 1998-09-16 1999-09-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
WOPCT/US99/21090 1999-09-15
WOPCT/US99/28313 1999-11-30
PCT/US1999/028313 WO2000032221A2 (en) 1998-12-01 1999-11-30 Promotion or inhibition of angiogenesis and cardiovascularization
WOPCT/US99/28634 1999-12-01
PCT/US1999/028634 WO2000036102A2 (en) 1998-12-16 1999-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US1999/028301 WO2000032776A2 (en) 1998-12-01 1999-12-01 Secreted amd transmembrane polypeptides and nucleic acids encoding the same
WOPCT/US99/28301 1999-12-01
WOPCT/US00/00219 2000-01-05
PCT/US2000/000219 WO2000053753A2 (en) 1999-03-08 2000-01-05 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US2000/003565 WO2001053486A1 (en) 1999-03-08 2000-02-11 Compositions and methods for the treatment of tumor

Related Child Applications (6)

Application Number Title Priority Date Filing Date
EP05018357A Division EP1626058B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Diagnose von Tumoren
EP05018353A Division EP1626084B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Methoden zur Diagnose von Tumoren
EP05018356A Division EP1607402B1 (de) 1999-03-08 2000-02-11 Methode zum Nachweis von Tumoren
EP05018358A Division EP1623990B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Behandlung von Tumoren
EP05018355A Division EP1623989B1 (de) 1999-03-08 2000-02-11 Verfahren und Zusammensetzungen zur Diagnose von Tumoren
EP05018354A Division EP1632499B9 (de) 1999-03-08 2000-02-11 In Tumoren vervielfältigte Gensequenzen und deren diagnostische Verwendungen

Publications (1)

Publication Number Publication Date
EP1173563A1 true EP1173563A1 (de) 2002-01-23

Family

ID=27578504

Family Applications (7)

Application Number Title Priority Date Filing Date
EP05018356A Expired - Lifetime EP1607402B1 (de) 1999-03-08 2000-02-11 Methode zum Nachweis von Tumoren
EP05018354A Expired - Lifetime EP1632499B9 (de) 1999-03-08 2000-02-11 In Tumoren vervielfältigte Gensequenzen und deren diagnostische Verwendungen
EP00907270A Withdrawn EP1173563A1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und verfahren zur behandlung von tumoren
EP05018355A Expired - Lifetime EP1623989B1 (de) 1999-03-08 2000-02-11 Verfahren und Zusammensetzungen zur Diagnose von Tumoren
EP05018357A Expired - Lifetime EP1626058B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Diagnose von Tumoren
EP05018358A Expired - Lifetime EP1623990B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Behandlung von Tumoren
EP05018353A Expired - Lifetime EP1626084B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Methoden zur Diagnose von Tumoren

Family Applications Before (2)

Application Number Title Priority Date Filing Date
EP05018356A Expired - Lifetime EP1607402B1 (de) 1999-03-08 2000-02-11 Methode zum Nachweis von Tumoren
EP05018354A Expired - Lifetime EP1632499B9 (de) 1999-03-08 2000-02-11 In Tumoren vervielfältigte Gensequenzen und deren diagnostische Verwendungen

Family Applications After (4)

Application Number Title Priority Date Filing Date
EP05018355A Expired - Lifetime EP1623989B1 (de) 1999-03-08 2000-02-11 Verfahren und Zusammensetzungen zur Diagnose von Tumoren
EP05018357A Expired - Lifetime EP1626058B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Diagnose von Tumoren
EP05018358A Expired - Lifetime EP1623990B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Verfahren zur Behandlung von Tumoren
EP05018353A Expired - Lifetime EP1626084B1 (de) 1999-03-08 2000-02-11 Zusammensetzungen und Methoden zur Diagnose von Tumoren

Country Status (10)

Country Link
EP (7) EP1607402B1 (de)
JP (6) JP2004520003A (de)
KR (1) KR100512819B1 (de)
AT (6) ATE348108T1 (de)
AU (3) AU2003200722B2 (de)
CA (5) CA2479498A1 (de)
DK (5) DK1632499T3 (de)
ES (6) ES2279473T3 (de)
PT (5) PT1626058E (de)
WO (1) WO2001053486A1 (de)

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000036102A2 (en) * 1998-12-16 2000-06-22 Genentech, Inc. Secreted and transmembrane polypeptides and nucleic acids encoding the same
WO1999040100A1 (en) 1998-02-09 1999-08-12 Human Genome Sciences, Inc. 45 human secreted proteins
US6593133B1 (en) * 1998-07-06 2003-07-15 Nsgene A/S Neurotrophic factors
CN1387538A (zh) 1999-01-15 2002-12-25 比奥根公司 针对tweak及tweak受体的拮抗剂和它们在治疗免疫性疾病中的应用
US8410248B2 (en) 1999-03-12 2013-04-02 Human Genome Sciences Inc. HWBAO62 polypeptides
EP1820860A3 (de) * 1999-06-02 2008-03-19 Genentech, Inc. Verfahren und Zusammensetzungen zur Hemmung des neoplastischen Zellenwachstums
US7589172B2 (en) 1999-07-20 2009-09-15 Genentech, Inc. PRO256 polypeptides
JP2004500844A (ja) 2000-05-08 2004-01-15 バイオジェン　インコーポレイテッド Ｔｗｅａｋアゴニストおよび血管形成因子を使用する、新血管新生を促進するための方法
US7208151B2 (en) 2001-09-12 2007-04-24 Biogen Idec Ma Inc. Tweak receptor agonists as anti-angiogenic agents
EP1392855A4 (de) * 2000-12-07 2005-05-25 Millennium Pharm Inc Verfahren und zusammensetzungen zur diagnose und behandlung einer viruserkrankung unter verwendung von 55092
DE60216482T2 (de) * 2001-09-07 2007-08-23 Genfit Zusammensetzungen und verfahren zum bestimmen von aa4rp
FR2843395A1 (fr) * 2002-08-12 2004-02-13 Genfit S A Composition et methodes pour le dosage de l'aa4rp
US20050123925A1 (en) * 2002-11-15 2005-06-09 Genentech, Inc. Compositions and methods for the diagnosis and treatment of tumor
AU2003227179A1 (en) * 2002-02-08 2003-09-09 Amersham Biosciences K.K. Fused protein having glucuronyl transferase activity
EP1477559A4 (de) 2002-02-20 2005-12-07 Astellas Pharma Inc Neues polypeptid
EP1361433A3 (de) * 2002-04-09 2005-02-23 Kabushiki Kaisha Hayashibara Seibutsu Kagaku Kenkyujo Verfahren zur erkennung die therapeutisches Wirkung TNF
WO2003086311A2 (en) 2002-04-09 2003-10-23 Biogen, Inc. Methods for treating tweak-related conditions
US20070128595A1 (en) * 2002-06-28 2007-06-07 Daniel Pereira Novel polynucleotide and polypeptide sequences and uses thereof
WO2004003158A2 (en) * 2002-06-29 2004-01-08 Genentech, Inc. Methods and compositions for modulating and detecting wisp activity
US7455834B2 (en) 2002-06-29 2008-11-25 Genentech, Inc. Methods and compositions for modulating and detecting WISP activity
CA2495563A1 (en) * 2002-08-07 2004-02-19 Curagen Corporation Therapeutic polypeptides, nucleic acids encoding same, and methods of use
WO2005028633A2 (en) 2003-09-17 2005-03-31 Isis Pharmaceuticals, Inc. Modulation of rankl expression
US8604185B2 (en) 2004-07-20 2013-12-10 Genentech, Inc. Inhibitors of angiopoietin-like 4 protein, combinations, and their use
DK1781698T3 (en) 2004-07-20 2016-10-03 Genentech Inc COMPOSITIONS AND METHODS FOR THE USE OF Angiopoietin-like-4-PROTEIN
WO2006023782A2 (en) 2004-08-19 2006-03-02 Biogen Ideca Ma Inc. Refolding transforming growth factor beta family proteins
DK2529619T3 (en) 2005-02-17 2016-01-11 Biogen Ma Inc Treatment of neurological disorders
CA2597485A1 (en) * 2005-03-07 2006-09-14 Genentech, Inc. Methods and compositions for modulating tweak and fn14 activity
EP1885388B1 (de) 2005-05-10 2013-09-11 Biogen Idec MA Inc. Behandlung und beurteilung von entzündlichen erkrankungen
WO2006138219A2 (en) 2005-06-13 2006-12-28 Biogen Idec Ma Inc. Methods of diagnosis / prognosis of inflammatory conditions
TWI501774B (zh) 2006-02-27 2015-10-01 Biogen Idec Inc 神經性病症之治療
ES2476253T3 (es) 2007-05-01 2014-07-14 Biogen Idec Ma Inc. P�ptidos de neublastina para su uso en el aumento de la vascularizaci�n en tejido con flujo sanguíneo deteriorado
AU2008269689A1 (en) * 2007-06-27 2008-12-31 Auckland Uniservices Limited Polypeptides and polynucleotides for artemin and related ligands, and methods of use thereof
HUE028878T2 (en) 2009-09-03 2017-01-30 Cancer Res Tech Ltd CLEC14A inhibitors

Family Cites Families (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994000603A1 (en) * 1992-06-26 1994-01-06 The Trustees Of Princeton University Method for detecting pre-cancerous or cancerous cells using p90 antibodies or probes
US5411860A (en) * 1992-04-07 1995-05-02 The Johns Hopkins University Amplification of human MDM2 gene in human tumors
AU8116494A (en) * 1993-11-12 1995-06-13 Kenichi Matsubara Gene signature
WO1999066041A1 (en) * 1998-06-16 1999-12-23 Human Genome Sciences, Inc. 94 human secreted proteins
WO2001034800A1 (en) * 1999-11-12 2001-05-17 Human Genome Sciences, Inc. 19 human secreted proteins
WO1999006550A2 (en) * 1997-08-01 1999-02-11 Genset 5' ESTs FOR SECRETED PROTEINS EXPRESSED IN PROSTATE
US6030831A (en) * 1997-09-19 2000-02-29 Genetech, Inc. Tie ligand homologues
AU2471899A (en) * 1998-01-30 1999-08-16 Human Genome Sciences, Inc. 67 human secreted proteins
WO1999045135A1 (en) * 1998-03-02 1999-09-10 Millennium Pharmaceuticals, Inc. Novel fdrg protein and nucleic acid molecules and uses therefor
DE19818620A1 (de) * 1998-04-21 1999-10-28 Metagen Gesellschaft Fuer Genomforschung Mbh Menschliche Nukleinsäuresequenzen aus Blase-Normal
AU4187499A (en) * 1998-05-14 1999-11-29 Chiron Corporation Human genes and gene expression products v
WO1999067382A2 (en) * 1998-06-24 1999-12-29 Compugen Ltd. Angiopoietin-like growth factor sequences
WO2000004135A2 (en) * 1998-07-16 2000-01-27 Incyte Pharmaceuticals, Inc. Human scad-related molecules, scrm-1 and scrm-2
WO2000006728A2 (en) * 1998-07-28 2000-02-10 Incyte Pharmaceuticals, Inc. Phosphorylation effectors
JP2002537757A (ja) * 1998-08-24 2002-11-12 アルファジーン・インコーポレイテッド 分泌タンパク質及びそれらをコードするポリヌクレオチド
WO2001053455A2 (en) * 1999-12-23 2001-07-26 Hyseq, Inc. Novel nucleic acids and polypeptides
WO2000034477A2 (en) * 1998-12-11 2000-06-15 Incyte Pharmaceuticals, Inc. Neuron-associated proteins
WO2000058473A2 (en) * 1999-03-31 2000-10-05 Curagen Corporation Nucleic acids including open reading frames encoding polypeptides; 'orfx'
ES2287020T3 (es) * 1999-06-02 2007-12-16 Genentech, Inc. Procedimiento y composiciones para inhibir el crecimiento de celulas neoplasicas.
WO2001053312A1 (en) * 1999-12-23 2001-07-26 Hyseq, Inc. Novel nucleic acids and polypeptides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0153486A1 *

Also Published As

Publication number Publication date
CA2479511A1 (en) 2001-07-26
DK1632499T3 (da) 2007-10-01
WO2001053486A1 (en) 2001-07-26
EP1626084A1 (de) 2006-02-15
ES2290834T3 (es) 2008-02-16
PT1626058E (pt) 2008-02-15
JP2004229503A (ja) 2004-08-19
ES2296029T3 (es) 2008-04-16
PT1623989E (pt) 2007-09-25
EP1632499A2 (de) 2006-03-08
CA2365610A1 (en) 2001-07-26
JP2004229504A (ja) 2004-08-19
AU2003200740B2 (en) 2005-12-15
DK1623989T3 (da) 2007-10-15
ATE364628T1 (de) 2007-07-15
AU2003200740C1 (en) 2008-07-17
ATE377025T1 (de) 2007-11-15
ATE363489T1 (de) 2007-06-15
CA2479476C (en) 2009-11-10
EP1632499B9 (de) 2008-02-20
ATE380195T1 (de) 2007-12-15
ES2298896T3 (es) 2008-05-16
JP2004520003A (ja) 2004-07-08
DK1626058T3 (da) 2008-02-25
ES2321954T3 (es) 2009-06-15
ES2289630T3 (es) 2008-02-01
PT1623990E (pt) 2008-03-18
EP1626084B1 (de) 2009-02-11
EP1623989B1 (de) 2007-06-13
AU2003200722C1 (en) 2003-05-01
EP1623990B1 (de) 2007-12-05
EP1623989A1 (de) 2006-02-08
EP1607402A1 (de) 2005-12-21
ES2279473T3 (es) 2007-08-16
PT1607402E (pt) 2007-03-30
EP1607402B1 (de) 2006-12-13
EP1632499B1 (de) 2007-05-30
JP2004201653A (ja) 2004-07-22
EP1623990A2 (de) 2006-02-08
CA2479498A1 (en) 2001-07-26
JP2004201652A (ja) 2004-07-22
EP1632499A3 (de) 2006-03-15
CA2479476A1 (en) 2001-07-26
EP1623990A3 (de) 2006-03-01
KR20010103045A (ko) 2001-11-17
KR100512819B1 (ko) 2005-09-07
CA2479494A1 (en) 2001-07-26
AU2003200731B2 (en) 2006-04-13
PT1632499E (pt) 2007-09-11
ATE422536T1 (de) 2009-02-15
AU2003200722B2 (en) 2006-02-02
CA2479494C (en) 2010-02-02
AU2003200731C1 (en) 2008-07-17
DK1607402T3 (da) 2007-04-16
JP2004201654A (ja) 2004-07-22
DK1623990T3 (da) 2008-04-07
EP1626058A1 (de) 2006-02-15
EP1626058B1 (de) 2007-10-31
ATE348108T1 (de) 2007-01-15

Similar Documents

Publication Publication Date Title
AU2003200722C1 (en) Compositions and methods for the treatment of tumor
US20050176104A1 (en) Compositions and methods for the treatment of tumor
WO2000053755A2 (en) Compositions and methods for the treatment of tumor
CA2371434A1 (en) Compositions and methods for the treatment of tumor
AU773055C (en) Compositions and methods for the treatment of tumors
WO2000037640A2 (en) Compositions and methods for the treatment of tumor
WO2001005836A1 (en) Polypeptidic compositions and methods for the treatment of tumors
AU756400B2 (en) Compositions and methods for the treatment of tumor
AU2003200721C1 (en) Compositions and methods for the treatment of tumor
NZ513423A (en) Compositions and methods for the treatment of tumors
CA2478728A1 (en) Compositions and methods for the treatment of tumors
ZA200106595B (en) Compositions and methods for the treatment of tumor.

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010904

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20050412

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20051025