Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
  • G01N33/576—Immunoassay; Biospecific binding assay; Materials therefor for hepatitis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2730/00—Reverse transcribing DNA viruses
  • C12N2730/00011—Details
  • C12N2730/10011—Hepadnaviridae
  • C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
  • C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N2500/00—Screening for compounds of potential therapeutic value
  • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Definitions

• the present invention relates to the fields of molecular biology and virology and to a cell line facilitating study of a virus and identification of efficacious antiviral agents and, more particularly, to HepG2 cells which are stably transfected with the hepatitis C virus and to use of a cell line for effective study of the hepatitis C virus or a hepatitis C virus mutant and for identification of efficacious therapeutic agents for such viruses or mutant viruses.
• HCV hepatitis , cirrhosis and hepatocellular carcinoma
• Primary human and chimpanzee hepatocytes are susceptible to HCV, and replicate the virus, but primary hepatocytes are difficult to obtain, and usually survive less than two weeks in culture. The same restrictions apply when hepatocytes are harvested from already infected individuals.
• Several cell lines that appear to be susceptible to HCV infection have not consistently generated stable baseline levels of virus.
• Full length HCV RNA has been successfully transfected into a number of cell lines, but replicative levels are not stable and become undetectable within a few weeks.
• the present invention relates to HepG2 cells stably transfected with a clone of full length HCV cDNA.
• the present invention relates to a cell line stably expressing a wild type hepatitis C virus.
• Another aspect of the present invention is a method of identifying a therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus replication, comprising: contacting a cell line stably expressing said hepatitis C virus with said therapeutic agent and measuring changes in said hepatitis C virus replication.
• Yet another aspect of the present invention is a method of identifying a therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus maturation, comprising: contacting a cell line stably expressing said hepatitis C virus with said therapeutic agent and measuring changes in said hepatitis C virus maturation.
• Another aspect of the present invention is a method of identifying an efficacy of a cloned therapeutic agent, comprising: inserting a therapeutic gene sequence into a stably producing hepatitis C virus cell line and measuring viral replication and maturation.
• Another aspect of the present invention is a cell line stably expressing a mutated hepatitis C virus.
• Yet another aspect of the present invention is a method of studying viral replication and maturation, comprising: a) growing said cell line of claim 5 wherein said mutated hepatitis C virus is expressed; b) growing said cell line of claim 1 wherein said wild type hepatitis C virus is expressed; c) determining an amount of viral replication and maturation in step a); d) determining an amount of viral replication and maturation in step b); and e) analyzing an effect of a mutation in said mutated hepatitis C virus by comparing said viral replication and maturation of said mutated hepatitis C virus determined in step c) to that of wild type hepatitis C virus determined in step d).
• Figure 2 RT/PCR using in vitro generated HCV RNA template with strand specific primers.
• Figure 3 Strand specific RT/PCR for HCV in HepG2-HCV cell lysates
• Figure 4 HCV RNA in cesium chloride density gradient fractions from HepG2 cells stably transfected with HCV cDNA.
• Figure 6. The presence of HCV RNA in the blood of immunodeficient mice injected with HepG2-HCV or control cells.
• Figure 7. Effect of actinomycin D treatment upon steady state levels of HCV RNA compared to cellular RNA
• HCV cDNA (pRc/CMV/HCV9.4, Takehara, T., et al., Hepatology 21 :746-751, 1995) to make it full length, and then the sequence of the entire cDNA confirmed.
• HCV expression is under control of the CMV early-intermediate promoter.
• full length HCV cDNA was excised from pRc/CMV/HCV with Hind ⁇ ll. The insert (9.6 kb) was then subcloned into pZErO-1.1 (InVitrogen), which is a vector that lacks the CMV promoter.
• HCV clone The sequence of the HCV clone was identical to that reported earlier (Takehara, T., et al., Hepatology 21:746-751, 1995).
• the full length clone in pRc/CMV/HCV or pZErO-1.1 was then stably transfected into HepG2 cells (Figure 1), and the cultures selected for 3 weeks in G418 or zeocin, respectively. No zeocin resistant colonies were recovered. G418 resistant cultures were assayed for the presence of HCV production.
• RNA by adding a plus strand "tagged" primer TAG-MF7 (5' TCATGGTGGCGAATAA 92 GTCTTCACGCAGAAAGCGTCTAGCCAT” 8 3',
• the "tag” is 16 nucleotides that are unrelated to the HCV sequence (underlined sequences in SEQ. ID. NO: 1), so that following reverse transcription the cDNA generated has a tag sequence at the extreme 5' end.
• PCR was conducted by addition of the plus strand "tagged" primer and a minus strand primer MF8 (5'
• a specific minus (SEQ. ID. NO: 2) or plus sense primer MF7 (5' 92 GTCTTCACGCAGAAAGCGTCTAGCCAT 118 3', SEQ. ID. NO: 3) within the 5' untranslated region (nts 92-118) was used initially for asymmetric single strand synthesis at high temperature (55°C).
• this primer had a 5' extension of HCV unrelated (tag) sequences (16 nt) so that the single stranded cDNA generated had tag sequences at the extreme 5' end.
• Ten percent of the cDNA was then transferred to a fresh tube containing a complementary HCV primer.
• the latter primer was used to direct PCR amplification exclusively to the single stranded cDNA.
• Lane 1 is the reaction starting with minus strand primer without reverse transcriptase.
• Lane 2 is the same reaction with reverse transcriptase.
• the results reflect the presence of plus strand HCV RNA.
• Figure 3, lane 3 When the same experiment was performed with a tagged plus strand primer in the reverse transcriptase step, the results without ( Figure 3, lane 3) or with ( Figure 3, lane 4) reverse transcriptase yielded RT/PCR products that reflect the presence of HCV minus strand RNA.
• HepG2 cells stably transfected with HCV cDNA.
• Lysates were prepared from an equal number of HCV plus [+] and minus [-] HepG2 cells by gentle disruption using Dounce homogenization. The lysates were clarified and layered on top of preformed CsCl gradients (1.05-1.40 gms/ml) in 5 ml heat sealable tubes, and the samples centrifuged to equilibrium at 10°C, for 70 hrs at 68,000 rpm in a table top ultracentrifuge (Beckman) ( Figure 4).
• the probe was made by PCR that incorporated biotinylated bases into the products. Hybridization was detected by the addition of horseradish peroxidase conjugated streptavidin, and finally by addition of the enhanced chemiluminescense (ECL) reagent (Amersham) ( Figure 4).
• ECL enhanced chemiluminescense
• HCV RNA is encapsidated
• HCV RNA To test for encapsidated HCV RNA, cell lysates were prepared in non-ionic buffer containing 0.1 % NP40 + 0.1 % Tween 20, clarified by centrifugation and then centrifuged to equilibrium in CsCl gradients, as described supra. When gradient fractions were assayed for HCV RNA by RT/PCR, signals were observed only at a density characteristic of HCV (1.1 gms/ml), implying encapsidation ( Figure 4). The HCV RNA in these fractions was RNase resistant. Anti-HCV E1/E2 immunoprecipitated material from the expected gradient fractions and upon amplification yielded RT/PCR products for HCV.
• Figure 5 shows the competitive RT/PCR analysis of samples collected on 3, 6, 9, and 12 months of culture on ethidium bromide stained gels (lower portion of figure), and after gel scanning, in graphic form (upper portion of figure).
• the results imply consistent production of stable levels of HCV RNA in HepG2-HCV cultures.
• the present invention provides cell lines derived from these stably producing HepG2- HCV cultures. The stable baseline of virus production in these cells provides an important tool for the screening of antiviral compounds. These results also demonstrate that the integrated HCV cDNA clone serves as a template for the consistent production of virus.
• SCID mice were injected subcutaneously with HepG2-HCV or an equal number of HepG2 -vector transfected cells. Mice were bled every 10 days postinjection, and the serum samples tested for HCV RNA by semiquantitative
• HCV RNA is secreted
• HCV stably replicates in HepG2 cells, and provides a long term culture of HCV suitable for a large variety of basic and applied studies.
• mice were each injected with 5 x 10 6 HepG2-pRc/CMV-HCV cells or control HepG2-pRc/CMV cells. The mice were bled once every 10 days post injection for a total of 30 days. Some serum samples were pretreated with RNase, and after inactivation, the RNA was extracted and subjected to RT/PCR, and finally analyzed on 1.4% agarose gels (Figure 8). The spike (1 x 10 5 copies) added just prior to RT/PCR consisted of HCV sequences containing an internal deletion that permitted faster migration on agarose gels relative to the viral amplicon. The gel containing the indicated samples was ethidium bromide stained.
• RNA for HCV in the serum of SCID mice injected with HepG2-HCV
• primers SEQ. ID. NO: 1 and 2 that spanned the 5' untranslated region of HCV ( Figure 9, top gel) or primers that amplified the downstream neo gene in the pRc/CMV plasmid into which the full length HCV cDNA was cloned.
• the results show the presence of HCV, but not neo sequences, at a density of 1.1 gm/ml, implying that viral but not downstream plasmid sequences are transcribed and packaged.
• He ⁇ G2-pRc/CMV and HepG2-pRc/CMV-HCV cells were radiolabeled with 100 ⁇ Ci/ml each of 35 S-cysteine plus 35 S-methionine for 3 hours.
• Cell lysates were prepared in standard RIP A buffer (4°C for 10 min), clarified, and immunoprecipitated with anti-NS5B or control serum, followed by protein G- agarose beads (Santa Cruz Biotech). The resulting material was washed 4X, collected by centrifugation (1000 x g for 5 min. at 4°C), and analyzed by SDS/PAGE and autoradiography (Figure 10).
• the present invention relates to the stable integration of HCV into HepG2 cells, thereby allowing for the stable production of hepatitis C virus.
• this stable HCV producing cell line is used to study viral replication and maturation.
• Mutations to the genome in the original wild-type hepatitis C virus clone are made using methodologies well known to those skilled in the art. These mutated viruses are then stably integrated into cells, as described supra, thereby producing cells that stably express a mutated virus genome.
• a mutation in a specific viral protein is introduced into the viral genome and the role of that viral protein in the replication or maturation of virus particles is determined.
• the present invention includes, but is not limited to, mutations in the active site of an enzyme, for example the NS5T polymerase or the NS3 protease.
• the HCV polymerase is necessary for replication of the viral genome and the protease is necessary for the processing of the virus polyprotein into mature, biologically active polypeptides.
• Replication and maturation of wild type virus in HepG2-HCV cells is used as a base line for replicative capacity, as well as for maturation of wild type hepatitis C virus.
• the replicative capacity and maturation of the stably integrated mutated hepatitis C virus is then determined and compared to the wild type. Assessing the effects of specific mutations upon replication and/or maturation of virus particles, will allow the role(s) of the respective viral proteins to be elucidated.
• the present invention identifies which proteins, and sites within these proteins, are most relevant targets for anti-viral intervention.
• hepatitis C virus is determined by Northern blot analysis of viral RNA extracted from purified intracellular core particles, as is well known to those skilled in the art. The same technique is used to determine mutated hepatitis C viral replication in cell lines expressing a mutated RNA genome of the hepatitis C virus. Cells stably expressing the hepatitis C virus, or a hepatitis C virus with a mutation in a gene, are lysed at 4.degree C by the addition of 500 . ⁇ l of a mixture containing TNE, 1 % Nonidet P-40 (NP40) and protease inhibitors (Boehringer Mannheim Corp. , Indianapolis, Ind.).
• NP40 Nonidet P-40
• protease inhibitors Boehringer Mannheim Corp. , Indianapolis, Ind.
• the cell lysates are cleared of nuclei and cellular debris by centrifugation at 10,000. times. g for 1 min.
• Cell lysates are mixed with Laemmli sample buffer, boiled for 5 min, and electrophoresed through a 15% SDS-polyacrylamide gel (Protogel, National Diagnostics, Atlanta, Ga.).
• the separated proteins are then transferred onto Immobilon-PT.TM. membrane (Millipore Co., Bedford, Mass.) (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, Cold Spring Harbor, N.Y. 1988).
• Hepatitis C viral proteins are detected using peptide antisera raised against specific viral proteins, as is standard methodology.
• This antibody is used for immunoprecipitation of the protein, which is then analyzed by Western blot analysis.
• the same antibody is used for both immunoprecipitation and Western blot analysis.
• Bound antibody was revealed by a chemiluminescence method utilizing horseradish peroxidase-labeled goat anti-rabbit or anti-mouse IgG antibodies (SuperSignal.TM., Pierce, Rockford, 111.).
• Cell lines expressing the hepatitis C virus are used to evaluate antibodies, peptides, or other molecules with therapeutic value in hepatitis C infections. Screening of organic or peptide libraries with cell lines expressing the hepatitis C virus are useful for identification of therapeutic molecules that function to inhibit or prevent viral replication and/or viral maturation. Synthetic and naturally occurring products are screened in a number of ways deemed routine to those skilled in the art. In general, these methodologies involve contacting the therapeutic agent with the cell line expressing the hepatitis C virus and measuring the efficacy of inhibiting or preventing viral replication or maturation.
• viral based expression systems specifically a retrovirus, adenovirus, or adeno-associated virus
• a retrovirus adenovirus
• adeno-associated virus adenovirus
• a cloned therapeutic agent including but not limited to, any cytokine, (such as interferon or interleukin), antisense molecule, ribozyme or anti-viral antibody fragment (sFv)
• adenovirus transcription/ translation control complex e.g., the late promoter and tripartite leader sequence.
• This chimeric gene is then inserted in the adenovirus genome by recombination.
• Insertion in a non-essential region of the viral genome will result in a recombinant virus that is viable and capable of expressing the cloned therapeutic agent in the stably producing hepatitis C virus cell line, (e.g., see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. U.S.A. 81:3655-3659).
• Insertion of a therapeutic gene sequence into the stably producing hepatitis C virus cell line allows for therapeutic efficacy of gene therapy to be determined. The efficacy of the cloned therapeutic agent is assessed by its effect on viral replication and maturation.
• Antisense refers to a nucleic acid capable of hybridizing to a portion of the hepatitis C virus RNA (preferably mRNA) by virtue of some sequence complementarity. Antisense RNA and DNA molecules act to directly block the translation of mRNA by binding to targeted mRNA and preventing protein translation.
• antisense DNA oligodeoxyribonucleo tides derived from the translation initiation site, e.g., between -10 and + 10 regions of a hepatitis C virus nucleotide sequence, are preferred.
• the present invention provides for an antisense molecule comprising a nucleotide sequence complementary to at least a part of the coding sequence of a hepatitis C virus protein which is hybridizable to a hepatitis C virus mRNA.
• the present invention also provides for an antisense molecule comprising a nucleotide sequence complementary to at least a part of a non-coding sequence.
• Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
• the mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage.
• engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of HCV RNA sequences.
• Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU and GUC.
• RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site are evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable.
• the suitability of candidate targets is also evaluated by testing their accessibility to hybridization with complementary oligonucleotides by using ribonuclease protection assays.
• Screening therapeutic agents for their efficacy in inhibiting or preventing hepatitis C virus replication or maturation is carried out by titrating the amount of therapeutic agent added to the stably producing hepatitis C virus cells. Viral replication and/or mamration is then measured by any of a variety of commonly known methods. These methods include, but are not limited to, measuring changes in viral RNA transcription, levels of virus particles secreted, or changes in viral protein levels.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Immunology (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Urology & Nephrology (AREA)
• Medicinal Chemistry (AREA)
• Biochemistry (AREA)
• Hematology (AREA)
• Organic Chemistry (AREA)
• Biotechnology (AREA)
• Food Science & Technology (AREA)
• Virology (AREA)
• Communicable Diseases (AREA)
• Biophysics (AREA)
• Cell Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Microbiology (AREA)
• Genetics & Genomics (AREA)
• Gastroenterology & Hepatology (AREA)
• Physics & Mathematics (AREA)
• Analytical Chemistry (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Investigating Or Analysing Biological Materials (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=22477857

Family Applications (1)

Country Status (4)

Families Citing this family (1)

Family Cites Families (1)

• 2000
  • 2000-06-02 JP JP2001501654A patent/JP2003501073A/ja active Pending
  • 2000-06-02 CA CA002339255A patent/CA2339255A1/en not_active Abandoned
  • 2000-06-02 WO PCT/US2000/015313 patent/WO2000075376A1/en not_active Application Discontinuation
  • 2000-06-02 EP EP00936474A patent/EP1105526A1/en not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events