EP1169464A1 - Adenovirus recombinants et mutants derives de l'adenovirus type 1 bovin - Google Patents

Adenovirus recombinants et mutants derives de l'adenovirus type 1 bovin

Info

Publication number
EP1169464A1
EP1169464A1 EP00921951A EP00921951A EP1169464A1 EP 1169464 A1 EP1169464 A1 EP 1169464A1 EP 00921951 A EP00921951 A EP 00921951A EP 00921951 A EP00921951 A EP 00921951A EP 1169464 A1 EP1169464 A1 EP 1169464A1
Authority
EP
European Patent Office
Prior art keywords
virus
bovine
bav
recombinant
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00921951A
Other languages
German (de)
English (en)
Inventor
Christina H. Chiang
Mark D. Cochran
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
MSD International Holdings GmbH
Original Assignee
Schering Plough Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Schering Plough Ltd filed Critical Schering Plough Ltd
Publication of EP1169464A1 publication Critical patent/EP1169464A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • the present invention relates to viral vectors for vaccination of animals.
  • the present invention pertains to viral vectors having insertion sites for the introduction of foreign DNA.
  • the adenoviruses cause enteric or respiratory infection in humans as well as in domestic and laboratory animals.
  • bovine adenovirus-based expression vectors have been reported for bovine adenovirus 3 (BAV-3)
  • Bovine adenoviruses comprise at least nine serotypes divided into two subgroups. These subgroups have been characterized based on enzyme-linked immunoassays (ELISA), serologic studies with immunofluorescence assays, virus- neutralization tests, immunoelectron microscopy and by their host specificity and clinical syndromes.
  • Subgroup 1 viruses include BAN 1, 2, 3 and 9 and grow relatively well in established bovine cells compared to subgroup 2 viruses which include BAN 4, 5, 6, 7 and 8.
  • BAN-3 was first isolated in 1965 and is the best characterized of the BAN genotypes and contains a genome of approximately 35 kilobases. The locations of hexon and proteinase genes in the BAN-3 genome have been identified and sequenced.
  • BAN-1 bovine adenovirus 1
  • the selection of (i) a suitable virus and (ii) the particular portion of the genome to use as an insertion site for creating a vector for foreign gene expression pose a significant challenge.
  • the insertion site must be non-essential for the viable replication of the virus, as well as its operation in tissue culture and in vivo.
  • the insertion site must be capable of accepting new genetic material, while ensuring that the virus continues to replicate.
  • the present invention provides recombinant viruses. While not limited to a particular use, these recombinant viruses can be used to generate vaccines.
  • the present invention provides a recombinant virus comprising a foreign D ⁇ A sequence inserted into the E4 gene region of a bovine adenovirus.
  • the insertion is to a non- essential site.
  • the present invention provides a recombinant virus comprising a foreign D ⁇ A sequence inserted into the E3 gene region of a bovine adenovirus 1.
  • the insertion is to a non-essential site.
  • the recombinant virus is replication competent.
  • the foreign DNA encodes a polypeptide and is from a virus or bacteria selected from the group consisting of bovine rotavirus, bovine coronavirus, bovine herpes virus type 1. bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus somnus.
  • the foreign DNA encodes a cytokine.
  • the polypeptide comprises more than ten amino acids and is antigenic.
  • the foreign DNA sequence is under the control of a promoter located upstream of the foreign DNA sequence.
  • the present invention also contemplates mutant viruses. While not limited to a particular mutant virus, in one embodiment, the mutant virus comprises a deletion of at least a portion of the E4 gene region of a bovine adenovirus. In a preferred embodiment, the deletion is of a non-essential site. In another embodiment, the virus comprises a deletion of at least a portion of the E3 gene region of a bovine adenovirus 1. In a preferred embodiment, the mutant virus is replication competent. In a further preferred embodiment, at least one open reading frame of the relevant gene region of the bovine adenovirus is completely deleted.
  • the present invention provides a method for preparing a recombinant virus comprising inserting at least one foreign gene or gene fragment that encodes at least one antigen into the genome of a virus wherein said gene or gene fragment has been inserted into the early gene region 4 of a bovine adenovirus or inserted into the early gene region 3 of bovine adenovirus 1.
  • the method includes the insertion of at least a part of the genome of a virus into a bacterial plasmid, transforming said bacteria with said plasmid, and incubating said bacteria at approximately 25°C.
  • the present invention provides vaccines. While not limited to a particular vaccine, in one embodiment, the vaccines comprise the recombinant viruses described above.
  • the present invention also contemplates methods of vaccination, including, but not limited to, the introduction of the above-described vaccines to an animal.
  • animal refers to organisms in the animal kingdom. Thus, this term includes humans, as well as other organisms. Preferably, the term refers to vertebrates. More preferably, the term refers to bovine animals.
  • a “vector” is a replicon, such as a plasmid, phage, cosmid or virus, to which another DNA sequence may be attached so as to bring about the expression of the attached DNA sequence.
  • a "host cell” is a cell used to propagate a vector and its insert. Infecting the cell can be accomplished by methods well known to those skilled in the art, for example, as set forth in Transfection of BAN-1 D ⁇ A below.
  • a D ⁇ A "coding sequence” is a D ⁇ A sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to, procaryotic sequences, cD ⁇ A from eucaryotic mR ⁇ A, genomic D ⁇ A sequences from eucaryotic (e.g., mammalian) D ⁇ A, viral D ⁇ A, and even synthetic D ⁇ A sequences.
  • a polyadenylation signal and transcription termination sequence can be located 3' to the coding sequence.
  • a “promoter sequence” is a D ⁇ A regulatory region capable of binding R ⁇ A polymerase or an auxiliary protein and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is in close proximity to the 5' terminus by the translation start codon (ATG) of a coding sequence and extends upstream (5' direction) to include the minimum number of bases or elements necessary to facilitate transcription at levels detectable above background.
  • ATG translation start codon
  • Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains (consensus sequences) responsible for the binding of R ⁇ A polymerase.
  • Eucaryotic promoters will often, but not always, contain "TATA" boxes and "CAAT” boxes, conserved sequences found in the promoter region of many eucaryotic organisms.
  • a coding sequence is "operably linked to” or “under the control of promoter or control sequences in a cell when RNA polymerase will interact with the promoter sequence directly or indirectly and result in transcription of the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
  • double-stranded DNA molecule refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its normal, double- stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes, for example, double-stranded DNA found in linear DNA molecules (e.g., restriction fragments of DNA from viruses, plasmids, and chromosomes), as well as circular and concatamerized forms of DNA.
  • linear DNA molecules e.g., restriction fragments of DNA from viruses, plasmids, and chromosomes
  • a "foreign DNA sequence” is a segment of DNA that has been or will be attached to another DNA molecule using recombinant techniques wherein that particular DNA segment is not found in association with the other DNA molecule in nature.
  • the source of such foreign DNA may or may not be from a separate organism than that into which it is placed.
  • the foreign DNA may also be a synthetic sequence having codons different from the native gene. Examples of recombinant techniques include, but are not limited to, the use of restriction enzymes and ligases to splice DNA.
  • An "insertion site” is a restriction site in a DNA molecule into which foreign DNA can be inserted.
  • a "homology vector” is a plasmid constructed to insert foreign DNA sequence in a specific site on the genome of an adenovirus.
  • the term “open reading frame” or “ORF” is defined as a genetic coding region for a particular gene that, when expressed, can produce a complete and specific polypeptide chain protein.
  • a cell has been "transformed” with exogenous DNA when such exogenous DNA has been introduced inside the cell membrane.
  • Exogenous DNA may or may not be integrated (covalently linked) to chromosomal DNA making up the genome of the cell.
  • the exogenous DNA may be maintained on an episomal element, such as a plasmid.
  • a stably transformed cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. For mammalian cells, this stability is demonstrated by the ability of the cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.
  • a “replication competent virus” is a virus whose genetic material contains all of the DNA or RNA sequences necessary for viral replication as are found in a wild-type of the organism. Thus, a replication competent virus does not require a second virus or a cell line to supply something defective in or missing from the virus in order to replicate.
  • a "non-essential site in the adenovirus genome” means a region in the adenovirus genome, the polypeptide product or regulatroy sequence of which is not necessary for viral infection or replication.
  • Two polypeptide sequences are "substantially homologous" when at least about 80%) (preferably at least about 90%, and most preferably at least about 95%) of the amino acids match over a defined length of the molecule.
  • Two DNA sequences are "substantially homologous" when they are identical to or not differing in more that 40% of the nucleotides, more preferably about 20% of the nucleotides, and most preferably about 10% of the nucleotides.
  • a virus that has had a foreign DNA sequence inserted into its genome is a
  • mutant virus while a virus that has had a portion of its genome removed by intentional deletion (e.g., by genetic engineering) is a “mutant virus.”
  • polypeptide is used in its broadest sense, i.e., any polymer of amino acids (dipeptide or greater) linked through peptide bonds.
  • polypeptide includes proteins, oligopeptides, protein fragments, analogs, muteins, fusion proteins, etc.
  • Antigenic refers to the ability of a molecule containing one or more epitopes to stimulate an animal or human immune system to make a humoral and/or cellular antigen- specific response.
  • An "antigen” is an antigenic polypeptide.
  • an "immunological response" to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to the composition or vaccine of interest.
  • a response consists of the subject producing antibodies, B cells, helper T cells, suppressor T cells, and'or cytotoxic T cells directed specifically to an antigen or antigens included in the composition or vaccine of interest.
  • immunogenic polypeptide and “immunogenic amino acid sequence” refer to a polypeptide or amino acid sequence, respectively, which elicit antibodies that neutralize viral infectivity, and/or mediate antibody-complement or antibody dependent cell cytotoxicity to provide protection of an immunized host.
  • immunogenic fragment is meant a fragment of a polypeptide which includes one or more epitopes and thus elicits antibodies that neutralize viral infectivity, and/or mediates antibody-complement or antibody dependent cell cytotoxicity to provide protection of an immunized host.
  • Such fragments will usually be at least about 5 amino acids in length, and preferably at least about 10 to 15 amino acids in length. There is no critical upper limit to the length of the fragment, which could comprise nearly the full length of the protein sequence, or even a fusion protein comprising fragments of two or more of the antigens.
  • infectious is meant having the capacity to deliver the viral genome into cells.
  • a “substantially pure” protein will be free of other proteins, preferably at least 10% homogeneous, more preferably 60% homogeneous, and most preferably 95% homogeneous.
  • Figure 1 is a diagram of BAN-1 genomic D ⁇ A showing the relative size of various regions in kilobase pairs. Fragments are lettered in order of decreasing size.
  • the methods and compositions of the present invention involve modifying DNA sequences from various prokaryotic and eucaryotic sources and by gene insertions, gene deletions, single or multiple base changes, and subsequent insertions of these modified sequences into the genome of an adenovirus.
  • One example includes inserting parts of an adenovirus DNA into plasmids in bacteria, reconstructing the virus DNA while in this state so that the DNA contains deletions of certain sequences, and/or furthermore adding foreign DNA sequences either in place of the deletions or at sites removed by the deletions.
  • the foreign gene construct is cloned into an adenovirus nucleotide sequence which represents only a part of the entire adenovirus genome, which may have one or more appropriate deletions.
  • This chimeric DNA sequence is usually present in a plasmid which allows successful cloning to produce many copies of the sequence.
  • the cloned foreign gene construct can then be included in the complete viral genome, for example, by in vivo recombination following a DNA-mediated cotransfection technique. Multiple copies of a coding sequence or more than one coding sequences can be inserted into the viral genome so that the recombinant virus can express more than one foreign protein or multiple copies of the same protein.
  • the foreign gene can have additions, deletions or substitutions to enhance expression and/or immunological effects of the expressed protein.
  • the gene In order for successful expression of the gene to occur, it can be inserted into an expression vector together with a suitable promoter including enhancer elements and polyadenylation sequences.
  • a suitable promoter including enhancer elements and polyadenylation sequences.
  • a number of eucaryotic promoter and polyadenylation sequences which provide successful expression of foreign genes in mammalian cells and how to construct expression cassettes, are known in the art, for example in U.S. Patent No. 5,151,267.
  • the promoter is selected to give optimal expression of immunogenic protein which in turn satisfactorily leads to humoral, cell mediated and mucosal immune responses according to known criteria.
  • the polypeptide encoded by the foreign DNA sequence is produced by expression in vivo in a recombinant virus-infected cell.
  • the polypeptide may be immunogenic. More than one foreign gene can be inserted into the viral genome to obtain successful production of more than one effective protein.
  • one utility of the use of a mutant adenovirus or the addition of a foreign DNA sequence into the genome of an adenovirus is to vaccinate an animal.
  • a mutant virus could be introduced into an animal to elicit an immune response to the mutant virus.
  • a recombinant adenovirus having a foreign DNA sequence inserted into its genome that encodes a polypeptide may also serve to elicit an immune response in an animal to the foreign DNA sequence, the polypeptide encoded by the foreign DNA sequence and/or the adenovirus itself.
  • a virus may also be used to introduce foreign DNA and its products into the host animal to alleviate a defective genomic condition in the host animal or to enhance the genomic condition of the host animal.
  • the present invention utilizes bovine adenovirus expression vector systems.
  • the present invention comprises a bovine adenovirus in which part or all of the E4 gene region is deleted and/or into which foreign DNA is introduced.
  • the system comprises a bovine adenovirus 1 (BAV-1) in which part or all of the E3 and/or E4 gene regions are deleted and/or into which foreign DNA is introduced.
  • BAV-1 bovine adenovirus 1
  • the foreign DNA sequence of interest will be derived from pathogens that in bovine cause diseases that have an economic impact on the cattle or dairy industry.
  • the genes may be derived from organisms for which there are existing vaccines, and because of the novel advantages of the vectoring technology, the adenovirus derived vaccines will be superior.
  • the gene of interest may be derived from pathogens for which there is currently no vaccine but where there is a requirement for control of the disease.
  • the gene of interest encodes immunogenic polypeptides of the pathogen and may represent surface proteins, secreted proteins and structural proteins.
  • the present invention is not limited by the particular organisms from which a foreign DNA sequence is obtained for gene insertion into a bovine adenovirus genome.
  • the foreign DNA is from bovine rotavirus, bovine coronavirus, bovine herpes virus type 1 , bovine respiratory syncytial virus, bovine para influenza virus type 3 (BPI-3), bovine diarrhea virus, bovine rhinotracheitis virus, bovine parainfluenza type 3 virus, Pasteurella haemolytica, Pasteurella multocida and/or Haemophilus somnus.
  • the foreign DNA encodes a cytokine.
  • the present invention is also not limited to the use of a particular DNA sequence from such an organism. Often selection of the foreign DNA sequence to be inserted into an adenovirus genome is based upon the protein it encodes. Preferably, the foreign DNA sequence encodes an immunogenic polypeptide.
  • the preferred immunogenic polypeptide to be expressed by the virus systems of the present invention contain full-length (or near full-length) sequences encoding antigens.
  • shorter sequences that are immunogenic i.e., encode one or more epitopes
  • the shorter sequence can encode a neutralizing epitope, which is defined as an epitope capable of eliciting antibodies that neutralize virus infectivity in an in vitro assay.
  • the peptide should encode a protective epitope that is capable of raising in the host an protective immune response; i.e., an antibody-mediated and/or a cell- mediated immune response that protects an immunized host from infection.
  • the gene for a particular antigen can contain a large number of introns or can be from an RNA virus. In these cases a complementary DNA copy (cDNA) can be used.
  • the antigens encoded by the foreign DNA sequences used in the present invention can be either native or recombinant immunogenic polypeptides or fragments. They can be partial sequences, full-length sequences, or even fusions (e.g., having appropriate leader sequences for the recombinant host and/or with an additional antigen sequence for another pathogen).
  • the present invention is also not limited by the ability of the resulting recombinant and mutant viruses to replicate.
  • the mutant and recombinant viruses of the present invention are replication competent. In this manner, a complimenting cell line is not necessary to produce adequate supplies of virus.
  • the present invention contemplates the administration of the recombinant and mutant viruses of the present invention to vaccinate an animal.
  • the present invention is not limited by the nature of administration to an animal.
  • the antigens used in the present invention can be conjugated to a vaccine carrier.
  • Vaccine carriers are well known in the art: for example, bovine serum albumin (BSA), human serum albumin (HSA) and keyhole limpet hemocyanin (KLH).
  • BSA bovine serum albumin
  • HSA human serum albumin
  • KLH keyhole limpet hemocyanin
  • a preferred carrier protein, rotavirus VP6, is disclosed in EPO Pub. No. 0259149.
  • the vaccines of the present invention carrying foreign genes or fragments can also be orally administered in a suitable oral carrier, such as in an enteric-coated dosage form.
  • Oral formulations include such normally-employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin cellulose, magnesium carbonate, etc.
  • Oral vaccine compositions may be taken in the form of solutions (e.g., water), suspensions, tablets, pills, capsules, sustained release formulations, or powders, containing from about 10% to about 95% of the active ingredient, preferably about 25% to about 70%.
  • An oral vaccine may be preferable to raise mucosal immunity in combination with systemic immunity, which plays an important role in protection against pathogens infecting the gastrointestinal tract.
  • the vaccine can be formulated into a suppository.
  • the vaccine composition will include traditional binders and carriers, such as polyalkaline glycols or triglycerides.
  • Such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w), preferably about 1% to about 2%.
  • Protocols for administering the vaccine composition(s) of the present invention to animals are within the skill of the art in view of the present disclosure. Those skilled in the art will select a concentration of the vaccine composition in a dose effective to elicit an antibody and/or T-cell mediated immune response to the antigenic fragment.
  • the timing of administration may also be important. For example, a primary inoculation preferably may be followed by subsequent booster inoculations if needed. It may also be preferred, although optional, to administer a second, booster immunization to the animal several weeks to several months after the initial immunization. To insure sustained high levels of protection against disease, it may be helpful to readminister a booster immunization to the animals at regular intervals, for example once every several years. Alternatively, an initial dose may be administered orally followed by later inoculations, or vice versa. Preferred vaccination protocols can be established through routine vaccination protocol experiments.
  • the dosage for all routes of administration of an in vivo recombinant virus vaccine depends on various factors, including the size of the patient, the nature of the infection against which protection is needed, the type of carrier and other factors, which can readily be determined by those of skill in the art.
  • a dosage of between 10 3 plaque forming units (pfu) and 10 s pfu can be used.
  • the present invention also includes a method for providing gene therapy to a mammal in need thereof to control a gene deficiency.
  • the methods comprises administering to said mammal a live recombinant bovine adenovirus containing a foreign nucleotide sequence encoding a non-defective form of a gene.
  • the foreign nucleotide sequence is either inco ⁇ orated into the mammalian genome or is maintained independently to provide expression of the required gene in the target organ or tissue.
  • examples of foreign genes nucleotide sequences or portions thereof that can be inco ⁇ orated for use in a conventional gene therapy include, but are not limited to, cystic fibrosis transmembrane conductance regulator gene, human minidystrophin gene, alpha 1-antitrypsin gene and others.
  • Methods for constructing, selecting and purifying recombinant adenovirus are detailed below in the materials, methods and examples below. The following serve to illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
  • Bovine adenovirus stocks were prepared by infecting tissue culture cells, Madin- Darby bovine kidney cells (MDBK), at a multiplicity of infection of 0.01 PFU/cell in Dulbecco's Modified Eagle Medium (DMEM) containing 2 mM glutamine, 100 units/ml penicillin, 100 units/ml streptomycin (these components are obtained from Sigma (St. Louis, MO) or an equivalent supplier, and hereafter are referred to as complete DME medium) plus 1% fetal bovine serum. After cytopathic effect was complete, the medium and cells were harvested. After one or two cycles of freezing (-70°C) and thawing (37°C), the infected cells were aliquot as 1ml stock and stored frozen at -70°C.
  • DMEM Dulbecco's Modified Eagle Medium
  • bovine adenovirus All manipulations of bovine adenovirus were made using strain 10 (ATCC VR- 313).
  • MDBK cells were infected at a multiplicity of infection (MOI) sufficient to cause extensive cytopathic effect before the cells overgrew. All incubations were carried out at 37°C in a humidified incubator with 5% CO : in air.
  • the cellular pellet was resuspended in 5 ml/roller bottle of TE buffer (10 mM Tris pH 7.5 and 1 mM EDTA) and swell on ice for 15 minutes.
  • NP40 Nonidet P-40.TM.; Sigma, St. Louis, MO
  • the sample was centrifuged for 10 minutes at 3000 ⁇ m in the cold to pellet the nuclei and remove cellular debris. The supernatant fluid was carefully transferred to a 30 ml Corex centrifuge tube.
  • SDS sodium dodecyl sulfate; stock 20%
  • SDS sodium dodecyl sulfate; stock 20%
  • 200 ⁇ l of proteinase-K at 10 mg/ml was added per roller bottle of sample, mixed, and incubated at 45°C for 1-2 hours.
  • the DNA pellet was dried briefly by vacuum (2-3 minutes), and resuspended in 2ml/roller bottle of infected cells of TE buffer (20 mM Tris pH 7.5, 1 mM EDTA). lO ⁇ l of RNaseA at lOmg/ml (Sigma. St. Louis, MO) was added and incubate at 37°C for one hour. 0.5ml of 5N NaCI and 0.75ml of 30% PEG was added and precipitated at 4°C overnight.
  • DNA in the sample was pelleted by spinning for 20 minutes to 8000 ⁇ m in an HB- 4 rotor at 4°c. Resuspend pellet in 2ml TES buffer (20mM Tris pH7.5, ImM EDTA and 0.2% SDS) and extracted with an equal volume of water-saturated phenol. The sample was spun in a clinical centrifuge for 5 minutes at 3000 ⁇ m to separate the phases. NaAc was added to the aqueous phase to a final concentration of 0.3M (stock solution 3M pH 5.2), and the nucleic acid precipitated at -70°C for 30 minutes after the addition of 2.5 volumes of cold absolute ethanol.
  • DNA in the sample was pelleted by spinning for 20 minutes to 8000 ⁇ m in an HB- 4 rotor at 5°C. The supernatant was carefully removed and the DNA pellet washed once with 25 ml of 80% ethanol. The DNA pellet was dried briefly by vacuum (2-3 minutes), and resuspended in 200 ⁇ l/roller bottle of infected cells of TE buffer (10 mM Tris pH 7.5, 1 mM EDTA). All viral DNA was stored at approximately 4°C.
  • PCR polymerase chain reaction
  • DNA sequencing was performed on the Applied Biosystems Automated Sequencer Model 373 A (with XL upgrade) per instructions of the manufacturer. Subclones were made to facilitate sequencing. Internal primers were synthesized on an ABI 392 DNA synthesizer or obtained commercially (Genosys Biotechnologies, Inc., The Woodlands, TX). Larger DNA sequences were built utilizing consecutive overlapping primers. Sequence across the junctions of large genomic subclones was determined directly using a full length genomic clone as template .Assembly, manipulation and comparison of sequences was performed with DNAstar programs. Comparisons with GenBank were performed using NCBI BLAST programs (Altschul, Stephen F., Thomas L. Madden, Alejandro A.
  • Recombinant BAN-1 genomes are constructed by homologous recombination according to the method of C. Chartier et al (1996) J. of Virology 70:805-4810.
  • a small, easily manipulated plasmid was constructed containing approximately 1000 base pairs each of the Left and Right ends of the BAV-1 genome. Homologous recombination between this vector and BAV-1 genomic D ⁇ A results in a plasmid containing the entire BAV-1 genome (adenoviral backbone vector).
  • This BAV-1 genomic plasmid may be used to generate recombinant genomes by linearization of the plasmid and recombination with homology D ⁇ As engineered to contain foreign D ⁇ A flanked by D ⁇ A derived from the desired BAV-1 insertion site. Note that in order to linearize the adenoviral backbone vector, an infrequent cutting enzyme must be located within the region analogous to the flanking BAV-1 sequences.
  • the adenoviral backbone vector contains a third Pvul site within the antibiotic resistance gene of the plasmid.
  • the Pvul site within the BamH C fragment is suitable for gene insertion sites within both the E3 and E4 regions. Therefore a partial Rvwl digestion of the adenoviral backbone vector will yield a sub population of molecules linearized at the Pvul site in the BamHl C fragment. These molecules may recombine with the homology DNA to generate a viable plasmid. Molecules linearized at the other two sites will not be able to recombine to generate viable plasmids.
  • E. coli BJ5183 recBC sbcBC The high competence of bacteria cells E. coli BJ5183 recBC sbcBC (D. Hanahan (1983) J. Mol. Biol. 166:557-580) is desired to achieve efficient recombination.
  • 10 nanograms of a restriction fragment containing foreign DNA flanked by the appropriate BAV insertion sequences (homology DNA) is mixed with 1 nanogram of linearized adenoviral backbone vector in a total volume of lO ⁇ l.
  • Low temperature (25-27°C) for growing small scale cultures (for screening carbenicillin resistant colonies) and subsequent large scale cultures (for isolation of large quantities of plasmid DNA) is essential.
  • Carb R colonies were first grown in 4-5 ml cultures at 25-27°C for two days.
  • Small scale DNAs were prepared using boiling method (J. Sambrook, et al., Molecular Cloning: A Laboratory Manual Second Edition, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)) and analyzed by DNA restriction analysis. To purify the DNA away from vector DNA concatemers the DNAs from correct clones were re-transform into DH10B (Life Technologies) cells. Analysis of bacterial colonies by DNA restriction analysis was repeated.
  • Glycerol stocks were prepared from the correct clones and stored at -70°C. Large quantities of plasmid DNA were prepared using Qiagen Plasmid Kit (Qiagen Inc.) or scale-up of boiling method from 250ml cultures which were inoculated with glycerol stock and grown at 37°C for one day.
  • MDBK Lipofectin
  • a transfection mix was prepared by adding several (4- 15) ⁇ g of BAV-1 viral DNA or linearized genome plasmid DNA and 50 ⁇ l of Lipofectin Reagent to 200 ⁇ l of serum-free medium according to the manufacturer's instruction.
  • the transfected virus stock was harvested by scraping cells in the culture and stored at -70°C. Plaque Purification of Recombinant Constructs
  • Monolayers of MDBK cells in 6cm or 10cm plates were infected with transfection stock, overlaid with nutrient agarose media and incubated for 5-10 days at 37°C. Once plaques have developed, single and well-isolated plaque was picked onto MDBK cells. After 5-10 days when 80-90% cytopathic effect was reached, the infected cells (PI stock) were harvested and stored at -70°C. This procedure was repeated one more time with PI stock.
  • Bovine Viral Diarrhea virus (BVDV) glvcoprotein 53 (g53) gene The bovine viral diarrhea g53 gene was cloned by a PCR cloning procedure essentially as described by Katz et al. (Journal of Virology 64: 1808-1811 (1990)) for the HA gene of human influenza.
  • Viral RNA prepared from BVD virus Singer strain grown in MDBK cells was first converted to cDNA utilizing an ohgonucleotide primer specific for the target gene. The cDNA was then used as a template for polymerase chain reaction (PCR) cloning (M.A.
  • PCR polymerase chain reaction
  • PCR Protocols A Guide to Methods and Applications, 84-91, Academic Press, Inc. San Diego (1990) of the targeted region.
  • the PCR primers were designed to inco ⁇ orate restriction sites which permit the cloning of the amplified coding regions into vectors containing the appropriate signals for expression in BAV-1.
  • One pair of oligonucleotides were required for the coding region.
  • the g53 gene coding region (amino acids 1-394) from the BVDV Singer strain (M.S.
  • the primary antibody was a mouse monoclonal antibody (Mab 6.12.2 from Dubovi, Cornell University, Ithaca, New York) diluted 1:100 with 5% non-fat dry milk in Tris-sodium chloride, and sodium Azide (TSA: 6.6 lg Tris- HC1, 0.97g Tris-base, 9.0g NaCI and 2.0g Sodium Azide per liter H2O).
  • TSA Tris-sodium chloride
  • the secondary antibody was a goat anti-mouse alkaline phosphatase conjugate diluted 1 : 1000 with TSA.
  • Plasmid 990-11 contains the Left and Right ends of the BAV-1 genome. These sequences were cloned by standard PCR methods (M. A. Innis, et al., PCR Protocols: A Guide To Methods And Applications, pp. 84-91, Academic Press, Inc., San Diego, CA (1990) using primers based on the sequences determined for the EcoRl A and BamHl F fragments respectively. Primers (1) 5'-3' GGCCTTAATTAACATCATCAATAATA TACGGAACAC [S ⁇ Q ID NO: 5] and (2) 5 '-3' GGAAGATCTTGAGCATGCAGAGC AATTCACGCCGGGTAT [S ⁇ Q ID NO: 6] were used to PCR the Left end of BAV-1.
  • Plasmid 990-11 was then constructed by cloning the BAV-1 end fragments into the polylinker of plasmid pPolyll (R. Lathe, J.L. Vilotte, and A.J. Clark, Gene, 57:193-201, 1997). The end fragments were cloned as a single R ⁇ cl fragment containing a unique Bgl ⁇ l site at their internal junction. Only the BamHl and EcoRl sites were retained from the polylinker. Plasmid 990-50 (adenoviral backbone vector)
  • Plasmid 990-50 was constructed according to the method described above (Construction of Recombinant BAV-1 Genomes in E. coli). Briefly, co-transformation of the Rg/II-linearized plasmid 990-11 and BAV-1 genomic DNA regenerated a stable circular plasmid containing the entire B AV- 1 genome. In this plasmid Pad sites flank the inserted BAV-1 genomic sequences. As R ⁇ cl is absent from BAV-1 genomic DNA, digestion with this enzyme allows the precise excision of the full-length BAV-1 genome from the plasmid 990-50.
  • Plasmid 996-80D contains DNA encompassing approximately 5945 base pairs of the Right end of the BAV-1 genome from which the EcoRl "G” and "H” fragments have been deleted and replaced with a synthetic Smal site.
  • the plasmid was constructed for the pu ⁇ ose of deleting a portion of the BAV-1 ⁇ 4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique Smal restriction enzyme site into which foreign DNA may be inserted.
  • the plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated.
  • the plasmid vector is derived from an approximately 2774 base pair Hindlll to RvwII restriction fragment of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • the synthetic linker sequence 5'-CTGTAGATCTGCGGCCGCGTTTAAACGT CGACAAGCTTCCC-3' [SEQ ID NO: 8] is ligated to the RvwII site of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • Fragment 1 is an approximately 1693 base pair Rstl to EcoRl sub fragment of the BAV-1 BamHl "C" fragment (positions 28241 to 29933 from S ⁇ Q ID NO: 3).
  • the synthetic linker sequence 5'-.A ⁇ TTCGAGCTCGCCCGGGCGAGCTCGA- 3' [S ⁇ Q ID NO: 9] is ligated to fragment 1 retaining EcoRl sites at both ends of the linker sequence.
  • Fragment 2 is an approximately 48 base pair EcoRl to BamHl restriction sub fragment of the BAV-1 BamHl "C” fragment (positions 31732 to 31779 from S ⁇ Q ID NO: 3).
  • Fragment 3 is the approximately 2406 base pair BAV-1 BamHl "F” fragment (positions 31780 to 34185 from S ⁇ Q ID NO: 3).
  • the synthetic linker sequence 5'-GACTCTAGGGGCGGGGAGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the Hindlll site of pSP64 (Promega Co ⁇ oration, Madison, WI). Note that the BAV-1 sequences can be cut out of this plasmid via the Notl restriction sites located in the flanking synthetic linker sequences.
  • Plasmid 1004-73.16.14 contains a recombinant BAV-1 genome from which the EcoRl "G” and “H” fragments have been deleted and replaced by a synthetic Smal site (5'-GAATTCGAGCTCGCCCGGGCGAGCTCGAATTC-3') [S ⁇ Q ID NO: 11].
  • This plasmid may be used to generate recombinant bovine adenovirus vectors with deletion and gene insertions at the ⁇ 4 region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 996-80D and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Pvul.
  • Plasmid 1004-07.16 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, CA), into the unique Smal site of plasmid 996-80D.
  • the BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).
  • Plasmid 1004-40 contains a recombinant BAV-1 genome from which the EcoRl G and H fragments have been deleted.
  • the gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in ⁇ . coli).
  • the homology D ⁇ A is derived from the Notl insert of plasmid 1004-17.16 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • Plasmid 1018-14.2 contains DNA flanking the E3 region of BAV-1, from which a specific region of this sequence flanked by Sail and BamHl sites (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted.
  • the plasmid was constructed for the pu ⁇ ose of deleting the corresponding portion of the BAV-1 E3 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique Hindlll restriction enzyme site into which foreign DNA may be inserted.
  • the plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated.
  • the plasmid vector is derived from an approximately 2774 base pair HindU ⁇ l to R ⁇ /II restriction fragment of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • the synthetic linker sequence 5'-CTGTAGATCTG CGGCCGCGTTTAAACG-3' [SEQ ID NO: 12] is ligated to the RvwII site of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • Fragment 1 is an approximately 2665 base pair Sail to Sail sub fragment (positions 22999 to 25663 from SEQ ID NO: 3) of the BAV-1 BamHl B fragment. Fragment 1 is ligated to the upstream synthetic sequence retaining the Sail site at the junction.
  • Fragment 1 contains a unique Aval site (positions 25317 to 25322 from SEQ ID NO: 3). Fragment 1 is oriented such that the unique Aval site is closer (406 base pairs) to fragment 2 than to the plasmid vector.
  • the synthetic linker sequence 5'- TCGACAAGCTTCCC-3' [SEQ ID NO: 13] is ligated to second end of fragment 1 again retaining the Sail site at the junction.
  • Fragment 2 is an approximately 4223 base pair BamHl to Hindlll restriction sub fragment of the BAV-1 BamHl C fragment (positions 26851 to 31073 from SEQ ID NO: 3). Note that the end of both fragments were blunt end by treatment with T4 polymerase.
  • the synthetic linker sequence 5'-CCCGGG AGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 14] is ligated between fragment 2 and the Hindlll site of pSP64 (Promega Co ⁇ oration, Madison, WI). Note that the Hindlll site is not retained.
  • the BAN-1 sequences can be cut out of this plasmid via the Notl restriction sites located in the flanking synthetic linker sequences.
  • Plasmid 1018-75 contains a recombinant BAN-1 genome from which a specific region of the BamHl "B" fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted.
  • This plasmid may be used to generate recombinant bovine adenovirus vectors with deletions and gene insertions at the E3 region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1018-14.2 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • Plasmid 1018-23C15 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen, Carlsbad, CA), into the unique Hindlll site of plasmid 1018-14.2.
  • the BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).
  • Plasmid 1018-42 contains a recombinant BAV-1 genome from which a specific region of the BamHl "B" fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted.
  • the gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1018-23 C15 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Pvul.
  • Plasmid 1018-45 contains a recombinant BAV-1 genome from which a specific region of the BamHl "B" fragment (positions 25664 to 26840 from SEQ ID NO: 3) has been deleted.
  • Plasmid 1018-45 contains DNA flanking the E3 region of BAV-1, from which a specific region of this sequence flanked by EcoRl and BamHl sites (positions 25765 to
  • the plasmid was constructed for the pu ⁇ ose of deleting the corresponding portion of the BAV-1 E3 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique Hindlll restriction enzyme site into which foreign DNA may be inserted.
  • the plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated.
  • the plasmid vector is derived from an approximately 2774 base pair Hindl ⁇ l to Rvzdl restriction fragment of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • the synthetic linker sequence 5'-CTGTAGATC TGCGGCCGCGTTTAAACG-3' [SEQ ID NO: 12] is ligated to the RvuII site of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • Fragment 1 is an approximately 1582 base pair S ⁇ cl to EcoRl sub fragment (positions 24183 to 25764 from SEQ ID NO: 3) of the BAV-1 R ⁇ wHI B fragment. Fragment 1 is ligated to the upstream synthetic sequence. The fragment was blunted end with T4 polymerase treatment so neither the S ⁇ cl nor EcoRl sites are retained. Fragment 1 contains a unique Aval site (positions 25317 to 25322 from S ⁇ Q ID NO: 3).
  • Fragment 1 is oriented such that the unique v ⁇ l site is closer (406 base pairs) to fragment 2 than to the plasmid vector.
  • the synthetic linker sequence 5'- CAAGCTTCCC-3' [S ⁇ Q ID NO: 17] is ligated to second end of fragment 1 again retaining the Sail site at the junction.
  • Fragment 2 is an approximately 4223 base pair BamHl to Hindlll restriction sub fragment of the BAV-1 BamHl C fragment (positions
  • GAGTTTAAACGCGGCCGCAGATCTAGCT-3' [S ⁇ Q ID NO: 14] is ligated between fragment 2 and the Hindlll site of pSP64 (Promega Co ⁇ oration, Madison, WI). Note that the Hindlll site is not retained.
  • the BAV-1 sequences can be cut out of this plasmid via the Notl restriction sites located in the flanking synthetic linker sequences. Plasmid 1028-03
  • Plasmid 1028-03 contains a recombinant BAV-1 genome from which a specific region of the BamHl "B" fragment (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted.
  • This plasmid may be used to generate recombinant bovine adenovirus vectors with deletions and gene insertions at the E3 region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1018-45 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Pvul.
  • Plasmid 1028-77 was constructed by inserting a BVDV g53 gene, engineered to be under control of the human cytomegalovirus immediate early promoter (Invitrogen,
  • the BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).
  • Plasmid 1038-16 contains a recombinant BAV-1 genome from which a specific region of the BamHl "B" fragment (positions 25765 to 26850 from SEQ ID NO: 3) has been deleted.
  • the gene for the bovine viral diarrhea virus (BVDV) glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1028-77 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Pvul.
  • Plasmid 1054-93 contains D ⁇ A derived from the E4 region of BAV-1.
  • the sequence corresponding to positions 33614 to 33725 from SEQ ID NO: 3 has been deleted and replaced with a synthetic Pstl site.
  • the plasmid was constructed for the pu ⁇ ose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique Pstl restriction enzyme site into which foreign DNA may be inserted.
  • the plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining restriction fragments from the following sources with the synthetic DNA sequences indicated.
  • fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment.
  • the plasmid vector is derived from an approximately 2774 base pair Hindlll to RvwII restriction fragment of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • the synthetic linker sequence 5'-CTGTAGATCTGCGG CCGCGTTTAAACGTCGACAAGCTTCCC-3' [SEQ ID NO: 8] is ligated to the RvwII site of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • Fragment 1 is an approximately 3538 base pair R to BamHl sub fragment of the BAV-1 R ⁇ mHI "C" fragment positions 28241 to 31779 from SEQ. ID NO.3.
  • Fragment 1 is ligated to the 3' end of the synthetic linker sequence [SEQ ED NO: 8].
  • Fragment 2 is an approximately 1832 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 31780 to 33613 from SEQ ID NO: 3). Fragment 2 is ligated to fragment 1 such that the BamHl site at the junction is retained.
  • the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 2.
  • Fragment 3 is an approximately 460 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 33725 to 34185 from SEQ ID NO: 3).
  • Fragment 3 is ligated to the 3' end of the synthetic linker sequence 5'- CTGCAG-3'.
  • the synthetic linker sequence 5'-GACTCTAGGGGCGGGGAGTTT AAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the Hindlll site of pSP64 (Promega Co ⁇ oration, Madison, WI). Note that the BAV-1 sequences can be cut out of this plasmid via the Notl restriction sites located in the flanking synthetic linker sequences.
  • Plasmid 1055-38 contains D ⁇ A derived from the E4 region of BAV-1.
  • the sequence encoding nORF13 (see Table 1) has been deleted and replaced with a synthetic Pstl site.
  • the plasmid was constructed for the pu ⁇ ose of deleting a portion of the BAV-1 E4 region. It may also be used to insert foreign DNA into recombinant BAV-1 genomes. It contains a unique Pstl restriction enzyme site into which foreign DNA may be inserted.
  • the plasmid may be constructed utilizing standard recombinant DNA techniques (see above Molecular Biological Techniques) by joining DNA fragments from the following sources with the synthetic DNA sequences indicated.
  • fragments derived from BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment.
  • the plasmid vector is derived from an approximately 2774 base pair Hindlll to RvwII restriction fragment of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • the synthetic linker sequence 5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC- 3' [SEQ ID NO: 8] is ligated to the Pvull site of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • Fragment 1 is an approximately 1282 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 28240 to 29522 from SEQ ID NO: 3).
  • Fragment 1 is ligated to the 3' end of the synthetic linker sequence indicated above [SEQ ID NO: 8].
  • the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 1.
  • Fragment 2 is an approximately 1372 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 30407 to 31779 from SEQ ID NO: 3).
  • Fragment 2 is ligated to the 3' end of the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4].
  • Fragment 3 is the approximately 2406 base pair BAV-1 R ⁇ wHl "F" fragment (positions 31779 to 34185 from SEQ ID NO: 3).
  • Fragment 3 is ligated to the 3' end of fragment 2.
  • the synthetic linker sequence 5'-GACTCTAGGGGCGGGGAGTTTA AACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the Hindlll site of pSP64 (Promega Co ⁇ oration, Madison, WI). Note that the BAV-1 sequences can be cut out of this plasmid via the Notl restriction sites located in the flanking synthetic linker sequences.
  • Plasmid 1055-52 contains a recombinant BAV-1 genome from which a portion of the E4 region (positions 29522-30407 from SEQ ID NO: 3) has been deleted and replaced by a synthetic Pstl site (5'-CTGCAG-3') [SEQ ID NO: 4].
  • This plasmid may be used to generate recombinant bovine adenovirus vectors with gene insertions and/or a deletion at the E4 region.
  • the plasmid may be constructed according to the method above
  • the homology DNA is derived from the Notl insert of plasmid 1055-38 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • Plasmid 1055-47 was constructed by inserting a BVDV g53 gene into the unique
  • the BVDV coding region was inserted in the reverse complimentary orientation such that it is transcribed by the E4 region promoter located at the right end of the genome.
  • the BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).
  • Plasmid 1055-56 contains a recombinant BAV-1 genome from which the BAV-1 's sequence from positions 29522 to 30407 [SEQ ID NO: 3] has been deleted.
  • the gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1055-47 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • Plasmid 1055-93 contains D ⁇ A derived from the E4 region of BAV-1.
  • the sequence encoding nORF13 (see Table 1) has been deleted and replaced with a synthetic Rstl site.
  • the plasmid was constructed for the pu ⁇ ose of deleting a portion of the BAV-1
  • E4 region It may also be used to insert foreign D ⁇ A into recombinant BAV-1 genomes.
  • the plasmid may be constructed utilizing standard recombinant D ⁇ A techniques (see above Molecular Biological Techniques) by joining D ⁇ A fragments from the following sources with the synthetic D ⁇ A sequences indicated. Note that fragments derived from
  • BAV-1 DNA are ligated in the orientation indicated by the positions given for each fragment.
  • the plasmid vector is derived from an approximately 2774 base pair Hindlll to RvwII restriction fragment of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • the synthetic linker sequence 5'-CTGTAGATCTGCGGCCGCGTTTAAACGTCGACAAGCTTCCC- 3' [SEQ ID NO: 8] is ligated to the RvwII site of pSP64 (Promega Co ⁇ oration, Madison, WI).
  • Fragment 1 is an approximately 1282 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 28240 to 29522 from SEQ ID NO: 3).
  • Fragment 1 is ligated to the 3' end of the synthetic linker sequence indicated above [SEQ ID NO: 8].
  • the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4] is ligated to fragment 1.
  • Fra ment 2 is an approximately 1372 base pair PCR fragment containing sequences derived from the BAV-1 genome (positions 30403 to 31779 from SEQ ID NO: 3).
  • Fragment 2 is ligated to the 3' end of the synthetic linker sequence 5'-CTGCAG-3' [SEQ ID NO: 4].
  • Fragment 3 is the approximately 2406 base pair BAV-1 BamHl "F" fragment (positions 31779 to 34185 from SEQ ID NO: 3).
  • Fragment 3 is ligated to the 3' end of fragment 2.
  • the synthetic linker sequence 5'-GACTCTAGGGGCGGG GAGTTTAAACGCGGCCGCAGATCTAGCT-3' [SEQ ID NO: 10] is ligated between fragment 3 and the Hindlll site of pSP64 (Promega Co ⁇ oration, Madison, WI). Note that the BAV-1 sequences can be cut out of this plasmid via the Notl restriction sites located in the flanking synthetic linker sequences.
  • Plasmid 1064-26 contains a recombinant BAV-1 genome from which a portion of the E4 region (positions 33613 to 33725 from SEQ ID NO: 3) has been deleted and replaced by a synthetic Rstl site (5'-CTGCAG-3') [SEQ ID NO: 4].
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1054-93 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • Plasmid 1066-29 contains a recombinant BAV-1 genome from which a portion of the E4 region (positions 33613 to 33725 from SEQ ID NO: 3) has been deleted and replaced by a synthetic Rstl site (5'-CTGCAG-3') [SEQ ID NO: 4].
  • the plasmid may be constructed
  • Plasmid 1066-29 was constructed by inserting a BVDV g53 gene into the unique
  • the BVDV coding region was inserted in the reverse complimentary orientation such that it is trans*ibed by the E4 region promoter located at the right end of the genome.
  • the BVDV g53 gene was isolated according to the method above (Cloning of Bovine Viral Diarrhea virus g53 gene).
  • Plasmid 1066-44 contains a recombinant BAV-1 genome from which a portion of the E4 region (positions 29523 to 30403 from SEQ ID NO: 3) has been deleted and replaced by a synthetic Pstl site (5'-CTGCAG-3') [SEQ ID NO: 4].
  • This plasmid may be used to generate recombinant bovine adenovirus vectors with gene insertions and/or a deletion at the E4 region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1055-93 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • Plasmid 1066-51 contains a recombinant BAV-1 genome from which the BAV-l 's sequence from positions 30403 to 29523 [SEQ ID NO: 3] has been deleted.
  • the gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region.
  • the plasmid may be constructed according to the method above (Construction of Recombinant BAV-1 Genomes in E. coli).
  • the homology DNA is derived from the Notl insert of plasmid 1066-29 and the adenoviral backbone vector plasmid 990-50 is linearized by partial digestion with the Rvwl.
  • This sequence contains 43 methionine initiated open reading frames (ORF) of greater than or equal to 110 amino acids (excluding smaller nested ORFs). All 43 ORFs were compared to the current version of the Genbank protein subset as described in the methods above (DNA Sequencing). Based on the BLAST analysis 28 of the ORFs (ORFS 1-28) exhibited significant homology to one or more other virus genes. Fifteen ORFs showed no significant homology to virus genes in the current version of Genbank (nORFs 1-15). Table 1 shows that the ORFs have a widely varying homology to adenovirus genes from several different species.
  • AvAd Avian adenovirus
  • HuAD Human Adenovirus
  • CAV Canine Adenovirus
  • SAV swine adenovirus
  • OvAd sheep adenovirus
  • the E3 and E4 gene regions of BAV-1 can defined by homology to genes from the corresponding regions of the human adenoviruses.
  • Evans et al (Virology 244:173-185) define the BAV-1 E3 gene region as bound by the TATA box sequence at positions 25362 to 25365 and the polyadenlyation signal at positions 27291 to 27296.
  • Analysis of the gene homologies from Table 1 indicates that the E4 region of BAV-1 is bounded by the polyadenylation signal at positions 29059 to 29065 and the TATA box sequence at positions 34171 to 34174.
  • BAV-1 exhibits a complex sequence organization at its left and right ends.
  • the genome exhibits an inverted terminal repeat (ITR) of 578 base pairs.
  • ITR inverted terminal repeat
  • a sequence of 419 base pairs is repeated twice at the left end of the genome.
  • a single inverted copy of this repeat occurs at the right end of the genome.
  • the two 419 base pair repeats a the left end of the genome are followed by a 424 bp sequence that appears as an inverted copy upstream of the 419 base pair sequence at the right end of the genome.
  • the sequence of the BAV-1 genome is useful for the construction of recombinant BAV-1 viral vectors.
  • this information may be used by analogy to human adenovirus vector systems to predict non-essential regions that may be used as gene insertion sites.
  • the information may also be used to predict intergenic regions, which may also be used as gene insertion sites.
  • Example 2 Method of constructing recombinant BAV-1 viral vectors
  • plasmid 990-50 DNA derived from this plasmid was transfected as described above into MDBK cells. Progeny viruses recovered from independent transfection stocks were amplified on MDBK cells and analyzed for growth characteristics, virus production yields, and DNA restriction patterns. In all cases, plasmid 990-50 derived adenovirus (S-BAV-002) was indistinguishable from wild-type BAV-1.
  • This procedure can be used to generate bovine adenovirus vectors expressing useful foreign DNA sequences.
  • the procedure may also be used to delete genomic sequences from the bovine adenovirus vector.
  • the production of bovine adenovirus vectors bearing a bovine diarrhea virus (BVDV) glycoprotein E2 (g53) expression cassette and deletions in E4 and E3 regions of BAV-1 respectively are described below (see examples 4-6).
  • Example 3 Preparation of recombinant adenovirus vector S-BAV-003
  • S-BAV-003 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans the EcoRl H and G fragments. This deletion removes all or a major portion of ORFs 25-27 and nORF13.
  • S-BAV-003 was created by transfection of DNA derived from plasmid 1004- 73.16.14 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamHl, EcoRl, and Smal DNA restriction patterns. This analysis indicates that the EcoRl G and H fragments have been deleted and a Smal site has been introduced into the genome. S- BAV-003 was also shown to grow to similar titers as the wild type BAV-1.
  • S-BAV-004 is a BAV-1 virus that has a deletion in the E4 region of the genome.
  • BVDV glycoprotein 53 glycoprotein 53 (g53) (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.
  • S-BAV-004 was created by transfection of DNA derived from plasmid 1004-40 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque
  • S-BAV-005 is a BAV-1 virus that has a deletion in the E3 region of the genome.
  • ORFs 21 and 22 A poly linker sequence (5'-TCGACAAGCTTCCC-3') [SEQ ID NO:
  • S-BAV-005 was created by transfection of DNA derived from plasmid 1018-75 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs).
  • S-BAV-006 is a BAV-1 virus that has a deletion in the E3 region of the genome.
  • the smaller Sail to BamHl sub fragment of BamHl fragment B (positions 25664 to 26850 from SEQ ID NO: 3) has been deleted. This deletion removes a major portion of ORFs 21 and 22.
  • the gene for the BVDV g53 (amino acids 1-394) under the control of the HCMV immediate early promoter was inserted into the deleted region.
  • S-BAV-006 was created by transfection of DNA derived from plasmid 1018-42 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs).
  • Example 7 Preparation of recombinant adenovirus vector S-BAV-007
  • S-BAV-005 is a BAV-1 virus that has a deletion in the E3 region of the genome.
  • the smaller EcoRl to BamHl sub fragment of BamHl fragment "B" (positions 25765 to 26850 from S ⁇ Q ID NO: 3) has been deleted. This deletion removes a major portion of ORFs 21 and 22.
  • S-BAV-007 was created by transfection of DNA derived from plasmid 1018-45 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamHl, EcoRl, and Xbal DNA restriction patterns. S-BAV-007 was also shown to grow to similar titers as the wild type BAV-1.
  • Example 8 Preparation of recombinant adenovirus vector S-BAV-014
  • S-BAV-014 is a BAV-1 virus that has a deletion in the E3 region of the genome.
  • S-BAV-014 was created by transfection of DNA derived from plasmid 1038-16 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Expression of the BVDV g53 gene was assayed by the Western Blotting Procedure. S-BAV-014 exhibited expression of a correct size protein with specific reactivity to BVDV g53 antibody.
  • S-BAV-022 is a BAV-1 virus that has a deletion in the E4 region of the genome.
  • CTGCAG-3' containing a Rstl site was inserted into the deletion.
  • S-BAV-022 was created by transfection of DNA derived from plasmid 1055-52 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque
  • S-BAV-022 was also shown to grow to similar titers as the wild type BAV-1.
  • S-BAV-023 is a BAV-1 virus that has a deletion in the E4 region of the genome.
  • BVDV g53 (amino acids 1-394) was inserted into the deleted region.
  • the BVDV g53 gene was under the control of E4 promoter(s).
  • S-BAV-023 was created by transfection of DNA derived from plasmid 1055-56 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Expression of the BVDV g53 gene was assayed by the Western Blotting Procedure.
  • S-BAV-006 exhibited expression of a correct size protein with specific reactivity to BVDV g53 antibody. Expression of the BDV g53 foreign antigen in S-BAV-023 establishes the utility of the BAV-1 E4 region promoter for transcription of foreign genes in vector systems.
  • Example 11 Preparation of recombinant adenovirus vector S-BAV-025
  • S-BAV-025 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 33614-33725 of SEQ. ID NO: 3. A linker sequence 5'- CTGCAG-3' containing a Rstl site was inserted into the deletion.
  • S-BAV-025 was created by transfection of DNA derived from plasmid 1064-26 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs). Progeny viruses derived from independent transfection stocks were amplified on MDBK cells and analyzed for BamHl, EcoRl, and PstR DNA restriction patterns. S-BAV-025 was also shown to grow to similar titers as the wild type BAV-1.
  • Example 12 Preparation of recombinant adenovirus vector S-BAV-026
  • S-BAV-026 is a BAV-1 virus that has a deletion in the E4 region of the genome. This deletion spans from positions 29523-30403 of SEQ ID NO: 3. A linker sequence 5'- CTGCAG-3' containing a Pstl site was inserted into the deletion.
  • S-BAV-026 was created by transfection of DNA derived from plasmid 1066-44 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque
  • S-BAV-027 is a BAV-1 virus that has a deletion in the E4 region of the genome.
  • This deletion spans from positions 29523-30403 of SEQ ID NO: 3.
  • the gene for the BVDV g53 (amino acids 1-394) was inserted into the deleted region.
  • the BVDV g53 gene was under the control of E4 promoter(s).
  • S-BAV-027 was created by transfection of DNA derived from plasmid 1066-51 according to the method described above (Method of constructing recombinant BAV-1 viral vectors). The resulting viruses were purified according to the method above (Plaque Purification of Recombinant Constructs).
  • Example 14 Shipping Fever Vaccine Shipping fever or bovine respiratory disease (BRD) complex is manifested as a result of a combination of infectious diseases of cattle and additional stress related factors (CA. Hje ⁇ e, The Bovine Respiratory Disease Complex. In: Current Veterinary Therapy 2: Food Animal Practice. Ed. by J.L. Howard, Philadelphia, W.B. Saunders Co., 1986, pp 670-680.). Respiratory virus infections, augmented by pathophysiological effects of stress, alter the susceptibility of cattle to Pasteurella organisms that are normally present in the upper respiratory tract by a number of mechanisms. Control of the viral infections that initiate BRD as well as control of the terminal bacterial pneumonia is essential to preventing the disease syndrome (F. Fenner, et al., "Mechanisms of Disease Production: Acute Infections", Veterinary Virology. Academic Press, Inc., Orlando, Florida, 1987, pp 183-202.).
  • infectious bovine rhinotracheitis virus infectious bovine rhinotracheitis virus
  • parainfluenza type 3 virus bovine viral diarrhea virus
  • bovine respiratory syncytial virus bovine respiratory syncytial virus
  • Pasteurella haemolytica infectious bovine rhinotracheitis virus
  • bovine viral diarrhea virus bovine viral diarrhea virus
  • bovine respiratory syncytial virus bovine respiratory syncytial virus
  • Pasteurella haemolytica F. Fenner, et al., "Mechanisms of Disease Production: Acute Infections", Veterinary Virology. Academic Press, Inc., Orlando, Florida, 1987, pp 183-202.
  • An extension of this approach is to combine vaccines in a manner so as to control the array of disease pathogens with a single immunization.
  • mixing of the various BAV-1 vectored antigens IBR, BRSV, PI-3, BVDV and P. Haemolytica
  • conventionally derived vaccines killed virus, inactivated

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

L'invention concerne des vecteurs viraux. Selon un mode de réalisation, cette invention concerne des adénovirus bovins recombinants et mutants ayant une délétion et/ou une insertion d'ADN dans la région 4 de gène précoce (E4). Selon un autre mode de réalisation, cette invention a trait à des virus d'adénovirus 1 bovins mutants et recombinants, possédant une délétion et/ou une insertion d'ADN dans la région 3 de gène précoce (E3). La présente invention porte également sur l'utilisation de vecteurs viraux dans le cadre de vaccination, de thérapie génique et d'autres applications dérivées.
EP00921951A 1999-04-09 2000-04-07 Adenovirus recombinants et mutants derives de l'adenovirus type 1 bovin Withdrawn EP1169464A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US28993099A 1999-04-09 1999-04-09
US289930 1999-04-09
PCT/US2000/009459 WO2000061773A1 (fr) 1999-04-09 2000-04-07 Adenovirus recombinants et mutants derives de l'adenovirus type 1 bovin

Publications (1)

Publication Number Publication Date
EP1169464A1 true EP1169464A1 (fr) 2002-01-09

Family

ID=23113786

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00921951A Withdrawn EP1169464A1 (fr) 1999-04-09 2000-04-07 Adenovirus recombinants et mutants derives de l'adenovirus type 1 bovin

Country Status (7)

Country Link
EP (1) EP1169464A1 (fr)
JP (1) JP2002541815A (fr)
AU (1) AU4220600A (fr)
BR (1) BR0009666A (fr)
CA (1) CA2365911A1 (fr)
MX (1) MXPA01010148A (fr)
WO (1) WO2000061773A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7906311B2 (en) 2002-03-20 2011-03-15 Merial Limited Cotton rat lung cells for virus culture
AU2003239589A1 (en) 2002-05-24 2003-12-12 Schering-Plough Ltd. Eta-1 gene and methods for use

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5820868A (en) * 1993-12-09 1998-10-13 Veterinary Infectious Disease Organization Recombinant protein production in bovine adenovirus expression vector system
FR2725726B1 (fr) * 1994-10-17 1997-01-03 Centre Nat Rech Scient Vecteurs viraux et utilisation en therapie genique
AU737243B2 (en) * 1996-07-03 2001-08-16 Merial, Inc. Recombinant canine adenovirus (CAV) containing exogenous DNA

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0061773A1 *

Also Published As

Publication number Publication date
CA2365911A1 (fr) 2000-10-19
MXPA01010148A (es) 2003-07-14
JP2002541815A (ja) 2002-12-10
AU4220600A (en) 2000-11-14
BR0009666A (pt) 2002-02-05
WO2000061773A1 (fr) 2000-10-19

Similar Documents

Publication Publication Date Title
US20090274724A1 (en) Novel recombinant and mutant adenoviruses
USRE40930E1 (en) Porcine adenovirus type 3 genome
US6387376B1 (en) Recombinant vaccine containing feline herpes virus type 1 particularly for treating feline infectious peritonitis
US20100008947A1 (en) Porcine adenovirus e1 and e4 regions
JP2002537766A (ja) ブタ組換えアデノウイルスをベースとするウイルス性ベクターおよびワクチン
JP2000512844A (ja) ベクターとして鳥類の感染性喉頭気管炎ウイルスを用いた鳥類用組換え生ワクチン
JP2010187679A (ja) 新規な組換えヘルペスウイルスおよび変異体ヘルペスウイルス
AU2002363489A1 (en) Porcine adenovirus E1 and E4 regions
EP1169464A1 (fr) Adenovirus recombinants et mutants derives de l'adenovirus type 1 bovin
Baxi et al. Mutational analysis of early region 4 of bovine adenovirus type 3
WO2011147002A1 (fr) Vaccins contre le prrsv à base de l'adénovirus porcin 3
US7264818B2 (en) BAV packaging regions and E1 transcriptional control regions
AU684046B2 (en) Recombinant herpesvirus of turkeys and uses thereof
AU684046C (en) Recombinant herpesvirus of turkeys and uses thereof
IE922043A1 (en) CCV vaccine
AU2004200229A1 (en) Porcine adenovirus type 3 genome

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011105

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO PAYMENT 20011105;SI PAYMENT 20011105

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031104