EP1095154A2 - Interaction de precurseur de la proteine beta-amyloide humaine (beta-app) et de proteine humaine du type lon-protease (hslon) - Google Patents
Interaction de precurseur de la proteine beta-amyloide humaine (beta-app) et de proteine humaine du type lon-protease (hslon)Info
- Publication number
- EP1095154A2 EP1095154A2 EP99932376A EP99932376A EP1095154A2 EP 1095154 A2 EP1095154 A2 EP 1095154A2 EP 99932376 A EP99932376 A EP 99932376A EP 99932376 A EP99932376 A EP 99932376A EP 1095154 A2 EP1095154 A2 EP 1095154A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- app
- hslon
- complex
- derivative
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4711—Alzheimer's disease; Amyloid plaque core protein
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
- C07K14/8114—Kunitz type inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- the present invention is directed to complexes of beta-APP and HsLON proteins.
- the present invention relates to the production of antibodies to the aforementioned protein complex, and its use in, inter alia, screening, diagnosis, prognosis and therapy.
- the human beta amyloid precursor ( ⁇ -APP ) protein has been the subject of intense study since amyloid plaques containing fragments of the ⁇ -APP protein represent a key pathophysiological feature in the brains of patients with Alzheimer's Disease (AD) (Glenner and Wong, 1984, Biochem. Biophys. Res. Commun. 120:885-890).
- the first mRNA for ⁇ -APP was cloned in 1988 (GenBank Accession No. A02759; Mueller-Hill et al, 1988, European Patent Publication EP 276723). This mRNA encodes a neuronally-expressed protein of 695 amino acids. Three other protein precursors of 714, 751, and 770 amino acids are also expressed via differential splicing (Kang and Muller-Hill, 1990, Biochem. Biophys. Res. Commun 166: 1192- 1200).
- a main focus of AD research has been the possibility that abnormal processing of ⁇ -APP results in products that collect in the brain and form damaging deposits.
- the principal product in amyloid plaques is ⁇ -A4, a 39-42 residue fragment of ⁇ -APP located at the start of the C-terminal third of the precursor molecule (Kang et al., 1987, Nature 325:733-736). While this fragment is a normally expressed product in human brain, its accumulation is greatly accelerated in some disorders including AD and trisomy 21 (Suebert et al, 1992, Nature 359:325-327).
- ⁇ -APP apolipoprotein E
- ApoE may act as a pathological molecular chaperone that binds to soluble ⁇ -A4 and stabilizes abnormal ⁇ -pleated sheet formation, and thus, plaque formation (Wisniewski et al., 1992, Neurosci. Lett.
- the presenilin proteins PS-1 and PS-2 display a linkage with some cases of early-onset familial AD (Sherrington et al., 1995, Nature 375:754-760; Cruts et al, 1996, Hum. Mol. Genet. 5:1449-1455).
- the results of the above-mentioned studies indicate that abnormal protein-protein interactions of, or functioning of, ⁇ -A4, or other products of ⁇ -APP, may underlie the pathogenesis of some or all forms of AD.
- Mitochondrial dysfunction may also be involved in the pathogenesis of AD.
- a mutation in codon 331 of mitochondrially-encoded subunit 2 of NADH dehydrogenase (complex I of the oxidative phosphorylation chain) has been reported in 10/19 AD patients, and 2/6 patients with amyotrophic lateral sclerosis (ALS) (Lin et al, 1992, Biochem. Biophys. Res. Commun. 182:238-246).
- ALS amyotrophic lateral sclerosis
- mitochondrial damage is associated with neurodegenerative diseases.
- a unifying hypothesis regarding the pathogenesis of AD has been formed around the central theme of increased oxidative damage to mitochondria causing disrupted calcium homeostasis and neuronal degeneration (Markesbery, 1997, Free Radic. Biol. Med.
- the human Lon-protease-like (HsLON) protein (GenBank Accession No. X74215; Amerik et al, 1994, FEBS Lett. 340:25-28) is the homologue of Lon, an E. coli protease which is involved in the degradation of misfolded proteins.
- the mitochondrially-localized protease PIMl is homologous to Lon, and PIMl and HsLON function interchangeably in yeast to degrade misfolded proteins in the mitochondrial matrix (Suzuki et al, 1994, Science 264:273-276; Teichmann et al, 1996, J. Biol. Chem. 271 : 10137-10142).
- HsLON human LON
- ATPase-dependent protease that can function in mitochondrial biogenesis and maintenance (Suzuki et al, 1997, Trends Biochem. Sci. 22:1 18-123). HsLON is implicated in all aspects of mitochondrial maintenance and function.
- mitochondrial biogenesis As such, it can affect physiological processes including, but not limited to, mitochondrial biogenesis, cell oxidative capacity and energy metabolism, cell apoptosis, calcium homeostasis, and the pathological processes of Alzheimer's Disease (AD), dementia of trisomy 21, amyotrophic lateral sclerosis (ALS), and other neurodegenerative disorders.
- AD Alzheimer's Disease
- ALS amyotrophic lateral sclerosis
- mutations in mitochondrial DNA which increase both with age and oxidative stress, are associated with a wide range of both spontaneous and heritable clinical disorders (Odawara, 1996, New Engl. J. Med. 334:270-271; Hammans, 1994, Essays Biochem. 28:99-112).
- MELAS syndrome Mitochondrial myopathy, Encephalomyopathy, Lactic Acidosis, and Stroke-like episodes; Saitoh et al, 1998, Neurology, 50:531-534
- progressive external ophthalmoplegia Mielberg et al, 1998, Neurology, 50:299-300
- both autosomal and non-autosomal cardiomyopathies Takeda et al, 1996, Diabetes Res. Clin. Pract. 31 Suppl. S123-126
- polymyalgia rheumatica Reynier et al, 1994, Biochem. Biophys. Res. Commun.
- mitochondrial DNA mutations are also associated with CNS degeneration, including Parkinson's disease (Ozawa et al, 1991, Biochem. Biophys. Res. Comm. 177:518-525), Alzheimer's Disease, including morphologically-identified amyloid plaques (Kaido et al, 1996, Acta Neuropath. [Berlin] 92:312-318), and late-onset encephalopathy (Johnston et al, 1995, Ann. Neurol. 37: 16-23).
- Parkinson's disease Ozawa et al, 1991, Biochem. Biophys. Res. Comm. 177:518-525
- Alzheimer's Disease including morphologically-identified amyloid plaques (Kaido et al, 1996, Acta Neuropath. [Berlin] 92:312-318), and late-onset encephalopathy (Johnston et al, 1995, Ann. Neurol. 37: 16-23).
- mitochondrial dysfunction either resulting from mitochondrial DNA mutations
- Mitochondrial DNA mutations also underlie diseases and disorders such as MERRF syndrome
- Kearns-Sayre syndrome pigmented retinopathy, bilateral progressive ophthalmoplegia, and cardiac conduction defects; Zoviani et al, 1988, Neurology 38:1339-1346), male infertility (St. John et al, 1997, Nat. Med. 3: 124-125), sensorineural hearing loss (Donovan et al, 1995, Ann. Otol. Rhinol. Laryngol.
- HsLON may also be implicated in cardiomyopathy, some forms of diabetes, hearing loss, male infertility, and a number of less common syndromes and disorders associated with mitochondrial DNA mutations.
- both ⁇ -APP and HsLON are implicated in neurodegenerative processes and mitochondrial function.
- each or both can affect physiological processes including, but not limited to, mitochondrial biogenesis, cell oxidative capacity and energy metabolism, cell apoptosis, calcium homeostasis, and pathological processes including, but not limited to, neurodegenerative disorders such as Alzheimer's Disease (AD), dementia of trisomy 21, Parkinson's disease, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing loss; and male infertility; as well as a number of less common syndromes and disorders that are associated with mitochondrial DNA mutations.
- AD Alzheimer's Disease
- ALS amyotrophic lateral sclerosis
- cardiomyopathy some forms of diabetes
- hearing loss and male infertility
- the present invention is based, in part, on the discovery of a novel interaction between ⁇ -amyloid precursor protein ( ⁇ -APP ) and the HsLON protein, in particular, interaction between the predominantly expressed 695 amino acid form of ⁇ -APP, (to which the term ⁇ -APP refers in this Application), or the portion of ⁇ -APP comprised of residues 597-638, (herein referred to as ⁇ -A4), and HsLON, or the C-terminal 126 residues of HsLON.
- ⁇ -APP ⁇ -amyloid precursor protein
- HsLON HsLON protein
- the present invention is directed to certain compositions comprising and methods for production of protein complexes of ⁇ -APP with a protein that interacts with (i.e., binds to) ⁇ -APP.
- the invention is directed to complexes of ⁇ -APP, and derivatives, fragments and analogs of ⁇ -APP, with HsLON, and its derivatives, fragments and analogs (a complex of ⁇ -APP and HsLON is designated as ⁇ -APP:HsLON herein).
- the present invention is further directed to methods of screening for proteins that interact with ⁇ -APP and/or HsLON, or with derivatives, fragments or analogs of ⁇ -APP and/or HsLON.
- compositions are also provided.
- the invention is further directed to methods for modulating (i.e., inhibiting or enhancing) the activity of a ⁇ -APP:HsLON complex.
- the protein components of a ⁇ -APP:HsLON complex have been implicated in physiological processes including, but not limited to, mitochondrial biogenesis, cell oxidative capacity and energy metabolism, cell apoptosis, calcium homeostasis, and pathological processes including, but not limited to, neurodegenerative disorders such as Alzheimer's Disease, dementia of trisomy 21, Parkinson's disease, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing loss; and male infertility; as well as a number of less common syndromes and disorders associated with mitochondrial DNA mutations.
- ALS amyotrophic lateral sclerosis
- the present invention is directed to methods for screening ⁇ -APP:HsLON complexes, as well as derivatives and analogs of the ⁇ -APP:HsLON complex, for the ability to alter a cell function, particularly a cell function in which ⁇ -APP and/or HsLON has been implicated, as non-exclusively listed, supra.
- the present invention is also directed to therapeutic and prophylactic, as well as diagnostic, prognostic, and screening methods and compositions based upon the ⁇ -APP:HsLON complex (and the nucleic acids encoding the individual proteins that participate in the complex).
- Therapeutic compounds of the invention include, but are not limited to, a ⁇ -APP:HsLON complex, and a complex where one or both members of the complex is a derivative, fragment, homolog or analog of ⁇ -APP or HsLON; antibodies to and nucleic acids encoding the foregoing; and antisense nucleic acids to the nucleotide sequences encoding the complex components. Diagnostic, prognostic and screening kits are also provided.
- Figure 1 The nucleotide sequence of ⁇ -APP (GenBank Accession No. A02759 (SEQ ID NO: 1) and deduced amino acid sequence (SEQ ID NO:2). The coding sequence beginning at base 1935 (amino acid 597), marked by arrow "A”, and ending at base 2060 (amino acid 638), marked by arrow "B”, was used as bait in the assays described infra.
- Figure 2 The nucleotide sequence (SEQ ID NO:3) and amino acid sequence (SEQ ID NO:4) of human HsLON (GenBank Accession No. X74215). The 5' start site of the identified prey sequence was at base 2194 (amino acid 721), marked by arrow "A”.
- Figure 3. Demonstration of the specificity of the ⁇ -APP:HsLON interaction. A positive interaction for a bait and prey proteins is indicated as "+” in the box forming the intersection between the particular bait and prey proteins, a lack of interaction is designated by "-”. The intersection of the ⁇ -APP column with the HsLON row indicates growth (Box A) (i.e., a positive interaction).
- the present invention is based, in part, upon identification of proteins that interact with ⁇ -APP (SEQ ID NOS:2) using a modified form of the yeast matrix mating test.
- At least amino acids 721 to 845 of HsLON (SEQ ID NOS:4) were found to form a complex under physiological conditions with at least amino acids 597 to 638 of ⁇ -APP (SEQ ID NOS:2) (the complex of ⁇ -APP with HsLON is indicated as " ⁇ -APP:HsLON” herein).
- the ⁇ -APP:HsLON complex by virtue of the interaction, is implicated in modulating the functional activities of ⁇ -APP and its binding partner.
- Such functional activities include physiological processes including, but not limited to, neurodegenerative disorders such as Alzheimer's Disease, dementia of trisomy 21, Parkinson's disease, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing loss; and male infertility; as well as a number of less common syndromes and disorders associated with mitochondrial DNA mutations.
- neurodegenerative disorders such as Alzheimer's Disease, dementia of trisomy 21, Parkinson's disease, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing loss; and male infertility; as well as a number of less common syndromes and disorders associated with mitochondrial DNA mutations.
- the present invention is also directed to methods of screening for proteins that interact with, e.g., bind to ⁇ -APP.
- the present invention further discloses a complex of the ⁇ -APP protein, or a derivative, analog or fragment thereof, in particular with HsLON protein, or a derivative, analog or fragment thereof.
- such complex binds an anti- ⁇ -APP, anti-HsLON, and/or anti- ⁇ -APP: HsLON complex antibody.
- a complex of human ⁇ -APP with human HsLON is provided.
- the present invention also provides methodologies for the production and/or isolation of ⁇ -APP:HsLON complex.
- the present invention provides methodology of using recombinant DNA techniques to express both ⁇ -APP and HsLON (or a derivative, fragment or analog of one or both members of the complex) wherein both binding partners are under the control of one heterologous promoter (i.e., a promoter not naturally associated with the gene encoding the particular complex component) or where each is under the control of a separate heterologous promoter.
- the present invention also provides methodology for the treatment or prevention of diseases or disorders associated with an aberrant level of ⁇ -APP:HsLON complex, or an aberrant level of activity of one or more of the components of the complex, by administration of a ⁇ -APP:HsLON complex, or modulators of ⁇ -APP: HsLON complex activity or formation (e.g., antibodies that bind to a ⁇ -APP:HsLON complex), or non-complexed ⁇ -APP or its binding partner or a derivative, fragment, analog or homolog thereof.
- modulators of ⁇ -APP: HsLON complex activity or formation e.g., antibodies that bind to a ⁇ -APP:HsLON complex
- the aforementioned derivative, fragment, analog or homolog contains: (i) the portion of ⁇ -APP or HsLON that is directly involved in complex formation; (ii) mutants of ⁇ -APP or of HsLON that modulate binding affinity; (iii) small molecule inhibitors or enhancers of complex formation; or (iv) antibodies that either stabilize or neutralize the complex, and the like.
- the present invention discloses the complex of ⁇ -APP with HsLON (the ⁇ -APP:HsLON complex).
- the ⁇ -APP:HsLON complex is a complex of human proteins.
- the present invention also relates to: ( ) complexes of derivatives, fragments and analogs of the ⁇ -APP with a HsLON; (ii) complexes of the ⁇ -APP with derivatives, fragments and analogs of HsLON and (iii) complexes of derivatives, fragments and analogs of the ⁇ -APP and HsLON.
- fragment, derivative or analog of a ⁇ -APP:HsLON complex includes complexes where one or both members of the complex are fragments, derivatives or analogs of the wild-type ⁇ -APP or HsLON protein.
- Derivatives, fragments, and analogs provided herein are defined as sequences of at least 6 (contiguous) nucleic acids or at least 4 (contiguous) amino acids, a length sufficient to allow for specific hybridization in the case of nucleic acids or for specific recognition of an epitope in the case of amino acids, respectively. Fragments are, at most, one nucleic acid-less or one amino acid-less than the wild type full length sequence. Derivatives and analogs may be full length or other than full length, if said derivative or analog contains a modified nucleic acid or amino acid, as described infra.
- Derivatives or analogs of ⁇ -APP and HsLON include, but are not limited to, molecules comprising regions that are substantially homologous to ⁇ -APP or HsLON, in various embodiments, by at least about 30%, 50%, 70%, 80%, or 90% identity (with a preferred identity of 80-95%) over an amino acid sequence of identical size or when compared to an aligned sequence in which the alignment is done by a computer homology program known in the art, for e.g., Wisconsin GCG (Genetics Computer Group) software package using default parameter settings.
- Wisconsin GCG Genetics Computer Group
- comparison may be made to an aligned sequence whose encoding nucleic acid is capable of hybridizing to the complement (e.g., the inverse complement) of a sequence encoding ⁇ -APP or HsLON under stringent (the preferred embodiment), moderately stringent, or low stringent conditions.
- complement e.g., the inverse complement
- stringent the preferred embodiment
- moderately stringent e.g. Ausubel, et al, CURRENT PROTOCOLS IN
- the ⁇ -APP:HsLON complex in which one or both members of the complex are a fragment, derivative or analog of the wild-type protein are functionally active ⁇ -APP:HsLON complex.
- the native proteins (or homologs, fragments, derivatives or analogs thereof) of the ⁇ -APP and/or HsLON are of insects (e.g., fly), plants, or animals (e.g., mouse, rat, pig, cow, dog, monkey, frog) or, most preferably, human.
- the term "functionally active ⁇ -APP:HsLON complex” refers to species displaying one or more known functional attributes of a full-length ⁇ -APP (or derivatives, fragments, analogs or homologs thereof), complexed with full-length HsLON (or derivatives, fragments, analogs or homologs thereof), including, but not exclusive to, the control of cell cycle progression, cellular differentiation and apoptosis, intracellular signal transduction, neurogenesis, response to viral infection, a hype ⁇ roliferative disorder such as tumorigenesis and tumor spread, a degenerative disorder such as a neurodegenerative disease, autoimmune disease, a disorder associated with organ transplantation, inflammatory and/or allergic disease, atherosclerosis, nephropathy, cardiac disease, muscle disease, or the like.
- ⁇ -APP:HsLON complex comprised of fragments of one or both protein species of the complex.
- these aforementioned fragments may consist of, but are not limited to, fragments of HsLON that have been identified as interacting with the ⁇ -APP in an improved, modified yeast two hybrid assay in this invention, i.e., amino acids 721-845 of HsLON as depicted in Figure 2 [SEQ ID NO:4].
- fragments (or proteins comprising fragments) that may lack some or all of the aforementioned regions of either member of the complex, as well as nucleic acids that encode the aforementioned proteins, are also disclosed herein.
- nucleotide sequences encoding human ⁇ -APP and human HsLON are known, (GenBank Accession No. A02759 and GenBank Accession No. X74215, respectively), and are disclosed in Figures 1 and 2 (SEQ ID NOS: 1 and 3, respectively).
- Nucleic acids may be obtained by any method known within the art (e.g., by PCR amplification using synthetic primers hybridizable to the 3'- and 5'-termini of the sequence and/or by cloning from a cDNA or genomic library using an oligonucleotide sequence specific for the given gene sequence, or the like).
- Homologs i.e., nucleic acids encoding the aforementioned proteins derived from species other than human
- other related sequences e.g., paralogs
- a nucleic acid sequence that is hybridizable to a nucleic acid sequence (or a complement of the foregoing) encoding ⁇ -APP and/or HsLON, or a derivative of the same, under conditions of high stringency is provided.
- procedures using such conditions of high stringency are as follows: Step 1 : Filters containing DNA are pretreated for 8 hours to overnight at 65°C in buffer composed of 6X SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 ⁇ g/ml denatured salmon sperm DNA.
- Step 2 Filters are hybridized for 48 hours at 65°C in the above prehybridization mixture to which is added 100 ⁇ g/ml denatured salmon sperm DNA and 5-20 x 106 cpm of 32 P-labeled probe.
- Step 3 Filters are washed for 1 hour at 37°C in a solution containing 2X SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1X SSC at 50°C for 45 minutes.
- Step 4 Filters are autoradiographed. Other conditions of high stringency that may be used are well known in the art. See, e.g., Ausubel et al.
- a nucleic acid sequence that is hybridizable to a nucleic acid sequence (or a complement of the foregoing) encoding ⁇ -APP and/or HsLON, or a derivative of either, under conditions of moderate stringency is provided.
- procedures using such conditions of moderate stringency are as follows: Step 1 : Filters containing DNA are pretreated for 6 hours at 55°C in a solution containing 6X SSC, 5X Denhardt's solution, 0.5% SDS and 100 ⁇ g/ml denatured salmon sperm DNA. Step 2: Filters are hybridized for 18-20 hours at 55°C in the same solution with 5-20 x 106 cpm 32 P-labeled probe added.
- Step 3 Filters are washed at 37°C for 1 hour in a solution containing 2X SSC, 0.1% SDS, then washed twice for 30 minutes at 60°C in a solution containing IX SSC and 0.1% SDS.
- Step 4 Filters are blotted dry and exposed for autoradiography. Other conditions of moderate stringency that may be used are well-known in the art. See, e.g., Ausubel et al. (eds.), 1993, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, NY, and Kriegler, 1990, GENE TRANSFER AND EXPRESSION, A LABORATORY MANUAL, Stockton Press, NY.
- a nucleic acid that is hybridizable to a ⁇ -APP and/or HsLON nucleic acid sequence or to a nucleic acid sequence encoding a ⁇ -APP and/or HsLON derivative (or a complement of the foregoing), under conditions of low stringency is provided.
- procedures using such conditions of low stringency are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. Sci.
- Step 1 Filters containing DNA are pretreated for 6 hours at 40°C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1%
- Step 2 Filters are hybridized for 18-20 hours at 40°C in the same solution with the addition of 0.02% PVP, 0.02% Ficoll,
- Step 3 Filters are washed for 1.5 hours at 55°C in a solution containing 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1 % SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 hours at 60°C.
- Step 4 Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68°C and reexposed to film.
- nucleic acids hybridizable to or complementary to the foregoing sequences in particular the invention provides the inverse complement to nucleic acids hybridizable to the foregoing sequences (i.e., the inverse complement of a nucleic acid strand has the complementary sequence running in reverse orientation to the strand so that the inverse complement would hybridize with little or no mismatches to the nucleic acid strand).
- nucleic acid molecules are provided that comprise a sequence complementary to (specifically, are the inverse complement of) at least about 10, 25, 50, 100, or 200 nucleotides or the entire coding region of a ⁇ -APP and/or HsLON gene (SEQ ID NOS:l and 3, respectively).
- Nucleic acid molecules encoding derivatives and analogs of ⁇ -APP and/or HsLON (supra), or antisense nucleic acids to the same are additionally provided.
- nucleotide sequences encoding polypeptides identified as beta APP interactants via the modified yeast two hybrid assay in this invention potential open reading frames can be identified using the NCBI BLAST program ORF Finder available to the public. Because all known protein translation products are at least 60 amino acids or longer (Creighton, 1992, PROTEINS, 2nd Ed., W.H. Freeman and Co., New York), only those ORFs potentially encoding a protein of 60 amino acids or more are considered. If an initiation methionine codon (ATG) and a translational stop codon (TGA, TAA, or TAG) are identified, then the boundaries of the protein are defined.
- ATG initiation methionine codon
- TGA, TAA, or TAG translational stop codon
- the ⁇ -APP and HsLON protein may be obtained by methods well-known in the art for protein purification and recombinant protein expression.
- the nucleic acid containing all or a portion of the nucleotide sequence encoding the protein may be inserted into an appropriate expression vector (i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein coding sequence).
- the regulatory elements are heterologous (i.e., not the native gene promoter).
- the necessary transcriptional and translational signals may also be supplied by the native promoter for the ⁇ -APP or any HsLON genes and/or their flanking regions.
- a variety of host-vector systems may be utilized to express the protein coding sequence(s).
- the ⁇ -APP:HsLON complex are obtained by expressing the entire ⁇ -APP coding sequence and a HsLON coding sequence within the same cell, either under the control of the same promoter or two separate promoters.
- a derivative, fragment or homolog of the ⁇ -APP and/or a derivative, fragment or homolog of a HsLON are recombinantly expressed.
- the derivative, fragment or homolog of the ⁇ -APP and/or the HsLON protein form a complex with a binding partner that has been identified by a binding assay (e.g., the modified yeast two hybrid system assay) and, more preferably, form a complex that binds to an anti- ⁇ -APP, anti-HsLON and/or anti- ⁇ -APP: HsLON complex antibody.
- a binding assay e.g., the modified yeast two hybrid system assay
- any of the methodologies known within the relevant prior art regarding the insertion of nucleic acid fragments into a vector may be utilized to construct expression vectors that contain a chimeric gene comprised of the appropriate transcriptional/translational control signals and protein-coding sequences. These methodologies may include, but are not limited to, in vitro recombinant DNA and synthetic techniques, as well as in vivo recombination techniques (e.g., genetic recombination).
- nucleic acid sequences that encode the ⁇ -APP and the HsLON protein, or derivatives, fragments, analogs or homologs thereof may be regulated by a second nucleic acid sequence such that the genes or fragments thereof are expressed in a host that has been concomitantly transformed with the recombinant DNA molecule(s) of interest.
- the expression of the specific proteins may be controlled by any promoter/enhancer known in the art including, but not limited to: (/) the SV40 early promoter (see e.g., Bernoist & Chambon, 1981.
- plant promoter/enhancer sequences within plant expression vectors may also be utilized including, but not limited to: (/ ' ) the nopaline synthetase promoter (see e.g., Herrar-Estrella, et al, 1984. Nature 303: 209-213); (/ ' / ' ) the cauliflower mosaic virus 35S RNA promoter (see e.g., Garder, et al, 1981. Nuc. Acids Res. 9: 2871) and (iii) the promoter of the photosynthetic enzyme ribulose bisphosphate carboxylase (see e.g., Herrera-Estrella, et al, 1984. Nature 310: 115-120) and the like.
- Promoter/enhancer elements from yeast and other fungi e.g., the Gal4 promoter, the alcohol dehydrogenase promoter, the phosphoglycerol kinase promoter, the alkaline phosphatase promoter
- animal transcriptional control regions for example, those that possess tissue specificity and have been used in transgenic animals, may be utilized in the production of proteins of the present invention.
- Transcriptional control sequences derived from animals include, but are not limited to: (i) the insulin gene control region active within pancreatic ⁇ -cells (see e.g., Hanahan, et al, 1985.
- a vector is utilized that comprises a promoter that is operably-linked to nucleic acid sequences that encode ⁇ -APP and/or HsLON, or a fragment, derivative or homolog, thereof, one or more origins of replication, and optionally, one or more selectable markers (e.g., an antibiotic resistance gene).
- a vector is utilized that is comprised of a promoter operably-linked to nucleic acid sequences encoding both ⁇ -APP and HsLON, one or more origins of replication, and, optionally, one or more selectable markers.
- an expression vector contains the coding sequences (or portions thereof) of ⁇ -APP and HsLON, either together or separately.
- the expression vector may be generated by subcloning the aforementioned gene sequences into the EcoRI restriction site of each of the three available pGEX vectors (glutathione S-transferase expression vectors; see e.g., Smith & Johnson, 1988. Gene 7: 31-40), thus allowing the expression of products in the correct reading frame.
- Expression vectors that contain sequences of interest may be identified by three general approaches: ( ) nucleic acid hybridization, ( / ' ) presence or absence of "marker" gene function and/or (iii) expression of the inserted sequences.
- ⁇ -APP and HsLON may be detected by nucleic acid hybridization using probes comprising sequences homologous and complementary to the inserted sequences of interest.
- the recombinant vector/host system may be identified and selected based upon the presence or absence of certain "marker" functions (e.g., binding to an antibody specific for ⁇ -APP, HsLON, or a ⁇ -APP:HsLON complex, resistance to antibiotics, occlusion-body formation in baculovirus, and the like) caused by the insertion of the sequences of interest into the vector.
- certain "marker" functions e.g., binding to an antibody specific for ⁇ -APP, HsLON, or a ⁇ -APP:HsLON complex, resistance to antibiotics, occlusion-body formation in baculovirus, and the like
- recombinant expression vectors may be identified by assaying for the expression of the ⁇ -APP concomitantly with expression of HsLON by the recombinant vector.
- expression vectors or their derivatives that can be used include, but are not limited to, human or animal viruses (e.g., vaccinia virus or adenovirus); insect viruses (e.g., baculovirus); yeast vectors; bacteriophage vectors (e.g., lambda phage); plasmid vectors and cosmid vectors, and the like.
- human or animal viruses e.g., vaccinia virus or adenovirus
- insect viruses e.g., baculovirus
- yeast vectors e.g., bacteriophage vectors (e.g., lambda phage); plasmid vectors and cosmid vectors, and the like.
- a host cell strain may be selected that modulates the expression of inserted sequences of interest, or modifies or processes expressed proteins encoded by said sequences in the specific manner desired.
- expression from certain promoters may be enhanced in the presence of certain inducers in a selected host strain; thus facilitating control of the expression of a genetically-engineered ⁇ -APP and/or HsLON.
- different host cells possess characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, phosphorylation, and the like) of expressed proteins. Appropriate cell lines or host systems may thus be chosen to ensure the desired modification and processing of the foreign protein is achieved. For example, protein expression within a bacterial system can be used to produce an unglycosylated core protein; whereas expression within mammalian cells ensures "native" glycosylation of a heterologous protein.
- ⁇ -APP and/or HsLON may be expressed as fusion or chimeric protein products comprising the protein joined via a peptide bond to a heterologous protein sequence of a different protein.
- chimeric products may be produced by ligating together appropriate nucleic acid sequences that encode desired amino acids, said ligation retaining the proper coding frames, and subsequently expressing the chimeric products in a suitable host by methods well known in the art.
- a chimeric product can be made by protein synthetic techniques (e.g., by use of a peptide synthesizer).
- a specific embodiment of the present invention discloses a chimeric protein comprising a fragment of ⁇ -APP and/or HsLON.
- fusion proteins are provided that contain the interacting domains of ⁇ -APP and HsLON (the domains involved in the direct formation of ⁇ -APP:HsLON complex) and, optionally, have a heterofunctional reagent (e.g., a peptide linker) that serves to both link the two aforementioned proteins and to promote the interaction of ⁇ -APP and HsLON binding domains.
- a heterofunctional reagent e.g., a peptide linker
- These fusion proteins may be particularly useful where the stability of the interaction is desirable (i.e., stability due to the formation of the complex as an intramolecular reaction), for example in production of antibodies specific to ⁇ -APP:HsLON complex.
- nucleic acids encoding proteins, and proteins consisting of or comprising a fragment of ⁇ -APP or HsLON that consists of a minimum of 6 contiguous amino acid residues of ⁇ -APP and/or HsLON are provided herein.
- the aforementioned protein fragment is comprised of at least 10, 20, 30, 40, or 50 amino acid residues (and preferably not larger that 35, 100 or 200 amino acid residues) of ⁇ -APP or HsLON.
- Derivatives or analogs of ⁇ -APP and HsLON include, but are not limited to, molecules comprising regions that are substantially homologous to ⁇ -APP or HsLON in various embodiments, of at least 30%, 40%, 50%>, 60%, 70%, 80%, 90% or preferably 95%) amino acid identity when: ( ) compared to an amino acid sequence of identical size; (//) compared to an aligned sequence in that the alignment is done by a computer homology program known within the art or ( ) the encoding nucleic acid is capable of hybridizing to a sequence encoding ⁇ -APP or HsLON under stringent (preferred), moderately stringent, or non-stringent conditions (see, e.g., supra).
- ⁇ -APP and/or HsLON derivatives may be produced by alteration of their sequences by substitutions, additions or deletions that result in functionally-equivalent molecules.
- the degeneracy of nucleotide coding sequences allows for the use of other DNA sequences that encode substantially the same amino acid sequence as ⁇ -APP or HsLON genes.
- one or more amino acid residues within the sequence of interest may be substituted by another amino acid of a similar polarity and net charge, thus resulting in a silent alteration.
- Conservative amino acid substitution variants for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs.
- nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine.
- Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.
- Positively charged (basic) amino acids include arginine, lysine and histidine.
- Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
- ⁇ -APP or HsLON derivatives and analogs of the present invention may be produced by various methodologies known within the art.
- the cloned ⁇ -APP and HsLON gene sequences may be modified by any of numerous methods known within the art. See e.g., Sambrook, et al, 1990.
- ⁇ -APP- or HsLON-encoding nucleic acids may be mutated in vitro or in vivo to: (/ ' ) create variations in coding regions; ( / ' ) create and/or destroy translation, initiation, and/or termination sequences; and/or (iii) form new restriction endonuclease sites or destroy pre-existing ones, so as to facilitate further in vitro modification.
- mutagenesis Any technique for mutagenesis known within the art may be utilized, including but not limited to, chemical mutagenesis and in vitro site-directed mutagenesis (see e.g., Hutchinson, et al, 1978. J. Biol. Chem 253: 6551-6558); use of TABJ TM linkers (Pharmacia), and other similar methodologies.
- the individual gene product or complex may be isolated and analyzed. This is achieved by assays that are based upon the physical and/or functional properties of the protein or complex, including, but not limited to, radioactive labeling of the product followed by analysis by gel electrophoresis, immunoassay, cross-linking to marker-labeled products, and the like.
- the ⁇ -APP:HsLON complex may be isolated and purified by standard methods known in the art (either from natural sources or recombinant host cells expressing the proteins/protein complex) including, but not limited to, column chromatography (e.g., ion exchange, affinity, gel exclusion, reverse-phase, high pressure, fast protein liquid, etc), differential centrifugation, differential solubility, or similar methodologies used for the purification of proteins.
- column chromatography e.g., ion exchange, affinity, gel exclusion, reverse-phase, high pressure, fast protein liquid, etc
- differential centrifugation e.g., differential centrifugation, differential solubility, or similar methodologies used for the purification of proteins.
- the amino acid sequence of the protein can be deduced from the nucleic acid sequence of the chimeric gene from which it was encoded.
- the protein or its derivative can be synthesized by standard chemical methodologies known in the art. See, e.g., Hunkapiller, et al, 1984.
- a ⁇ -APP:HsLON complex (whether produced by recombinant DNA techniques, chemical synthesis methods, or by purification from native sources) is made up from proteins, fragments, analogs and derivatives thereof, that, as their primary amino acid, contain sequences substantially as depicted in Figures 1 (SEQ ID NO:2) and 2 (SEQ ID NO:4), as well as proteins homologous thereto.
- Manipulations of the ⁇ -APP and/or HsLON sequences may be made at the protein level. Included within the scope of the present invention are complex of the ⁇ -APP or HsLON fragments, derivatives, fragments or analogs that are differentially modified during or after translation (e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, and the like).
- any of the numerous chemical modification methodologies known within the art may be utilized including, but not limited to, specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 , acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin, etc.
- the ⁇ -APP and/or HsLON sequences are modified to include a fluorescent label.
- the ⁇ -APP and/or the HsLON are modified by the inco ⁇ oration of a heterofunctional reagent, wherein such heterofunctional reagent may be used to cross-link the members of the complex.
- ⁇ -APP and/or HsLON can be chemically synthesized.
- a peptide corresponding to a portion of ⁇ -APP and/or HsLON that comprises the desired domain or that mediates the desired activity in vitro may be synthesized by use of a peptide synthesizer.
- the amino acid sequence of ⁇ -APP and/or HsLON isolated from the natural source may be determined from analysis of the DNA sequence, or alternatively, by direct sequencing of the isolated protein.
- the ⁇ -APP:HsLON complex may also be analyzed by hydrophilicity analysis (see e.g., Hopp & Woods, 1981. Proc. Natl. Acad. Sci. USA 78: 3824-3828) that can be utilized to identify the hydrophobic and hydrophilic regions of the proteins, thus aiding in the design of substrates for experimental manipulation, such as in binding experiments, antibody synthesis, etc.
- Secondary structural analysis may also be performed to identify regions of the ⁇ -APP and/or HsLON that assume specific structural motifs. See e.g., Chou & Fasman, 1974. Biochem. 13: 222-223. Manipulation, translation, secondary structure prediction, hydrophilicity and hydrophobicity profiles, open reading frame prediction and plotting, and determination of sequence homologies, can be accomplished using computer software programs available in the art, for e.g., Wisconsin GCG (Genetics Computer Group) software package using default parameter settings. Other methods of structural analysis including, but not limited to, X-ray crystallography (see e.g., Engstrom, 1974. Biochem. Exp. Biol.
- the present invention provides methodologies for screening ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complexes, as well as derivatives, fragments and analogs thereof, for the ability to alter and/or modulate cellular functions, particularly those functions in which ⁇ -APP and/or HsLON have been implicated. These functions include, but are not limited to, control of cell-cycle progression; regulation of transcription; control of intracellular signal transduction; and pathological processes, as well as various other biological activities (e.g., binding to an anti- ⁇ -APP, anti-HsLON, and/or anti- ⁇ -APP: HsLON complex antibody, and the like).
- the derivatives, fragments or analogs that possess the desired immunogenicity and/or antigenicity may be utilized in immunoassays, for immunization, for inhibition of ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex activity, etc.
- derivatives, fragments or analogs that retain, or alternatively lack or inhibit, a given property of interest e.g., participation in a ⁇ -APP:HsLON complex
- a given property of interest e.g., participation in a ⁇ -APP:HsLON complex
- inducers, or inhibitors, respectively, of such a property and its physiological correlates may be utilized as inducers, or inhibitors, respectively, of such a property and its physiological correlates.
- Derivatives, fragments and analogs of ⁇ -APP:HsLON complex may be analyzed for the desired activity or activities by procedures known within the art.
- ⁇ -APP:HsLON complex may be utilized as immunogens in the generation of antibodies that immunospecifically-bind these protein components.
- Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, F ab fragments and an F ab expression library.
- antibodies to a complex of human ⁇ -APP and human HsLON are disclosed.
- polyclonal or monoclonal antibodies to a ⁇ -APP:HsLON complex, or derivative, fragment, analog or homolog thereof.
- various host animals may be immunized by injection with the native ⁇ -APP:HsLON complex, or a synthetic variant thereof, or a derivative of the foregoing (e.g., a cross-linked ⁇ -APP:HsLON).
- adjuvants may be used to increase the immunological response and include, but are not limited to, Freund's (complete and incomplete), mineral gels (e.g., aluminum hydroxide), surface active substances (e.g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, etc.) and human adjuvants such as Bacille
- any technique that provides for the production of antibody molecules by continuous cell line culture may be utilized.
- Such techniques include, but are not limited to, the hybridoma technique (see Kohler & Milstein, 1975. Nature 256: 495-497); the trioma technique; the human B-cell hybridoma technique (see Kozbor, et al, 1983. Immunol. Today 4: 72) and the EBV hybridoma technique to produce human monoclonal antibodies (see Cole, et al, 1985. In: Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
- Human monoclonal antibodies may be utilized in the practice of the present invention and may be produced by the use of human hybridomas (see Cote, et al, 1983. Proc. Natl. Acad. Sci. USA 80: 2026-2030) or by transforming human B-cells with Epstein Barr Virus in vitro (see Cole, et al, 1985. In: Monoclonal Antibodies and Cancer Therapy (Alan R. Liss, Inc., pp. 77-96).
- techniques can be adapted for the production of single-chain antibodies specific to ⁇ -APP:HsLON complex (see e.g., U.S. Patent No. 4,946,778).
- methodologies can be adapted for the construction of F ab expression libraries (see e.g., Huse, et al, 1989. Science 246: 1275-1281) to allow rapid and effective identification of monoclonal F ab fragments with the desired specificity for ⁇ -APP:HsLON or derivatives, fragments, analogs or homologs thereof.
- Non-human antibodies can be "humanized" by techniques well known in the art. See e.g., U.S. Patent No. 5,225,539.
- Antibody fragments that contain the idiotypes to ⁇ -APP:HsLON complex may be produced by techniques known in the art including, but not limited to: ( ) an F (ab)2 fragment produced by pepsin digestion of an antibody molecule; (/ ) an F ab fragment generated by reducing the disulfide bridges of an F (ab)2 fragment; (iii) an F ab fragment generated by the treatment of the antibody molecule with papain and a reducing agent and (iv) F v fragments.
- methodologies for the screening of antibodies that possess the desired specificity include, but are not limited to, enzyme-linked immunosorbent assay (ELISA) and other immunologically-mediated techniques known within the art.
- ELISA enzyme-linked immunosorbent assay
- selection of antibodies that are specific to a particular domain of ⁇ -APP:HsLON complex is facilitated by generation of hybridomas that bind to the fragment of ⁇ -APP:HsLON complex possessing such a domain.
- methodologies for the selection of an antibody that specifically binds a ⁇ -APP:HsLON complex but that does not specifically bind to the individual proteins of ⁇ -APP:HsLON complex are within the scope of the invention. Accordingly, antibodies that are specific for a domain within ⁇ -APP:HsLON complex, or derivative, fragments, analogs or homologs thereof, are also provided herein.
- anti- ⁇ -APP, anti-HsLON, and/or anti- ⁇ -APP:HsLON complex antibodies, or derivatives, fragments, analogs or homologs thereof that contain the antibody derived binding domain are utilized as pharmacologically-active compounds [hereinafter "Therapeutics"].
- ⁇ -APP:HsLON complex may serve as a "marker" for specific disease states that involve the disruption of physiological processes in which ⁇ -APP and HsLON are known to be involved. See, e.g., BACKGROUND OF THE INVENTION.
- Such functional activities include, but not limited to, (1) neurodegenerative disorders such as Alzheimer's Disease, dementia of trisomy 21, Parkinson's disease, amyotrophic lateral sclerosis (ALS); (2) cardiomyopathy; (3) some forms of diabetes; (4) hearing loss; (5) and male infertility; as well as (6) a number of less common syndromes and disorders associated with mitochondrial DNA mutations, and the like.
- ⁇ -APP:HsLON complexes are predicted to have diagnostic utility. Therefore, the differentiation and classification of particular groups of patients possessing elevations or deficiencies of a ⁇ -APP:HsLON complex may lead to new nosological classifications of diseases, thereby markedly advancing diagnostic ability.
- the detection of levels of ⁇ -APP:HsLON complex or levels of ⁇ -APP and/or HsLON protein, or detection of levels of mRNAs that encode the components of a ⁇ -APP:HsLON complex may be utilized in the analysis of various diseases, and may provide critical information in various medical processes, including: diagnosis, prognosis, identifying disease states, following a disease course, following the efficacy of an administered therapeutics, following therapeutic response, and the like.
- both the nucleic acid sequences (and sequences complementary thereto) and antibodies specific to ⁇ -APP:HsLON complex and/or the individual components that can form ⁇ -APP:HsLON complexes can be used in diagnostics.
- Said molecules may be utilized in assays (e.g., immunoassays) to detect, prognose, diagnose, or monitor various conditions, diseases, and disorders characterized by aberrant levels of ⁇ -APP:HsLON complex, or monitor the treatment thereof.
- assays e.g., immunoassays
- An "aberrant level” means an increased or decreased level in a sample relative to that present in an analogous sample from an unaffected part of the body, or from a subject not having the disorder.
- the aforementioned immunoassay may be performed by a methodology comprising contacting a sample derived from a patient with an anti- ⁇ -APP, anti-HsLON, and/or anti- ⁇ -APP: HsLON complex antibody under conditions such that immunospecific-binding may occur, and subsequently detecting or measuring the amount of any immunospecific-binding by the antibody.
- an antibody specific for ⁇ -APP, HsLON, and/or a ⁇ -APP:HsLON complex may be used to analyze a tissue or serum sample from a patient for the presence of uncomplexed or complexed ⁇ -APP:HsLON; wherein an aberrant level of ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex is indicative of a diseased condition.
- the immunoassays include, but are not limited to, competitive and non-competitive assay systems using techniques such as Western Blots, radioimmunoassays (RIA), enzyme linked immunosorbent assay (ELISA), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein-A immunoassays, etc.
- nucleic acid species of the present invention encoding the associated protein components of ⁇ -APP:HsLON complex, and related nucleotide sequences and subsequences, may also be used in hybridization assays.
- ⁇ -APP and HsLON nucleotide sequences, or subsequences thereof comprising at least 6 nucleotides may be used as hybridization probes.
- Hybridization assays can be used to detect, prognose, diagnose, or monitor conditions, disorders, or disease states associated with aberrant levels of the mRNAs encoding the components of a ⁇ -APP:HsLON complex, as described supra.
- diseases and disorders involving or characterized by aberrant levels of ⁇ -APP:HsLON complex or a predisposition to develop such disorders may be diagnosed by detecting aberrant levels of ⁇ -APP:HsLON complex, or non-complexed ⁇ -APP and/or HsLON proteins or nucleic acids for functional activity.
- This aforementioned functional activity may include, but is not restricted to, ( ) binding to an interacting partner (e.g., ⁇ -APP, HsLON) or (ii) detecting mutations in ⁇ -APP and/or a HsLON RNA, DNA or protein (e.g., translocations, truncations, changes in nucleotide or amino acid sequence relative to wild-type ⁇ -APP and/or the HsLON) that can cause altered expression or activity of a ⁇ -APP, a HsLON or a ⁇ -APP:HsLON complex.
- an interacting partner e.g., ⁇ -APP, HsLON
- detecting mutations in ⁇ -APP and/or a HsLON RNA, DNA or protein e.g., translocations, truncations, changes in nucleotide or amino acid sequence relative to wild-type ⁇ -APP and/or the HsLON
- Methodologies that are well-known within the art may be used to determine whether one or more particular ⁇ -APP:HsLON complexes are present at either increased or decreased levels, or are absent, within samples derived from patients suffering from a particular disease or disorder, or possessing a predisposition to develop such a disease or disorder, as compared to the levels in samples from subjects not having such disease or disorder or predisposition thereto. Additionally, these assays may be utilized to determine whether the ratio of ⁇ -APP:HsLON complex to the non-complexed components (i.e.
- ⁇ -APP and/or HsLON in the complex of interest is increased or decreased in samples from patients suffering from a particular disease or disorder or having a predisposition to develop such a disease or disorder as compared to the ratio in samples from subjects not having such a disease or disorder or predisposition thereto.
- diseases and disorders that involve altered levels of one or more ⁇ -APP:HsLON complex may be diagnosed, or their suspected presence may be screened for, or a predisposition to develop such diseases and disorders may be detected, by quantitatively ascertaining altered levels of: (i) the one or more ⁇ -APP:HsLON complex; (ii) the mRNA encoding both protein members of said complex; (iii) the complex functional activity or (iv) mutations in ⁇ -APP or the HsLON (e.g., translocations in nucleic acids, truncations in the gene or protein, changes in nucleotide or amino acid sequence relative to wild-type ⁇ -APP or the HsLON) that enhance/inhibit or stabilize/destabilize ⁇ -APP:HsLON complex formation.
- the use of detection techniques provide methods for the detection of specific cells that express the uncomplexed or complexed protein of interest, e.g., ⁇ -APP and/or HsLON.
- specific cell types may be quantitatively characterized in which one or more particular components of a ⁇ -APP:HsLON complex are expressed, and the presence of the uncomplexed or complexed protein may be correlated with cell viability by techniques well-known within the art (e.g., fluorescence-activated cell sorting).
- detection techniques include, but are not limited to, cell-sorting of prokaryotes (see e.g., Davey & Kell, 1996. Microbiol. Rev. 60: 641-696); primary cultures and tissue specimens from eukaryotes, including mammalian species such as human (see e.g., Steele, et al, 1996. Clin. Obstet. Gynecol. 39: 801-813) and continuous cell cultures (see e.g., Orfao & Ruiz-Arguelles, 1996. Clin. Biochem. 29: 5-9.
- kits for diagnostic use are comprised of one or more containers containing an anti- ⁇ -APP, anti-HsLON, and/or anti- ⁇ -APP:HsLON complex antibody and, optionally, a labeled binding partner to said antibody.
- the label inco ⁇ orated into the anti- ⁇ -APP:HsLON complex antibody may include, but is not limited to, a chemiluminescent, enzymatic, fluorescent, colorimetric or radioactive moiety.
- kits for diagnostic use that are comprised of one or more containers containing modified or unmodified nucleic acids that encode, or alternatively, that are the complement to, ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex and, optionally, a labeled binding partner to said nucleic acids, are also provided.
- the kit may comprise, in one or more containers, a pair of oligonucleotide primers (e.g., each 6-30 nucleotides in length) that are capable of acting as amplification primers for polymerase chain reaction (PCR; see e.g., Innis, et al, 1990.
- PCR polymerase chain reaction
- the kit may, optionally, further comprise a predetermined amount of a purified ⁇ -APP, HsLON or ⁇ -APP:HsLON complex, or nucleic acids thereof, for use as a diagnostic, standard, or control in the aforementioned assays.
- the present invention provides a method for treatment or prevention of various diseases and disorders by administration of a biologically-active therapeutic compound (hereinafter "Therapeutic”).
- “Therapeutics” include but are not limited to: (i) ⁇ -APP, HsLON, and ⁇ -APP:HsLON complex, and derivative, fragments, analogs and homologs thereof; (ii) antibodies directed against the aforementioned proteins and protein complex thereof; (iii) nucleic acids encoding ⁇ -APP and/or HsLON, and derivatives, fragments, analogs and homologs thereof; (iv) antisense nucleic acids to sequences encoding ⁇ -APP and HsLON proteins, and (v) ⁇ -APP:HsLON complex and modulators thereof ( i.e., inhibitors, agonists and antagonists).
- ⁇ -APP and its binding partner HsLON are implicated significantly in disorders including, but not limited to, neurodegenerative disorders such as Alzheimer's Disease, dementia of trisomy 21, Parkinson's disease, amyotrophic lateral sclerosis (ALS); cardiomyopathy; some forms of diabetes; hearing loss; and male infertility; as well as a number of less common syndromes and disorders associated with mitochondrial DNA mutations.
- a wide range of cell diseases is treated or prevented by administration of a Therapeutic that modulates, i.e., antagonizes or promotes, ⁇ -APP:HsLON complex activity or formation.
- ⁇ -APP:HsLON complex Diseases or disorders associated with aberrant levels of a ⁇ -APP:HsLON complex or levels of activity or aberrant levels of ⁇ -APP may be treated by administration of a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity.
- the activity or levels of ⁇ -APP are modulated by administration of HsLON.
- the activity or levels of HsLON are modulated by administration of ⁇ -APP.
- ⁇ -APP:HsLON levels or biological activity may be treated with Therapeutics that antagonize (i.e., reduce or inhibit) ⁇ -APP:HsLON complex formation or activity.
- Therapeutics that antagonize ⁇ -APP:HsLON complex formation or activity may be administered in a therapeutic or prophylactic manner.
- Therapeutics that may be utilized include, but are not limited to, ⁇ -APP or HsLON, or analogs, derivatives, fragments or homologs thereof; (ii) anti- ⁇ -APP, anti-HsLON, and/or anti- ⁇ -APP:HsLON complex antibodies; (/ ' / ' / ' ) nucleic acids encoding ⁇ -APP or HsLON; (iv) concurrent administration of a ⁇ -APP and a HsLON antisense nucleic acid and ⁇ -APP and/or HsLON nucleic acids that are "dysfunctional" (i.e., due to a heterologous [non- ⁇ -APP and/or non-HsLON] insertion within the coding sequences of ⁇ -APP and HsLON coding sequences) are utilized to "knockout" endogenous ⁇ -APP and/or HsLON function by homologous recombination (see e.g., Capecchi, 1989.
- mutants or derivatives of a first HsLON that possess greater affinity for ⁇ -APP than the wild-type first HsLON may be administered to compete with a second HsLON for binding to ⁇ -APP, thereby reducing the levels of complex between ⁇ -APP and the second HsLON.
- Increased levels of ⁇ -APP:HsLON complex can be readily detected by quantifying protein and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy tissue) and assaying it in vitro for RNA or protein levels, structure and/or activity of the expressed ⁇ -APP:HsLON complex (or ⁇ -APP and HsLON mRNAs).
- Methods that are well-known within the art include, but are not limited to, immunoassays to detect ⁇ -APP:HsLON complex (e.g., by Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, immunocytochemistry, and the like) and/or hybridization assays to detect concurrent expression of ⁇ -APP and HsLON mRNAs (e.g., Northern assays, dot blots, in situ hybridization, and the like).
- immunoassays to detect ⁇ -APP:HsLON complex e.g., by Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, immunocytochemistry, and the like
- hybridization assays to detect concurrent expression of ⁇ -APP and HsLON mRNAs (e.g., Northern assays, dot blots
- RNA Therapeutics are differentiated into three classes: ( ) antisense species; (ii) ribozymes or (/ ' // * ) RNA aptamers. See e.g., Good, et al, 1997. Gene Therapy 4: 45-54. Antisense oligonucleotides have been the most widely utilized and are discussed infra.
- Ribozyme therapy involves the administration (i.e., induced expression) of small RNA molecules with enzymatic ability to cleave, bind, or otherwise inactivate specific RNAs, thus reducing or eliminating the expression of particular proteins. See e.g., Grassi & Marini, 1996. Ann. Med. 28: 499-510.
- the design of "hai ⁇ in” and/or "hammerhead" RNA ribozymes are necessary to specifically-target a particular mRNA (e.g., ⁇ -APP mRNA).
- RNA aptamers are specific RNA ligands for proteins, such as for Tat and Rev RNA (see e.g., Good, et al, 1997. Gene Therapy 4: 45-54) which can specifically inhibit their translation.
- the activity or level of ⁇ -APP may be reduced by administration of HsLON, a nucleic acid that encodes HsLON or an antibody (or a derivative or fragment of the antibody possessing the binding domain thereof) that immunospecifically-binds to HsLON.
- the levels or activity of HsLON may be reduced by administration of ⁇ -APP, a nucleic acid encoding ⁇ -APP or an antibody (or a derivative or fragment of the antibody possessing the binding domain thereof) that immunospecifically-binds ⁇ -APP.
- diseases or disorders that are associated with increased levels of ⁇ -APP or HsLON may be treated or prevented by administration of a Therapeutic that increases ⁇ -APP:HsLON complex formation, if said complex formation acts to reduce or inactivate ⁇ -APP or the particular HsLON via ⁇ -APP:HsLON complex formation.
- Such diseases or disorders may be treated or prevented by: (/ ' ) the administration of one member of ⁇ -APP: HsLON complex, including mutants of one or both of the proteins that possess increased affinity for the other member of ⁇ -APP:HsLON complex (so as to cause increased complex formation) or ( / ' ) the administration of antibodies or other molecules that serve to stabilize ⁇ -APP:HsLON complex, or the like.
- suitable in vitro or in vivo assays are utilized to determine the effect of a specific Therapeutic and whether its administration is indicated for treatment of the affected tissue.
- in vitro assays may be performed with representative cells of the type(s) involved in the patient's disorder, to determine if a given Therapeutic exerts the desired effect upon said cell type(s).
- Compounds for use in therapy may be tested in suitable animal model systems including, but not limited to rats, mice, chicken, cows, monkeys, rabbits, and the like, prior to testing in human subjects.
- suitable animal model systems including, but not limited to rats, mice, chicken, cows, monkeys, rabbits, and the like, prior to testing in human subjects.
- any of the animal model system known in the art may be used prior to administration to human subjects.
- ⁇ -APP and its binding partner HsLON have been implicated in neurodegenerative diseases.
- Therapeutics of the invention may be effective in treating or preventing neurodegenerative disease.
- Therapeutics of the present invention that modulate ⁇ -APP:HsLON complex activity involved in neurodegenerative disorders can be assayed by any method known in the art for efficacy in treating or preventing such neurodegenerative diseases and disorders.
- Such assays include in vitro assays for regulated cell maturation or inhibition of apoptosis or in vivo assays using animal models of neurodegenerative diseases or disorders, or any of the assays described infra. Potentially effective
- Therapeutics for example but not by way of limitation, promote regulated cell maturation and prevent cell apoptosis in culture, or reduce neurodegeneration in animal models in comparison to controls.
- a neurodegenerative disease or disorder has been shown to be amenable to treatment by modulation of ⁇ -APP:HsLON complex activity
- that neurodegenerative disease or disorder can be treated or prevented by administration of a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity, including supplying a ⁇ -APP:HsLON complex or an uncomplexed binding partner, e.g., ⁇ -APP and/or HsLON.
- a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity, including supplying a ⁇ -APP:HsLON complex or an uncomplexed binding partner, e.g., ⁇ -APP and/or HsLON.
- Such diseases include all degenerative disorders involved with aging, especially osteoarthritis and neurodegenerative disorders.
- HsLON has been linked to several disorders and syndromes that share the common feature of hypertrophic cardiomyopathy. Accordingly, Therapeutics of the invention, particularly those that modulate (or supply) ⁇ -APP:HsLON complex activity or formation may be effective in treating or preventing hypertrophic cardiomyopathy and associated diseases or disorders. Therapeutics of the invention (particularly Therapeutics that modulate the levels or activity of a ⁇ -APP:HsLON complex) can be assayed by any method known in the art, including those described infra, for efficacy in treating or preventing such diseases and disorders.
- an hypertrophic cardiomyopathy-associated disease or disorder has been shown to be amenable to treatment by modulation of ⁇ -APP:HsLON complex activity or formation
- that disease or disorder can be treated or prevented by administration of a Therapeutic that modulates ⁇ -APP:HsLON complex activity or formation including supplying a ⁇ -APP:HsLON complex, or individual uncomplexed ⁇ -APP and/or HsLON proteins.
- Therapeutics of the invention may be effective in treating or preventing neurodegenerative disease.
- Therapeutics of the present invention that modulate ⁇ -APP:HsLON complex activity involved in diabetes can be assayed by any method known in the art for efficacy in treating or preventing such diseases and disorders.
- Such assays include in vitro assays or in vivo assays using animal models of diabetes, or any of the assays described infra.
- Potentially effective Therapeutics for example but not by way of limitation, reduce diabetes in animal models in comparison to controls.
- ⁇ -APP:HsLON complex activity a disease or disorder can be treated or prevented by administration of a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity, including supplying a ⁇ -APP:HsLON complex or an uncomplexed binding partner, e.g., ⁇ -APP and/or HsLON.
- a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity, including supplying a ⁇ -APP:HsLON complex or an uncomplexed binding partner, e.g., ⁇ -APP and/or HsLON.
- HsLON has been implicated in both sensorineural hearing loss and maternally-inherited deafness. Accordingly, Therapeutics of the invention, particularly but not limited to those that modulate (or supply) ⁇ -APP:HsLON complex activity, may be effective in treating or preventing sensorineural hearing loss or maternally-inherited deafness. Therapeutics of the present invention that modulate ⁇ -APP:HsLON complex activity involved in sensorineural hearing loss or maternally-inherited deafness can be assayed by any method known in the art for efficacy in treating or preventing such diseases and disorders.
- Such assays include in vitro assays or in vivo assays using animal models of sensorineural hearing loss or maternally- inherited deafness, or any of the assays described infra.
- Potentially effective Therapeutics for example but not by way of limitation, reduce sensorineural hearing loss or maternally-inherited deafness in animal models in comparison to controls.
- ⁇ -APP:HsLON complex activity a sensorineural hearing loss or maternally-inherited deafness has been shown to be amenable to treatment by modulation of ⁇ -APP:HsLON complex activity
- that disease or disorder can be treated or prevented by administration of a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity, including supplying a ⁇ -APP:HsLON complex or an uncomplexed binding partner, e.g. , ⁇ -APP and/or HsLON.
- Therapeutics of the invention may be effective in treating or preventing male infertility.
- Therapeutics of the present invention that modulate ⁇ -APP:HsLON complex activity involved in male infertility can be assayed by any method known in the art for efficacy in treating or preventing such diseases and disorders.
- Such assays include in vitro assays or in vivo assays using animal models of male infertility, or any of the assays described infra.
- Potentially effective Therapeutics for example but not by way of limitation, reduce male infertility in animal models in comparison to controls.
- ⁇ -APP:HsLON complex activity a male infertility has been shown to be amenable to treatment by modulation of ⁇ -APP:HsLON complex activity
- that disease or disorder can be treated or prevented by administration of a Therapeutic that modulates ⁇ -APP:HsLON complex formation or activity, including supplying a ⁇ -APP:HsLON complex or an uncomplexed binding partner, e.g., ⁇ -APP and/or HsLON.
- HsLON has been implicated in a number of diseases or disorders associated with mitochondrial DNA mutations. Accordingly, Therapeutics of the invention, particularly but not limited to those that modulate (or supply) ⁇ -APP:HsLON complex activity, may be effective in treating or preventing diseases or disorders associated with mitochondrial DNA mutations. Therapeutics of the present invention that modulate ⁇ -APP:HsLON complex activity involved in diseases or disorders associated with mitochondrial DNA mutations can be assayed by any method known in the art for efficacy in treating or preventing such diseases and disorders. Such assays include in vitro assays or in vivo assays using animal models of diseases or disorders associated with mitochondrial DNA mutations, or any of the assays described infra. Potentially effective Therapeutics, for example but not by way of limitation, reduce diseases or disorders associated with mitochondrial DNA mutations in animal models in comparison to controls.
- nucleic acids comprising a sequence that encodes ⁇ -APP and/or HsLON, or functional derivatives thereof, are administered to modulate ⁇ -APP:HsLON complex function, by way of gene therapy.
- a nucleic acid or nucleic acids encoding both ⁇ -APP and HsLON, or functional derivatives thereof, are administered by way of gene therapy.
- Gene therapy refers to therapy that is performed by the administration of a specific nucleic acid to a subject.
- the nucleic acid produces its encoded protein(s), which then serve to exert a therapeutic effect by modulating ⁇ -APP:HsLON complex function.
- Any of the methodologies relating to gene therapy available within the art may be used in the practice of the present invention. See e.g., Goldspiel, et al, 1993. Clin. Pharm. 12: 488-505.
- the Therapeutic comprises a ⁇ -APP and/or HsLON nucleic acid that is part of an expression vector expressing both of the aforementioned proteins, or fragments or chimeric proteins thereof, within a suitable host.
- a nucleic acid possesses a promoter that is operably-linked to ⁇ -APP and HsLON coding region(s), or, less preferably, two separate promoters linked to separate ⁇ -APP and HsLON coding regions. Said promoter may be inducible or constitutive, and, optionally, tissue-specific.
- a nucleic acid molecule is used in which ⁇ -APP and HsLON coding sequences (and any other desired sequences) are flanked by regions that promote homologous recombination at a desired site within the genome, thus providing for intra-chromosomal expression of ⁇ -APP and HsLON nucleic acids. See e.g., Koller & Smithies, 1989. Proc. Natl. Acad. Sci. USA 86: 8932-8935.
- Delivery of the Therapeutic nucleic acid into a patient may be either direct (i.e., the patient is directly exposed to the nucleic acid or nucleic acid-containing vector) or indirect (i.e., cells are first transformed with the nucleic acid in vitro, then transplanted into the patient). These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
- a nucleic acid is directly administered in vivo, where it is expressed to produce the encoded product.
- nucleic acid as part of an appropriate nucleic acid expression vector and administering the same in a manner such that it becomes intracellular (e.g., by infection using a defective or attenuated retroviral or other viral vector; see U.S. Patent No.
- a nucleic acid-ligand complex may be produced in which the ligand comprises a fusogenic viral peptide designed so as to disrupt endosomes, thus allowing the nucleic acid to avoid subsequent lysosomal degradation.
- the nucleic acid may be targeted in vivo for cell-specific endocytosis and expression, by targeting a specific receptor. See e.g., PCT Publications WO 92/06180; WO93/14188 and WO 93/20221.
- the nucleic acid may be introduced intracellularly and inco ⁇ orated within a host cell genome for expression by homologous recombination. See e.g., Zijlstra, et al, 1989. Nature 342: 435-438.
- a viral vector that contains ⁇ -APP and/or HsLON nucleic acids is utilized.
- retroviral vectors may be employed (see e.g., Miller, et al, 1993. Meth. Enzymol. 217: 581-599) that have been modified to delete those retroviral-specific sequences that are not required for packaging of the viral genome, with its subsequent integration into host cell DNA.
- ⁇ -APP and/or HsLON (preferably both) nucleic acids may be cloned into a vector that facilitates delivery of the genes into a patient. See e.g., Boesen, et al, 1994. Biotherapy 6: 291-302; Kiem, et al, 1994.
- adenovirus may be used as an especially efficacious "vehicle" for the delivery of genes to the respiratory epithelia.
- Other targets for adenovirus-based delivery systems are liver, central nervous system, endothelial cells, and muscle. Adenoviruses also possess advantageous abilities to infect non-dividing cells.
- Adenovirus-associated virus AAV has also been proposed for use in gene therapy. See e.g., Walsh, et al, 1993. Proc. Soc. Exp. Biol. Med. 204: 289-300.
- An additional approach to gene therapy in the practice of the present invention involves transferring a gene into cells in in vitro tissue culture by such methods as electroporation, lipofection, calcium phosphate-mediated transfection, viral infection, or the like.
- the methodology of transfer includes the concomitant transfer of a selectable marker to the cells.
- the cells are then placed under selection pressure (e.g., antibiotic resistance) so as to facilitate the isolation of those cells that have taken up, and are expressing, the transferred gene. Those cells are then delivered to a patient.
- the nucleic acid prior to the in vivo administration of the resulting recombinant cell, is introduced into a cell by any method known within the art including, but not limited to: transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences of interest, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, and similar methodologies that ensure that the necessary developmental and physiological functions of the recipient cells are not disrupted by the transfer. See e.g., Loeffler & Behr, 1993. Meth. Enzymol. 217: 599-618.
- the chosen technique should provide for the stable transfer of the nucleic acid to the cell, such that the nucleic acid is expressible by the cell.
- said transferred nucleic acid is heritable and expressible by the cell progeny.
- the resulting recombinant cells may be delivered to a patient by various methods known within the art including, but not limited to, injection of epithelial cells (e.g., subcutaneously), application of recombinant skin cells as a skin graft onto the patient, and intravenous injection of recombinant blood cells (e.g., hematopoietic stem or progenitor cells).
- epithelial cells e.g., subcutaneously
- recombinant skin cells as a skin graft onto the patient
- recombinant blood cells e.g., hematopoietic stem or progenitor cells
- Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and may be xenogeneic, heterogeneic, syngeneic, or autogeneic.
- Cell types include, but are not limited to, differentiated cells such as epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes and blood cells, or various stem or progenitor cells, in particular embryonic heart muscle cells, liver stem cells (International Patent Publication WO 94/08598), neural stem cells (Stemple and Anderson, 1992, Cell 71: 973-985), hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, and the like.
- the cells utilized for gene therapy are autologous to the patient.
- stem or progenitor cells that can be isolated and maintained in vitro may be utilized.
- stem cells include, but are not limited to, hematopoietic stem cells (HSC), stem cells of epithelial tissues, and neural stem cells (see e.g., Stemple & Anderson, 1992. Cell 71 : 973-985).
- HSCs hematopoietic stem cells
- stem cells of epithelial tissues include, but are not limited to, hematopoietic stem cells (HSC), stem cells of epithelial tissues, and neural stem cells (see e.g., Stemple & Anderson, 1992. Cell 71 : 973-985).
- HSCs any technique that provides for the isolation, propagation, and maintenance in vitro of HSC may be used in this specific embodiment of the invention.
- the HSCs utilized for gene therapy may, preferably, be autologous to the patient.
- non-autologous HSCs are, preferably, utilized in conjunction with a method of suppressing transplantation immune reactions of the future host/patient. See e.g., Kodo, et al, 1984. J. Clin. Invest. 73: 1377-1384.
- HSCs may be highly enriched (or produced in a substantially-pure form), by any techniques known within the art, prior to administration to the patient. See e.g., Witlock & Witte, 1982. Proc. Natl. Acad. Sci. USA 79: 3608-3612.
- ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex formation and function may be inhibited by the use of anti-sense nucleic acids for ⁇ -APP or HsLON, or most preferably, ⁇ -APP and HsLON.
- the present invention discloses the therapeutic or prophylactic use of nucleic acids (of at least six nucleotides in length) that are anti-sense to a genomic sequence (gene) or cDNA encoding ⁇ -APP and/or HsLON, or portions thereof.
- Such anti-sense nucleic acids have utility as Therapeutics that inhibit ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex formation or activity, and may be utilized in a therapeutic or prophylactic manner.
- Another specific embodiment of the present invention discloses methodologies for inhibition of expression of ⁇ -APP and HsLON nucleic acid sequences within a prokaryotic or eukaryotic cell, such as providing a cell with an therapeutically-effective amount of an anti-sense nucleic acid of ⁇ -APP and/or HsLON, or derivatives thereof.
- the anti-sense nucleic acids of the present invention may be oligonucleotides that may either be directly administered to a cell or that may be produced in vivo by transcription of the exogenous, introduced sequences.
- the anti-sense nucleic acid may be complementary to either a coding (i.e., exonic) and/or non-coding (i.e., intronic) region of ⁇ -APP or HsLON mRNAs.
- ⁇ -APP and HsLON anti-sense nucleic acids are, at least, six nucleotides in length and are, preferably, oligonucleotides ranging from 6-200 nucleotides in length.
- the anti-sense oligonucleotide is at least 10 nucleotides, at least 15 nucleotides, at least 100 nucleotides, or at least 200 nucleotides.
- the anti-sense oligonucleotides may be DNA or RNA (or chimeric mixtures, derivatives or modified versions thereof), may be either single-stranded or double-stranded and may be modified at a base, sugar or phosphate backbone moiety.
- said anti-sense oligonucleotide may include other associated functional groups, such as peptides, moieties that facilitate the transport of the oligonucleotide across the cell membrane, hybridization-triggered cross-linking agents, hybridization-triggered cleavage-agents, and the like. See e.g., Letsinger, et al, 1989. Proc. Natl. Acad. Sci. U.S.A. 86: 6553-6556; PCT Publication No. WO 88/09810.
- ⁇ -APP and HsLON antisense oligonucleotides comprise catalytic RNAs or ribozymes. See, e.g., Sarver, et al, 1990. Science 247: 1222-1225.
- the anti-sense oligonucleotides of the present invention may be synthesized by standard methodologies known within the art including, but not limited to: (/ ' ) automated phosphorothioate-mediated oligonucleotide synthesis (see e.g., Stein, et al, 1988. Nuc. Acids Res. 16: 3209) or (/ ) methylphosphonate oligonucleotides prepared by use of controlled pore glass polymer supports (see e.g., Sarin, et al, 1988. Proc. Natl. Acad. Sci. U.S.A. 85: 7448-7451).
- ⁇ -APP and HsLON antisense nucleic acids are produced intracellularly by transcription of an exogenous sequence.
- a vector comprising a promoter functionally linked to the reverse complement of a desired gene, and the like, may be produced that (upon being taken up by the cell) is transcribed in vivo, thus producing an antisense nucleic acid (RNA) species.
- RNA antisense nucleic acid
- the aforementioned vector may either remain episomal or become chromosomally-integrated, so long as it can be transcribed to produce the desired antisense RNA.
- An origin of the vectors utilized may be derived from bacterial, viral, yeast or other sources known within the art that are utilized for replication and expression in mammalian cells.
- RNAs may be facilitated by any promoter known within the art to function in mammalian, preferably, human cells.
- promoters may be inducible or constitutive and include, but are not limited to: ( ) the SV40 early promoter region; ( /) the promoter contained in the 3'-terminus long terminal repeat of Rous sarcoma virus (RSV); ( ) the Herpesvirus thymidine kinase promoter and (; ' v) the regulatory sequences of the metallothionein gene.
- ⁇ -APP and HsLON antisense nucleic acids may be utilized prophylactically or therapeutically in the treatment or prevention of disorders of a cell type that expresses (or preferably over-expresses) ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex.
- Cell types that express or over-express ⁇ -APP and HsLON RNA may be identified by various methods known within the art including, but not limited to, hybridization with ⁇ -APP and HsLON-specific nucleic acids (e.g., by Northern hybridization, dot blot hybridization, in situ hybridization) or by observing the ability of RNA from the specific cell type to be translated in vitro into ⁇ -APP and/or HsLON by immunohistochemistry.
- primary tissue from a patient may be assayed for ⁇ -APP and/or HsLON expression by, for example, immunocytochemistry or in situ hybridization, prior to actual treatment.
- compositions of the present invention comprising an effective amount of a ⁇ -APP and HsLON antisense nucleic acid contained within a pharmaceutically-acceptable carrier, may be administered to a patient having a disease or disorder of a type that involves modified expression of ⁇ -APP:HsLON complex, or of RNA or protein of the individual components of said complex.
- the amount of ⁇ -APP and/or HsLON antisense nucleic acid that is effective in the treatment of a particular disorder or condition will be dependant upon the nature of the disorder or condition, and may be determined by standard clinical techniques. Where possible, it is desirable to determine the antisense cytotoxicity in in vitro systems and in useful animal model prior to testing and use in humans.
- compositions comprising ⁇ -APP and HsLON antisense nucleic acids may be administered via liposomes, microparticles, or microcapsules or the like. See, e.g., supra, and Leonetti, et al, 1990. Proc. Natl Acad. Sci. U.S.A. 87: 2448-2451.
- ⁇ -APP:HsLON complex may be assayed by a number of methods known in the art.
- putative modulators e.g., inhibitors, agonists and antagonists
- ⁇ -APP: ⁇ -APP complex activity e.g., anti- ⁇ -APP: HsLON complex antibodies, as well as ⁇ -APP or HsLON antisense nucleic acids
- ⁇ -APP:HsLON complex formation and/or activity e.g., anti- ⁇ -APP: HsLON complex antibodies, as well as ⁇ -APP or HsLON antisense nucleic acids
- immunoassay-based methodologies are provided wherein one is assaying for: (/ ' ) the ability to bind to, or compete with, wild-type ⁇ -APP:HsLON complex or HsLON, or (ii) the ability to bind to an anti- ⁇ -APP:HsLON complex antibody.
- immunoassays include, but are not limited to, competitive and non-competitive assay systems utilizing techniques such as radioimmunoassays, enzyme linked immunosorbent assay (ELISA), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (e.g., using colloidal gold, enzyme or radioisotope labels), complement fixation assays, Western blots, Northwestern blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), immunofluorescence assays, protein-A assays and immunoelectrophoresis assays, and the like.
- ELISA enzyme linked immunosorbent assay
- sandwich immunoassays immunoradiometric assays
- gel diffusion precipitin reactions e.g., gel diffusion precipitin reactions
- antibody binding is detected directly by assaying for a label on a primary antibody.
- binding of the primary antibody is ascertained by detection of a secondary antibody (or reagent) that is specific for the primary antibody.
- the secondary antibody is labeled.
- ⁇ -APP or HsLON genes may be detected using techniques known within the art including, but not limited to, Southern hybridization, Northern hybridization, restriction endonuclease mapping, DNA sequence analysis, and polymerase chain reaction amplification (PCR) followed by Southern hybridization or RNase protection (see e.g., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY 1997, John Wiley and Sons, New York, NY) with probes specific for ⁇ -APP and HsLON genes in various cell types.
- Southern hybridization may be used to detect genetic linkage of ⁇ -APP and/or HsLON gene mutations to physiological or pathological states. Numerous cell types, at various stages of development, may be characterized for their expression of ⁇ -APP and HsLON (particularly the concomitant expression of ⁇ -APP and HsLON within the same cells).
- the stringency of the hybridization conditions for Northern or Southern blot analysis may be manipulated to ensure detection of nucleic acids with the desired degree of relatedness to the specific probes used. See, e.g., supra. Modification of these aforementioned methods, as well as other methods well-known within the art, may be utilized in the practice of the present invention. Binding Assays
- Derivatives, fragments, analogs and homologs of HsLON may be assayed for binding to ⁇ -APP by any method known within the art including, but not limited to: ( ) the modified yeast two hybrid assay system; (ii) immunoprecipitation with an antibody that binds to ⁇ -APP within a complex, followed by analysis by size fractionation of the immunoprecipitated proteins (e.g., by denaturing or non-denaturing polyacrylamide gel electrophoresis); (iii) Western analysis; (v) non-denaturing gel electrophoresis, and the like.
- the aforementioned techniques may be modified to allow for the reverse analysis, whereby ⁇ -APP components bind to HsLON.
- a specific embodiment of the present invention provides a methodology for screening a derivative, fragment, analog or homolog of ⁇ -APP for biological activity, which is comprised of contacting said derivative, fragment, analog or homolog of ⁇ -APP with HsLON and detecting complex formation between said derivative, fragment, analog or homolog of ⁇ -APP and HsLON; wherein the detection of the formation of said complex indicates that said ⁇ -APP derivative, fragment, analog or homolog, possesses biological (e.g., binding) activity.
- an additional embodiment discloses a methodology for the screening a derivative, fragment, analog or homolog of HsLON for biological activity comprising contacting said derivative, fragment, analog or homolog of said protein with ⁇ -APP; and detecting complex formation between said derivative, fragment, analog or homolog of HsLON and ⁇ -APP; wherein detecting the formation of said complex indicates that said HsLON derivative, fragment, analog, or homolog possesses biological activity.
- ⁇ -APP has been implicated in the development and involution of all organs, including the central nervous system.
- ⁇ -APP:HsLON complex or derivative, homolog, analog or fragment thereof, nucleic acid molecules encoding ⁇ -APP or HsLON, anti- ⁇ -APP: HsLON complex antibodies, and other modulators of ⁇ -APP, HsLON, and/or ⁇ -APP:HsLON complex activity or formation can be tested for activity in treating or preventing neurodegenerative disease in in vitro and in vivo assays.
- a Therapeutic of the invention can be assayed for activity in treating or preventing neurodegenerative disease by contacting a cultured cell that exhibits an indicator of a neurodegenerative disease in vitro with the Therapeutic and comparing the level of said indicator in the cell so contacted with the Therapeutic, with said level of said indicator in a cell not so contacted, wherein a lower level in said contacted cell indicates that the Therapeutic has activity in treating or preventing neurodegenerative disease.
- cultured models for neurodegenerative disease include, but are not limited to, cultured rat endothelial cells from affected and nonaffected individuals (Maneiro et al, 1997, Methods Find. Exp. Clin. Pharmacol.
- a Therapeutic of the invention can be assayed for activity in treating or preventing neurodegenerative disease by administering the Therapeutic to a test animal that is predisposed to develop symptoms of a neurodegenerative disease, and measuring the change in said symptoms after administration of said Therapeutic, wherein a reduction in the severity of the symptoms of the neurodegenerative disease, or the prevention of the symptoms of the neurodegenerative disease, indicates that the Therapeutic has activity in treating or preventing said disease states.
- a test animal can be any one of a number of animal models known in the art for neurodegenerative disease. These models, including those for Alzheimer's Disease and mental retardation of trisomy 21, accurately mimic natural human neurodegenerative diseases. Farine, 1997, Toxicol 119: 29-35.
- Examples of specific models include, but are not limited to, the partial trisomy 16 mouse (Holtzman et al, 1996, Proc. Natl. Acad. Sci. USA 93: 13333-13338); bilateral nucleus basalis magnocellularis-lesioned rats (Popovic et al, 1996, Int. J. Neurosci. 86: 281-299); the aged rat (Muir, 1997, Pharmacol. Biochem. Behav. 56: 687-696); the PDAPP transgenic mouse model of Alzheimer's disease (Johnson- Wood et al, 1997, Proc. Natl. Acad. Sci. USA 94: 1550-1555); and experimental autoimmune dementia (Oron et al, 1997, J. Neural Transm. Suppl. 49: 77-84).
- a ⁇ -APP:HsLON complex is administered to treat or prevent a disease or disorder involving cardiomyopathy.
- HsLON has been linked to several disorders and syndromes that share the common feature of hypertrophic cardiomyopathy.
- a ⁇ -APP:HsLON complex or a derivative, homolog, analog or fragment thereof, nucleic acids encoding the ⁇ -APP and HsLON proteins, anti- ⁇ -APP:HsLON antibodies, and other modulators of ⁇ -APP:HsLON complex activity or formation can be tested for activity in treating or preventing a disease or disorder involving cardiomyopathy in in vitro and in vivo assays.
- a Therapeutic of the invention can be assayed for activity in treating or preventing cardiomyopathy by contacting cultured cells, such as but not limited to, cultured cardiac myocytes from neonates (Wall et al, 1996, Eur. J. Pharmacol. 306: 165-174) or adults (Hain and Schaper, 1996, Curr. Opin. Cardiol.
- cultured cells such as but not limited to, cultured cardiac myocytes from neonates (Wall et al, 1996, Eur. J. Pharmacol. 306: 165-174) or adults (Hain and Schaper, 1996, Curr. Opin. Cardiol.
- a Therapeutic of the invention can be assayed for activity in treating or preventing cardiomyopathy by administering the Therapeutic to a test animal exhibiting symptoms of cardiomyopathy; and measuring the change in said symptoms of cardiomyopathy after administration of said Therapeutic, wherein a reduction in the severity of the symptoms, or prevention of the symptoms, of cardiomyopathy indicates that the Therapeutic has activity in treating or preventing cardiomyopathy.
- a test animal can be any one of a number of animal models known in the art for cardiomyopathy. These models include, but are not limited to, those of aryl-hydrocarbon receptor-deficient mice
- a ⁇ -APP:HsLON complex is administered to a subject to treat or prevent diabetes in the subject.
- HsLON has been implicated in the development of maternally- inherited diabetes.
- a ⁇ -APP:HsLON complex or a derivative, homolog, analog or fragment thereof, nucleic acids encoding the ⁇ -APP and HsLON proteins, anti- ⁇ -APP:HsLON antibodies, and other modulators of ⁇ -APP:HsLON complex activity or formation can be tested for activity in treating or preventing diabetes in in vitro and in vivo assays.
- a Therapeutic of the invention can be assayed for activity in treating or preventing diabetes by contacting cultured cells that exhibit an indicator of diabetes in vitro with the Therapeutic, and comparing the level of said indicator in the cells contacted with the Therapeutic, with said level of said indicator in cells not so contacted, wherein a lower level in said contacted cells indicates that the Therapeutic has activity in treating or preventing diabetes or its sequelae.
- cultured models of diabetes include, but are not limited to, cultured rat endothelial cells from affected and nonaffected individuals (Bazan et al, 1997, Therapie 52: 447-451), antigen-specific lymphocytes cultured from TCR-HA transgenic mice (Sarukhan et al, 1998, EMBO J.
- a Therapeutic of the invention can be assayed for activity in treating or preventing diabetes by administering the Therapeutic to a test animal exhibiting symptoms of diabetes, and measuring the change in said symptoms of diabetes after administration of said Therapeutic, wherein a reduction in the severity of the symptoms of, or prevention of, diabetes indicates that the Therapeutic has activity in treating or preventing diabetes.
- a test animal can be any one of a number of animal models known in the art for diabetes including, but not limited to, the non-obese diabetic mouse model of diabetes (Delovitch and Singh, 1997 Immunity 7: 727-738), TCR-HA transgenic mice (Sarukhan et al, 1998, EMBO J.
- a ⁇ -APP:HsLON complex is administered to treat or prevent hearing loss.
- HsLON has been implicated in both sensorineural hearing loss and maternally-inherited deafness.
- a ⁇ -APP:HsLON complex or a derivative, homolog, analog or fragment thereof, nucleic acids encoding the ⁇ -APP and HsLON proteins, anti- ⁇ -APP: HsLON antibodies, and other modulators of ⁇ -APP:HsLON complex activity or formation can be tested for activity in treating or preventing hearing loss in in vitro and in vivo assays.
- a Therapeutic of the invention can be assayed for activity in treating or preventing hearing loss by contacting cultured cells that exhibit an indicator of decreased function in vitro with the Therapeutic, and comparing the level of said indicator in the cells contacted with the Therapeutic, with said level of said indicator in cells not so contacted, wherein a lower level in said contacted cells indicates that the Therapeutic has activity in treating or preventing hearing loss.
- cultured models for hearing loss include, but are not limited to, cultured sensory epithelia from the mammalian inner ear (Holley and Lawlor, 1997, Audiol. Neurootol.
- a Therapeutic of the invention can be assayed for activity in treating or preventing hearing loss by administering the Therapeutic to a test animal that is predisposed to develop hearing loss, and measuring the change in said hearing loss after administration of said Therapeutic, wherein a reduction in the severity of the symptoms of, or prevention of, the hearing loss indicates that the Therapeutic has activity in treating or preventing hearing loss.
- a test animal can be any one of a number of animal models known in the art for hearing loss. These models include, but are not limited to, mouse (Steel and Brown, 1994, Trends Genet. 10:428-435) and human (Hughes, 1997, Audiol. Neurootol.
- a ⁇ -APP:HsLON complex is administered to treat or prevent male infertility.
- HsLON has been implicated in the development of male infertility.
- a ⁇ -APP:HsLON complex or a derivative, homolog, analog or fragment thereof, nucleic acids encoding the ⁇ -APP and HsLON proteins, anti- ⁇ -APP: HsLON antibodies, and other modulators of ⁇ -APP:HsLON complex activity or formation can be tested for activity in treating or preventing male infertility in in vitro and in vivo assays.
- a Therapeutic of the invention can be assayed for activity in treating or preventing male infertility by contacting cultured cells that exhibit an indicator of male infertility in vitro with the Therapeutic, and comparing the level of said indicator in the cells contacted with the Therapeutic, with said level of said indicator in cells not so contacted, wherein a lower level in said contacted cells indicates that the Therapeutic has activity in treating or preventing male infertility.
- cultured models for male infertility include, but are not limited to, spermatogenic cell cultures from affected and unaffected individuals (Blanchard et al, 1991, Mol.
- a Therapeutic of the invention can be assayed for activity in treating or preventing male infertility by administering the Therapeutic to a test animal that is infertile, and measuring the change in said symptoms of the male infertility after administration of said Therapeutic, wherein a reduction in the severity of the symptoms of, or prevention of, the symptoms of male infertility indicates that the Therapeutic has activity in treating or preventing male infertility.
- a test animal can be any one of a number of animal models known in the art for male infertility including, but not limited to, mice expressing t haplotypes (Olds-Clarke, 1997, Rev. Reprod.
- a ⁇ -APP:HsLON complex is administered to treat or prevent a disease or disorder associated with mitochondrial DNA mutations.
- HsLON has been implicated in a number of diseases or disorders associated with mitochondrial DNA mutations. Further, through the link between neurodegeneration and mitochondrial dysfunction, ⁇ -APP is also implicated in diseases of mitochondria.
- a ⁇ -APP:HsLON complex nucleic acids encoding the ⁇ -APP and HsLON proteins, anti- ⁇ -APP: HsLON antibodies, and other modulators of ⁇ -APP:HsLON complex activity or formation, or derivatives, fragments, analogs or homologs thereof, can be tested for activity in treating or preventing a disease or disorder associated with mitochondrial DNA mutations in in vitro and in vivo assays.
- a Therapeutic of the invention can be assayed for activity in treating or preventing a disease or disorder associated with mitochondrial DNA mutation by contacting cultured cells that exhibit an indicator of a disease or disorder associated with mitochondrial DNA mutations in vitro with the Therapeutic, and comparing the level of said indicator in the cells contacted with the Therapeutic, with said level of said indicator in cells not so contacted, wherein a lower level in said contacted cells indicates that the Therapeutic has activity in treating or preventing diseases or disorders associated with mitochondrial DNA mutations.
- Specific examples of such cultured models for diseases or disorders associated with mitochondrial DNA mutations include, but are not limited to, cultured myotubes from muscles of unaffected individuals and individuals with mitochondrial myopathies (Collombet et al, 1996, Mol. Gen.
- a Therapeutic of the invention can be assayed for activity in treating or preventing a disease or disorder associated with mitochondrial DNA mutation by administering the Therapeutic to a test animal having symptoms associated with mitochondrial DNA mutations, and measuring the change in said symptoms after administration of said Therapeutic, wherein a reduction in the severity of the symptoms of, or prevention of, the symptoms of the disease or disorder associated with mitochondrial DNA mutations, indicates that the Therapeutic has activity in treating or preventing a disease or disorder associated with mitochondrial DNA mutations.
- a test animal can be any one of a number of animal models known in the art for diseases or disorders associated with mitochondrial
- DNA mutations include, but are not limited to, liver, heart, and brain tissues from adult and senescent rats (Gadaleta et al, 1992, Mut. Res. 275:181-193), skeletal muscle tissue from adult and aging rhesus monkeys (Lee et al, 1993, J. Gerontol. 48:B201-B205), and primate xenomitochondrial cybrids (Kenyon and Moraes, 1997, Proc. Natl. Acad. Sci. USA 94:9131-9135.
- the present invention provides methodologies relating to modulating the level or activity of a protein moiety that possesses the ability to participate in a ⁇ -APP:HsLON complex, via the administration of a binding partner of that protein (or derivative, fragment, analog or homolog thereof).
- ⁇ -APP (and derivatives, fragments, analogs and homologs thereof) may be assayed for its ability to modulate the activity or levels of HsLON by contacting a cell, or administering to an animal expressing the HsLON gene, with ⁇ -APP protein, or, alternatively, with a nucleic acid encoding ⁇ -APP or an antibody that immunospecifically-binds ⁇ -APP, or derivative, fragment, analog, or homolog thereof that contains the antibody binding domain, and measuring a change in HsLON levels or activity, wherein said change in HsLON levels or activity indicates that said ⁇ -APP possesses the ability to modulate HsLON levels or activity.
- HsLON (and derivatives, fragments, analogs and homologs thereof) may be assayed for their ability to modulate the activity or levels of ⁇ -APP in an analogous manner.
- the present invention discloses methodologies for assaying and screening derivatives, fragments, analogs and homologs of HsLON for binding to ⁇ -APP.
- the derivatives, fragments, analogs and homologs of the HsLON that interact with ⁇ -APP may be identified by means of a yeast two hybrid assay system (see e.g., Fields & Song, 1989. Nature 340: 245-246) or; preferably, a modification and improvement thereof, as described in U.S. Patent Applications Serial Nos. 08/663,824 (filed June 14, 1996) and 08/874,825 (filed June 13, 1997), to Nandabalan, et al, and that are inco ⁇ orated by reference herein in their entireties.
- the identification of interacting proteins by the improved yeast two hybrid system is based upon the detection of the expression of a reporter gene (hereinafter "Reporter Gene"), the transcription of which is dependent upon the reconstitution of a transcriptional regulator by the interaction of two proteins, each fused to one half of the transcriptional regulator.
- Reporter Gene a reporter gene
- the bait ⁇ -APP (or derivative, fragment, analog or homolog) and prey protein (proteins to be tested for ability to interact with the bait protein) are expressed as fusion proteins to a DNA-binding domain, and to a transcriptional regulatory domain, respectively, or vice versa.
- the prey population may be one or more nucleic acids encoding mutants of HsLON (e.g., as generated by site-directed mutagenesis or another method of producing mutations in a nucleotide sequence).
- the prey populations are proteins encoded by DNA (e.g., cDNA, genomic DNA or synthetically generated DNA), said DNAs derived either from a specific gene of choice, or from cDNA libraries obtain from a cell type of interest.
- the populations may be expressed from chimeric genes comprising cDNA sequences derived from a non-characterized sample of a population of cDNA from mammalian RNA.
- recombinant biological libraries expressing random peptides may be used as the source of prey nucleic acids.
- the present invention discloses methods for the screening for inhibitors of HsLON.
- the protein-protein interaction assay may be performed as previously described herein, with the exception that it is performed in the presence of one or more candidate molecules.
- a resulting alteration in level of Reporter Gene activity in relation to that level which was present when the one or more candidate molecules are absent, indicates that the candidate molecule exerts an effect on the interacting pair.
- inhibition of the protein interaction is necessary for the yeast cells to survive, for example, where a non-attenuated protein interaction causes the activation of the URA3 gene, causing yeast to die in medium containing the chemical 5-fluoroorotic acid. See e.g., Rothstein, 1983. Meth. Enzymol. 101 : 167-180.
- the proteins comprising the bait and prey populations are provided as fusion (chimeric) proteins, preferably by recombinant expression of a chimeric coding sequence containing each protein contiguous to a pre-selected sequence.
- the pre-selected sequence is a DNA-binding domain that may be any DNA-binding domain, so long as it specifically recognizes a DNA sequence within a promoter (e.g., a transcriptional activator or inhibitor).
- the pre-selected sequence is an activator or inhibitor domain of a transcriptional activator or inhibitor, respectively.
- the assay system further includes a reporter gene operably linked to a promoter that contains a binding site for the DNA-binding domain of the transcriptional activator (or inhibitor). Accordingly, in the practice of the present invention, the binding of ⁇ -APP fusion protein to a prey fusion protein leads to reconstitution of a transcriptional activator (or inhibitor), which concomitantly alters expression of the Reporter Gene.
- the present invention discloses a methodology for detecting one or more protein-protein interactions comprising the following steps: ( ) recombinantly-expressing ⁇ -APP (or a derivative, fragment, analog or homolog thereof) in a first population of yeast cells of a first mating type and possessing a first fusion protein containing ⁇ -APP sequence and a DNA-binding domain; wherein said first population of yeast cells contains a first nucleotide sequence operably-linked to a promoter that is "driven” by one or more DNA-binding sites recognized by said DNA-binding domain such that an interaction of said first fusion protein with a second fusion protein (comprising a transcriptional activation domain) results in increased transcription of said first nucleotide sequence; (ii) negatively selecting to eliminate those yeast cells in said first population in which said increased transcription of said first nucleotide sequence occurs in the absence of said second fusion protein; ( / ' /) recombinantly expressing in a second population of yeast
- the bait (a ⁇ -APP sequence) and the prey (a library of chimeric genes) are combined by mating the two yeast strains on solid media for a period of approximately 6-8 hours. In a less preferred embodiment, the mating is performed in liquid media. The resulting diploids contain both types of chimeric genes (i.e., the DNA-binding domain fusion and the activation domain fusion). After an interactive population is obtained, the DNA sequences encoding the pairs of interactive proteins are isolated by a method wherein either the DNA-binding domain hybrids or the activation domain hybrids are amplified, in separate reactions.
- the amplification is carried out by polymerase chain reaction (PCR; see e.g., Innis, et al, 1990. PCR PROTOCOLS, Academic Press, Inc., San Diego, CA) utilizing pairs of oligonucleotide primers specific for either the DNA-binding domain hybrids or the activation domain hybrids.
- the PCR amplification reaction may also be performed on pooled cells expressing interacting protein pairs, preferably pooled arrays of interactants.
- Other amplification methods known within the art may also be used including, but not limited to, ligase chain reaction; Q ⁇ -replicase or the like. See e.g., Kricka, et al, 1995. MOLECULAR PROBING, BLOTTING, AND SEQUENCING, Academic Press, New York, NY.
- the plasm ids encoding the DNA-binding domain hybrid and the activation domain hybrid proteins may also be isolated and cloned by any of the methods well-known within the art.
- a shuttle vector for e.g., yeast to E. coli
- the genes may be subsequently recovered by transforming the yeast DNA into E. coli and recovering the plasmids from the bacteria. See e.g., Hoffman, et al, 1987 Gene 57: 267-272.
- the invention provides methods of treatment and prophylaxis by the administration to a subject of a pharmaceutically-effective amount of a Therapeutic of the invention.
- the Therapeutic is substantially purified and the subject is a mammal, and most preferably, human.
- Formulations and methods of administration that can be employed when the Therapeutic comprises a nucleic acid are described supra.
- Various delivery systems are known and can be used to administer a Therapeutic of the present invention including, but not limited to: ( ) encapsulation in liposomes, microparticles, microcapsules; (ii) recombinant cells capable of expressing the Therapeutic; (iii) receptor-mediated endocytosis (see, e.g., Wu & Wu, 1987. J. Biol. Chem. 262: 4429-4432); (iv) construction of a Therapeutic nucleic acid as part of a retroviral or other vector, and the like.
- Methods of administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
- the Therapeutics of the present invention may be administered by any convenient route, for example by infusion or bolus injection, by abso ⁇ tion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically-active agents. Administration can be systemic or local.
- Intraventricular injection may be facilitated by an intraventricular catheter attached to a reservoir (e.g., an Ommaya reservoir).
- Pulmonary administration may also be employed by use of an inhaler or nebulizer, and formulation with an aerosolizing agent. It may also be desirable to administer the Therapeutic locally to the area in need of treatment. This may be achieved by, for example, and not by way of limitation, by local infusion during surgery, by topical application, by injection, by means of a catheter, by means of a suppository, or by means of an implant.
- administration may be by direct injection at the site (or former site) of a malignant tumor or neoplastic or pre-neoplastic tissue.
- the Therapeutic may be delivered in a vesicle, in particular a liposome. See e.g., Langer, 1990. Science 249: 1527-1533.
- the Therapeutic can be delivered in a controlled release system including, but not limited to, a delivery pump (see e.g., Saudek, et al, 1989. New Engl J. Med. 321 : 574) and a semi-permeable polymeric material (see e.g., Howard, et al, 1989. J. Neurosurg. 71 : 105).
- the controlled release system can be placed in proximity of the therapeutic target (e.g., the brain), thus requiring only a fraction of the systemic dose. See, e.g., Goodson, In: MEDICAL APPLICATIONS OF CONTROLLED RELEASE, CRC Press, Bocca Raton, FL ( 1984).
- the Therapeutic nucleic acid may be administered in vivo to promote expression of its encoded protein by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular (e.g., via a retroviral vector, direct injection, use of microparticle bombardment, coating with lipids or cell-surface receptors or transfecting agents, or administering it in linkage to a homeobox-like peptide that is known to enter the nucleus (see e.g., Joliot, et al, 1991. Proc. Natl. Acad. Sci. USA 88: 1864-1868), and the like.
- a nucleic acid Therapeutic can be introduced intracellularly and inco ⁇ orated into host cell DNA for expression, e.g., by homologous recombination.
- compositions comprise a therapeutically-effective amount of Therapeutic, and a pharmaceutically acceptable carrier.
- pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government, or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals and, more particularly, in humans.
- carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered and includes, but is not limited, to such sterile liquids as water and oils.
- the amount of the Therapeutic of the invention that will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and may be determined by standard clinical techniques by those of average skill within the art. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration and the overall seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and of each patient's circumstances. However, suitable dosage ranges for intravenous administration of a Therapeutics herein are generally about 20-500 micrograms ( ⁇ g) of active compound per kilogram (kg) body weight.
- Suitable dosage ranges for intranasal administration are generally about 0.01 picograms (pg)/kg body weight to 1 milligram (mgVkg body weight. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
- Suppositories generally contain active ingredient in the range of 0.5% to 10%> by weight; oral formulations preferably contain 10% to 95% active ingredient.
- the present invention also provides a pharmaceutical pack or kit, comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions and Therapeutics of the present invention.
- a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions and Therapeutics of the present invention.
- Optionally associated with such container(s) may be a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceutical or biological products, which notice reflects approval by the agency of manufacture, use, or sale for human administration.
- a modified, improved yeast two hybrid system was used to identify protein interactions for the neuronal protein product ⁇ -APP.
- Yeast is an eukaryote, and therefore any intermolecular protein interactions detected in this system are likely to occur under physiological conditions found in mammalian cells (Chien et al, 1991, Proc. Natl. Acad. Sci. USA 88:9578-9581).
- Expression vectors were constructed to encode two hybrid proteins.
- One hybrid consists of the DNA binding domain of the yeast transcriptional activator Gal4 fused to a predetermined "bait" polypeptide.
- the other hybrid consisted of the Gal4 activator domain fused to "prey" polypeptide sequences encoded by a mammalian cDNA library.
- the bait was fused to the activator domain, and the prey was fused to the DNA binding domain, but the assay was otherwise identically performed.
- ⁇ -APP, HsLON, and other proteins were inserted into complementary (a and alpha) mating types of yeast using methods known in the art. Mating was carried out to express both vector constructs within the same yeast cells, thus allowing interaction to occur. Interaction between the domains led to transcriptional activation of reporter genes containing c/s-binding elements for Gal4.
- the reporter genes encoding the indicator protein ⁇ -galactosidase, and metabolic markers for uracil and histidine auxotrophy, were included in specific fashion in one or the other of the yeast strains used in the mating. In this way, yeast were selected for successful mating, expression of both fusion constructs, and expression of ⁇ -APP-interacting proteins and the interaction of both fusion proteins.
- the HsLON cDNA were obtained from a commercial fetal brain cDNA library of 3.5 x 10 6 independent isolates (Clontech #HL4029AH, Palo Alto, CA).
- the library was synthesized from Xho l-dT I5 primed fetal brain mRNA (from five male/female 19-22 week fetuses) that was directionally cloned into pACT2, a yeast Gal4 activation domain cloning vector including the LEU2 gene for selection in yeast deficient in leucine biosynthesis.
- the bait fragment was amplified from the Clontech pACT2 library (Clontech, Palo Alto, CA) by polymerase chain reaction (PCR) using the forward primer 5'GATGCAGAATTCCGACATGACTCAG3' (SEQ ID NO:5) and the reverse primer 5 'ATGGTGGGCGGTGTTGTCATAGCG3 ' (SEQ ID NO:6) by standard techniques.
- the fragment was cloned into the Sfil site of the vector pAS-Sfil, constructed by introducing an S7?/-containing polylinker into the vector pAS2-l (Clontech, Palo Alto, CA).
- This vector is a yeast
- DNA-binding domain cloning vector that contains the TRP1 gene for selection in yeast strains deficient in tryptophan biosynthesis.
- the bait sequence was confirmed by nucleic acid sequencing to confirm that PCR amplification reproduced an accurate copy of the ⁇ -APP sequence ( Figure 1, SEQ ID NO: l). This test determined that, as predicted, the bait sequence encoded an interacting domain identical to the human ⁇ -A4 peptide of 42 amino acids.
- ⁇ -APP was transformed by lithium acetate/polyethylene glycol transformation (Ito et al, 1983, J. Bacteriol 153: 163-168) into the yeast strain N106 r (mating type a, ura3, his3, ade2, trpl, leu2, gal4, gal80, cyh r , Lys2::GALl s -HIS3 1ArA -HIS3 , ura 3::GAL1 UAS -GAL TATA -lacZ), while the coding sequences of HsLON were transformed into the yeast strain YULH (mating type alpha, ura3, his3, lys2, trpl, leu2, gal4, gal80, GAL1-URA3).
- the two transformed populations were then mated using standard methods in the art. Sherman et al, eds., 1991, GETTING STARTED WITH YEAST, Vol. 194, Academic Press, New York. Briefly, cells were grown until mid-to-late log phase on media that selected for the presence of the appropriate plasmids. The two mating strains, alpha and a, were then, diluted in YAPD media, filtered onto nitrocellulose membranes, and incubated at 30° C for 6-8 hours.
- the cells were then transferred to media selective for the desired diploids, i.e., yeast harboring reporter genes for ⁇ -galactosidase, uracil auxotrophy, and histidine auxotrophy, and expression of the vectors encoding the bait and prey.
- the mating products were plated on SC (synthetic complete) (Sambrook et al, 1989, A LABORATORY MANUAL, 2 nd Ed., Cold Spring Harbor Press, New York) media lacking adenine and lysine (to select for successful mating), leucine and tryptophan (to select for expression of genes encoded by both plasmids), and uracil and histidine (to select for protein interactions).
- SC synthetic complete
- This medium is herein referred to as SCS medium, for SC Selective medium.
- ⁇ -APP:HsLON interaction two general tests were first performed.
- YULH cells expressing HsLON were created and plated on SC-Ura plates, grown for 1-2 days, and examined for growth. No growth was found for HsLON, confirming that it is not a "self-activating" protein, that is, HsLON requires interaction with a second protein domain for a functional activation complex.
- plasmids containing ⁇ -APP inserts were transformed into strain N106 r (mating type alpha) and mated with yeast strain YULH (mating type a) expressing either CDK2, HsLON, or certain other proteins.
- Promiscuous binders that is, insert products able to bind with many other proteins in a non-specific fashion, would interact non-specifically with non-CDK2 domains, and would be discarded as non-specific interactants.
- the intersection of the ⁇ -APP column with the HsLON row indicates growth (Box A) (i.e., a positive interaction).
- the intersection of the ⁇ -APP column with the rows for PI - P5, and the intersection of the HsLON row with columns for Bl - B6, indicates no growth, i.e., no protein interaction.
Abstract
L'invention concerne une interaction de β-APP et de HsLON et la formation d'un complexe β-APP:HsLON ou de dérivés, de fragments, d'analogues et d'homologues correspondants, que l'on a identifié en utilisant un système d'essai modifié et amélioré à la levure avec double hybride. L'invention concerne en outre des procédés relatifs au dosage des types de complexe susmentionnés qui permettent de traiter et/ou de prévenir efficacement un certain nombre de maladies et de troubles, en particulier les affections neurodégénératives, la cardiomyopathie, le diabète, la surdité, la stérilité masculine, les troubles associés à la mutation d'ADN mitochondrial et autres.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US11334898A | 1998-07-10 | 1998-07-10 | |
US113348 | 1998-07-10 | ||
PCT/US1999/015592 WO2000002911A2 (fr) | 1998-07-10 | 1999-07-08 | INTERACTION DE PRECURSEUR DE LA PROTEINE BETA-AMYLOIDE HUMAINE (β-APP) ET DE PROTEINE HUMAINE DU TYPE LON-PROTEASE (HsLON) |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1095154A2 true EP1095154A2 (fr) | 2001-05-02 |
Family
ID=22348923
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP99932376A Withdrawn EP1095154A2 (fr) | 1998-07-10 | 1999-07-08 | Interaction de precurseur de la proteine beta-amyloide humaine (beta-app) et de proteine humaine du type lon-protease (hslon) |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1095154A2 (fr) |
JP (1) | JP2002521004A (fr) |
AU (1) | AU4869399A (fr) |
CA (1) | CA2332625A1 (fr) |
WO (1) | WO2000002911A2 (fr) |
Families Citing this family (18)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6379620B1 (en) | 1998-11-16 | 2002-04-30 | Barry M. Tydings | Assaying device and method for in field urinalysis |
WO2001073057A1 (fr) * | 2000-03-24 | 2001-10-04 | Millennium Pharmaceuticals, Inc. | Nouvelle molecule du type atpase appelee 19053 et ses utilisations |
CN1315402A (zh) * | 2000-03-28 | 2001-10-03 | 上海博德基因开发有限公司 | 一种新的多肽——人淀粉类前体蛋白结合蛋白14和编码这种多肽的多核苷酸 |
CN1315439A (zh) * | 2000-03-29 | 2001-10-03 | 上海博德基因开发有限公司 | 一种新的多肽——人淀粉类前体蛋白结合蛋白9和编码这种多肽的多核苷酸 |
CN1323833A (zh) * | 2000-05-16 | 2001-11-28 | 上海博德基因开发有限公司 | 一种新的多肽——人淀粉类前体蛋白结合蛋白51和编码这种多肽的多核苷酸 |
ATE554169T1 (de) | 2001-11-02 | 2012-05-15 | Giuliani Int Ltd | Smad7-inhibitoren zur behandlung von krankheiten des zns |
US6805838B2 (en) | 2002-03-04 | 2004-10-19 | Barry M. Tydings | Assaying device and method for in field urinalysis |
NZ536054A (en) * | 2002-04-09 | 2009-10-30 | Scripps Research Inst | Motif-grafted hybrid polypeptides and uses thereof |
US7771952B2 (en) | 2002-06-26 | 2010-08-10 | Abott Laboratories | Modulators and modulation of the interaction between RGM and Neogenin |
ES2353690T3 (es) | 2002-10-03 | 2011-03-04 | Neuropharmacology Services, Llc | Oxitocina para su uso en el tratamiento del autismo y del trastorno de asperger. |
EP2053409A1 (fr) | 2003-11-20 | 2009-04-29 | F. Hoffmann-La Roche Ag | Marqueurs spécifiques du syndrome métabolique |
US8906864B2 (en) | 2005-09-30 | 2014-12-09 | AbbVie Deutschland GmbH & Co. KG | Binding domains of proteins of the repulsive guidance molecule (RGM) protein family and functional fragments thereof, and their use |
US8962803B2 (en) | 2008-02-29 | 2015-02-24 | AbbVie Deutschland GmbH & Co. KG | Antibodies against the RGM A protein and uses thereof |
SG181563A1 (en) | 2009-12-08 | 2012-07-30 | Abbott Gmbh & Co Kg | Monoclonal antibodies against the rgm a protein for use in the treatment of retinal nerve fiber layer degeneration |
WO2011083147A1 (fr) | 2010-01-08 | 2011-07-14 | Cemm-Forschungsinstitut Für Molekulare Medizin Gmbh | Inhibition de wave1 dans l'intervention médicale de maladies inflammatoires et/ou d'infections causées par un pathogène |
US20130116304A1 (en) | 2010-04-19 | 2013-05-09 | Ernst R. Werner | Tmem195 encodes for tetrahydrobiopterin-dependent alkylglycerol monooxygenase activity |
MY176695A (en) | 2012-01-27 | 2020-08-19 | Abbvie Inc | Composition and method for the diagnosis and treatment of diseases associated with neurite degeneration |
US20220133808A1 (en) * | 2019-02-01 | 2022-05-05 | Avrobio, Inc. | Compositions and methods for treating neurocognitive disorders |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE3702789A1 (de) * | 1987-01-30 | 1988-08-18 | Bayer Ag | Vorlaeuferprotein des apc-polypeptids, dafuer codierende dna und diagnostische verwendung der dna und des proteins |
-
1999
- 1999-07-08 EP EP99932376A patent/EP1095154A2/fr not_active Withdrawn
- 1999-07-08 WO PCT/US1999/015592 patent/WO2000002911A2/fr not_active Application Discontinuation
- 1999-07-08 AU AU48693/99A patent/AU4869399A/en not_active Abandoned
- 1999-07-08 JP JP2000559140A patent/JP2002521004A/ja not_active Withdrawn
- 1999-07-08 CA CA002332625A patent/CA2332625A1/fr not_active Abandoned
Non-Patent Citations (1)
Title |
---|
See references of WO0002911A2 * |
Also Published As
Publication number | Publication date |
---|---|
AU4869399A (en) | 2000-02-01 |
JP2002521004A (ja) | 2002-07-16 |
WO2000002911A3 (fr) | 2001-01-18 |
WO2000002911A2 (fr) | 2000-01-20 |
CA2332625A1 (fr) | 2000-01-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6627405B1 (en) | 53BP2 complexes | |
EP1095154A2 (fr) | Interaction de precurseur de la proteine beta-amyloide humaine (beta-app) et de proteine humaine du type lon-protease (hslon) | |
US20030064477A1 (en) | Novel E6 targeted protein (E6TP1) | |
JP2002510490A (ja) | Lystタンパク質複合体およびlyst相互作用タンパク質 | |
US6476193B1 (en) | NLK1 protein and NLK1 protein complexes | |
US6521412B1 (en) | HsReq*1 and hsReq*2proteins and use thereof to detect CDK2 | |
AU770000B2 (en) | Hermansky pudlak syndrome protein-interacting proteins and methods of use thereof | |
JP4249927B2 (ja) | コラーゲン様新規蛋白clacおよびその前駆体、ならびにそれらをコードする遺伝子 | |
WO2001068846A2 (fr) | Proteine transactivatrice transcriptionnelle | |
AU4690499A (en) | Interaction of p27(kip1) with fkbp-12 | |
KR100811926B1 (ko) | 파킨 유전자 활성의 조절에 유용한 조성물 | |
CA2319782A1 (fr) | Complexes proteiques de retinoblastome et proteines interagissant avec le retinoblastome | |
JP4709383B2 (ja) | Ucp4 | |
JPWO2002064770A1 (ja) | 新規スカベンジャー受容体クラスa蛋白質 | |
US7342102B2 (en) | Uncoupling protein 5 (UCP5) | |
US6967245B2 (en) | Ucp5 | |
JP2002533062A5 (fr) | ||
AU3291799A (en) | Retinoblastoma protein complexes and retinoblastoma interacting proteins |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20010110 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
17Q | First examination report despatched |
Effective date: 20030903 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20040316 |