EP1105418A1 - Vanadate resistance glycosylation 4 gene - Google Patents

Abstract

The invention is a Vanadate-Resistant Glycosylation (VRG4) gene and gene product from pathogenic yeast and fungi that encodes a Golgi-nucleotide-sugar transporter. Methods of detecting transporter activity and methods of screening for candidate anti-fungal compounds are disclosed.

Description

VANADATE RESISTANCE GLYCOSYLATTON 4 GENE

Field of the Invention

The present invention relates to a yeast Vanadate Resistance Glycosylation 4 (VRG 4) gene and homologs thereof and protein encoded therein useful in methods of identifying inhibitors of a GDP-mannose transporter for use as anti-fungal compounds.

Background of the Invention

The Golgi complex is the site at which the terminal glycosylation of both proteins and lipids occurs. Unlike mammalian cells, in the yeast S. cerevisiae, glycoproteins and sphingolipids are exclusively modified by the addition of mannose residues in the Golgi. Glycoproteins can undergo two types of modifications in which oligosaccharides are linked to either asparagine residues (N- linked) or serine/threonine residues (0-linked) (for review see (1,2). Both of these glycosylation pathways initiate in the endoplasmic reticulum (ER) and terminate in the Golgi. After transport of the protein to the Golgi, most TV-linked oligosaccharides are elongated by a series of different mannosyltransferases to form glycoproteins that contain outer chains of 50 or more mannose residues. The αl,6- linked outer chain is highly branched with αl ,2- and αl ,3-linked mannoses. As in higher eukaryotes, it appears that the various mannosyltransferases that catalyse these sequential reactions are compartmentalized from one another within the individual Golgi cisternae. In the case of O-linked sugars, up to five mannoses are added after the addition of the first mannose in the ER (3,4). The phosphoinositol- containing sphingolipids in yeast also undergo mannosylation in the Golgi. In S. cerevisiae, there are three major classes of sphingolipids. These include the inositol-phosphorylceramides (IPCs) and the mannosylinositolphosphorylceramides

(MIPC and M(IP)₂C) (for review, see (5). MIPC and M(IP)₂C contain a single mannose attached to the inositol (6). though little is known about the mannosyltransferase(s) that catalyses this reaction. The mannosyl donor for all of these Golgi-localized reactions is the nucleotide sugar GDP-mannose, whose site of synthesis is the cytoplasm. Before it can be utilized by the different lumenal mannosyltransferases, GDP-mannose must be transported into the Golgi by a specific nucleotide sugar transporter (7). Once the sugar is donated to lumenal mannosyltransferase acceptors, the nucleoside diphosphate GDP is converted to a monophosphate by a nucleoside diphosphatase

(7). As in the mammalian Golgi, the transport of the nucleotide sugar into the lumen is coupled to the outward exit of the monophosphate in yeast. The yeast GDPase-encoding gene, GDAl, has been isolated (8). As predicted, a deletion of GDAl results in the under glycosylation of proteins and lipids, though the null allele has no effect on growth.

Many nucleotide sugar transport activities have been reported, which differ from one another in their substrate specificity and subcelluar localization (9). Since the cytoplasm is the sole site at which nucleotide sugars are synthesized, they must be transported into the various organelles in which glycosylation occurs. Mammalian cells require the transport of many different nucleotide sugars due to the diversity of carbohydrate processing in the ER and Golgi. Carbohydrate chains may contain galactose, sialic acid, fucose, xylose, N-acetylglucosamine, and N- acetylgalactosamine. In contrast, in S. cerevisiae, glycosylation in the Golgi is largely restricted to mannosylation which in principle requires only a single transporter.

The VRG4 gene is an essential gene that is required for a number of different Golgi-specific functions, including TV-linked glycosylation (10-12), secretion, protein sorting and the maintenance of a normal endomembrane system (12).

The present invention discloses that the transport of GDP-mannose into the Golgi is the principal function of the VRG4 gene product in yeast. The present invention discloses that pathogenic yeast also contain a VRG 4 gene homolog. The VRG 4 gene is essential for viability. A simple system to assay GDP-mannose transport is disclosed, using permeabilized yeast spheroplasts. Methods for identifying putative inhibitors of VRG 4 gene and gene product are disclosed. Summary of the Invention

The invention provides a method of measuring an activity of a nucleotide- sugar transporter derived from yeast comprising providing a nucleotide sugar to a source, said source comprising a nucleotide-sugar transporter associated with a phospholipid membrane, and determining the amount of nucleotide-sugar bound to or transported through said membrane.

The invention further provides a method of measuring an activity of a nucleotide-sugar transporter derived from yeast comprising providing a nucleotide- sugar to a source, said source comprising a nucleotide-sugar transporter associated with a phospholipid vesicle, and determining the amount of nucleotide-sugar transported into or accumulated within the vesicle.

One object of the invention is to provide a method of measuring an activity of a Golgi nucleotide-sugar transporter from yeast comprising providing a nucleotide-sugar to a source derived from permeabilized yeast spheroplasts, the source comprising a nucleotide-sugar transporter and yeast golgi, and determining the amount of golgi-associated nucleotide-sugar as an indicator of nucleotide-sugar transporter activity.

Another object of the invention is to provide a method of identifying inhibitors of golgi nucleotide-sugar transporter activity in yeasts comprising providing a putative inhibitor to a source derived from permeabilized yeast spheroplasts, the source comprising a nucleotide-sugar transporter and yeast golgi, with a nucleotide-sugar, and determining the amount of golgi-associated nucleotide- sugar in the presence of the inhibitor compared to the amount of golgi-associated nucleotide sugar in the absence of candidate inhibitor.

One aspect of the invention is permeabilized yeast cells useful in methods of assessing nucleotide-sugar transport.

The present invention encompasses permeabilized yeast cells useful in methods of assessing GDP-mannose transport and useful in methods of identifying inhibitors of GDP-mannose transport. The present invention provides permeabilized yeast cells containing a dpm 1 mutation useful in methods of measuring transporter activity. o An aspect of the invention is a kit comprising permeabilized yeast cells and optionally a nucleotide sugar useful in methods of measuring golgi nucleotide-sugar transporter activity.

One aspect of the invention are anti-fungal compounds that inhibit GDP- mannose transporter activity in yeast.

Another aspect of the invention is an isolated VRG4 gene and portions thereof encoding a golgi GDP-mannose transporter in a pathogenic yeast.

Yet another aspect of the invention is an isolated VRG4 protein or portion thereof encoded by a VRG4 gene from a pathogenic yeast. Another object of the invention is to provide a recombinant method of making RNA or protein encoded by the VRG4 gene encoding a golgi GDP-mannose transporter derived from a pathogenic yeast.

Another aspect of the invention is antibody specifically reactive to a VRG4 protein or immunogenic portion thereof.

A further aspect of the invention is a pharmaceutical composition comprising an antibody specifically reactive to a VRG4 protein or immunogenic portion thereof useful in inhibiting nucleotide-sugar transporter function.

It is another object of the invention to provide nucleic acid probes for the detection of a wild-type VRG4 gene or alterations or mutations in the VRG4 gene. In accordance with the invention, such nucleic acid probes are complementary to the wild-type VRG4 gene coding sequences and can form mismatches with mutant or altered VRG4 genes, thus allowing their detection by enzymatic cleavage, chemical cleavage, or by shifts in electrophoretic mobilities.

It is still another object of the invention to provide a method for diagnosing yeast infections human cells and tissues. In accordance with the invention the method comprises isolating cells and/or infected tissue from a human and detecting the normal or wild-type VRG4 genes, mRNA or their expression products from the cells and/or infected tissue, wherein the detection of the gene. mRNA or expression products in the cell and/or infected tissue is indicative of a yeast infection.

Another aspect of the invention is to provide a method of determining efficacy of treatment of a yeast infection in humans comprising isolating cells and/or infected tissue from a human and detecting alterations, reduction or absence ° of the normal or wild-type VRG4 gene. mRNA or expression product is indicative of efficacy of treatment by an antifungal compound.

It is a further object of the invention to provide a kit for the identification and determination of the genomic nucleotide sequence of the VRG4 genes by using ohgonucleotide probes.

It is another object of the invention to provide diagnostic probes for detection of pathogenic yeast in humans.

Yet another object of the invention is to provide a method of supplying normal or wild-type VRG4 gene function to a cell which has lost such normal gene *0 function by virtue of a mutation or alteration in the endogenous wild-type VRG4 gene, which comprises introducing a exogenous wild-type VRG4 gene or functional portion thereof into a cell which has lost said gene function, or which contains an aberrant gene, such that the wild-type gene is expressed in the cell. , c Another object of the invention is to provide a method of supplying VRG4 gene function to a cell which lacks such a gene, which comprises introducing a portion or part of a wild-type VRG4 gene into a cell which lacks said gene function, such that the gene portion or part is expressed in the cell.

0

Brief Description of Drawings

Figure 1. Immunoblot analysis of chitinase in vrg4 mutant and wild type extracts. Proteins were extracted from the culture supematants of RSY255 (VRG4. lane 1). NDY5 (vrg4-2, lane 2), or HTY10 (mnnlO-2, lane 3) by acetone 5 precipitation, fractionated by 8% SDS-PAGE and subjected to immunoblot analysis using anti -chitinase antisera as described in Materials and Methods. The arrow denotes the mobility of wild type chitinase.

Figure 2. Analysis of sphingolipids in vrg4-2 and wild type cells. Sphingolipids in RSY255 (VRG4) or NDY5 (vrg4-2) were pulse labeled with [³H] 0 myoinositol and chased for 20 or 40 minutes with unlabeled inositol, extracted and separated by thin layer chromatography as described in Materials and Methods. The assignment of PI, IPCs, MIPC and M(IP)₂C. denoted by arrows, is based upon a comparison of their mobility on TLC with those reported in the literature and upon 5 their relative abundance (41 ). ⁰ Figure 3A and 3B. GDP-mannose transport in permeabilized yeast cells as a function of time and protein concentration. PYCs (prepared from strain JPY25 6c) were incubated in reaction buffer containing 3μM GDP-mannose and 50 nCi GDP- [³H] -mannose (15 Ci/mmole) in a final volume of 25 μl, as described in Materials and Methods. Figure 3A shows the transport of GDP-[³H]mannose as a function of time, in which reactions were carried out in a final protein concentration of 0.5 μg/μl. Figure 3B shows the protein dependence of the reactions, carried out for six min at 30°C under conditions described above. 20 pmoles of GDP mannose transport corresponds to a lumenal uptake of 27% of the GDP-mannose in the

10 reaction. Typical values for the absolute cpms transported into vesicles prepared from a 25 μl reaction range from 6000-12,000 cpm in over 10 separate experiments Figure 4. GDP-mannose transport activity in vrg4-2 and wild type cells. PYCs were prepared in parallel from JPY26 3d (vrg4-2) , JPY26 3d harboring

, _c pRHL which bears the wild type VRG4 gene or the isogenic wild type strain, JPY25

6c as described in Materials and Methods. PYCs were used in standard GDP- mannose transport assays and the time of incubation was varied. The % of GDP- mannose transported was determined as described in Materials and Methods.

Figure 5A-5C. Western immunoblot and cytological analysis of the 0

Vrg4 protein. Figure 5A. Whole cell protein extracts were prepared from yeast cells (SEY6210) harboring plasmids expressing Vrg4-HA3p on a CEN plasmid

(pRHL-HA3), a 2μ plasmid (pYRHL-HA3) or the vector alone (pYEp352) or untransformed and fractionated by 10 % SDS-PAGE and subjected to western blot 5 analysis using anti-HA antibodies, as described in Materials and Methods. Figure

5B and 5C. Indirect immunofluorescence of SEY6210 cells or SEY6210 expressing Vrg4-HA3p (Figure 5B) or Ochl-HA3p (Figure 5C). Fixed cells were treated with anti-HA antibodies, followed by FITC-conjugated anti-mouse IgG and viewed by confocal microscopy. 0

Figure 6. The Nucleotide (SEQ. ID No: 1) and Predicted Amino Acid

Sequence (SEQ. ID No: 2) of VRG4 gene from Saccharomyces cerevisiae. The five potential glycosylation sites, at amino acid positions 81, 1 19, 242, 246, and

249. are denoted by asterisks. Four potential membrane-spanning domains, 5 comprised of at least 20 uncharged residues and flanked by charged residues are underlined. This sequence was found to be the same as that of the VAN 2 gene (GenBank™ accession no. UI 5599 (1 1).

Figure 7A-7B . The Full Length Nucleotide (SEQ. ID No: 3) and Predicted Amino Acid Sequence (SEQ. ID No: 4) of VRG4 gene from Candida albicans.

Figure 8. An Alignment of the S. cerevisiae and C albicans VRG4 proteins. Shown here is a portion of the C albicans VRG4 homolog (SEQ. ID No: 5) and the region of its conservation to the S. cerevisiae VRG4 protein (SEQ. ID No: 6). The alignment was performed using the Gapped BLAST algorithim (Altschul,

10 S. et al 1997, Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acids Research 25:3389-3401). The two proteins display 65% identity and 78% similarity along their entire length.

Figure 9. The physical map of the pSK^"Ca /?G¥ plasmid containing a , c portion of the VRG4 gene from Candida albicans.

Figure 10A and 10B. Co-immunoprecipitation of stable Vrg4p multimers in detergent extracts. Epitope tagged Vrg4p-containing complexes were extracted from yeast cells by treatment with 1 % digitonin (PANEL 10A) or 1% Triton X-100 (PANEL 10B) and immunoprecipitated with anti-HA antibodies. 0 After loading equivalent amounts of protein in each lane and fractionating by SDS- PAGE, precipitates were immunoblotted with anti-myc antibodies and detected by chemiluminescence. Extracts were prepared from a yeast strain (SEY6210) expressing VRG4-myc alone (YEplac81-Vrg4myc₃) (lane 1), co-expressing both 5 VRG4-myc (YEplacl 81 -Vrg4myc₃) and VRG4-HA (YEp352-Vrg4-HA₃) (lane 2), or expressing either VRG4-myc (YEplacl 81-Vrg4myc₃) or VRG4-HA (YEp352-Vrg4- HA₃) and mixed after extraction but prior to immunoprecipitation (lane 3). Extracts were prepared from SEY6210 co-expresing VRG4-myc (YEplacl 81-Vrg4myc₃) and GDA1-HA (pY023-GDAl-HA₃) (PANEL 10A, lane 4) or from strains expressing 0 either of these genes and extracts were mixed prior to immunoprecitation (PANEL 10B, lane 4).

Figure 11 A and 11B. Expression of the cloned vrg4-2 (A286D) mutant allele. The vrg4-2 mutant allele was cloned and epitope-tagged as described in 5 Materials and Methods. PANEL 1 1A. Isogenic wild type (RSY255) or vrg4-2 mutatnt cells (NDY5) transformed with plasmids containing either VRG4-HA (YEp- RHL-HA₃) or wg4-A286D-HA (YEpVrg4-A286D-HA₃) were streaked onto YPAD media plus or minus 50 μg/ml hygromycin B. PANEL 1 IB. Western blot of the mutant Vrg4-A286D-HA and wild type Vrg4-HA proteins. Whole cell lysates from wild type yeast (SEY6210) expressing either VRG4-HA on a CEN plasmid (pRHL- HA₃) (lane 2) or a 2μ plasmid (YEpRHL-HA₃) (lane 5) or vrg4-A286D-HA on a EN plasmid (pRS316Nrg4-A286D-HA₃) (lane 3) or 2μ plasmid (YΕp352-Vrg4- A286D-HA₃) (lane 4). After loading equivalent amounts of protein per well, proteins were fractionated by SDS-PAGE and subjected to western blot analysis with anti-HA antibodies and detected by chemiluminescence.

Figure 12. The Vrg4-A286D mutant protein stably interacts with itself and with the wild type Vrg4 protein.

Extracts were prepared from a yeast strain (SEY6210) expressing VRG4-myc alone (YEplacl81-Vrg4-myc₃) (lane 1), co-expressing both VRG4-HA (YEpRHLHA3) and vrg4-A286D-myc (YEplacl81-Vrg4-A286D-myc₃) (lane 2), both vrg4A286D-HA and vrg4-A286D-myc (YEp352-Vrg4-A2826-HA₃ and YEplacl81 Vrg4-A286D-myc₃) (lane 3), or both VRG4-HA and VRG4-myc

(YEpRHL-HA₃ and YEplacl81-Vrg4-myc₃) (lane 4). Vrg4p-containing complexes were extracted from yeast cells by treatment with 1% Digitonin and immunoprecipitated with anti-HA antibodies. After loading equivalent amounts of protein in each lane and fractionating by SDS-PAGE, precipitates were - immunoblotted with anti-myc antibodies and detected by chemiluminescence.

Figure 13A-13D. The Vrg4-A286D mutant protein localizes to the Golgi.

Indirect immunofluorescence of SEY6210 expressing Vrg4-HAp (pRHL- HA₃) (13C), the mutant Vrg4-A286D-HAp (pRS316-Vrg4-A286D-HA₃) (13D),

Ochl-HAp (a Golgi marker) (13B) and Ost4-HAp (an ER marker) (13A). Fixed cells were treated with anti-HA antibodies, followed by FITC-conjugated anti- mouse IgG. ° Figure 14A and 14B. The vrg4-2 allele contains a single mutation (A286D) in a region of the protein that is highly conserved among other NSTs.

PANEL 14A. A hydropathy profile of the Vrg4 protein, with the location of the A286D mutation indicated with a circle. PANEL 14B. An alignment of the region surrounding the A286D mutation (depicted with an asterisk) in other nucleotide sugar transporters. Group I proteins are closely related to the GDP- mannose transporters defined by the Leishmania donovani Lpg2 protein and the S. cerevisiae Vrg4 protein. Group II proteins are most highly related to those that transport UDP-sugars. The accession numbers for related but uncharacterized ORFs 10 are indicated. The identification of these proteins was obtained using BLAST version 2.0s [Altschul, 1997 #242]. Alignments were performed using the DNASTAR MegAlign program, using the Clustal algorithm. The consensus was stringently defined as a majority of five out of six identical residues for Group I ι proteins (shaded in black) and five out of eight identical residues for Group II

(shaded in gray). Residues in group II that are identical to group I are shaded in black.

Detailed Description of the Invention

The present invention discloses that the Vanadate Resistance Glycosylation 0 4 (VRG4) gene isolated from Saccharomyces cerevisiae encodes a protein that transports GDP-mannose from the cytoplasm into the lumen of the golgi complex. GDP-mannose is the mannosyl donor for all of the glycosylation events that occur in the yeast golgi. As such, the VRG4 protein may be said to be the master 5 regulator of glycosylation in yeast. The VRG4 protein of the present invention as essential for viability of the yeast Golgi. Mammalian cells do not have a GDP- mannose transporter. Since the VRG4 protein is a yeast-specific gene product, it represents a specific anti-fungal drug target. Thus anti-fungal compounds specifically targeted against the VRG4 gene or gene product have little or no side 0 effects on mammalian cells.

The present invention encompassed the VRG4 gene isolated from yeast. Of particular interest are VRG4 genes isolated from pathogenic yeast. The pathogenic yeast including but not limited to Candida albicans, Candida tropicalis, Torulopsis 5 glabrata. Cryptococcus neoformans. Aspergillus. Microsporium, Trichophyton, ⁰ Epidermophyton, Pityrosporum. Histoplasma, Blastomyces and the like. Preferably the VRG4 gene is derived from Candida albicans. Homologs and functional portions of the VRG4 gene are included in the ambit of the invention. Functional portion as used herein, is any portion which has nucleotide-sugar transporter activity, preferably GDP-mannose transporter activity. The nucleotide sequence of the VRG4 gene is depicted in Figures 6 and 7. However, the nucleotide sequence of the VRG4 gene of the present invention is in no way limited to the sequences depicted in Figures 6 and 7, but may include the complementary sequence as well as variations in the nucleotide sequence as are known in the art as a result of code degeneracy that results in a functionally equivalent sequence. Further, naturally occurring allelic variations in a given species are also encompassed by the present invention.

The present invention also encompasses a mutant VRG 4 gene.

15 Encompassed in mutant VRG4 genes are mutations which renders the gene totally nonfunctional or renders selected portions of the gene nonfunctional. In one embodiment, the mutant VRG4 gene has one or more mutations in a GDP-mannose binding domain. The mutation includes one or more substitutions or deletions, and the like, which render the GDP-mannose binding domain incapable of binding

20 GDP-mannose. In one embodiment, the mutant VRG4 gene comprises a single base pair change in the region coding for the GDP-mannose binding domain. In a particular embodiment, the mutant VRG4 gene comprises a single C to A base pair change at nucleotide position 857 of the wild-type VRG4 gene.

25 A VRG4 gene from a yeast may be cloned by methods known in the art such as those used to clone the VRG4 gene of Saccharomyces cerevisiae (12). Of particular interest is the cloning of the full length VRG4 gene from pathogenic yeast such as from Candida albicans. The full length VRG4 gene of Candida albicans may be isolated from a genomic Candida albicans library using standard methods known in the art. In one embodiment, a Candida genomic library transformed into

E. coli is used to isolate the full length gene. The full length clone is obtained by screening E. coli colonies using the partial Candida gene as a probe by the conventional method of colony hybridization. 5 ⁰ The isolated VRG4 gene may be incorporated into vectors including but not limited to yeast vectors, yeast shuttle vectors, plasmid vectors for expression in mammalian cells and the like. The vectors contain the appropriate promoters and selectable markers as are known in the art for expression in the host cell. In one embodiment, the vector is the plasmid SK^'Ca VRG4 containing a partial VRG4 gene of C. albicans deposited August 1 1, 1998 with the American Type Culture Collection, 10801 University Boulevard, Manassas, VA under Accession No. ATCC 203137 under the terms of the Budapest Treaty.

The present invention includes host cells transformed or transfected with the VRG4 gene or portion thereof. Host cells include both eukaryotic and prokaryotic host cells provided they contain the correct elements for host-specific expression. Such host cells include but are not limited to bacterial cells, yeast cells, mutant yeast, mammalian cells such as BHK-21, COS-7, CV-1, Hela and the like. In one ι r embodiment, Saccharomyces cerevisiae is a host cell in which the endogenous

VRG4 gene is replaced by the homolog VRG4 gene isolated from Candida albicans.

The present invention encompasses the VRG4 gene product from yeast. In one embodiment the VRG4 gene product is a protein of about 36.9 kDa and peptides thereof. The VRG4 gene product of the present invention is associated with Golgi 0 GDP-mannose transport in yeast. The amino acid sequence of the VRG4 gene product from Saccharomyces cerevisiae is depicted in Figure 6. Functional portions of the VRG4 protein are within the ambit of the present invention. Such isolated portions are those which facilitate transport of GDP-mannose across the Golgi. 5 A full length nucleic acid sequence of the VRG4 gene and predicted amino acid sequence of the VRG4 protein from Candida albicans is depicted in Figure 7 A and 7B. The alignment of the amino acid sequence from C. albicans with S. cerevisiae is provided in Figure 8. The two proteins display 65% identity and 78% similarity along their entire length.

In one embodiment, a functional portion of the VRG4 protein encompass the GDP-mannose binding domain.

In another embodiment, the GDP-mannose binding domain comprises the consensus sequence: 5 ⁰ W Xaa Xaa Xaa Xaa T Xaa Xaa T T Y S

1 5 10

Xaa V G Xaa L N K Xaa P Xaa Xaa

15 20

Xaa Xaa G Xaa Xaa Xaa F Xaa 5

25 30 in which Xaa at position 16 is Ala or Ser; Xaa at position 20 is Leu or He; Xaa at position 22 is Leu or He; and

Xaa at positions 2-5, 7-8, 14, 22-25, 27-29 and 31 is one of any naturally occurring _j0 amino acid (SEQ. ID No: 23).

In another example, the GDP-mannose binding domain comprises SEQ. ID No: 7, SEQ. ID No: 9, or SEQ. ID No: 11.

Another aspect of the invention is a mutant GDP-mannose binding domain. The mutant may be the result of one or more substitutions, deletions and the like

15 which affects the function of the domain. In one embodiment the mutant GDP- mannose binding domain comprises SEQ. ID No. 8, which contains a single amino acid substitution in the consensus sequence.

The full length VRG4 protein from Candida albicans may be easily obtained

20 by recombinant techniques or the protein may be isolated from yeast cells by chromatographic techniques known in the art such as immunoaffinity chromatography and the like.

In one embodiment, a recombinant VRG4 protein or portion thereof is made 25 by a method comprising incorporating an isolated VRG4 gene or functional nucleic acid sequence thereof into a vector, transforming or transfecting a host cell with the vector and culturing the host cell under conditions that allows expression of the recombinant VRG4 protein or portion thereof.

The VRG4 protein or functional portion thereof may be used in assays for measuring VRG4 transporter activity and in assays for identifying inhibitors of GDP-mannose transport activity. Such inhibitors may be used as anti-fungal compounds in the treatment of yeast infections. The VRG4 protein or immunogenic portions thereof are also useful in eliciting anti-VRG4 antibody. Such antibody is ^J useful in diagnostic assay and as a therapeutic to inhibit transporter activity. ° The present invention encompasses a method of measuring a nucleotide- sugar transporter activity. The nucleotide-sugar transporter, under natural conditions, is unique to yeast cells and is not present under natural conditions in mammalian cells or bacterial cells. Of particular interest is a nucleotide-sugar transporter from pathogenic yeasts such as Candida albicans, Cryptococcus, Aspergillus and the like.

In the method of measuring nucleotide-sugar transporter activity, the transport of an amount of exogenously added nucleotide-sugar is measured which is associated with the Golgi. The nucleotide-sugar transporter of the present invention 0 is capable of causing the transport of a nucleotide-sugar into the Golgi. The amount of nucleotide-sugar accumulating within the Golgi, in particular the lumen of the Golgi is indicative of activity by the transporter.

The method of the present invention may be used to determine the activity of ι any nucleotide-sugar transporter which is associated with golgi.

In one embodiment, the activity of a GDP-mannose transporter is determined. The method of assaying GDP-mannose transporter activity comprises adding an amount of GDP-mannose to a source of GDP-mannose transporter and a membrane source. The GDP-mannose transporter is associated with the membrane 0 source in a manner such that the binding and transport of the GDP-mannose may be determined from the membrane source.

In one embodiment, the GDP-mannose is detectably labeled in such a manner to allow it to be easily detected and quantitated when associated with the 5 GDP-transporter. Such labels include but are not limited to enzymes, radioisotopes, chemiluminescent compounds, bioluminescent compounds, and the like provided the labels do not interfere with transport. Alternatively, a second reagent may be added to detect the GDP-mannose. The second reagent, such as an antibody, may be labeled. 0

The source of the GDP-mannose transporter is from natural sources or recombinant sources. The GDP-mannose transporter may be expressed from an endogenous GDP-mannose transporter gene or an exogenous GDP-mannose transport gene or a functional portion thereof. In a preferred embodiment, the GDP- 5 mannose transporter is associated in a membrane such as the Golgi membrane, or synthetic membrane such as a liposome membrane. Liposome membranes useful in the present invention may be made by methods known in the art such as those described in U.S. Patent Nos. 4,663,161 and 5,766,626.

The membrane source for use in the method of measuring transport activity and inhibitors of transport activity include but are not limited to permeabilized yeast cells, mammalian cells, liposomes having associated therewith a GDP-mannose transporter, and the like.

In one embodiment the membrane source is a mammalian cell transformed or transfected with a yeast nucleotide-sugar transporter. In a preferred embodiment permeabilized yeast cells are used in the method of determining nucleotide-sugar transporter activity. The yeast cells for use in the method of measuring transport activity are yeast spheroplasts, devoid of cell walls. The yeast spheroplasts are permeabilized spheroplasts which comprise a leaky plasma membrane within which is contained an intact Golgi, an endomembrane system and a Golgi associated nucleotide-sugar transporter.

The permeabilization of the yeast spheroplasts provides a leaky plasma membrane to allow access of the nucleotide-sugar into the cell. The yeast cells may be permeabilized by means which slightly disrupts the integrity of the plasma membrane and at the same time has little or no effect on the nucleotide-sugar transporter system. In a preferred embodiment, the yeast spheroplasts are permeabilized using liquid nitrogen.

The permeabilized yeast spheroplasts for use in a method of measuring Golgi nucleotide-sugar transporter activity are devoid of any other system which may utilize GDP-mannose or compete with the GDP-mannose transport.

In a preferred embodiment, the permeabilized spheroplasts lack/or have been genetically altered to inactivate a dolichol phosphate-mannose synthase. In one preferred embodiment, the permeabilized spheroplasts have a dolichol phosphate- mannose synthase mutation which renders the synthase inactive.

The permeabilized spheroplasts for use in the method of measuring Golgi nucleotide-sugar transporter activity, preferably Golgi GDP-mannose transporter activity, contain a functionally active endogenous Golgi GDP-mannose transporter or an exogenous source of a functionally active Golgi GDP-mannose transporter. In ° an embodiment in which the permeabilized spheroplasts utilizes an exogenous source of active Golgi GDP-mannose transporter provided by an exogenous gene encoding a Golgi GDP-mannose transporter, an endogenous gene encoding a Golgi GDP-mannose transporter, if present, is mutated so as to prevent expression of the endogenous Golgi GDP-mannose transporter.

In one embodiment, the permeabilized spheroplasts have a functional VRG4 gene derived from a pathogenic yeast, preferably derived from Candida albicans.

In a preferred embodiment the permeabilized spheroplasts are from a Saccharomyces strain which has a dpml gene mutation (dpml^") and a mutation in 10 the endogenous VRG4 gene (VRG4^~), each mutation rendering the respective gene inactive. In one preferred embodiment the yeast strain is JPY263D of Saccharomyces cerevisiae having the genotype dpml^'/ VRG 4^' deposited August 11, 1998 with The American Type Culture Collection under Accession No. ATCC , - 74461 under the terms of the Budapest Treaty. A functionally active exogenous

VRG4 gene may be incorporated into JPY263D yeast strain by techniques known in the art and transporter activity determined using the methods of the present invention.

The method of the present invention is an improvement over methods 0 described in the past because of its simplicity and efficiency. Past methods relied on the use of enriched, partially purified Golgi membranes that are of a low specific activity. The prior art method involved growing up liters (10) of cell cultures, resulting in the recovery of only small amounts of active membranes. Typically, the 5 prior art method starting with 1 liter of cells only provided enough material for about 4-5 reactions. The present method allows one to start with much smaller cell culture volumes, yet provides enough material to perform many assays of the present invention as the Golgi membranes enclosed in permeabilized spheroplasts retain higher levels of activity. In one embodiment of the present invention, 1 liter 0 provided enough material for about 100-200 assays. For the application of testing Golgi nucleotide-sugar transporter inhibitors, a quick, reliable and quantitative assay is essential as it allows large number of candidate inhibitors to be screened at a time.

Vectors suitable for use in the invention comprise at least one expression 5 control element operationally linked to the nucleic acid sequence or part thereof. ° Expression control elements are inserted in the vector to control and regulate the expression of the nucleic acid sequence. Non-limiting examples of expression control elements include, but are not limited to. the lac system, operator and promoter regions of phage lambda, yeast promoters, and promoters derived from vaccinia virus, adenovirus, retroviruses, or SV40. Other operational elements include, but are not limited to, appropriate leader sequences, termination codons, polyadenylation signals, and other sequences required for the appropriate transcription and subsequent translation of the nucleic acid sequence in a given host system. Of course, the correct combinations of expression control elements will

1 depend on the host system used. In addition, it is understood that the expression vector contains any additional elements necessary for the transfer and subsequent replication of the nucleic acid-containing expression vector in the host system. Examples of such elements include, but are not limited to, origins of replication and ι j- selectable markers. Such expression vectors are commercially available or are readily constructed using methods known to those in the art (e.g., F. Ausubel et al., 1987, in "Current Protocols in Molecular Biology", John Wiley and Sons, New York, New York).

The recombinant expression vector containing all or part of the VRG4 0 nucleic acid sequence are transformed, transfected or otherwise inserted into a host organism or cell. The host cells transformed with the VRG4 nucleic acid sequence of the invention include eukaryotic and mammalian cells, such as animal, plant, insect and yeast cells, and prokaryotic cells, such as E. coli, or algal cells as known 5 in the art. The means by which the vector carrying the gene may be introduced into a cell includes, but is not limited to, microinjection, electroporation, transduetion, or transfection using DEAE-dextran, lipofection, calcium phosphate, or other procedures known to those skilled in the art (Sambrook et al. (1989) in "Molecular Cloning. A Laboratory Manual", Cold Spring Harbor Press, Plainview, New York). 0 In one embodiment, eukaryotic expression vectors that function in eukaryotic cells, and preferably mammalian cells, are used. In one embodiment, mammalian expression vectors that function in a mammalian host cells are used. In a preferred embodiment, yeast expression vectors that function in yeast host cells are used. 5 Non-limiting examples of vectors include vaccinia virus vectors, adenovirus vectors, herpes virus vectors, and baculovirus transfer vectors. Preferred eukaryotic cell lines include, but are not limited to, COS cells, CHO cells, HeLa cells, and NIH/3T3 cells. Particularly preferred host cells are yeast cells.

The expressed recombinant VRG4 protein or portions thereof may be detected by methods known in the art, some of which include Coomassie blue staining, silver staining, and Western blot analysis using antibodies specific for the

VRG4 protein as discussed further below. In addition, the recombinant protein expressed by the transformed host cells can be obtained as a crude lysate or can be purified by standard protein purification procedures known in the art, including differential precipitation, molecular sieve chromatography, ion-exchange chromatography, isoelectric focusing, gel electrophoresis, affinity and immunoaffinity chromatography and the like. (Ausubel et. al., 1987, In "Current

Protocols in Molecular Biology" John Wiley and Sons, New York, New York). In the case of immunoaffinity chromatography, the recombinant protein may be purified by passage through a column containing a resin which has bound thereto antibodies specific for the VRG4 protein (Ausubel et. al., 1987, In "Current

Protocols in Molecular Biology" John Wiley and Sons, New York, New York).

In one embodiment, an active VRG4 protein was purified by using an HA- epitope tagged gene which was constructed and tested for activity by complementation of the VRG 4 mutant phenotype. This HA-tagged protein was then over-expressed and purified by affinity-chromoatography using 12CA5 bound resin.

According to the diagnostic method of the present invention, the wild type VRG4 gene or alterations of the wild type VRG4 gene is detected. Alteration of a wild-type gene according to the present invention encompasses all forms of mutations, including deletions. The alteration may also be due to rearrangements, such as insertions, inversions, and deletions, or to point mutations. Deletions may be of the entire gene or only a portion of the gene. The method of the present invention may be used to determine efficacy of antifungal treatment in a mammal in which an alteration, reduction or elimination of the wild type VRG4 gene, mRNA or gene product is indicative of efficacy in reducing or eliminating a yeast infection. Mutations induced by antifungal therapy leads to non-functional or absent gene products which in turn also lead to inhibition and loss of viability of yeast. The detection of point mutations may be accomplished by molecular cloning of the allele (or alleles) present in the yeast and sequencing that allele(s) using techniques well known in the art. Alternatively, polymerase chain reaction (PCR) can be used to amplify gene sequences directly from a genomic DNA preparation from yeast. The DNA sequence of the amplified sequences can then be determined by conventional methods. The polymerase chain reaction itself is well known in the art (see, e.g., Saiki et al., 1988. Science, 239:487; U.S. Patent No. 4,683,203; and

U.S. Patent No. 4,683,195). Specific primers which can be used in order to amplify the gene. It will be appreciated by those skilled in the art that the primers provided herein, in particular primers from the C. albicans VRG4 gene may be used to amplify the specified VRG4 gene and to screen population samples for mutations. The ligase chain reaction, which is known in the art, can also be used to amplify VRG4 sequences (See, e.g., Wu et al., 1989, Genomics, 4:560-569). In addition, a technique known as allele-specific PCR can be used (see, e.g., Ruano and Kidd, 1989, Nucl. Acids Res., 17:8392) According to this technique, primers are used which hybridize at their 3' ends to a particular VRG4 mutation. If the particular VRG4 mutation is not present, an amplification product is not observed.

Also, combinations of ohgonucleotide pairs based on the VRG4 nucleotide sequence may be used as PCR primers to detect VRG4 mRNA in a biological sample using the reverse transcriptase polymerase chain reaction (RT-PCR) process for amplifying selected RNA nucleic acid sequences as detailed in Ausubel et al., 1987, In "Current Protocols in Molecular Biology" Chapter 15, John Wiley and Sons, New York, New York. The oligonucleotides can be synthesized by automated instruments sold by a variety of manufacturers or can be commercially prepared based upon the nucleic acid sequence of the invention. Biological samples for testing may include cells, tissues, organs, blood, serum, stool, sputum, amniotic fluid, mucous secretions and urine.

In one preferred embodiment, insertions and deletions of VRG4 gene are detected by using a non-complementation assay of a mutant as is known in the art

(Current Protocols in Molecular Biology, Vol. 2. Chapter 13, Eds. Ausubel, F.M. et al, John Wiley & Sons, Inc. 1998) The invention also relates to antibody specifically immunoreactive with the

GDP-mannose transporter, preferably immunoreactive with VRG-4 protein or epitope thereof. This invention comprises an antibody preparation or antibodies which are immunoreactive with the VRG4 protein having the amino acid sequence depicted in Figure 6, 7 or 8, or a unique portion or peptide thereof. In this embodiment of the invention, the antibodies are either monoclonal or polyclonal in origin. The antibodies may be raised against native VRG4 protein or peptides,

VRG4 fusion proteins or peptides, or mutant VRG4 proteins or peptides. The

VRG4 proteins or peptides used to generate the antibodies may be from natural or recombinant sources or produced by chemical synthesis using synthesis techniques known in the art. Natural VRG4 proteins can be isolated from yeast cultures, isolated golgi, from mammalian biological samples containing or suspected to contain yeast and the like. Recombinant VRG4 proteins or peptides may be produced and purified by conventional methods. Synthetic VRG4 peptides may be custom ordered or commercially made based upon the predicted amino acid sequence of the present invention (Figure 6, 7 or 8) or synthesized by methods known to one skilled in the art (Merrifield, R.B., 1963, J. Amer. Soc. 85:2149). If the peptide is of insufficient size to be antigenic, it may be conjugated, complexed, or otherwise covalently linked to a carrier molecule to enhance the antigenicity of the peptide. Examples of carrier molecules, include, but are not limited to, albumins (e.g., human, bovine, fish, ovine), and keyhole limpet hemocyanin ("Basic and Clinical Immunology", 1991, Eds. D.P. Stites, and A.I. Terr, Appleton and Lange, Norwalk Connecticut, San Mateo, California).

The antibodies should be specific and immunoreactive with VRG4 epitopes, preferably epitopes not present on other yeast protein or human protein, to avoid crossreactivity. However, antibodies can be generated against particular epitopes which are found to be common to other proteins, if desired or necessary to detect related structures or molecules. In a preferred embodiment of the invention, the antibodies will immunoprecipitate VRG4 proteins from solution as well as react with VRG4 proteins on Western or immunoblots of polyacrylamide gels on membrane supports or substrates. In another preferred embodiment, the antibodies will detect VRG4 proteins in paraffin or frozen tissue sections, or in cells which ° have been fixed or unfixed and prepared on slides, coverslips. or the like, for use in immunocytochemical, immunohistochemical, and immunofluorescence techniques.

Exemplary antibody molecules for use in the detection methods or as a therapeutic of the present invention are intact immunoglobulin molecules, substantially intact immunoglobulin molecules, or those portions of immunoglobulin molecules that contain the antigen binding site, known in the art as F(ab), F(ab)¹ ₂, and F(v) immunoglobulin fragments. Polyclonal or monoclonal antibodies may be produced by methods conventionally known in the art (e.g., Kohler and Milstein, 1975. Nature, 256:495-497; Campbell "Monoclonal Antibody Technology, the Production and Characterization of Rodent and Human

Hybridomas", 1985, In: "Laboratory Techniques in Biochemistry and Molecular Biology," Eds. Burdon et al., Volume 13, Elsevier Science Publishers, Amsterdam). Monoclonal antibodies may be human monoclonal antibodies, chimeric monoclonal r antibodies, or humanized monoclonal antibodies made by techniques that are well known in the art. (Takeda 1985 Nature 314:452; U.S. Patent No. 5,585,089, U.S. Patent No. 5,530,101.) The antibodies or antigen binding fragments may also be produced by genetic engineering. The technology for expression of both heavy and light chain genes in E. coli is the subject of PCT patent applications, publication number WO 901443, WO 901443 and WO 9014424 and in Huse et al, 1989, Science, 246:1275-1281. Antibody molecules of the present invention may be intact immunoglobulin molecules, or portions thereof that contain the antigen binding site. Single chain antibody may be constructed by methods known in the art (U.S. Patent No. 4,946,778; Davis, G.T. et al. 1991 Biotechnology 9:165-169;

Pluckthun, A. 1990 Nature 347:497-498). The antibody molecules may be of any class including IgG, IgM and IgA.

The antibody of the present invention may be used as a diagnostic reagent to detect and quantitate the Golgi GDP-mannose transporter, and to determine Golgi

GDP-mannose transporter activity. Standard immunoassay may be used with the anti-GDP-mannose transporter antibody for detection and quantitation of the Golgi GDP-mannose transporter in biological samples.

In another embodiment, VRG4 protein-specific antibodies are used in immunoassays to detect the novel VRG4 protein in biological samples. In this ° method, the antibodies of the present invention are contacted with a biological sample and the formation of a complex between the VRG4 protein and the antibody is detected. As described, suitable immunoassays include radioimmunoassay, Western blot assay, immunofluorescent assay, enzyme linked immunoassay (ELISA), chemiluminescent assay, immunohistochemical assay, immunocytochemical assay, and the like (see, e.g., "Principles and Practice of Immunoassay", 1991, Eds. Christopher P. Price and David J. Neoman, Stockton Press, New York, New York; "Current Protocols in Molecular Biology", 1987, Eds. Ausubel et al., John Wiley and Sons, New York, New York). Standard techniques

10 known in the art for ELISA are described in Methods in Immunodiagnosis, 2nd Ed.,

Eds. Rose and Bigazzi, John Wiley and Sons, New York 1980; and Campbell et al., 1984, Methods in Immunology, W.A. Benjamin, Inc.). Such assays may be direct, indirect, competitive, or noncompetitive as described in the art (see, e.g., "Principles

, ,. and Practice of Immunoassay", 1991, Eds. Christopher P. Price and David J.

Neoman, Stockton Pres, NY, NY; and Oellirich, M., 1984, J. Clin. Chem. Clin. Biochem., 22:895-904). Proteins may be isolated from test specimens and biological samples by conventional methods, as described in "Current Protocols in Molecular Biology", 1987, Eds. Ausubel et al., John Wiley and Sons, New York, New York.

The antibody of the present invention may be provided in the form of a kit and may also include GDP-mannose and/or other assay reagents.

The antibody of the present invention may be used as a therapeutic to 5 specifically inhibit the function of the Golgi GDP-mannose transporter. Binding of the antibody to the transporter prevents glycosylation in yeast and results in the loss of viability of the yeast cells. The antibody may be provided intraperitoneally, intravenously, intramuscularly, subcutaneously, mucosally or topically administered. The antibody is administered to a patient with a yeast infection for a period of time sufficient to reduce or eliminate the infection. For use as a therapeutic, the antibody may be modified so as to enhance the transport of the antibody across the cell wall of the yeast so as to aid accessibility of the antibody to the transporter in the golgi. For topical administration, or as an oral mouthwash, the 5 ° antibody may be administered in combination with a detergent to allow entry of the antibody through the cell wall.

In another aspect of the invention, primer pairs of the invention are useful for the determination of the nucleotide sequence of the VRG4 gene using the polymerase chain reaction. The pairs of single stranded DNA primers can be annealed to sequences within or surrounding the VRG4 gene, or a discrete segment of the gene in order to prime amplifying DNA synthesis of the VRG4 gene itself. In general, PCR primers may be on the order of about 15-40 bp, more preferably, on the order of about 18-30 bp to PCR an approximately 100-600 bp, more preferably, a 100-200 bp stretch of DNA. A complete set of primers allows synthesis of all of the nucleotides of the VRG4 gene coding sequences. Allele specific primers can also be used. Such primers anneal only to particular VRG4 mutant alleles, and thus will only amplify a product in the presence of the mutant allele as a template. Non- r limiting examples of VRG4 sequence primers for use in the invention may be the nucleic acid sequence or portion thereof as shown in Figures 6, 7A and 7B.

In order to facilitate the subsequent cloning of amplified sequences, primers may have enzyme restriction site sequences appended to their 5' ends. Thus, all nucleotides of the primers are derived from VRG4 sequences or sequences adjacent to VRG4. except for the few nucleotides necessary to form a restriction enzyme site. Such enzymes and enzyme restriction sites are well known in the art. The primers themselves (for each strand of DNA) can be synthesized using techniques which are well known in the art. Generally, the primers can be made using synthesizing machines which are commercially available. Given the sequence of the VRG4 open reading frame shown in Figure 6 and in Figure 7A and 7B, the design of particular primers is well within the skill of the art, as there are no exons in the VRG4 gene. Nucleic acid probes provided by the present invention are useful for a number of purposes. They can be used in Southern hybridization analyses to probe genomic DNA, and in the RNase protection method for detecting point mutations. The probes can be used to detect PCR amplification products, and can also be used to detect mismatches with the VRG4 gene or mRNA using other techniques. Examples of nucleic acid sequences that can be used as probes include, but are not limited to, native DNA, recombinant DNA, and synthetic oligonucleotides. Methods known in the art can be used prepare and label nucleic acid probes. As examples, DNA sequences can be labeled with P using Klenow enzyme, polynucleotide kinase or polymerases, such as TAQ used in the PCR reactions. There are also non-radioactive labeling techniques for signal amplification, including methods for attaching chemical moieties to pyrimidine and purine rings (Dale, R.N.K. et al., 1973, Proc. Natl. Acad. Sci. USA, 70:2238-2242; and Heck, R.F., 1986, S. Am. Chem. Soc, 114:8736-8740); methods allowing detection by chemiluminescence (Barton et al., 1992, J. Am. Chem. Soc, 114:8736- 8740); and methods utilizing biotinylated nucleic acid probes (Johnson, T.K. et al., 1983, Anal. Biochem., 133:125-131 ; Erickson, P.F. et al., 1982, J. Immunol. Meths.. 51 :241-249; and Matthaei, F.S. et al., 1986, Anal. Biochem., 157:123-128); as well as methods allowing detection by fluorescence using commercially available kits. An entire battery of nucleic acid probes is used to formulate a kit for detecting wild type VRG4 genes and alternations thereof. The kit allows for hybridization to the entire VRG4 gene, or to particular regions thereof. The probes may overlap with each other or may be contiguous. Kits may contain other reagents useful for carrying out the assay, such as buffers, enzymes, control samples, and the like.

Nucleic acid probes may also be complementary to the VRG4 gene or to mutant alleles of the VRG4 gene. Such probes are useful to detect similar homologs or mutations on the basis of hybridization. As also described, the VRG4 probes can be used in Southern hybridizations to genomic DNA to detect gross chromosomal changes, such as deletions and insertions. In addition, the probes can be used to detect VRG4 mRNA from yeasts in tissues to determine if expression is diminished as a result of alteration of wild type VRG4 genes as a result of antifungal therapy.

Antisense oligonucleotides may be derived from the VRG4 gene as depicted in Figures 6, 7A and 7B or derived from the nucleic acid sequence encoding the GDP-mannose binding domain depicted in Figures 14A and 14B.

Antisense oligonucleotides are useful in specifically inhibiting the formation of the VRG4 gene product. Antisense oligonucleotides may be made by methods known in the art.

According to the present invention, a method is also provided to supply wild type VRG4 function to a cell which is devoid of a VRG4 gene or to a cell that carries a mutant VRG4 alleles. The wild type VRG4 gene or a part of the gene may be introduced into the cell in a vector. Vectors for the introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector or vector construct may be used in the invention. Methods for introducing DNA into cells such as electroporation, calcium phosphate co-precipitation and viral transduetion as mentioned hereinabove are known in the art; therefore, the choice of method may lie with the competence and preference of the skilled practitioner. Cells transformed with the wild type VRG4 gene are used as model systems to study nucleotide-sugar transport to screen for antifungal drugs for treatments against yeast infections.

The protein or peptides of VRG4 may function as competitive inhibitors of the native VRG4 protein and as such may be used as an antifungal compound to treat infections caused by yeast. Protein and peptides can be produced by expression of the isolated DNA sequence, in particular genomic DNA, in yeast, for example, using known expression vectors. Alternatively, VRG4 can be extracted from cells, such as yeast cells. The protein may be cleaved using enzymes or reducing agents may be used to form peptides. Inhibitor peptides may be selected using the methods described herein . In addition, the techniques of synthetic chemistry can be employed to synthesize VRG4 protein or peptides.

Active inhibitory VRG4 molecules can be introduced into cells by microinjection or by the use of liposomes, for example. Alternatively, some of the active molecules may be taken up by cells, actively or passively by diffusion.

Extracellular application of VRG4 gene product may be sufficient to affect yeast growth. Agents may be added to facilitate the entry of the VRG4 protein or peptide across the cell wall of the yeast and to facilitate the association of the exogenously supplied VRG4 protein or peptide with the golgi. Such agents include but are not limited to liposomes antibody and the like. ° The isolated VRG4 protein or portion thereof may be used in the form of a pharmaceutical composition, along with standard excipients as are known in the art, for inhibition of the endogenous VRG4 gene product of a yeast. The inhibitors of the present invention are useful in preventing and treating yeast and fungal infections in mammals, including humans. Yeast and fungal diseases that may be treated using the inhibitors of the present invention include but are not limited to candidiasis, aspergillosis, phycomycoses, nocardiosis, cryptococcosis, histoplasmosis, blastomycosis, coccidioidomycosis, paracoccidioidomycosis, onychomycosis dermatophyte infections and the like. 10 The inhibitors of the present invention may be administered in the form of a pharmaceutical composition, alone, or as a mixture, and may be administered in combination with one or more other fungicidal and fungistatic compounds. The fungicidal and fungistatis compounds include but are not limited , c to ketoconazole, flucytosine, fluconazole, itraconazole, amphotericin B and the like.

Means of administering the VRG4 protein or parts thereof include, but are not limited to, oral, sublingual, intravenous, intraperitoneal, percutaneous, intranasal, intrathecal, subcutaneous, intracutaneous, mucosal or enteral. Local administration to the afflicted site may be accomplished through means known in 0 the art, including, but not limited to, topical application, injection, and implantation. In a method of treatment of a yeast or fungal infection in a mammal, the inhibitor is provided in a dose sufficient to inhibit nucleotide-sugar transport into the Golgi of the yeast or fungi, preferably a dose effective in inhibiting a Golgi GDP-mannose 5 transporter present in the yeast or fungi. Such inhibition in transport results in inhibition of growth and loss of viability of the yeast or fungi causing the infection.

Other inhibitors of a Golgi nucleotide-sugar transporter include but are not limited to a nucleotide-sugar analog, stilbeine or derivatives thereof provided the inhibitor specifically inhibits a Golgi nucleotide-sugar transporter in fungi or 0 yeast and is nontoxic or has minimal effect on mammalian cells. The inhibitors of the present invention may be competitive or noncompetitive inhibitors.

The inhibitors of the present invention are useful in inhibiting VRG4 transport activity in fungi and yeast. Such inhibition of VRG4 transport activity in 5 the Golgi result in inhibition of growth and ultimate lack of inability of fungi and yeast. The fungi and yeast amenable to inhibition by the inhibitors of VRG4 transport activity include but are not limited to Candida, Torulopsis, Cryptococcus,

Aspergillus, Nocardia, Histoplasmosis, Trycophyton. and the like.

All publications, patents and articles referred to herein are expressly incorporated herein in toto by reference thereto. The following examples are presented to illustrate the present invention but are in no way to be construed as limitations on the scope of the invention. It will be recognized by those skilled in the art that numerous changes and substitutions may be made without departing from the spirit and purview of the invention. Example 1

Cloning of VRG4 Gene of Saccharomyces cerevisiae

Cloning and Sequencing the Wild Type VRG4 Gene - Strain NDY5 (ura3-52 leu2-211 vrg4-2) was transformed with a yeast genomic CEN -based library, carrying the LEU2 selectable marker. Prototrophic transformants were selected on medium lacking leucine and replica-plated onto media containing 50 μg/ml hygromycin B. Plasmid DNA from hygromycin B-resistant colonies was isolated, amplified in Escherichia coli, and retransformed into the VRG4 mutant to confirm complementing activity.

A 2.1-kb EcoRI/Hindlll fragment capable of complementing the hygromycin B sensitivity of VRG4 was sequenced by the dideoxy method (43) generating a nested deletion series using the ExoIII/ExoVII method (44). Both DNA strands were sequenced. DNA and predicted protein sequence comparisons against data bases were made using the BLAST algorithm (41) and analyzed using the GCG programs.

Plasmid Constructions - All DNA manipulations were carried out according to standard protocols (45). The 2.1-kb EcoRI/Hindlll fragment containing the entire VRG4 gene and regulatory sequences was subcloned into the vector pRS316 (46) to generate the CEN based plasmid, pRHL, containing the selectable marker, URA3. This plasmid was labeled with [^j2P]dCTP (Amersham

Corp.) using the random priming method and used to probe a nitrocellulose filter, which contained separated yeast chromosomes (47). o The disruption plasmid pG5::LEU was constructed by inserting a

Smal/Sall fragment (blunt-ended with Klenow) containing the LEU2 gene into the unique Hpal site that lies within the VRG4 gene.

The integrative plasmid pG5i was constructed by cloning the

Hindlll/EcoRI fragment containing the entire VRG4 gene into the URA3 -containing

5 pRS306. The plasmid was linearized at a unique Hpal site in the VRG4 gene and transformed into strain NDY5.

Cloning and Analysis of the VRG4 Gene - Vanadate-resistant mutants fail to grow on media containing hygromycin B at concentrations where

10 wild type cells grow normally (10). This drug sensitivity was exploited as a means to clone the wild type VRG4 gene. Mutants were transformed with a CEN-based yeast genomic library, containing the Leu2 gene as a selectable marker. Leucine prototrophs were selected and replica plated onto media supplemented with 50

, , μg/ml hygromycin B. Six hygromycin-resistant colonies were isolated. Plasmids isolated from each of these colonies were distinct, but contained overlapping restriction fragments. All six plasmids conferred hygromycin B resistance when retransformed into the VRG4 mutant. Further subcloning isolated the complementing activity to a 2.1-kb EcoR/Hindlll fragment. Hybridization of the 0 ³²P-labeled EcoRI/Hindlll fragment to separated yeast chromosomes mapped this gene on chromosome XV (data not shown). Expression of the cloned fragment containing the putative VRG4 gene in the VRG 4 mutant restores the ability of these cells to retain ER proteins and rescues the invertase glycosylation defect. A slight 5 amount of invertase that was underglycosylated could still be detected in VRG4 mutant cells that harbored the cloned gene. Cell growth during invertase induction was not carried out under conditions that favor plasmid selection. Therefore, this apparent leakiness may have been due to plasmid loss in some of the cells assayed. To confirm that the cloned fragment contained the VRG4 locus, the 0 EcoRI/Hindlll fragment was cloned in an integrative plasmid (pRS306) that contains the selectable marker, URA3. The plasmid was linearized at a unique site within the VRG4 portion to allow homologous recombination at the VRG4 locus and used to transform VRG4 ura3 cells. Ura⁺ transformants were then crossed to a 5 VRG4 ura3 strain. The resulting diploid was sporulated and tetrads dissected. This analysis demonstrated a 2:2 segregation pattern for UraVUra^" and a 4:0 pattern for hygromycin resistance/hygromycin sensitivity, indicating that the cloned fragment is tightly linked to VRG4 and most likely does contain VRG4 locus (data not shown).

DNA sequence analysis of the 2.1-kb fragment revealed the presence of two open reading frames. Further analyses mapped the complementing activity to the larger open reading frame, within a 1.6-kb Hindlll/EcoRV fragment. The nucleotide and predicted amino acid sequence of this region is shown in Figure 6. The VRG4 DNA sequence encodes a predicted protein of about 36.9 kDa. There are five potential recognition sites for N-linked glycosylation (indicated by asterisks in Figure 6). Hydrophobicity analysis (33) suggests that the protein is hydrophobic. containing multiple membrane-spanning domains.

Example 2 Cloning of VRG4 Gene of Candida Albicans

A plasmid designated SK^'Ca VRG4 comprising a partial VRG4 gene of Candida albicans was deposited with the American Type Culture Collection, P.O. Box 3605, Manassas, Virginia 20108 U.S.A. (ATCC), on August 11, 1998 under Accession No. ATCC 203137 under the terms of the Budapest treaty. The physical map of the Sk^"Ca VRG4 plasmid is shown in Figure 9. Yeast strain JPY263D of Saccharomyces cerevisiae which lacks dpml and has a mutant endogenous VRG4 gene was used as a host cell for incorporation of the VRG4 gene of Candida albicans. The yeast strain was deposited with ATCC on August 11, 1998 under Accession No. ATCC 74461 under the terms of the Budapest Treaty.

The partial VRG4 gene was used to isolate a full length genomic VRG4 gene from a genomic Candida albicans library and a clone comprising a full length genomic VRG4 gene was isolated.

Example 3 ^L

GDP-Mannose Transport Function of VRG4 Materials and Methods

Yeast strains, media and general genetic methods -

Yeast strains used in this study are listed in Table 1. Media preparation and standard yeast genetic methods used for sporulation, tetrad dissection and strain constructions have been described (13). YPAD liquid medium was supplemented with 0.5 M KC1 for the growth of the vrg4 mutant strains (10,12). Hygromycin B (Boehringer Mannheim) was added to YPAD agar after autoclaving to a final concentration of 30 μg/ml. Yeast strains were transformed using the lithium acetate procedure (14).

Table I Strains used in this study

Strain Genotype Source

RSY255 MATa ura3-52 leu2-2111 R Scheckman

XD2-7C MATa ura3-52 hιs4 dpml P Orlean

NDY5 MATa ura3-52 leu2-211 vrg4-2 Poster et al (12

SEY6210 MATa ura3-52 hιs3-Δ200 trpl-Δ901 lys2-801 suc2-Δ9 leu2-3, 112 S Emr

SEY621 1 MATa ura3-52 hιs3-Δ200 trpl-Δ901 ade2 -101 suc2-Δ9 leu2-3, 112 S. Emr

JPY23 MA Ta/MA Ta ura3-52/ura3-52 hιs3-Δ200/hιs3-Δ200 trpl-Δ901/trpl- 901 This study ade2 -101/ADE2 leu2-3, l 12/ leu2-3, l 12 Iys2-801/LYS2 suc2-Δ9/ suc2-Δ9 hvglΔ LEU2/HVG1

JPY23 6c MATa ura3-52 hιs3-Δ200 trpl-Δ901 leu2-3 112 hvglΔ LEU2 This study JPY23 6d MATa ura3-52 hιs3-Δ200 trpl-Δ901 ade2 -101 suc2-Δ9 leu2-3 112 hvglΔ This study

LEU2 This study

JPY24 la MATa ura3-52 hιs3-Δ200 trpl-Δ901 ade2 -101 suc2-Δ9 leu2-3 112 vrg4-2 This study hvglΔ LEU2

JPY25 6b MATa urα3-52 hιs3-Δ200 trpl-Δ901 αde2-101 JPY25 6c MATa urα3-52 hιs3-Δ200 trpl-Δ901 αde2-101 dpml This study JPY26 3d MATα urα3-52 leu2-3 112 αde2-101 vrg4-2 dpml This study JPY32 MATα MATα urα3-52/urα3-52 hιs3-Δ200/hιs3-Δ200 trpl-Δ901/trpl-Δ901 This study Ivs2-801/LYS2 sue 2 - Δ9/suc 2 - Δ9leu2-3 112/leu 2-3 112 vrg 4Δ LEU2/VRG4 αde2-Wl/ADE2

JPY32 1A MATα urα3-52 his 3-Δ 200 trp 1-Δ 901 Ivs 2-801 leu 2-3, 112 sue 2- A 9 vrg4Δ LEU2 pVRG4 URA3 This study

Plasmids

An epitope -tagged allele of VRG4 was created in several steps. First, PCR was used to amplify the VRG4 gene while replacing the stop codon with an Nsil site. A 1.5 kb Hindlϊl/Nsil fragment containing the VRG4 gene was then ligated into the Hindlll/Pstl site of SK^'P/X HA3 (15) to produce pSK^"RHL HA3. This results in the in-frame fusion of VRG4 with sequences encoding three tandem copies of the HA epitope at the 3^' terminus, followed by a stop codon. A 0.5 kb Hpal/Xbal fragment from pSK-RHL HA3. containing the HA-tagged 3" terminus of VRG4 was exchanged with the 3^* end of VRG4 in pRHL (12) which contains the VRG 4 gene ⁰ as well as 5" and 3' flanking regulatory sequences. This places the HA-tagged allele of VRG4 under its own promoter in a URA3/ CEN yeast expression plasmid. pYRHL-HA3 contains the H A3 -tagged VRG4, under its own promoter in a 2μ, URA3 plasmid. It was constructed by ligating the Hindlll/Xbal fragment from pRHL-HA3 into the Hindlll/Xbal sites of YEp352.

A DNA fragment containing the entire HVG1 gene and flanking sequences was cloned by PCR amplification of genomic yeast DNA. This 1.3 kb fragment, flanked by BamUl/Hindϊll sites was cloned into pRS316 to generate the plasmid, pHVGl . Similarly, PCR amplification of yeast genomic DNA was used to

10 generate a 1,026 bp fragment containing only the HVG1 ORF. This fragment, flanked by a .B mHl/H dlll site was cloned into YIp56X to place it under the control of the TPI promoter (16). A deletion of the HVG1 gene was carried out by replacing the entire HVG1 open reading frame with the S. pombe HIS5 gene, which

, t- is functionally analogous to the S. cerevisiae HIS3 gene (17). PCR amplification of a fragment containing the S. pombe HIS5 gene (kindly provided by Sean Munro, MRC, LMB), with HVG1 primer ends, was used to generate a linear fragment containing the HIS5 gene flanked by 50 bp of sequence homologous to HVG1. This linear fragment was used to transform strain SEY6210. Ηis⁺ transformants were 0 isolated and the deletion was confirmed by PCR (data not shown). Western Immunoblotting

Whole cell protein extracts were prepared, separated by SDS-PAGE and immunoblotted as described (12). For the detection of secreted chitinase, proteins in 5 the culture supematants were precipitated by the addition of 10 volumes of ice cold acetone and centrifuged at 10,000 X g. Anti-chitinase antibodies (from W. Tanner) were used at a 1 : 1000 dilution. Culture supematants. containing the monoclonal anti-HA antibody, 12CA5, were used at a 1 :10 dilution. Secondary anti -rabbit or anti-mouse antibodies (Amersham), conjugated to horseradish peroxidase, were 0 used at a 1 :3000 dilution and were detected by chemiluminescence (ECL, Amersham) followed by autoradiography. Indirect Immunofluorescence

10 ml of logarithmic cultures (1-3 XI 0⁷ cells/ml) of SEY6210 or SEY6210 5 containing pYRHL-HA3 or TiOCH-HA (15) were fixed by the addition of formaldehyde to 3.7 % for 30 min at room temperature. Cells were harvested, resuspended in 10 ml of (3.7 % formaldehyde; 0.1 M KPO₄, pH 6.8) and fixed for an additional 1-2 hours at room temperature. Fixed cells were washed with (1.0 M sorbitol; 100 mM HEPES, pH 6.8; 5 mM NaN₃) and spheroplasted by the addition of 30 μg/ml Zymolase 100T. Spheroplasts were treated with 0.1% Triton X-100 for 5 min at room temperature. After attaching to glass slides, cells were plunged into - 20°C methanol for 6 minutes, followed by -20°C acetone for 30 sec. Slides were incubated overnight in primary antibody (12CA5 culture supernatant, diluted 1 :10), washed 12 times with PBS and then incubated in anti-mouse IgG:FITC or anti- rabbit: IgG:FITC (Jackson ImmunoResearch, PA), diluted 1 :200, for 1-2 hours. After washing, cells were overlayed with mounting media containing 25 ng/ml DAPI. Radiolabeling of cells and lipid analysis Cultures were grown to an OD₆oo of 1 in Wickerham's minimal medium (18), containing 2% glucose and lacking myo-inositol (WH-I). Labeling was initiated by the addition of 5 μCi/ml of [ H]-myoinositol (American Radiolabeled Chemicals, St Louis, MO). Cells were metabolically labeled for 10 min at 30 °C and chased by the addition of 4 volumes of WH containing 40 μg/ml unlabeled myoinositol. Reactions were stopped by the addition of ice cold NaN . Cells were washed once in NaN₃. suspended in 100 μl NaN₃ and broken by vortexing with glass beads.

The lysate was removed from the glass beads and lipids were extracted by adding 600 μl chloroform methanol (1 :1) to 90 μl of the cell extract to achieve a final concentration of (10: 10:3) chloroform/methanol/aqueous solution.

After centrifugation, the pellet was re-extracted for 45 min with chloroform/methanol/H₂θ (10:10:3). The pooled lipid fractions were dried under N₂ gas and desalted by phase separation in «-butanol and water (19). Lipids were resuspended in 40 μl of chloroform/methanol/aqueous solution (10: 10:3) for thin layer chromatography.

HPTLC Silica-60 gel plates ( 0.2 mm) (Merck, Darmstedt, Germany) were dried (1 10°C) for two hours and then cooled to room temperature prior to using. Samples were applied (150,000 cpm per lane) and ascending chromatography was performed using a chloroform/methanol/0.22 % KC1 in H₂O ⁰ (55:45:10) solvent system (in tanks equilibrated with solvent for 1-2 hours). After chromatography, plates were air dried, sprayed with ENΗANCE (New England Nuclear) and fluorographed overnight. Preparation of permeabilized yeast cells

Permeabilized yeast cells (PYC), suitable for use in determining Golgi nucleotide- sugar transport, were prepared as described (20) with modifications. 100-200 ml of cells were grown in YPAD medium containing 0.5 M KC1 at 30°C to an OD₆oo of 1- 2. After harvesting, cells were suspended at 50 OD unit/ml in (100 mM Tris-HCl, pH 9.4; 10 mM DTT) and kept at room temperature for 5 min. The cells were

10 centrifuged and resuspended at 50 OD unit/ml in (0.75 X YPA, 0.5% glucose, 0.7 M sorbitol, 10 mM Tris-HCl, pH 7.5) and 10 U lyticase/OD unit of cells was added to form spheroplasts. After 20 minutes incubation at 30°C, over 80% of the yeast cells were converted to spheroplasts. Spheroplasts were centrifuged at 1,500 X g for 3

15 min and resuspended in 0.75 X YPA containing 0.7 M sorbitol and 1% glucose.

After incubating at 30°C for 20 minutes to allow metabolic recovery, cells were washed with the buffer (400mM sorbitol; 20 mM HEPES, pH 6.8; 150 mM potassium acetate; 2 mM magnesium acetate) and resuspended in buffer at 300 OD unit/ml. For permeabilization, aliquots of PYCs were slowly frozen over liquid

20 nitrogen for 1 hour and immediately transfered to -70°C. GDP-mannose Transport Assay Using Permeabilized Yeast Cells GDP-mannose transport was measured in permeabilized spheroplasts. Reactions contained 20 mM HEPES (pH6.8); 150 mM potassium acetate, 250 mM sorbitol, 5

25 mM magnesium acetate; 3 μM GDP mannose and 50 nCi GDP- [³H] -mannose (15

Ci/mmole) in a final volume of 25 μl. Permeabilized cells were thawed quickly and washed three times with 1 ml of ice cold reaction buffer (buffer H) (20 mM HEPES, pH6.8; 150 mM potassium acetate, 250 mM sorbitol, 5 mM magnesium acetate) to

_? remove cytosol and endogenous GDP-mannose. Membranes were concentrated to one half the original volume in buffer H. Reactions were initiated by mixing 5 μl of membranes (containing 10-20 μg of protein) with 20 μl reaction buffer, bringing the final protein concentration to 0.4-0.8 mg/ml. Protein concentrations were determined using the BCA reagent (Pierce Chemical Co, Rockford, IL) 5 After incubating at 30°C for 6 min, the reaction was stopped by adding 0.5 ml of ice-cold buffer H and samples were placed on ice. Membranes were pelleted by centrifugation at either 14,000 X g or 100,000 X g in an ultracentrifuge (Beckman Optima TL). Free radioactive solutes were removed by washing the membrane pellet three times with 1.0 ml of ice-cold buffer H. Pellets were resuspended in 100 μl 0.1% Triton X-100 and 50 μl sample was removed, added to 1 ml of scintillation mix and radioactivity quantitated in a scintillation counter. The amount of GDP-[ H] mannose that non-specifically bound to the outside of membrane was determined by measuring radioactivity of membranes at zero time of incubation and subtracting from the value of solutes associated with the membranes. The percent activity was calculated by dividing this value by the total cpm in the reaction [% transport activity = (CPM in pellet_{6 mm}- CPM in pelleto _mm)/CPM otai]- Each value was normalized by dividing the percent transport activity by the total amount of protein in each reaction, when comparing PYC preparations of different strains. Guanosine Diphosphatase assay

GDPase was assayed as described (7) in solubilized PI 00 fractions prepared from PYCs from strains JPY25 6c (VRG4) or JPY26 3d (vrg4-2). Inorganic phosphate was determined by the method of Ames (21). One unit of GDPase is defined as the activity that releases 1 nmole of inorganic phosphate per minute. Background values, determined by assaying reactions that lacked substrate or protein were subtracted to give the values described. Example 4

The vrg4 mutant is defective in both N- and O-linked sugar modifications VRG4 is required for TV-linked glycosylation (10-12). To assay for effects on O-linked glycosylation, we examined the glycosylation state of chitinase. Chitinase is a secreted protein that contains carbohydrates that are exclusively O- linked. Therefore, any effect on O-linked glycosylation can be detected by an electrophoretic mobility shift (22). Whole cell extracts were prepared from isogenic wild type and vrg4 cells and assayed by immunoblotting, using anti-chitinase antiserum. As a control, chitinase mobility was also examined in cells containing an mnnlO-2 mutation, which are defective only in N-linked glycosylation (23). A ° mobility shift was detected in chitinase from vrg4-2 when compared to wild type cells, but not in mnnlO-2 cells (Figure 1). This result demonstrates that the vrg4 mutation affects ( -linked glycosylation and therefore is required for the glycosylation of both classes of proteins.

Example 5

The vrg4 mutant is defective in sphingolipid mannosylation vrg4 cells display an aberrant morphology of intracellular membranes when viewed by electron microscopy (12). In vrg4 mutants, membranes accumulate but stain poorly with potassium permanganate. This

10 observation suggested that the VRG4 gene product may be required for maintaining the normal protein/lipid ratio of these Golgi membranes whose staining properties are altered by the vrg4 mutation. The synthesis of sphingolipids in yeast requires vesicular transport to the Golgi, and suggests that their synthesis occurs in this

, ,- compartment (24). Therefore, it was of interest to determine whether the vrg4 mutation affected sphingolipid biosynthesis. In S. cerevisiae, there are three major classes of sphingolipids. These include the inositolphosphorylceremides (IPCs) and the mannosylinositolphosphorylceramides (MIPC, and M(IP)₂C) (see reference 5 for review). To test the idea that VRG4 is required for sphingolipid biosynthesis, we 0 compared [ H]-inositol-labeled lipids in isogenic vrg4-2 mutant and wild type strains. Cells were labeled for 10 minutes with [ H]-inositol and chased for 20 or

40 minutes. Lipids were extracted and analysed by thin layer chromatography. The most significant difference between wild type and vrg4-2 cells was the failure of the 5 vrg4-2 strain to accumulate MIPC and M(IP)₂C (Figure 2). These results demonstrate that VRG4 is required for the biosynthesis of sphingolipids and suggest that the defect specifically affects the mannosylated forms.

Example 6

Development of an in vitro GDP-mannose transport based on permeabilized yeast cells.

The effect of the vrg4 mutation on glycoprotein and sphingolipid biosynthesis suggested that VRG4 is generally required for mannosylation in the

Golgi. A simple model that could explain the pleiotropic phenotype of the vrg4 5 ⁰ mutant is that VRG4 is required for the accumulation or transport of GDP-mannose into the lumen of the Golgi.

To test this model, GDP-mannose transport activity was compared in isogenic wild type and vrg4-2 mutant strains. Lumenal GDP-mannose transport in vitro in yeast has been characterized using crude Golgi-enriched vesicles (7). Using this system, we routinely observed a decrease in the activity of mutant membranes compared to wild type (data not shown). However, this method involves large scale cell preparations, where reactions typically require the addition of milligram quantities of protein. To allow the processing of more samples simultaneously for 10 comparative purposes we sought to develop another system to measure GDP-

[Ηjmannose transport at an analytical scale. For this purpose, permeabilized yeast cells (PYCs) were used. PYCs are highly competent for glycosylation in vitro when supplemented with GDP-mannose (20) and therefore must be capable of efficient , _- lumenal GDP-mannose transport.

GDP-mannose transport was characterized in permeabilized yeast cells containing a dpml mutation that results in a 90%-95% decrease of dolichol- phosphate-mannose synthase (Dpml) activity in vitro (25). This mutant background was required to eliminate a competing reaction catalyzed by Dpmlp, in 0 which GDP-mannose donates mannose to form dolichol-phosphate-mannose (Dol- P-Man) that in turn acts as the mannose donor for glycosylation in the ER. This ER reaction, which is quite efficient in vitro, would otherwise obscure the Golgi transport of GDP-mannose (7). A comparison of the [ H]-mannose uptake into 5 sealed membranes of isogenic strains that were wild type (JPY25 6b) or that contained the dpml mutation (JPY25 6c) demonstrated that mannose incorporation into Dol-P-Man accounted for greater than 60% of the observed [³H] uptake (data not shown). Therefore, all of the experiments described below were conducted with isogenic strains harboring the dpml mutation, which did not otherwise effect the 0 growth properties of these strains (data not shown).

To assay GDP-mannose uptake, after incubating PYCs in the presence of GDP-[³H]mannose, the amount of [³H] -mannose associated with washed vesicles was compared to that which remained in the supernatant (SI 00). 5 Vesicles were prepared by centrifugation at 100.000 X g (PI 00) with extensive ⁰ washes to remove bound radiosolutes. A time course of [Η] uptake suggested that transport of GDP-mannose was quite efficient. Typically 20-30 % of the [Η] in the reaction was recovered in the PI 00 fraction after 6-8 min, corresponding to an uptake of about 25 pmoles of GDP mannose (Figure 3 A). The rate of transport was linear with time up to 6 min (Figure 3A) and with protein concentration in a range from 0.4 to 1.2 mg/ml (Figure 3B). Transport was temperature dependent; optimal transport occurred at 30° C, was slightly reduced at 25 and 42°C and inhibited at temperatures above 60°C (data not shown).

GDP-mannose uptake was completely inhibited by the addition of

10 detergent (0.1 % Triton X-l 00) with transport reduced to less than 2%, demonstrating that the accumulation of GDP-mannose requires intact vesicles. Similarly, inclusion of 4 mM 4,4-diisothiocyanostilbene-2,2-disulfonic acid (DIDS), a stilbene derivative that is known to inhibit transport of nucleotide sugars in both

, - mammalian (26) and yeast (7) systems completely inhibited activity. As demonstrated previously, (7), transport was not dependent on energy nor on divalent cations as the addition of ATP, Mg⁺⁺ or EDTA did not affect the efficiency of transport (data not shown). However, we infer that removal of Mg⁺⁺ or inclusion of EDTA did affect the activity of endogenous acceptor glycosyltransferases that 0 utilized the labeled mannose, since the transport was stimulated about two fold in the presence of Mg⁺⁺ (data not shown).

The physical properties of lumenal radioactive material was examined by analyzing the transport reaction products after phase partitioning. This 5 separates lipid-linked oligosaccharides, which partition into the organic phase from protein-linked oligosaccharide, which are insoluble in chloroform/methanol. After allowing the transport reaction to occur for six minutes, PYCs were extracted to separate lipid, protein and water soluble products as described by Waechter et al (27). By this assay, most of the radioactive products (87%) that associated with the membranes were water soluble (GDP-mannose) or chloroform/methanol insoluble (protein). We conclude that GDP-mannose transport in PYCs appears to have all of the hallmarks previously described for this activity in crude Golgi membranes (7).

5 Example 7

The VRG4 gene product is required for lumenal Golgi GDP-mannose translocation.

To test the model that VRG4 is required for GDP-mannose transport, PYCs were prepared in parallel from wild type and vrg4 mutant cells and their transport activity was compared. Transport activity in VRG4 (JPY25 6c and vrg4-2 (JPY26 3d) strains was examined as a function of time. In contrast to wild type cells, where greater than 25 % of the exogenous GDP-[ H]-mannose was transported, vrg4-2 membranes displayed a severe defect in GDP mannose uptake (< 2 % transport) (Figure 4). This defect was partially complemented in the vrg4-2 mutant strain by a plasmid bearing the VRG4 gene (Figure 4). This is consistent with the observation that this plasmid does not fully complement the vrg4-2 mutant glycosylation phenotype in vivo (data not shown). To determine whether the effect of the vrg4-2 mutation was specific for GDP-mannose uptake, the activity of another Golgi protein was assayed in solubihzed PI 00 fractions prepared from wild type and vrg4-2 PYCs. As shown in Table II, the level of GDPase activity in wild type or vrg^-2-derived PI 00 fractions was essentially indistinguishable. Vrg4p is therefore specifically required for GDP- mannose uptake.

Table 11. Guanosine Diphosphatase activity in vrg4-2 and VRG4 extracts

Extract U*/μ protein vrg4-2 9.6

VRG4 20.6

Membranes were prepared from the isogenic strains JPY25 6c (VRG4) or JPY26 3d (vrg4-2) and assayed for hydrolysis of GDP, as described (7, 21).

* One unit is defined as the activity that releases 1 nmole of inorganic phosphate per minute. Background values, determined by assaying reactions that lacked substrate (GDP) or protein were subtracted to give the values listed above. Example 8

VRG4 is a resident Golgi protein

The VRG4 gene product is required for a number of different Golgi functions (12). If these effects are due to its role in nucleotide sugar uptake, Vrg4p would be predicted to reside in the Golgi complex. To determine the intracellular localization of Vrg4p, the VRG4 gene was tagged at the carboxy terminus with three tandem copies of the HA epitope (see Materials and Methods). Even when tagged with three copies of the HA epitope, when expressed as a single copyNrg4-HA3p in whole cell extracts was barely detectable by immunoblot analyses (Figure 5A). Although the HA-tagged form of VRG4 did not complement the slow growth phenotype of the vrg4-2 mutant to the same extent as the wild type VRG4 gene, it was able to complement the sensitivity to hygromycin B as well as the lethality of a VRG4 deletion (data not shown). This suggests that the C-terminal addition of the HA-epitope does not significantly alter the normal function of the Vrg4 protein.

The intracellular location of Vrg4-HA3p was examined by indirect immunofluorescence, using antibody directed at the HA epitope. A punctate pattern of fluorescence, characteristic of the Golgi complex, was observed in cells expressing Vrg4-HA3p (Figure 5B). This staining pattern was similar to another

Golgi-localized protein, Ochlp, an initiating l,6 mannosyltransferase (Figure 5B). One difference in the staining pattern of these two proteins was that generally more punctate spots were observed in the Vrg4-HA3p expressing cells. In most of the

Vrg4-HA3p-expressing cells observed, the average number of HA-staining spots per cell observed by shifting the plane of focus was 20-25. This was confirmed by performing a Z-series in which the analysis of optical sections of 1 μ thickness through individual cells indicated an average number of 25 spots per cell (data not shown). Cells expressing Ochl-HA3p contained between 7-10 spots/cell and no qualitative differences were observed in cells overexpressing Ochlp. From these results, we conclude that Vrg4p resides in the Golgi complex. Taken together with immunoelectronmicroscopy studies which suggest that the yeast Golgi is comprised of about 30 spot-like structures (28), it appears that unlike the more spatially restricted Ochlp, the Vrg4 protein is broadly distributed throughout the Golgi complex. Example 9

Homology to VRG4 predicts the existence of other putative S. cerevisiae nucleotide sugar transporters.

VRG4 encodes a highly conserved protein. Thirteen different members have been identified including the Leishmania LPG2 and the Kluyveromyces lactis MNN2 gene products (12, 29, 30). In the case of Lpg2p and Mnn2p, both proteins have been implicated as nucleotide sugar transporters (29-31). A search of the S. cerevisiae genome data base identified several other yeast ORFs with sequence similarity to Vrg4, suggesting that these putative proteins may function in nucleotide sugar transport. These putative yeast proteins are listed by ORF name in Table III. One of these ORFs (Yer039p), which we have designated HVG1 (for Homologous to VRG4) encodes a predicted protein that is highly similar to Vrg4p (80% identical). Although the other proteins listed in Table III are more distantly related to Vrg4 and Hvglp (about 25% identical and 45% similar along their length), each of these proteins are of a similar size (35-45 kD) and have a similar predicted structure, as inferred by the near overlap of their respective hydrophobicity profiles (data not shown).

Table III. Putative Vrg4p yeast homolosues

ORF % identity % similarity

Yer039p 81 92

(HVG1)

Yel004p 36 55

Ymd8 26 42

Yor306c 26 42

Yml018c 25 41 The Vrg4 protein sequence was used to search the S. cerevisiae genome data base using the BLAST algorithm (42) and the identified proteins were aligned using DNASTAR MegAlign program with the Clustal algorithm. The accession numbers for each are as follows: (hvgl=Yem9/yer039p accession # P40027); Yea4/yel004p accession # P40004; YMD8 accession # Q03697; Yor306c, accession #Q04835; Yml018C accession # Z46659x21.

Because of the high degree of identity to Vrg4p, it was of interest to examine the Hvgl protein and the phenotype of the null mutant. The predicted ORF and flanking sequences were cloned by PCR amplification of yeast genomic DNA (see Materials and Methods). To determine whether the HVG1 gene could complement the vrg4 mutation, the HVG1 gene was introduced into the vrg4-2 mutant strain (NDY5) in either a single and high copy expression plasmid. Though the encoded gene products are remarkably similar, the HVG1 gene does not complement the glycosylation and slow growth phenotype of the vrg4-2 mutant or the inviability of the null vrg4 allele. Unlike VRG4, which is required for viability, a deletion of HVG1 has no discernible effect on the growth properties of vegetatively growing cells. Similarly, the vrg4-2 hvgl double mutant did not display any synthetic phenotype and PYCs prepared from the hvg mutant had wild type levels of GDP-mannose transport activity (data not shown). These results demonstrate that the Hvglp and Vrg4 proteins do not perform overlapping functions. They also suggest that either Hvglp performs a function that is redundant to another, as yet unidentified protein(s) or that its function is completely dispensable for vegetative growth of yeast.

Example 10 We have undertaken a functional analysis of Vrg4p as a model for understanding nucleotide sugar transport in the Golgi. We analyzed epitope tagged alleles of VRG4 which were fused with either the myc or HA epitope. Results from co-immunoprecipitation experiments demonstrate that the Vrg4 protein multimerizes with specificity and high affinity, both in vivo and in vitro. The molecular weight of the Vrg4p-containing complex calculated by gel filtration is twice that of the monomer, suggesting that the active enzyme is a dimer of identical subunits. In addition to the wild type protein, we have also characterized a protein encoded by a mutant allele of VRG4. Although the mutant protein is catalytically inactive for nucleotide sugar - transport, it maintains the ability to multimerize, is localized normally to the Golgi, and is as stable as its wild type counterpart. Sequence analysis of the vrg4-2 allele reveals a single base pair alteration that changes an alanine to an aspartate residue. This alanine is embedded in a region that is highly conserved in other GDP-mannose transporters but has diverged in transporters of other nucleotide sugars. These results are consistent with a model in which this amino acid identifies a site that is involved in binding to or transport of GDP-mannose.

MATERIAL AND METHODS

Yeast Strains and Media Standard yeast media and genetic techniques were used (48). Hygromycin B sensitivity was tested on yeast extract/peptone/ adenine sulfate/dextrose plates (YPAD) supplemented with 50μg/ml hygromycin B (Boehringer Mannheim) as described (49). The wild type strain used was SEY6210 (MATα ura3-52 leu2-3,l 12 his3-A200 trpl-Δ901 / 2-801 suc2A9) NDY5 (MATα wrα3-52 /ew2-21 1 vrg4-2)

(12) was used as the source of genomic DNA for the cloning of the vrg4-2 allele. The isogenic parental strain is RSY255 (MATα ura3-52 leu2-2l 1). Cloning and DNA sequence analysis of the vrg4-2 allele

A 1.35-kB fragment containing the vrg4-2 open reading frame and 237 base pairs of 5' and 72 base pairs of 3' flanking sequences was amplified by PCR using LA Taq thermophilic DNA polymerase (TaKaRa Shuzo, Japan) from genomic DNA isolated from the vrg4-2 strain, NDY5 (12), using the following primers: 5'CGTAATGAATCGCAATATACG3' (SEQ. ID No: 25) and 5 TGCATTAGATGCCTCTATAA3' (SEQ. ID No: 26). LA Taq polymerase has the same high fidelity as Pfu, but like Taq polymerase, lacks the 3' to 5' proofreading exonuclease activity. This results in PCR products containing TA overhangs that were directly cloned into the pCRII-TA cloning vector (In Vitrogen) to generate pCRIIvrg4-2. Plasmids from three independent clones were isolated and the sequence from each of these was compared to the VRG4 gene isolated by PCR from the isogenic parental strain and cloned in the same way to exclude PCR- derived mutations. DNA sequencing was performed by the dideoxy chain termination method (43) as described (50) using the Thermo Sequenase cycle sequencing kit (Amersham Pharmacia Biotech). DNA sequence analysis was performed using an automated LI-COR 4000L DNA sequencer. Construction of plasmids

Standard molecular biology techniques were used for all plasmid constructions (45). DNA sequence analysis identified-a single C to A base pair change at nucleotide 857 in the vrg4-2 allele. To construct a series of equivalent expression plasmids containing either the VRG4 or vrg4-2 allele that differ only in this mutation, a 251 base pair Hpal/Mfel fragment from pCRIIvrg4-2, containing this point mutation, was used to replace the same region in the wild type VRG4 gene. The plasmid, pRS316Vrg4-A286D, was made by replacing this fragment in pRHL (12) which contains the VRG4 gene under its own promoter on an

EcoRI/Hindlll fragment in pRS316, a CEN6/URA3 vector (46). pRS316Vrg4-A286D-HA₃ encodes the Vrg4-A286D mutant protein tagged with three copies of the HA epitope at the C-terminus in pRS316. It was constructed by replacing a Hpal/Mfel fragment of pRHL-HA₃ (51), with the Hpal/Mfel fragment from pCRIIvrg4-2. To construct YEp352-Vrg4-A286D-HA₃, which contains the HA-tagged vrg4-2 allele on a 2μ/URA3 plasmid, a Hindlll/Xbal fragment from pRS316 Vrg4-A286D-HA₃, containing the entire Vrg4-A286D-HA₃, was subcloned into YEp352 (52).

To construct pRHL-myc₃, the VRG4 gene was cloned in-frame to three copies of the myc epitope. A fragment containing the VRG4 ORF, lacking the stop codon and flanked by a 5' Hindlϊl and a 3' Nsil site was isolated by PCR. This fragment was cloned into Hindϊll-Pstl digested pSK /X myc₃, a Bluescript SK^" derivative (Stratagene). pSKT/X myc₃ carries a 172 bp fragment containing sequences that encode three tandem copies of the myc epitope (EQKLISEEDL) (SEQ. ID No: 27) cloned between the Pstl and Xbal sites. Thus, the SKNRG4-myc₃ construct contains an in-frame fusion of the three copies of the myc epitope to the carboxy terminus of Vrg4p. SK VRG4-myc₃ was used to generate pRHL-myc₃ which contains VRG4-mycτ, on an EcoRI/Hm<ΛII fragment in pRS316. A myc-tagged vrg4-A286D allele was constructed in several steps. First, a fragment containing the 3' end of vrg4-A286D-HA₃ including the triple HA tag but lacking the point mutation, on an Mfel l/Sac I fragment, was replaced by the corresponding MfellSacl fragment from VRG4-myc_?,. The resulting plasmid, pRS316-Vrg4-A286D-myc₃ contains the myc-tagged vrg4-2 allele in pRS316. A 1.3 kB Hindlll/Xbal fragment containing the entire vrg4-A286D-m_yc₃ ORF and promoter sequences was subcloned into YEplacl81, a LEU2/2μ vector to generate YEpLacl81Nrg4-A286D-myc₃.

An HA-tagged GDA 1 plasmid was created by introducing a Sail lEco RI site 5' and 3' to the GDA 1 ORF by PCR. After digestion with Sail and EcoRI, this fragment was ligated into the Sα/I/EcøRI site of pSKT/X HA₃ plasmid (15) to produce pSK^"GDAl-HA₃. This results in the in-frame fusion of GDA l with sequences encoding 3 copies of the HA epitope at the 3' terminus, followed by a stop codon. The sequence of PSKODAI-HA₃ was confirmed by DΝA sequencing as described above. Finally, the Sall/Not fragment containing GDAI-HA₃ from pSK^"GDAl-HA₃ was subcloned into a HIS3/2μ expression vector, pYO323 (53) to generate pY0323 GDAI-HA3. Preparation of cell free lysates

Exponentially growing yeast cells (A600: 1-3) were harvested and converted to spheroplasts with lyticase (SIGMA), as described (59). Spheroplasts were resuspended in 400 μl of ice cold lysis buffer (150 mM ΝaCl, 10 mM HEPES-KOH (pH7.5), 5 mM MgCl₂, 1 mM PMSF) containing either 1% digitonin or 1% Triton X-100 to solubilize membrane proteins, and centrifuged for 5 min at 4°C at 14 kG to remove debris. These detergent extracts were used for both FPLC analysis and the co-immunopreciptation assays described below. Whole cell protein extracts were prepared by TCA precipitation, as described (59). For preparation of a membrane fraction, 50 A₆₀o units of cells were spheroplasted using lyticase (59). The spheroplasts were resuspended in 1 ml cold lysis buffer (0.1 M Sorbitol, 50 mM Potassium Acetate, 2 mM EDTA, 20 mM~ HEPES (pH7.4), 1 mM DTT) containing a protease inhibitor cocktail (1 mM phenylmethylsulfonyl fluoride (PMSF), 1 μg/ml pepstatin, 50 μg/ml Ν - Tosyl-L- lysine chloromethyl ketone, (TLCK) 1 OOμg/ml Ν-Tosyl-L-phenylalanine chloromethyl ketone (TPCK) and 100 μg/ml Trypsin inhibitor). Lysis was carried out by dounce homogenization (25 strokes) on ice and unbroken cells were removed from the lysate by centrifugation for 5 min in a microfuge. Membranes were isolated by centrifugation at 100 kG for 30 min in a Beckman optima TL ultracentrifuge. The membrane pellet was resuspended in 150μl lysis buffer and used for protease protection assays (see below). Co-immunoprecipitation, western immunoblotting and immunofluorescence

The HA-tagged proteins were immunoprecipitated by incubating 400ul of the detergent extract (described above) with 200 μl of a hybridoma cell cultpre supematants containing the 12CA5 monoclonal anti-HA antibody and 25 μl of protein A-Sepharose (Pharmacia) at room temperature for 2 hours. The protein A- Sepharose beads and associated proteins were centrifuged and washed three times with the same lysis buffer ( 1% digitonin or 1% Triton X-100; 150 mM NaCI, 50 mM HEPES-KOH (pH7.5), 5 mM MgCl₂, 1 mM PMSF). After resuspending in Laemmli's sample buffer and solubilizing at 45°C for 3 min, immunoprecipitates were fractionated by 10% SDS-PAGE, transferred to Immobilon-PVDF membranes (Millipore) and immunoblotted with anti-myc A- 14 polyclonal antibodies (Santa Cruz Biotechnology). Secondary anti-rabbit antibodies conjugated to horseradish peroxidase (Amersham) were used at a 1 :3000 dilution and detected by chemiluminescence (ECL, Amersham) followed by autoradiography.

Indirect immunofluorescence of yeast cells expressing Vrg4-HAp or Vrg4 A286D-HA was performed as described (51). Samples were observed with a Zeiss Axioscop and photographed with a Sony DXC-9000 cooled CCD camera. Images were captured using NIH Image software and all processing was done with Canvas version 5 (Deneba).

RESULTS

The Vrg4 protein multimerizes in vivo and in vitro

To examine whether the Vrg4 protein functions as a monomer or in a higher order structure, a co-immunoprecipitation assay was first used to determine whether the Vrg4 protein can interact with itself. A yeast strain was constructed that co- expressed both an HA- and myc-tagged allele of VRG4 on high copy plasmids. Both of these tagged alleles can complement the hygromycin B sensitivity of a vrg4 mutant, although not as well as the untagged alleles. indicating that these epitopes do not significantly alter the normal function of Vrg4p. Membrane proteins from this strain were solubihzed with 1% digitonin and immunoprecipitated with the 12CA5 anti-HA monoclonal antibody. To measure the relative amount of Vrg4-myc protein that associated with the HA-tagged Vrg4p. the precipitates were fractionated by SDS-PAGE and immunoblotted with a rabbit antiserum against the myc epitope (Figure 10A). Vrg4-mycp efficiently co-precipitated with Vrg4-HA, since it could only be detected in the presence of extracts containing Vrg4-HA (Figure 10A,

10 compare lanes 1 and 2). Similar results were obtained if the anti-myc antibody was used for the immunoprecipitation and the anti-HA antibody was used for western blotting (not shown), indicating that co-precipitation is not dependent on the antibody. Though strains coexpressing high levels of Vrg4-HAp and Vrg4-mycp

15 were used for the experiment shown in Figure 10A, Vrg4p multimerized as efficiently when the epitope-tagged proteins were expressed from low copy CEN- containing vectors or when the proteins were expressed from epitope-tagged chromosomal alleles (not shown). These results suggest that Vrg4p multimerizes

20 efficiently.

Vrg4p is very hydrophobic, containing six to eight predicted membrane spanning domains. As a control for non-specific aggregation due to its hydrophobicity, we examined whether we could detect an interaction of Vrg4p with other membrane proteins. Neither Gdal-HAp (Figure 10B, lane 4), Yndl-HAp (not

25 shown) which are Golgi localized GDPases with single transmembrane domains, nor Pmalp (not shown), a plasma membrane protein that contains 10 predicted transmembrane domains, co-precipitated with Vrg4-mycp, suggesting that Vrg4p oligomerization is not due to nonspecific hydrophobic interactions.

30 To determine if the observed Vrg4p-containing complex had assembled in vivo, we performed a mixing experiment in which digitonin extracts were prepared from strains that expressed either Vrg4-mycp or Vrg4-HAp. These extracts were combined together prior to immunoprecipitation with anti-HA antibody. Following

- . fractionation by SDS-PAGE, no Vrg4-mycp could be detected in the precipitate (Figure 10A, lane 3), demonstrating that the complex had stably formed in vivo and did not disassemble in the presence of digitonin in vitro.

In the course of determining optimal conditions for extracting Vrg4p- containing complexes, we noticed that the Vrg4p-containing complex behaved differently in Triton X-100 than in digitonin. As was observed with digitonin, stable Vrg4p ohgomers could be extracted from yeast solubihzed with 1% Triton X-1OO since Vrg4-mycp efficiently co-precipitated with Vrg4HA and could only be detected in the presence of extracts containing Vrg4HAp (Figure 10B, lanes 1 and 2). However, when Triton extracts from strains expressing Vrg4-mycp or Vrg4- HAp were mixed together prior to immunoprecipitation with anti-HA antibodies, a substantial amount of Vrg4mycp precipitated with Vrg4-HAp (Figure 10B, lane 3). The strains used for these experiments contain the endogenous, untagged Vrg4p in addition to the epitope-tagged version. Presumably the tagged and untagged forms of Vrg4p form a complex with one another in vivo. Therefore, any association between Vrg4-mycp and Vrg4-HAp that we observed in vitro required the disassembly of complexes that had assembled in vivo. The amount of Vrg4mycp that co-precipitated with Vrg4-HAp after mixing was three fold reduced from that which co-precipitated from extracts that were prepared from cells co-expressing these two proteins (Figure 10B, lanes 2 and 3), suggesting that the Vrg4p-containing complex is less stable in Triton X-1OO than in digitonin. Vrg4 multimerization in Triton is specific since its association with other membrane proteins, such as Gdal- mycp (Figure 10B, lane 4) or Yndl-mycp (not shown) was not observed. This was the case in extracts from strains coexpressing these control proteins and Vrg4-HA (not shown), or in extracts containing each of these proteins individually that were mixed prior to immunoprecipitation (Figure 10B, lane 4). Taken together, these results demonstrate that Vrg4p has the capacity to multimerize with high specificity and efficiency both in vivo and in vitro.

The mutant protein encoded by the vrg4-2 allele is stable and retains the ability to form protein interactions.

Although a deletion of the VRG4 gene is lethal, we previously isolated a viable allele of vrg4 that has a severe glycosylation phenotype both in vivo and in vitro. vrg4-2 strains display a level of nucleotide sugar transport activity in vitro that is about twenty five fold reduced from those of wild type strains. To analyze the mutant protein in yeast extracts, the vrg4-2 allele was cloned by PCR amplification of genomic DNA from a vrg4-2 mutant strain and tagged with either the HA-or myc epitope appended to the C-terminus (see Materials and Methods). The isolation of the mutant allele was confirmed by sequence analysis (see below), by testing its inability to complement the hygromycin B growth sensitivity of the vrg4-2 mutant strain (Figure 11 A), and by western blot analysis (Figure 1 IB).

Sequence analysis demonstrated that the vrg4-2 allele contains a single point mutation that changes an alanine at position 286 to an aspartate (see below). 0 Therefore, this mutant protein will be referred to as Vrg4-A286Dp. To determine if the A286D mutation altered protein stability, the steady state level of the HA-tagged mutant protein was compared to the normal Vrg4-HA protein by western blot analysis with the anti-HA antibody (Figure 1 IB). By this assay, we found that the 5 steady state levels of the mutant and wild type Vrg4 proteins were virtually indistinguishable, when expressed from either a low copy, CEN vector (Figure 1 IB, compare lanes 2 and 3) or a high copy, 2μ vector (Figure 1 IB, compare lanes 4 and 5). These results demonstrate that the Vrg4 A286D-HA protein is as stable as its 0 wild type counterpart.

Multimerization of the mutant Vrg4 A286D-HA was examined using a co- immunoprecipitation assay. Yeast strains were constructed that co-express in either the mutant and wild type Vrg4 proteins that were HA- and myc-tagged, respectively, or that co-express the HA- and myc- tagged mutant Vrg4-A286D 5 protein. The relative affinity of the mutant protein for itself and for the wild type Vrg4 protein was compared by quantitating the amount of Vrg4 A286Dmycp that precipitated with anti-HA antibody in detergent extracts. The Vrg4A286D mutant protein could multimerize as well as the wild type Vrg4 protein since equal amounts 0 of Vrg4 A286D-mycp precipitated with both Vrg4-HAp and Vrg4-A286D-HAp

(Figure 12, lanes 2 and 3 ). This was similar, but not identical to the amount of wild type Vrg4 protein that precipitated with itself which was typically observed to be in the range of 1.5 to 3 fold greater (Figure 12. compare 3 and 4). r The Vrg4-A286D protein is correctly localized to the Golgi The vrg4-2 mutation causes a severe underglycosylation of both proteins and lipids. In addition, this mutant displays levels of GDP-mannose transport activity in vitro that are at background levels. Since the Vrg4-A286D mutant protein is stable and also retains the ability to homo-dimerize, this raised the question of what is the biochemical basis for the loss of nucleotide transport activity. GDP-mannose transport activity is associated with Golgi membranes and the Vrg4-HA protein is localized to the yeast Golgi. One possible explanation for its inactivity is that Vrg4 A286Dp fails to exit the ER. To test whether the mutant Vrg4-A286D protein is mislocalized, we compared its intracellular location to that of the normal Vrg4 protein. Cells expressing VRG4-HA or vrg4-A286D-HA were fixed with formaldehyde and the HA-tagged proteins were detected by indirect immunofluorescence using antibodies directed against the HA-epitope. By this assay, the mutant protein displayed the same punctate pattern characteristic of the yeast Golgi that is observed for the wild type Vrg4 protein that is distinct from the perinuclear, ER staining (Figure 13A-13D) suggesting that the mutant protein is correctly localized to the Golgi. Therefore, the inactivity of the mutant Vrg4 A286D protein is not due to its mislocalization. Sequence analysis of the mutant vrg4-2 allele

The results described above indicated that the vrg4-2 allele contains a mutation that affects nucleotide sugar transport, but that does not affect homo- oligomerization, Golgi localization or protein stability. To identify the molecular basis for this mutant phenotype, the sequence of the vrg4-2 mutant allele was determined. The mutant gene was cloned using a PCR approach (see Materials and

Methods). A comparison of the DNA sequence from three independent clones containing the mutant allele to the wild type VRG4 gene revealed a single C to A base pair change at nucleotide position 857. This point mutation results in the replacement of an alanine with an aspartate at position 286 whose location in the protein is shown graphically in the hydropathy plot in Figure 14A. This amino acid is located in a region of Vrg4p that is particularly conserved-among Vrg4-related proteins (Figure 14B).

Example 11 Figure 15A and 15 B show complementation of the S. cerevisiae vrg-4 mutant by the Candida VRG4 gene. This figure demonstrates that the isolated gene is not just a structural homologue but also a functional homologue, i.e.. that the isolated C. albicans VRG4 gene is a bonafide GDP-mannose transporter. The second important point of this datum is that the Candida gene functions in S. cerevisiae, which means that method aimed at inhibition of the Candida protein can be performed in this nonpathogenic strain, rather than in Candida.

References

1. Herscovics, A., and Orlean, P. (1993) FASEB J. 7, 540-550

2. Ballou, C. E. (1990) Methods Enzymol. 185, 440-470

3. Gentzsch, M., and Tanner, W. (1996) EMBO J. 15, 5752-5759

4. Gentzsch, M., and Tanner, W. (1997) Glycobiology 7, 481-486

5. Lester, R. L., and Dickson, R. C. (1993) Adv. in Lipid Res. 26, 253-274

6. Smith, S. W., and Lester, R. L. (1974) J. Biol. Chem 249, 3395-3405

7. Abeijon, C, Orlean, P., Robbins, P. W., and Hirschberg, C. B. (1989) Proc. Natl. Acad. Sci U.S.A. 86, 6935-6939

8. Abeijon, C, Yanagisawa, K., Mandon, E. C, Hausler, A., Moremen, K., Hirschberg, C. B., and Robbins, P. W. (1993) J. Cell Biol. 122(2), 307-323

9. Hirschberg, C. B., and Snider, M. D. (1987) Annu. Rev. Biochem. 56, 63-87

10. Ballou, L., Hitzeman, R. A., Lewis, M. S., and Ballou, C. E. (1991) Proc. Natl. Acad. Sci. 88, 3209-3212

1 1. Kanik-Enulat, C, Montalvo, E., and Neff, N. (1995) Genetics 140(3), 933-943

12. Poster, J. B., and Dean, N. (1996) J. Biol. Chem. 211, 3837-3845

13. Sherman, F., Fink, G. R., and Hicks, J. B. (1983) Methods in Yeast Genetics: Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor

14. Ito, H. Y., Fukuda, Y., Murata, K., and Kimura, J. (1983) J. Bacteriol. 153, 163-168

15. Neiman, A. M., Mhaiskar, V., Manus, V., Galibert, F., and Dean, N. (1997) Genetics 145, 637-645 16. Alber, T., and Kawasaki, G. (1982) J Mol Appl Genet 1, 419-434

17. Cottarel, G. (1995) Curr. Genet. 28, 380-383

18. Wickerham, L. J. (1946) J. Bacteriol. 52, 293-301

19. Krakow, J. L., Hereld, D., Bangs, j. D., Hart, G. W., and Englund, P. T. (1986) J. Biol. Chem. 261, 12147-12153

20. Baker, D., Hicke, L., Rexach, M., Schleyer, M., and Schekman, R. (1988) Cell 54, 335-344

21. Ames, B. N. (1966) Methods Enzymol. 8, 115-118

22. Kuranda, M. J., and Robbins, P. W. (1991) J. Biol Chem. 266, 19758-19767

23. Dean. N.. and Poster, j. (1996) Glycobiology 6, 73-81 24. Puoti, A., Desponds, C, and Conzelmann, A. (1991) J. Cell Biol. 113, 515-525

25. Orlean, P.. Albright, C, and Robbins, P. W. (1988) J. Biol. Chem. 263, 17499- 17507

26. Perez, M., and Hirschberg, C. B. (1987) Methods Enzymol. 138, 709-715

27. Waechter, C. J., Lucas, J. J., and Lennarz, W. j. (1973) J. Biol. Chem. 248, 7570-7579

28. Preuss, D., Mulholland, J., Franzusoff, A., Segev, N., and Botstein, D. (1992) Mol. Biol. Cell. 3, 782-803

29. Ma, D., Russell, D. G., Beverley, S. M., and Turco, S. j. (1997) J. Biol. Chem. 0 272, 3799-3805

30. Abeijon, C, Robbins, P. W., and Hirschberg, C. B. (1996) Proc. Natl. Acad. Sci. U.S.A. 93, 5963-5968

31. Abeijon, C, Mandon, E. C, Robbins, P. W., and Hirschberg, C. B. (1996) J. 5 Biol. Chem. 271, 8851-8854

32. Patton, and Lester. (1992) Arch. Biochem. Biophys. 292, 70-76

33. Wu, W. I., Lin, Y. P., Wang, E., Merrill, A. H., Jr., and Carman, G. M. (1993) J. Biol. Chem. 268, 13830-13837 o 34. Conzelmann, A., Puoti, A., Lester, R. L., and Desponds, C. (1992) EMBO J.

11, 457-466

35. Hechtberger, P., Zinser, E., Saf, R., Hummel, K., Paltauf, F., and Daum, G. (1994) Eur. J. Biochem. 225, 641-649

36. te Heesen, S., Janetsky, B., Lehle, L., and Aebi, M. (1992) EMBO J. ll, 2071- 5 2075

37. Silberstein, S., and Gilmore, R. (1996) FASEB J. 10, 849-858

38. Nakanishi-Shindo, Y., Nakayama, K., Tanaka, A., Toda, Y., and Jigami, Y. (1993) J. Biol. Chem. 268(15), 26338-26345 39. Nakayama, K., Nagasu, T., Shimma, Y., Kuromitsu, J., and Jigami, Y. (1992)

EMBO J. (7), 2511-2519

40. Lussier, M., Sdicu, A. M., Bussereau, F., Jacquet, M., and Bussey, H. (1997) J. Biol. Chem. 212, 15527-15531

41. Smith, S. W., and Lester, R. L. (1974) J. Biol. Chem. 249, 3395-3405

42. Altschul. S., F.Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410

43. Sanger, F., et al 1977 Proc. Natl. Acad. Sci U.S.A. 74:5463-5467

44. Yannish-Perron, C. et al 1985. Gene (Amst). 33. 103-1 19.

45. Sambrook, J. et al 1989. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

46. Sikorski, R. et al 1989 Genetics 122, 19-27

47. Carle, G.F. et al 1985 Proc. Natl. Acad. Sci U.S.A. 82, 3756-3760.

48. Guthrie, C, and Fink, G. R. (1991) Methods Enzymol. 194, 3-20

49. Dean, N. (1995) Proc. Natl. Acad. Sci. U.S.A. 92, 1287-1291

50. Machida, M., Chang, Y. C, Manabe, M., Yasukawa, M., Kunihiro, S., and Jigami, Y. (1996) Curr. Genet. 30, 423-431

51. Dean, N., Zhang, Y. B., and Poster, J. B. (1997) J. Biol. Chem. 272, 31908- 31914 52. Hill, J. E., Myers, A. M., Koemer, T. J., and Tzagoloff, A. (1993) Yeast 2, 163-

167

53. Homma, K., Te i, S., Minemura, M., Qadota, H., Anraku, Y., Kanaho, Y., and ohya, Y. (1998) J. Biol. Chem. 273, 15779-15786 54. Baudin, A., ozier-Kalogeropoulos, o., Denouel, A., Lacroute, F., and Cullin, C.

(1993) Nucleic Acids Res 21(14), 3329-30

55. Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994) Yeast 10(13). 1793-808

56. Wach, A., Brachat, A., Alberti-Segui, C, Rebischung, C, and Philippsen, P. (1997) Yeast 13(11), 1065-75

57. Mondigler, M., and Ehrmann, M. (1996) J Bacteriol 178(10), 2986-8

58. Longtine, M. S., McKenzie, A., 3rd, Demarini, D. J., Shah, N. G., Wach, A., Brachat, A., Philippsen, P., and Pringle, J. R. (1998) Yeast 14, 953-61 59. Chi, J. H., Roos, J., and Dean, N. (1996) J. Biol. Chem. 271, 3132-3140

Claims

WHAT IS CLAIMED IS:

1. A method of measuring activity of a nucleotide-sugar transporter derived from a yeast comprising:

A) providing a nucleotide-sugar to a source of permeabilized yeast spheroplasts comprising a nucleotide-sugar transporter and yeast golgi, and

B) determining an amount of golgi-associated nucleotide-sugar as an indicator of nucleotide-sugar transporter activity.

2. The method according to claim 1 wherein the source is permeabilized using liquid nitrogen.

10

3. A method of measuring activity of a nucleotide-sugar transporter derived from yeast comprising:

A) providing a nucleotide-sugar or derivative thereof to a mammalian cell, said mammalian cell transformed or transfected with a

15 nucleotide-sugar transporter derived from yeast; and

B) determining the amount of golgi-associated nucleotide-sugar; said amount is an indicator of nucleotide-sugar transporter activity.

4. The method according to claim 1 or 3 wherein the nucleotide-sugar is 20 GDP-mannose or derivative thereof.

5. The method according to claim 1 or 3, wherein the yeast is a Saccharomyces specie or a Candida specie.

6. The method according to claim 1 or 3, wherein the yeast is Candida albicans, Candida tropicalis, or Torulopsis glabrata.

25

1. The method according to claim 1 or 3, wherein the yeast is

Saccharomyces cerevisiae.

8. The method according to claim 1 or 3. wherein the yeast is

Cryptococcus neoformans. 30 9. The method according to claim 1 or 3, wherein the yeast is an

Aspergillus specie.

10. The method according to claim 1 , wherein the source is a yeast cell containing a dolichol phosphate-mannose synthase mutation. „ 1 1. The method according to claim 1, wherein the yeast cell comprises an exogenous gene encoding a nucleotide-transporter.

12. The method according to claim 1, wherein the yeast cell comprises an exogenous gene encoding a GDP-mannose binding domain.

13. The method according to claim 1, wherein the source is a yeast strain JPY263D deposited with ATCC under Accession No. ATCC 74461.

14. The method according to claim 1 or 3, wherein the nucleotide-sugar transporter is a VRG4 protein or homolog thereof.

15. The method according to claim 14, wherein the VRG4 protein is encoded by SEQ. ID No. 1 or SEQ. ID No: 3 or functional portion thereof.

16. The method according to claim 14, wherein the VRG4 protein has SEQ. ID No: 2 or SEQ. ID No: 4 or functional portion thereof.

17. The method according to claim 14, wherein the VRG4 protein comprises SEQ. ID No: 7, SEQ. ID No: 9, SEQ. ID No: 11, SEQ. ID No: 23, or homologs thereof. 18. The method according to claim 14, wherein the VRG4 protein is derived from a Saccharomyces species or a Candida species.

19. The method according to claim 14, wherein the VRG4 protein is derived from Cryptococcus neoformans or an Aspergillus specie. 20. A method of screening for inhibitors of golgi nucleotide-sugar transporter activity in yeasts comprising:

A) providing a candidate inhibitor to a source derived from permeabilized yeast spheroplasts comprising a nucleotide-sugar transporter and yeast golgi, prior to or concurrently with a nucleotide-sugar, and

B) determining the amount of golgi-associated nucleotide-sugar, wherein a reduction in an amount of golgi-associated nucleotide-sugar in the presence of inhibitor in comparison to the amount of golgi-associated nucleotide sugar in the absence of candidate inhibitor is indicative of an inhibitor of transporter activity .

21. A method of screening for inhibitors of golgi nucleotide-sugar transporter activity in yeast comprising:

A) providing a candidate inhibitor to a mammalian cell, said cell comprising a yeast nucleotide-sugar transporter, prior to or concurrently with a nucleotide-sugar, and B) determining the amount of golgi-associated nucleotide-sugar, wherein a reduction in an amount of golgi-associated nucleotide-sugar in the presence of inhibitor in comparison to the amount of golgi-associated nucleotide sugar in the absence of candidate inhibitor is indicative of an inhibitor of transporter activity.

22. The method according to claim 20 or 21 , wherein the nucleotide- sugar transporter is a GDP-mannose transporter.

23. The method according to claim 22, wherein the GDP-mannose transporter is derived from a Saccharmyces specie, Candida specie, Cryptococcus specie, Torulopsis specie, or Aspergillus specie.

24. The method according to claim 22, wherein the GDP-mannose transporter comprises SEQ. ID No: 2, SEQ. ID No: 4, SEQ. ID No: 7, SEQ. ID No: 9, SEQ. ID No: 11, SEQ. ID No: 23, or functional portion thereof. 25. The method according to claim 22, wherein the GDP-mannose transporter is encoded by SEQ. ID No: 1, SEQ. ID No: 3 or functional portion thereof.

26. The method according to claim 20 or 21 , wherein the inhibitor is a nucleotide-sugar analogue.

27. The method according to claim 20 or 21 , wherein the inhibitor is a competitive or non-competitive inhibitor.

28. The method according to claim 20 or 21, wherein the inhibitor is stilbene or derivative thereof. 29. The method according to claim 20 or 21 , wherein the inhibitor is a derivative of 4,4-diisothiocyanostilbene-2,2-disulfonic acid which specifically inhibits a GDP-mannose transporter and is nontoxic to mammalian cells.

30. The method according to claim 20 or 21 , wherein the inhibitor is an antibody or fragment thereof immunoreactive with VRG4 or epitope thereof.

31. The method according to claim 20 or 21 , wherein the inhibitor is a portion of VRG4 protein.

32. The method according to claim 20 or 21 , wherein the inhibitor is a

GDP-mannose binding domain.

33. A kit comprising permeabilized yeast spheroplasts for use in the method according to claim 1, 14, 20 or 21 and optionally a nucleotide-sugar.

34. A kit according to claim 33 wherein the permeabilized yeast cells are derived from Saccharomyces.

35. A kit according to claim 33 wherein the nucleotide-sugar is GDP- mannose.

36. A anti-fungal compound having golgi GDP-mannose transporter inhibitory activity, said inhibitory activity determined according to claims 20 or 21.

37. A pharmaceutical composition for inhibiting growth of yeast in a patient comprising as an active ingredient the compound according to claim 36 and a pharmaceutically acceptable vehicle.

38. A method for inhibiting the growth of yeast in a patient comprising administering to said patient an amount of an anti-fungal compound, said amount is effective in inhibiting the activity of a golgi GDP-mannose transporter.

39. An isolated nucleotide sequence comprising a VRG4 gene or portion thereof derived from a pathogenic yeast.

40. An isolated nucleotide sequence according to claim 39 wherein the nucleotide sequence comprises SEQ. ID No: 3 or portion thereof.

41. An isolated nucleotide sequence according to claim 39 wherein the pathogenic yeast is Candida albicans.

42. An isolated nucleotide sequence according to claim 39 wherein the pathogenic yeast is Cryptococcus neoformans or an Aspergillus specie. 43. An isolated nucleotide sequence according to claim 39 wherein the sequence encodes GDP-mannose transport activity.

44. An isolated nucleotide sequence according to claim 39 wherein the sequence encodes a GDP-mannose binding domain. 45. An isolated nucleotide sequence according to claim 39, wherein the nucleotide sequence encodes SEQ. ID No. 4 or homolog thereof.

46. An isolated nucleotide sequence encoding SEQ. ID No: 7, SEQ. ID No: 8, SEQ. ID No: 9, SEQ. ID No: 1 1 or homolog thereof.

47. An isolated nucleotide sequence encoding a consensus amino acid sequence comprising SEQ. ID No: 23.

48. A recombinant protein encoded by the nucleotide sequence or portion thereof according to claim 39-42.

49. A protein or peptide comprising an amino acid sequence comprising SEQ. ID No: 4, SEQ. ID No: 7, SEQ. ID No: 8, SEQ. ID No: 9, SEQ. ID No: 11, SEQ. ID No: 13, a substantially homologous sequence thereof, or a portion thereof.

50. A recombinant expression vector comprising a nucleic acid sequence of SEQ. ID No: 3 or portion thereof.

51. A recombinant expression vector according to claim 50 designated SKXa VRG4 deposited with ATCC under Accession No. ATCC 203137.

52. A recombinant expression vector encoding a GDP-mannose binding domain.

53. A recombinant expression vector according to claim 52 wherein the GDP-mannose binding domain comprises an amino acid sequence of SEQ. ID No: 7, SEQ. ID No: 1 1 or SEQ. ID No: 23.

54. A host cell transformed or transfected with a recombinant expression vector according to any of claims 50-53.

55. A host cell according to claim 54 selected for the group consisting of yeast cells, mammalian cells, bacterial cells, and insect cells.

56. A host cell according to claim 54 or 55 which expresses a GDP- mannose transporter.

57. A host cell according to any of claims 54-46 wherein the cell is Saccharomyces cerevisiae. 58. A host cell according to claim 57 wherein the host cell contains dolichol phosphate mannose synthase mutation.

59. A host cell according to claim 57, JPY263D deposited with ATCC under Accession No. ATCC 74461.

60. A host cell according to any of claims 54-59, wherein the host cell lacks an endogenous VRG4 gene or has a nonfunctional endogenous VRG4 gene.

61. A host cell according to any of claims 54-56 or 58-60, wherein the host cell is a mammalian cell.

62. A method of producing a recombinant VRG4 protein or portion thereof, comprising: A) inserting a nucleotide sequence encoding a VRG4 protein into an expression vector;

B) transferring the expression vector into a host cell;

C) culturing the host cell under conditions that allow expression of the VRG4 protein or portion thereof.

63. A method according to claim 62 wherein the expression vector is selected from the group consisting of yeast expression vectors and mammalian expression vectors.

64. An isolated antibody immunoreactive with a VRG-4 protein or epitopes thereof.

65. An isolated antibody according to claim 64 wherein the antibody is a monoclonal antibody or a recombinantly produced antibody.

66. An isolated antibody according to claim 65 wherein the recombinantlyjproduced antibody is a single chain antibody.

67. A method of detecting VRG4 genomic nucleic acid sequences in a biological sample comprising the steps of: a) contacting the genomic nucleic acid isolated from a biological sample with all or part of a nucleic acid sequence of the VRG4 gene under conditions to allow complexes to form between the VRG4 nucleic acid sequence and the nucleic acid of the sample; and b) detecting the VRG4 genomic sequence complex.

68. The method according to claim 67 wherein VRG4 mutated genomic DNA sequence are detected.

69. A kit for detecting a VRG4 gene comprising at least one ohgonucleotide primer specific for the VRG4 gene.

70. A method of determining efficacy of treatment by an antifungal compound in a human patient, comprising: a) obtaining a tissue sample from a patient undergoing treatment for a yeast infection; b) comparing VRG4 gene coding sequences or VRG4 mRNA molecules in the tissue sample to wild type VRG4 gene coding sequences or VRG4 mRNA molecules, wherein an observed alteration in the VRG4 gene coding sequence or mRNA molecules in said tissue sample compared with the wild type gene indicates efficacy of treatment.

71. The method according to claim 70, wherein an alteration of VRG4 mRNA is detected by hybridization of mRNA isolated from said tissue sample to a VRG4 gene probe.

72. The method according to claim 70, wherein the yeast is Candida albicans.

73. The method according to claim 70, wherein the yeast is Cryptococcus neoformans or an Aspergillus specie.

74. The method according to claim 70, wherein the tissue sample is selected from the group closing of cells, tissue, blood, serum, stool, urine, amniotic fluid, mucous secretions and sputum. 75. A method of detecting VRG4 protein or portion thereof in a biological sample, comprising the steps of: a) contacting a reagent which specifically reacts with the VRG4 protein in the sample; and b) detecting the formation of a complex between the protein and the reagent.

76. The method according to claim 75, wherein the sample is selected from membranes the group consisting of yeast cells, mammalian tissues, mammalian cells, golgi samples, and artifical membranes. 77. The method according to claim 75, wherein the reagent is an antibody or fragment thereof.

78. The method according to claim 75, wherein the reagent is a monoclonal antibody. 79. The method according to claim 75, wherein the reagent is a polyclonal antibody.

80. The method according to claim 75, wherein the biological sample is from an individual infected with Candida albicans.

81. The method according to claim 75, wherein the biological sample is from an individual infected with Cryptococcus neoformans or an. Aspergillus specie.

82. The method according to claim 75 wherein the reagent is a nucleotide-sugar or analog thereof.

83. The method according to claim 75, wherein the nucleotide-sugar is GDP-mannose or analog thereof. 84. The method according to claim 75, wherein the nucleotide-sugar is detectably labelled.

85. The method according to claim 75, wherein the sample is permeabilized yeast spheroplasts.