EP1085898A1 - Parasite antigens - Google Patents

Abstract

Isolated nucleic acid molecules encoding Neospora caninum antigens, polypeptides forming N. caninum antigens, and uses of the nucleic acid molecules and the polypeptides for protecting and diagnosing neosporosis in animals.

Description

Parasite Antigens

Technical Field

The present invention is directed to parasite antigens, particularly Neospora antigens and uses thereof. Background Art

Neospora caninum was first described in 1988 during a retrospective study of dogs previously diagnosed with fatal toxoplasmosis (Dubey et al. 1988). Since then, N. caninum has been shown to be one of the main causes of abortion in livestock around the world including, for example, the United States of America, Europe, New Zealand and Australia.

The genus Neospora was established in the family Sarcocystidae of the phylum Apicomplexa because of the close similarity in morphology between N. caninum and other cyst-forming coccidia such as Toxoplasma gondii. The complete life cycle of N. caninum is not known but probably involves dogs as the definitive host (McAllister et al. 1998) and congenital transmission has been recorded in dogs. cats, sheep, cattle, goats and horses.

The major clinical signs of neosporosis in congenitally infected pups is hindlimb paralysis which may rapidly progress to tetraplegia and death. Other symptoms include difficulty in swallowing, jaw paralysis, muscle flaccidity and atrophy. The disease does not usually become apparent until 3-6 weeks of age when limping or reduced limb movement may become apparent. Neosporosis occasionally manifests itself in older dogs, but congenital infection is more common. Transmission of infection to multiple, successive litters is possible. Histologically, necrotising nonsuppurative myositis of skeletal muscles and meningoencephalitis are the most consistent findings associated with canine neosporosis. Myositis is characterised by muscle atrophy, hypertrophy, necrosis and mononuclear cell infiltration. Mineralisation of muscle and acute myocarditis have also been reported. Parasites are most numerous in the central nervous system (CNS) and may be associated with lesions.

Vaccines for the control of neosporosis are not available, although infections in dogs (if caught early enough) may be treated with clindamycin. Therapy is not considered practical for cattle herds, and a vaccine is believed to represent one potential form of control. No information is currently available regarding the spread of the parasite, except through vertical transmission from mother to foetus. Therefore a vaccine that eliminates or reduces congenital infection and foetal abortion in cattle and other livestock is considered essential.

There is a need for a vaccine to raise a protective immune response in animals that are susceptible to neosporosis and/or toxoplasmosis. The present inventors have now isolated and determined DNA sequences of complementary (c)DNA coding for antigens oi Neospora caninum which are suitable candidates for a Neospora vaccine. Disclosure of Invention

The present inventors have isolated, by immunoscreening a cDNA expression library from N. caninum, gene sequences coding for antigens of the tachyzoite life cycle stage of N. caninum. One of the gene sequences isolated predicted a significant level of protein sequence homology of the gene product to the GRA2 antigen of T. gondii. Immunisation of mice with plasmid DNA encoding GRA2 under the control of a cytomegalovirus promoter demonstrated both vector and recombinant plasmid conferred partial protection against weight loss in a central nervous system (CNS) model of neosporosis in mice. GRA2, and plasmid constructs made from it, therefore have the potential to be a component of a DNA vaccine against neosporosis. In a first aspect, the present invention consists in an isolated nucleic acid molecule encoding a Neospora caninum antigen, the molecule including a cDNA nucleotide sequence substantially as shown in Figure 1 (SEQ ID NO: 2) or Figure 2 (SEQ ID NO: 3), functionally equivalent nucleotide sequences thereof, portions thereof encoding a JV. caninum antigen, sequences which hybridises to the cDNA nucleotide sequences of Figure 1 (SEQ ID NO: 2) or

Figure 2 (SEQ ID NO: 3), or sequences which show at least 60% homology with the nucleotide sequences of Figure 1 (SEQ ID NO: 2) or Figure 2 (SEQ ID NO: 3).

More preferably, the nucleic acid molecule has at least 80% homology with the cDNA nucleotide sequences of Figure 1 (SEQ ID NO: 2) or Figure 2 (SEQ ID NO: 3). and most preferably the nucleic acid molecule has at least 90% homology with either of the sequences.

Preferably, the isolated nucleic acid molecule has a nucleotide sequence substantially as shown in Figure 1 (SEQ ID NO: 2) or Figure 2 (SEQ ID NO: 3). The present invention also includes polynucleotides which hybridise to the sequences shown in Figure 1 (SEQ ID NO: 2) and Figure 2 (SEQ ID NO: 3). Preferably, the polynucleotide hybridises to the sequence set out in Figure 1 (SEQ ID NO: 2) or Figure 2 (SEQ ID NO: 3) under high stringency. As used herein, stringent conditions are those that (a) employ low ionic strength and high temperature for washing, for example. 0.015M NaCl/0.0015 M sodium citrate/0.1% NaDodS0₄ at 50°C; (b) employ during hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50mM sodium phosphate buffer at pH 6.5 with 750mM NaCl, 75mM sodium citrate at 42°C; or (c) employ 50% formamide, 5 x SSC (0.75M NaCl, 0.075M sodium citrate), 50mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42°C in 0.2 x SSC and 0.1% SDS. In a further preferred embodiment of the first aspect of the present invention, the polynucleotide capable of hybridising to the cDNA nucleotide sequences of Figure 1 (SEQ ID NO: 2) or Figure 2 (SEQ ID NO: 3) is less than 10,000 nucleotides, however, it can be less than 1000 or even less than 500 nucleotides in length. Preferably, the hybridising polynucleotides are at least 10, more preferably at least 18 nucleotides in length.

In a second aspect, the present invention consists in an isolated polypeptide forming a Neospora caninum antigen encoded by the isolated polynucleotides according to the first aspect of the present invention.

Preferably, the polypeptide is selected from the group consisting of SEQ ID NO: 4. SEQ ID NO: 5, SEQ ID NO: 6, antigenic portions thereof, and functionally equivalent polypeptides thereof.

The cDNA sequence of Figure 2 (SEQ ID NO: 3) has several open reading frames which encode antigens of N. caninum. Two of the encoded antigens are termed 24B1 (SEQ ID NO: 5) and 24B2 (SEQ ID NO: 6) by the present inventors.

In one preferred embodiment of the second aspect of the present invention, the isolated polypeptides are produced in a prokaryotic expression system, preferably using Escheήchia coli, such that the polypeptides have amino acid sequences substantially as shown in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or functionally equivalent amino acid sequences. In another preferred embodiment of the second aspect of the present invention, the isolated polypeptides are produced in a eukaryotic expression system from the polynucleotides shown SEQ ID NO: 2 or SEQ ID NO: 3. As eukaryotic cells express genes differently from prokaryotes, the polypeptides produced by such a system may be expected to differ from the polypeptides shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 due to post- translational modifications that may occur.

The polypeptides produced by the bacterial expression of the nucleotide sequences according to the first aspect of the present invention react with antibodies present in animals, such as cows and mice, that have been infected by Neospora. Accordingly, it will be appreciated that the polypeptides will have the same or similar antigenic epitopes as present on the native polypeptides of N. caninum. Thus, the polypeptides according to the second aspect of the present invention, whether produced by bacterial or mammalian expression systems, are good candidates for antigens to raise protective immunity to N. caninum in animals.

In a third aspect, the present invention consists in a suitable vector for the replication and/or expression of a polynucleotide according to the first aspect of the present invention. The vectors may be, for example, plasmid, virus or phage vectors provided with an origin of replication, and preferably a promoter for the expression of the polynucleotide and optionally a regulator of the promoter. The vector may contain one or more selectable markers, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian expression vector. The vector may be used in vitro, for example for the production of RNA or used to transfect or transform a host cell.

Preferably, the vector is a plasmid, preferably being VR1012 or pTrcHisB. It will be appreciated, however, that any other suitable plasmid could be used. In a fourth aspect, the present invention consists in a composition for use in raising an immune response in an animal against neosporosis, the composition comprising a carrier and a polypeptide according to the second aspect of the present invention.

Preferably, the polypeptide has an amino acid sequence substantially as shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, mixtures thereof, or immunogenic fragments thereof. It will be appreciated by those skilled in the art that a number of modifications may be made to the polypeptides and fragments of the present invention without deleteriously affecting the biological activity of the polypeptides or fragments. This may be achieved by various changes, such as sulfation, phosphorylation, nitration and halogenation: or by amino acid insertions, deletions and substitutions, either conservative or non- conservative (eg. D-amino acids, desamino acids) in the peptide sequence where such changes do not substantially alter the overall biological activity of the peptide. Preferred substitutions are those which are conservative, i.e., wherein a residue is replaced by another of the same general type. As is well understood, naturally-occurring amino acids can be subclassified as acidic, basic, neutral and polar, or neutral and nonpolar. Furthermore, three of the encoded amino acids are aromatic. It is generally preferred that encoded peptides differing from the determined polypeptide contain substituted codons for amino acids which are from the same group as that of the amino acid replaced. Thus, in general, the basic amino acids Lys, Arg. and His are interchangeable: the acidic amino acids Asp and Glu are interchangeable; the neutral polar amino acids Ser, Thr, Cys. Gin, and Asn are interchangeable; the nonpolar aliphatic amino acids Gly, Ala, Val. He, and Leu are conservative with respect to each other (but because of size, Gly and Ala are more closely related and Val, He and Leu are more closely related), and the aromatic amino acids Phe, Trp and Tyr are interchangeable.

It should further be noted that if the polypeptides are made synthetically, substitutions by amino acids which are not naturally encoded by DNA may also be made. For example, alternative residues include the omega amino acids of the formula NH₂(CH₂)_nCOOH wherein n is 2-6. These are neutral, nonpolar amino acids, as are sarcosine, t-butyl alanine, t-butyl glycine, N- methyl isoleucine, and norleucine. Phenylglycine may substitute for Trp, Tyr or Phe; citrulline and methionine sulf oxide are neutral nonpolar, cysteic acid is acidic, and ornithine is basic. Proline may be substituted with hydroxyproline and retain the conformation conferring properties.

In a preferred embodiment of the fourth aspect of the invention, the composition further includes a suitable adjuvant. Preferred adjuvants may be composed of aluminium salts, water-in-oil emulsions, oil-in-water emulsions, saponin, QuilA and derivatives, iscoms, liposomes, cytokines such as gamma interferon or interleukin 12. DNA such as plasmid DNA, and methods for the microencapsulation of the antigen in a solid or semi-solid particle. Adjuvants may include Freunds complete and incomplete adjuvant or active ingredients thereof such as muramyl dipeptide and analogues, DEAE dextran/mineral oil, Alhydrogel, Auspharm adjutant and Algammulin. In a fifth aspect, the present invention consists in a composition for use in raising an immune response in an animal against neosporosis, the composition comprising a carrier and a vector according to the third aspect of the present invention.

The carrier may be any suitable diluent, excipient and the like used in preparations for vaccines.

In a sixth aspect, the present invention consists in a method of obtaining a protective effect against neosporosis in an animal, the method comprising administering to the animal a polypeptide according to the second aspect of the present invention or a vector according to the third aspect of the present invention.

The administering of the composition may be by any suitable means including by injection via intramuscular, subcutaneous, intradermal or intraperitoneal routes or included as an additive in feed or water.

In a seventh aspect, the present invention consists in use of one or more of the polypeptides according to the second aspect of the present invention in methods for detecting antibodies reactive or specific to Neospora. One particularly suitable use is a recombinant ELISA assay where detection of antibodies in a serum or blood sample from an animal that bind to one or more of the polypeptides would be indicative of the exposure to and/or infection of that animal with Neospora. Screening of animal herds for the presence of an immune response to Neospora can be carried out using the polypeptides according to the present invention in suitable immunological assays known to the art. Such tests would also be useftil to determine whether immunisation with a vaccine according to the third aspect of the present invention of an animal was successful at raising antibodies to the Neospora.

Preferably, the polypeptide is NcGra2 (SEQ ID NO: 4) or 24B1 (SEQ ID NO:5).

Furthermore, antibodies raised against the polypeptides according to the present invention are suitable for use in assays to identify or diagnose the presence of Neospora. The antibodies can be raised in animals, for example laboratory animals, and purified for use by standard techniques. Similarly, monoclonal antibodies can also be produced in the usual manner from rodents immunised with a polypeptide so as to produce antibodies specific to Neospora. Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. In order that the present invention may be more clearly understood, preferred forms will be described with reference to the following examples and drawings. Brief Description of Drawings

Figure 1. A) Gene organisation of NCGRA2. Exons 1 and 2 are in bold and separated by a single intron. N represents an unidentified base. The start codon is at the beginning of exon 1; the stop codon at the end of exon 2. B) Open reading frame of NCGRA2. C) Predicted amino acid sequence inferred from the open reading frame of GRA2.

Figure 2. A) DNA sequence of clone 24B from lamda ZAP (including the EcoRl adaptor at the 5' end used to make the cDNA). B) Predicted amino acid sequence of polypeptide used to vaccinate mice. The amino acids encoded by the 24B1 sequence are in bold and underlined. The remainder of the amino acids are encoded by pTrcHisB. C) Predicted amino acid sequence of polypeptide 24B2 sequence. Fig ire 3. Comparison of the amino acid sequence of Gra2 between N. caninum (NC) and T. gondii (TG). The unique C-terminal domain of NcGra2 is not shown.

Figure 4. DNA vaccination of balb/c mice with either VR'1012 (vector), pRevGRA2 or pGf_A2 via the ear pinna. Graph shows change in mean body weight (MBW in g) with time (days post infection with N. caninum tachyzoites; dpi). The control was injected with endotoxin-free TE. The dashed line represents the change in weight of an unimniunised, uninfected group of mice. Numbers embedded in the graph represent the number of mice surviving at that time point. Figure 5. DNA vaccination of balb/c mice with either VR1012 (vector), pRevGflA2 or pGflA2 via the footpad. Graph shows change in mean body weight (MBW in g) with time (days post infection with N. caninum tachyzoites; dpi). The control was injected with endotoxin-free TE. The dashed line represents the change in weight of an unimmunised, uninfected group of mice. Numbers embedded in the graph represent the number of mice surviving at that time point.

Figure 6. DNA vaccination of balb/c mice with either VR1012 (vector), pRevGfiA2 or τpGRA2 via the leg. Graph shows change in mean body weight (MBW in g) with time (days post infection with V. caninum tachyzoites; dpi). The control was injected with endotoxin-free TE. The dashed line represents the change in weight of an unimmunised, uninfected group of mice.

Numbers embedded in the graph represent the number of mice surviving at that time point.

Figure 7. ELISA performed using recombinant (his-tagged) NcGra2 with sera from experimentally infected mice. The experimental groups were: Cnp; control group of non-pregnant mice; 1) non- pregnant mice infected with IO⁶ tachyzoites of N. caninum (NC-Liverpool); Cp, control group of uninfected, pregnant mice; 2) pregnant mice infected with IO⁷ tachyzoites of N. caninum (NC-Liverpool); 3) pregnant mice infected with IO⁶ tachyzoites of N. caninum (NC-SweBl). Figure 8. Vaccination with 24B1 polypeptide in mice. Changes in mean body weight (MBW) of mice with days post infection (dpi) following challenge with N. caninum tachyzoites. Numbers embedded in the graph represent the number of mice surviving at that time point. Modes for Carrying Out the Invention DEFINITIONS

General molecular biology

Unless otherwise indicated, the recombinant DNA techniques utilised in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Gviide to Molecular

Cloning, John Wiley and Sons (1984), J. Sambrook et al., MolecLilar Cloning: A Laboratory Manual, Cold Spring HarboLir Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and

F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) and are incorporated herein by reference. Gene/DNA isolation

The DNA encoding a protein may be obtained from any cDNA library prepared from tissue or organisms believed to express the gene mRNA and to express it at a detectable level. The gene sequences can also be obtained from a genomic library or genomic DNA.

Libraries are screened with probes or analytical tools designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal or polyclonal antibodies that recognise and specifically bind the protein; oligonucleotides of about 20-80 bases in length that encode known or suspected portions of cDNA from the same or different species: and/or complementary or homologous cDNAs or fragments thereof that encode the same or a hybridising gene. Appropriate probes for screening genomic DNA libraries include, but are not limited to. oligonucleotides: cDNAs or fragments thereof that encode the same or hybridising DNA including expressed sequence tags and the like; and/or homologous genomic DNAs or fragments thereof. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures as described in chapters 10-12 of

Sambrook et al.

An alternative means to isolate a gene encoding is to use polymerase chain reaction (PCR) methodology as described in section 14 of Sambrook et al. This method requires the use of oligonucleotide probes that will hybridise to the gene.

The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimised. The actual nucleotide sequence(s) is usually based on conserved or highly homologous nucleotide sequences or regions of the gene. The oligonucleotides may be degenerate at one or more positions. The use of degenerate oligonucleotides may be of particular importance where a library is screened from a species in which preferential codon usage in that species is known. The oligonucleotide must be labelled such that it can be detected upon hybridisation to DNA in the library being screened. The preferred method of labelling is to use ³²P-labelled ATP with polynucleotide kinase. as is well known in the art, to radiolabel the oligonucleotide. However, other methods may be used to label the oligonucleotide. including, but not limited to, biotinylation or enzyme labelling.

Nucleic acid having all the protein coding sequence is obtained by screening selected cDNA or genomic libraries, and if necessary, using conventional primer extension procedures as described in section 7.79 of

Sambrook et al., to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.

Another alternative method for obtaining the gene of interest is to chemically synthesise it using one of the methods described in Fingels et al. (Agnew Chem. Int. Ed. Engl. 28: 716-734, 1989). These methods include triester. phosphite, phosphoramidite and H-Phosphonate methods, PCR and other autoprimer methods, and oligonucleotide syntheses on solid supports.

These methods may be used if the entire nucleic acid sequence of the gene is known, or the sequence of the nucleic acid complementary to the coding strand is available, or alternatively, if the target amino acid sequence is known, one may infer potential nucleic acid sequences using known and preferred coding residues for each amino acid residue.

Mutants, variants and homology - nucleic acids

Mutant polynucleotides will possess one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say. isolated from a natural source) or synthetic (for example, by performing site-directed mutagensis on the DNA).

It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant (that is to say prepared using recombinant DNA techniques).

An allelic variant will be a variant that is naturally occurring within an individual organism.

A polynucleotide at least 70% identical, as determined by methods well known to those skilled in the art (for example, the method described by Smith. T.F. and Waterman, M.S. (1981) Ad. Appl. Math., 2: 482-489, or

Needleman. S.B. and Wunsch, CD. (1970) J. Mol. Biol.. 48: 443-453), to those polynucleotides of the present invention are included in the invention, as are proteins at least 80% or 90% and more preferably at least 95% identical to the polynucleotide of the present invention. This will generally be over a region of at least 60, preferably at least 90, contiguous nucleotide residues. Mutants, variants and homology - proteins

Mutant polypeptides will possess one or more mutations which are deletions, insertions, or substitutions of amino acid residues. Mutants can be either naturally occurring (that is to say, purified or isolated from a natural source) or synthetic (for example, by performing site-directed mutagensis on the encoding DNA). It is thus apparent that polypeptides of the invention can be either naturally occurring or recombinant (that is to say prepared using recombinant DNA techniques).

An allelic variant will be a variant that is naturally occurring within an individual organism.

A protein at least 50% identical, as determined by methods well known to those skilled in the art (for example, the method described by Smith. T.F. and Waterman. M.S. (1981) Ad. Appl. Math., 2: 482-489. or Needleman, S.B. and Wunsch, CD. (1970) J. Mol. Biol., 48: 443-453). to those polypeptides of the present invention are included in the invention, as are proteins at least

70% or 80% and more preferably at least 90% identical to the protein of the present invention. This will generally be over a region of at least 5, preferably at least 20, contiguous amino acids. Protein variants Amino acid sequence variants can be prepared by introducing appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such variants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the desired characteristics. The amino acid changes also may alter post- translational processes such as changing the number or position of glycosylation sites, altering the membrane anchoring characteristics, altering the intra-cellular location by inserting, deleting or otherwise affecting the transmembrane sequence of the native protein, or modifying its susceptibility to proteolytic cleavage.

In designing amino acid sequence variants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, eg., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting residues of other ligands adjacent to the located site.

A useful method for identification of residues or regions for mutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells {Science (1989) 244: 1081-1085J. Here, a residue or group of target residues are identified (eg., charged residues such as Arg, Asp, His, Lys, and Glu) and replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine) to affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell. Those domains demonstrating functional sensitivity to the substitutions then are refined by introducing further or other variants. Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to optimise the performance of a mutation at a given site, alanine scanning or random mutagenesis may be conducted at the target codon or region and the expressed variants are screened for the optimal combination of desired activity.

There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. These may represent naturally occurring alleles or predetermined mutant forms made by mutating the DNA either to arrive at an allele or a variant not found in nature. In general, the location and nature of the mutation chosen will depend upon the characteristic to be modified.

Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.

Amino acid sequence insertions include amino and/or carboxyl- terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Other insertional variants include the fusion of the N- or C-terminus of the proteins to an immunogenic polypeptide eg. bacterial polypeptides such as betalactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, bovine serum albumin, and chemotactic polypeptides. C-terminal fusions with proteins having a long half-life such as immunoglobulin constant regions (or other immunoglobulin regions), albumin, or ferritin, are included. Another group of variants are amino acid substitution variants. These variants have at least one amino acid residue in the protein molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active site(s). Other sites of interest are those in which particular residues obtained from various species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 under the heading of "preferred substitutions". If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 1, or as further described below in reference to amino acid classes, are introduced and the products screened.

Table 1. Preferred amino acid substitutions

Substantial modifications in function or immunological identity are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydro-phobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side chain properties:

(1) hydrophobic: norleucine, met, ala, val, leu, ile;

(2) neutral hydrophilic: cys, ser, thr; (3) acidic: asp, glu;

(4) basic: asn, gin, his, lys, arg;

(5) residues that influence chain orientation: gly, pro; and

(6) aromatic: trp. tyr, phe

Non-conservative substitutions will entail exchanging a member of one of these classes for another.

Substantially purified

By "substantially purified" the present inventors mean a polypeptide or polynucleotide that has been separated from lipids, nucleic acids, other polypeptides or polynucleotides, and other contaminating molecules. Active fragment

By "active fragment" the present inventors mean a fragment of a cDNA sequences shown in Figure 1 or Figure 2 which encodes antigens according to the present invention.

MATERIALS AND METHODS Parasite culture

N. caninum isolates NC-Liverpool (Barber et al. 1995) and NC-SweBl

(Stenlund et al. 1997) were propagated _.-vi.ro in Vero host cells according to established procedures (Barber et al. 1995).

Immunoscreening of expression libraries The approach used involved screening of a recombinant cDNA expression library with sera obtained from an infected cow. Sera were obtained from cows in a herd where Neosporα-associated abortion was common. The sera obtained from each cow was screened by western blotting using N. caninum tachyzoite antigen in order to identify diagnostic antigens. Serum from cow X (identified in this way) was prepared for immunoscreening by preabsorption against Escherichia coli and non recombinant lambda ZAP bacteriophage by pseudoscreening in order to remove non-specific cross reactive antibodies from it prior to use (Sambrook et al. 1988).

Total RNA was extracted from cell-cultured tachyzoites of NC- Liverpool. Briefly, tachyzoites were lysed and vortexed in a strong denaturing buffer containing 5.7M guanidium thiocyanate, lOOmM sodium acetate pH 5.2, lOmM EDTA and lOOmM 2-mercaptoethanol. Insoluble debris was removed by centrifugation (10,000g, 4°C, 10 min) and the supernatant was precipitated overnight, recentrifuged. resuspended and subject to a phenol/choroform step in lysis buffer containing 4.5M guanidium thiocyanate. The aqueous phase was precipitated overnight, centrifuged and the pellet was washed twice and stored as a precipitate in 70% ethanol at - 20°C Messenger RNA was purified from total RNA using oligo-dT cellulose chromatography. RNA pellets were centrifuged (20 min. 10,000g, 4°C), pooled and resuspended in 5 ml of TS buffer (lOmM Tris. 0.1% SDS) for 15 min at 65°C The solution was then cooled rapidly on ice and sodium chloride added to a final concentration of 400mM. The solution was then passed through a sterile syringe containing oligo-dT cellulose (Clontech), eluate was collected in baked cuvettes and the A26O of consecutive fractions was read on a spectrophotometer. After the major peak of poly-A" was eluted off, the bound poly-A⁺ (mRNA) was collected by flushing the column with TS buffer. Fractions containing the poly-A⁺ A26O peaks were then precipitated and stored at -70°C Reagents and equipment for cDNA library construction were supplied by Stratagene. The mRNA was centrifuged (20 min, 10,000g, 4°C) and resuspended in DEPC-treated water for 15 min at

65 °C The solution was cooled rapidly on ice and single stranded cDNA was synthesised in first strand buffer containing a poly-dT primer with an internal Xhol restriction site. Second strand synthesis, blunt ending, addition of EcoRl adaptors and Xhol digestion were performed following instructions provided by the manufacturer. Double stranded cDNA was then size-fractionated on a Sephacryl S-500 column (Clontech) to remove short molecules. Prepared cDNA was ligated into EcoRl/Xhol digested arms of the UNI-ZAP XR bacteriophage vector and packaged into viable phage using Gigapack Gold III packagene extracts. The titre of the cDNA library was determined by plating serially diluted aliquots onto E. coli. The primary library contained l.lxlO⁶ recombinant clones. The cDNA library was screened with preabsorbed bovine anti- Neospora antisera from cow X using standard procedures. Briefly, filters containing plaques were incubated in Tris-buffered saline supplemented with 5% skim milk powder either overnight at 4°C, or for 1 hour at room temperature (RT) in order to prevent non-specific antibody binding. Filters were then incubated for 45 min at RT with either a negative bovine control serum (sourced from a Neospora-fτee herd of dairy cattle) or from cow X, diluted 1/50 or 1/100. Filters were then washed in Tris-buffered saline- Tween and further incubated for 45 min at RT in a 1/500 dilution of anti- bovine IgG conjugated to alkaline phosphatase (Sigma). Washing was repeated and membranes were placed in the developing solution of nitroblue tetrozoleum and 5-bromo-4-chloro-3-indolyl-phosphate (Sigma) for 20 min at RT. Recombinant clones expressing N. caninum antigens were picked and rescreened until a pure population of phages was produced. Characterisation of cloned sequences

The cloned DNAs coding for V. caninum specific antigens were characterised as follows. A recombinant phage plaque was picked into double distilled water and subject to PCR amplification using primers FpB (5^*GTAAAACGACGGCCAGT3') and RpB2 (5'GCCGCTCTAGAACTA3'). A 50μl PCR reaction was used with 2.5mM MgC_2, 200μM dNTP, 25pmol primer with cycling conditions, 1 cycle, 95°C, 3 min; 25 cycles, 95°C, 1 min, 52°C, 1 min, 72°C, 2.5 min and 1 cycle, 72°C, 5 min. Five μl of the PCR product was run on a 1% agarose gel to estimate size and amount of product obtained. The PCR product was then purified using a Qiagen column and sequenced by cycle sequencing and the aid of an ABI automated sequencer.

The non-redundant nucleotide sequence database maintained by the National Cente for Bioinformatics (NCBI) and the Apicomplexa nucleotide sequence database at the Parasite Genome Blast Server (PGBS; http://www.ebi.ac.uk/parasite/parasite_blast_server.html) were searched with the sequences obtained using the program BlastN in order to detect homologies with nucleotide sequences currently in the nucleotide sequence databases. The recombinants were then grouped according to their database matches. Further searches were also made of the Toxoplasma Database of Clustered ESTS (ToxoDB; http://www.cibil.upenn.edu/agi- bin/ParaDBs/Toxoplasma/index.html). In order to obtain the complete sequence of the N. caninum cDNAs isolated, a PCR product derived for each cloned insert was cloned into the plasmid vector pGEM-T and the inserts were sequenced by cycle sequencing and a LiCOR sequencer. The sequences obtained were compiled using AssemblyAlign. Northern blotting

Total RNA was extracted from iV. caninum tachyzoites using a Qiagen RNeasy Mini kit following the manufacturers instructions. The quality of the RNA was checked by agarose gel electrophoresis. For northern blotting. 5μg of total RNA was mixed with formaldehyde, formamide, 10X MOPS buffer and DEPC-treated water. This mixture was heated to 65°C for 10 min and gel loading buffer added (50% glycerol, lmM EDTA. 0.25% Bromophenol Blue. 0.25% Xylene Cyanol). Samples were then loaded onto a 1% agarose gel containing 5% formaldehyde and IX MOPS buffer. RNA markers (0.28 - 6.58Kb range) from Promega were used. The gel was run overnight at 30V with buffer recirculating. After electrophoresis, RNA markers were cut off, stained with ethidium bromide and photographed. The remaining gel was northern blotted as detailed in Sambrook e_ al. (1989). Membranes carrying RNA were prehybridised for an hour at 65°C in hybridisation solution (6X SSC, 5X Denhardts. 0.5% SDS, 20μg/ml salmon sperm DNA). One hundred and fifty ng of DNA (for probe) was labelled using the Amersham Multiprime kit and added to the membrane which was hybridised overnight at 65°C The membrane was then washed three times at room temperature (2X SSC) for 10 min each. Two further washes were done for 30 min in 0.1X SSC. 0.1% SDS. Membranes were then rinsed in 0.2X SSC wrapped in Gladwrap and exposed to Fuji film for required time. Expressed sequence tag analysis

Individual, random, recombinant phage plaqLies were picked from the cDNA library, placed in lOOμl sterile water and boiled for 3 min before being put on ice. Five μl of this material was used as a template for a PCR reaction using primers FpB and RpB2 as described above. PCR products were then purified using the Qiaquick (Qiagen) PCR purification kit and cycle sequenced with the RpB2 primer and the aid of an ABI automated sequencer. All DNA sequences were manually inspected and edited to remove vector sequences and sequences of poor quality normally close to the primer binding sites. The poly A tail, if present, was also removed and the iV. caninum data set was then compiled using CreateDB into a local database (MyDB:Ncaninum) on the Australian Genome Information Service (ANGIS). BlastN was used to search MyDB:Ncaninum for sequences homologous to those under study. Matches were considered significant if scores were returned with a probability >10⁶.

Isolation of GftA2-like sequences from genomic DNA of _V. caninum

PCR was performed using total cellular DNA from NC-Liverpool and NC-SweBl using primers 12F2 (5'CGAGCACCCACAAGTAA3') and 12R2 (5'GACCATAACGGATGCAAC3'). PCR and DNA sequencing was also performed with primers P28F (5'CAGCGGTTATTCCGGATA3') and P28R

(5'GCCTCAAGAATTTCCTCAGC3'). PCR products were then purified using the Qiaquick (Qiagen) PCR purification kit and sequenced by cycle sequencing and the aid of an ABI automated sequencer.

GRA2 intron sequences were amplified by PCR using primers CRIF (5'GGTAGGTTACCACAACTTGC3') and CRIR

(5'GCAATTGCATTGAGCATC3') that were designed from within the intron sequence of GRA2. The PCR cycling conditions used were: 95°C, 3 min, 1 cycle; 95°C, 45 sec: 50°C, 45 sec; 72°C, 1 min, 28 cycles; 72°C, 5 min, 1 cycle. Five μl of PCR product was run on a 1% agarose gel to check for amplification and size.

Expression of Gra2 in E. coli

The open reading frame (ORF) of GRA2 was PCR amplified from clone 12 with primers pTrcHisIDAl2F2 (5ΑCGGATGGATCCGTTCACGGGGAAACGTTGG3') and pTrcHisIDAl2R2 (5ΑCGTCAGAATTCTAACGCCATACACACCGT3¹). These primers place unique BamHI and EcoRl restriction sites on the five and three prime sides of the GRA2 ORF respectively. The PCR product was checked on a 1% agarose gel for size and purified using a Qiaquick PCR purification kit. DNA from the purified PCR product and pTrcHisB vector (Invitrogen) were then digested with both BamHI and EcoRI restriction enzymes for three hours at 37°C The digested DNA were purified using a Qiaquick column and checked on a 1% agarose gel. The ORF of GRA2 was then ligated into the pTrcHisB vector and transformed into E. coli DH5α. Individual recombinants were screened for inserts by PCR using primers pTrcHisFwd (5'GAGGTATATATTAATGTATCG3') and pTrcHisIDAl2R2. The sequence of the constructs made were confirmed by cycle sequencing. This strategy ensures the initiation codon of GRA2 is cloned in-frame into the pTrcHisB vector, which following transcription and translation should produce a polypeptide of 26 kDa. Subsequently, E. coli containing recombinant DNA were grown in LB medium containing ampicillin and at mid-log phase were induced with ImM IPTG. After several hours, the bacteria were collected by centrifugation and solubilised in guanidinium lysis buffer. His-tagged protein was purified using Ni-NTA (Qiagen) resin following the manufacturer's instructions for preparation of denamred E. coli cell lysate. Proteins were analysed on 14% SDS-PAGE gels by either staining with Coomassie blue or by western blotting after transfer to PVDF membrane

(Atkinson et al. 1999). Antigen expression was detected using pooled, mouse sera from animals made resistant to a lethal challenge of NC-Liverpool. This serum was produced in female in-bred balb/C mice using two infections of NC-SweBl tachyzoites as described by Atkinson et al. (1999). Secondary structure predictions for Gra2

Signal peptides were predicted using the SIGCLEAVE program of von Heijne (1986). The protein sequence of NcGra2 was also submitted to the PSA server and a secondary structure prediction made using a Type-1 analysis and the DSM model of Stultz et al. (1993) which presumes the protein is a monomeric, single-domain, globular, water-soluble protein. The following algorithms were subsequently used to investigate the location of potential helical structures in NcGra2: SSPRED (Mehta et al.. 1995), nnSSP (Salamov and Solovyev, 1995). PHDsec (Rost and Sander. 1993: Rost. 1996), GOR 1 (Gamier et al. 1978), 2 (Gibrat et al. 1987) and 4 (Gamier et al. 1996). SIMPA96 (Levin. 1997), LEV (Levin et al. 1986). DPM (Deleage and Roux,

1987), predator (Frishman and Argos, 1996), SOPM (Geourjon and Deleage. 1994), SOPMA (Geourjon and Deleage, 1995) and HNN (Guermeur, 1997). Solvent accessibility was performed using PHDacc (Rost and Sander. 1994). DNA vaccination in mice Constructs were made using GRA2 cDNA and PCR in the following way. In order to clone GRA2 in the correct orientation (pGRA2), primers VR1012F (5^*CGTACGTCTAGAGCCACCATGTTCACGGGGAAACGTTGG3') and VR1012R2 (5ΑCGTCAGGATCCGCACGCACACAAAGCCCA3') were used to PCR amplify the open reading frame of GRA2. In this approach, an Xbal site is placed upstream of a consensus Kozak sequence and the ATG start site. At the 3' end a BamHI site is placed immediately downstream of the stop codon. The resulting PCR product was purified using a Qiaquick (Qiagen) purification kit; cleaved with BamHI and Xbal (Promega) in multicore buffer for 3 hours. The restriction product was purified with the Qiaquick kit and ligated into BamHl/Xbal doubly digested VR1012 (Vical). The ligation was transformed into E. coli DH5α and kanamycin resistant colonies selected. Transformants were screened by PCR with primers VRl012Fwd (5'GCTGACAGACTAACAGACTG3') and VRl012Rev (5ΑACTAGAAGGCACAGCAG3') in order to identify colonies containing sequences of the correct size. A similar procedure was used to construct a plasmid with GHA2 cloned in the reverse orientation (pRevG_M2). Primers Revp28F (5'CGTACGTCTAGAGCCACCATGGTCGGCGCCGCAGTCGTA3') and Revp28R (5ΑCGTCAGGATCCTTCACGGGGAAACGTTGG3') were used to generate a PCR product that was then cleaved with BamHI and Xbal. The product was cloned as above. The inserts of both pGRA2 and pRevGflA2 were sequenced to confirm the orientation of the inserts and the reading frame.

One hundred μg of VR1012 or recombinant VR1012 (in endotoxin-free TE, lOmM Tris pH 8.0, ImM EDTA) carrying the N. caninum GHA2 gene in either forward (pGi 2) or reverse [p- RevGRA2) orientations were injected, using a 30 gauge needle, into 6 week old, female in-bred Balb/C mice via either the pinna of the ear or intramuscularly into the footpad or leg (5 mice/group). All plasmids were maintained in E. coli DH5α and purified from 2.5 litre cultures (Luria-broth with kanamycin) using the EndoFree Plasmid Giga Kit (Qiagen). Changes in mean mouse body weight between days 14 - 27 post infection (dpi) withN. caninum tachyzoites were analysed by a one-factor-repeated measures analysis of variance, with treatment as the factor and time as the repeated measure. All the sampling times were included in the analysis, although mice which died or were euthanased before the fifth sampling time were excluded. Infection of Pregnant Mice

Ovulation of 9 week old, female outbred Quackenbush (Qs) mice was synchronised using a single injection of folligon (Intervet) followed by a single injection of chorulon (Intervet) 48 hours later. Female mice were then mixed individually with a male stud for 24 hours and mating was detected by the presence of a vaginal mucoid plug. At day 8 of pregnancy, mice were injected subcutaneously with culture-derived tachyzoites of . caninum. Pregnancies were allowed to proceed to day 21 when all mice were autopsied and serum taken.

The experimental groups were: Cnp; a control group (10 mice) which were not pregnant;

1) non- pregnant mice (10) which were infected with IO⁶ tachyzoites of N. caninum (NC-Liverpool);

Cp, a control group (5) of un-infected pregnant mice;

2) pregnant mice (8) infected with 10⁷ tachyzoites of N. caninum (NC- Liverpool);

3) pregnant mice (8) infected with IO⁶ tachyzoites of N. caninum (NC- SweBl).

Enzyme-linked imunosorbant assay (ELISA) using NcGra2

Histidine-tagged, recombinant NcGra2 (purified on Ni-NTA resin as described previously) was coated onto a 96-well microtitre plate at a concentration of 1 μg/well, diluted in ELISA buffer 1 (70mM NaHCθ3, 29mM Na2Cθ3, 3. ImM NaNβ, pH 9.6). Following overnight incubation at 4°C, the plate was washed 3 times in wash buffer (0.15M NaCl, 0.3% Tween 20). Pooled, experimental serum samples from mice were diluted 1:100 using phosphate buffered saline (PBS) and 100 μl of each sample was added to the plate in duplicate. The plate was incubated for 2 hours at 37°C and then washed as before. One hundred μl of biotinylated antibody to mouse IgGl or IgG2a (The Binding Site, UK) was added to each well at a dilution of 1:6000 in ELISA buffer 2 (0.5 g bovine haemoglobin, 0.3% Tween 20, 3. ImM NaNβ, pH 7.2 in PBS). Following a 2 hour incubation at 37°C, the plate was washed and each well coated with 100 μl of Extravidin alkaline phosphatase (Sigma, USA) at a dilution of 1:5000 in ELISA buffer 2. After incubation for 1 hour at 37°C the plate was again washed and 100 μl of Alkaline Phosphatase Substrate 104 (Sigma, USA) was added at a concentration of 1 mg/ml in ELISA buffer 3 (58mM NaHCθ3, 42mM a2Cθ3, 2mM MgCl2.6H2θ, pH 9.8). The plate was incubated at 37°C for 30 min, allowing sufficient colour development. The absorbance reading of each well at 405 nm was determined using an electronic plate reader (Biorad). Identification of clones 24B and 24B1

Clone 24B was isolated from a tachyzoite cDNA library by immunoscreening with serum from cow X naturally infected with Neospora as described previously. TblastX searches of the ToxoDB database showed the sequence of 24B clustered with the Ctoxquall2_130 cluster which contains 8 uncharacterised ESTs of T. gondii. from both the tachyzoite and bradyzoite life cycle stages. Thus it was concluded that 24B represented a previously uncharacterised gene that encodes an antigen of N. caninum. The most probable ORF (24B2) encoding a gene product runs from positions 912 to 1389 base pairs inclusive of the sequence shown in SEQ ID NO: 2 and encodes the amino acid sequence shown in SEQ ID NO: 6. The gene product of this ORF is proline rich and database searches reveals, because of this, vague protein similarity to RNA polymerase II from several taxa plus extensins and modulins of plants, which are also proline-rich. During these studies, however, the present inventors also characterised a number of other ORFs present in this cDNA sequence. A product of these is 24B1 (SEQ ID NO: 5) relates specifically to an ORF at the 5' end of the cDNA sequence of Figure 2. Subcloning of clone 24B1 into pTrcHisB The insert of lambda ZAP clone 24B was PCR amplified using primers

FpB and RpB2 and the product was purified using a Qiaquick (Qiagen) PCR purification kit. The product was then digested with the restriction enzyme BamHI. Clone 24B1 has a BamHI site about 670 bp into the insert which is 3' to a stop codon of an open reading frame at the 5' end of this cDNA The restriction digest product was purified with a Qiaquick column. The 24B1 insert was then ligated into BamHI digested and purified pTrcHisB vector, transformed into E. coli DH5α and transformants selected. Recombinants were screened, in order to check orientation of insert, by PCR with primers pTrcHisFwd (5*GAGGTATATATTAATGTATCG3') and 24BR (5'TATTATGCTACCGTAAGTTGA3'). With these primers, clones containing insert in the reverse orientation will give no PCR product. The PCR product was sequenced in order to check that the 24B1 insert had been cloned correctly and the insert was in frame with the ATG start in the pTrcHisB (Figure 2B). Purification of 24B1 protein

A bacterial clone containing 24B1 subcloned into pTrcHisB was cultured in Luria broth to mid-log phase of growth and expression induced with ImM IPTG. A protein of approximately 14 kDa (as detected by SDS- PAGE gels) was produced. The bacteria were concentrated by centrifugation and solubilised in 7M guanidinium hydrochloride, 100 mM Na2HPθ4, 10 mM Tris pH 8.0 and purification of the fusion protein with Ni-NTA agarose (Qiagen) was attempted but unsuccessful. The guanidium extract was then dialysed against 0.9% NaCl. A precipitate formed during the dialysis which was removed by centrifugation at 10,0000g. The 24B1 protein was the only detectable protein found in the soluble fraction. Immunisation of mice with 24B1

Groups of 10 female, in-bred, Balb/C mice (approximately 6 weeks of age) were injected twice (4 weeks apart) with either: 1) normal saline (0.9% NaCl); 2) 100 μl Freunds complete adjuvant; 3) 100 μl

Freunds complete adjuvant containing 10 μg 24B1 protein. Incomplete Freunds adjuvant was used in the second immunisation. Four weeks later, all mice were challenged subcutaneously with in vitro derived tachyzoites of N. caninum. Changes in mean body weight per group were monitored post infection.

Changes in weight loss were analysed by a one-factor repeated- measures analysis of variance, with Treatment as the factor and Time as the repeated measure. RESULTS Isolation of NCGJΪΛ2

Twenty-five independent bacteriophage clones were isolated that expressed antigen which is recognised by antibody from a cow that was chronically infected with Neospora. All were sequenced using ABI sequencing technology. Several of these were found to bear DNA sequence homology to the Nc4.1 (eight) and Nc2.1 (two) recombinant clones described by Lally et al. (1996) and were not studied further. The sequence of another recombinant (clone 12) was found to predict significant protein sequence homology of the gene product to the amino acid sequence of the 28 kDa antigen (Gra2) of T. gondii (Prince et al. 1989; hereafter called TgGra2) and so was studied further. The sequence of clone 12 (hereafter called NCGAA2) clustered using the Tblast X algorithm, in the ToxoDB database with the cluster Ctoxqual2_1721 and Ctoxqual2_289 which contains sequences coding for Gra2. Thus the present inventors concluded that this clone represented a N. caninum gene which has not been described previously. Expression and gene organisation of GBΛ2 in tachyzoites RNA was extracted from tachyzoites of NC-Liverpool and subjected to northern blotting using clone 12 as probe. A single transcript of approximately 1300 bp was detected. DNA sequence from 522 ESTs was generated and 12 of the data set were homologous to NCGRA2. This represented the most abundant transcript detected in the data set and corresponds to a level of expression of approximately 2.3%. The EST sequences and the sequence of clone 12 were compiled to yield a consensus sequence for the mRNA of NCGRA2.

PCR amplification of total cellular DNA using primers 12F2 and 12R2 from both NC-Liverpool and NC-SweBl yielded two PCR products (approximately 800 and 1200 bps). These were both sequenced and subsequent BlastN searches revealed the 1200 bp fragment contained the desired GHA2-like sequences. The 800 bp fragment was found to be homologous to cytochrome B of T. gondii (GenBank accession number AF023246). The 1200 bp product from NC-SweBl and NC-Liverpool was almost identical in sequence (98%).

Genomic and cDNA sequences for NCG< A2 were compared. The gene structure possessed 2 exons separated by an intron of 241 bp (Figure lA). The intron showed no sequence similarity to any sequence in GenBank including the intron of the T. gondii gene. In order to confirm this observation, PCR was performed with primers CRIF and CRIR using both N. caninum and T. gondii genomic DNA as template. A PCR product of 228 bp was produced only from . caninum DNA (NC-SweBI; NC-Liverpool and NCl strains) but not from DNA of Vero or T. gondii (RH or Beverley strains). DNA sequencing confirmed the PCR product was derived from the JV. caninum intron.

A comparison of the N. caninum and T. gondii (M993921) coding sequences revealed (excluding the three prime end) a 56% sequence similarity between them. The nucleotide differences between the two sequences were manifest as a range of indels and nucleotide substitutions. In addition, the three prime end of NCGRA2 encoded 19 additional amino acids not present in TgGra2. Expression ofNCGiϊA2 in E. coli

Western blotting detected a 45 kDa antigen in both soluble and insoluble denatured, reduced extracts of E. coli. Consequently, bacteria expressing NCGRA2 were collected by centrifugation and solubilised in guanidinium lysis buffer and His-tagged protein purified using Ni-NTA resin following the manufacturer's instructions. After purification, Coomassie blue staining of an SDS-PAGE revealed the presence of a 35 kDa protein that was also detected specifically by mouse anti-N. caninum antisera. Injection of this protein into mice, resulted in the production of IgG antibodies to an IV. caninum tachyzoite antigen of 45 kDa in NC-SweBl and 65 kDa in NC-

Liverpool. Secondary Structure Predictions

Analysis of the predicted protein sequence encoded by NCGRA2 revealed the amino acid sequence was 52% similar to TgGra2 (Figure 3). The amino terminus was particularly conserved. The SIGCLEAVE program predicted a signal peptide (WILWAVGALVGA) in this region that was almost identical to that present in T. gondii. Mercier et al. (1993) predicted that the secondary structure of Gra2 in T. gondii was a globular protein with two amphipathic helices separated by a 10 amino acid linker. Consequently, the protein sequence of NcGra2 was submitted to the PSA server and a secondary structure prediction made using a Type-'l analysis and the DSM model of Stultz et al. (1993). The analyses showed that NcGra2 most probably belongs to the protein superclass which predominantly contain alpha helices (probability 0.95574). The algorithm also predicted the presence of two major and one minor helical regions in NcGra2 and that the most plausible explanation for the structure of the remaining residues of NcGra2 was in the form of loops or turns. In NcGra2 the helical regions spanned residues 70-110, 110-150 and 170-190. This secondary structure prediction was investigated further using 14 additional algorithms. A consensus derived from this alignment provides considerable support for four, and not three, helices (Hl-4) spanning residues T70-V92, E95-D116, K120-G132 and N177-G194. The amphipathic nature of HI, H2 and H4 is clearly evident by the distribution of hydrophobic and hydrophilic residues on alternative sides of the helical wheel. Since the predictions for the location of HI and H2 were similar to but not identical to that for TgGra2, the predictions of Mercier et al. (1993) were re-evaluated in light of knowledge gained from NcGra2. Hi in TgGra2 was assigned to residues P70-V94, H2 to S97-K115 plus an additional helix (H3) was predicted at R121-G133. Thus these results differ from those of Mercier et al. (1993) by the location of the start of Hi at P plus the existence of H3 not previously identified nor suggested. Proline has long been known to be a

"helix breaker" (Chou & Fasman, 1973) and so is generally restricted to the first turn of the N-terminal helix. Its location as the first residue in an amphipathic helix, or in a turn leading into the helix, is suggested by the fact that proline has no free NH group and therefore cannot form the conventional intra-helical NH...O=C hydrogen bond (Chakrabarti &

Chakrabarti, 1998). The subtle differences suggested here in the helical structures from those reported by Mercier et al. (1993) results from the use of a more extensive number of refined algorithms which exist and are in use today. DNA Vaccination

Since the route of administration of DNA vaccines may effect the outcome of vaccination, groups of mice were given pGfiA2 via either the pinna of the ear, or intramuscularly via the footpad or leg and subsequently challenged with N. caninum tachyzoites. The results are shown in Figures 5 to 7. Mice which were not immunised nor challenged with N. caninum showed little change in body weight between 14-27 dpi ( + 0.1g). In addition, control mice which were sham treated, along with mice which were not immunised but were challenged with N. caninum showed a very large drop in mean body weight (-3.4 to -4.6g) along with clinical signs of neosporosis (predominantly a ruffled appearance with a limited level of limb paralysis).

In the group immunised via the pinna, mice receiving pRevGRA2 rapidly lost weight between 14-27 dpi. Three mice were euthanased because of the advanced signs of neosporosis. In contrast, the groups receiving either

VR1012 or γGRA2, all mice lost weight between 14-20 dpi when 3 of the mice became unwell and were euthanased. However, the other 7 mice remained well, although ruffled, and maintained their body weight in both groups. Analyses of variance (Table 2) confirmed these treatments were significantly different from the other two groups. Table 2. Analyses of variance for mouse weights

Source Probabilities for Treatment Groups

Ear Footpad Leg

Treatment 0.046 0.217 0.222

Time <0.001 <0.001 <0.001

Treatment* Time <0.001 <0.001 <0.001

In the experiment involving footpad immunisation, all three groups of mice receiving plasmid DNA (VR1012, pGRA2 and pRevGRA2) all showed some weight loss between 14-27 dpi but this was significantly less than the control group. Although all mice became ruffled, mortality was limited to 1 animal in the DNA vaccinated groups compared to 3/5 in the control group. Statistical analysis of the changes in mean body weight described confirms that mice immunised via the footpad with plasmid or recombinant DNA were significantly different from the control group, although the mean weight loss in all groups at the end of the experiment was significantly less than mice which were not immunised nor challenged.

An experiment was also performed where the plasmid DNAs were delivered intramuscularly via the hindleg. Only the group receiving VR1012 retained their body weight over the course of the experiment and this was statistically significant. Although there were no mortalities in this experiment, all mice in the remaining three groups were ruffled and showed rapid weight loss over the course of the experiment. No doubt if this experiment had been allowed to continue these mice would have died.

In summary, immunisation of mice via the footpad with VR1012 or pGRA2 demonstrated evidence for partial protection against mortality due to neosporosis in this model. Protection against weight loss due to N. caninum infection was also demonstrated in both pinna and footpad delivery experiments, although it was more pronounced when the plasmid DNA was delivered via the footpad.

Use of NcGra2, expressed and purified from E. coli, to detect antibodies against IV. caninum in an ELISA assay

Injection of IO⁶ tachyzoites of N. caninum (NC-Liverpool) into the non-pregnant Qs mouse induced no weight loss and no signs of clinical symptoms of neosporosis. An ELISA performed using NcGra2 purified from E. coli demonstrated that infection induced a strong IgGl and IgG2a antibody response to this protein in these animals (compare the results of groups Cnp and 1 in Figure 7). Experiments with pregnant Qs mice showed that an antibody response of similar magnitude was also induced by IO⁷ (group 2) tachyzoites of N. caninum (NC-Liverpool). Animals in this group infected with NC-Liverpool delivered live pups (total live pups born=58; mean litter size = 8) with only 5 stillborn. In contrast, infection of mice with NC-SweBl produced only 18 viable pups. Histopathology demonstrated extensive foetal resorption in this group. ELISA with NcGra2 demonstrated mice infected with NC-SweBl possessed a larger IgGl/IgG2a antibody ratio to this protein than those mice infected with NC-Liverpool (group 3).

In summary, this study has shown that an ELISA assay, using NcGra2, expressed and purified fromE. coli, can be used to detect antibodies produced during infection of an animal by IV. caninum. Furthermore, detection of specific antibody sub-types induced during pregnancy against

NcGra2 (in this example, IgGl or IgG2a, or more specifically the ratio of IgGl/IgG2a) may provide a method of predicting the outcome of infection during pregnancy (e.g. whether foetal resorption has/will occur and whether young may be born live). 24B1 protein vaccination

The DNA sequence of clone 24B is shown in Figure 2A. Subcloning of this insert into the pTrcHisB vector resulted in the expression of a 14 kDa antigen from clone 24B1 which was purified and injected into mice. The predicted amino acid sequence of the 24B1 protein produced is shown in Figure 2B. The antigen induced a potent IgG response in mice which was detectable by western blotting.

The control group of mice, after challenge with N. caninum tachyzoites, rapidly lost weight due to clinical neosporosis (Figure 8). This group were euthanased at day 23 dpi because of severe clinical signs (severely ruffled, some paralysis, weight loss). Mice vaccinated with either adjuvant or adjuvant plus 24B1 protein lost weight 10-15 dpi, but thereafter maintained body weight until 46 dpi. Three of the 20 mice in these two groups were euthanased because of the signs of clinical neosporosis. The remaining 17 mice, although showing signs of infection (a ruffled coat), remained otherwise healthy. The mice immunised with 24B1 showed a marginal improvement in weight gain compared to the group immunised with adjuvant alone.

The significant two-factor interaction (P<0.001 for Treatment*Time) indicates that the Treatments (the groups immunised with either adjuvant or adjuvant plus 24B1) differ significantly from the control in their response through time.

The main conclusion from this study, therefore, is that treatment of mice with Freunds adjuvant alone or adjuvant plus 24B1 protein was able to induce a significant level of protection against neosporosis as judged by weight loss and clinical signs of neosporosis. DISCUSSION

A gene from N. caninum, homologous to the GRA2 gene of T. gondii, has been cloned and sequenced. Both lV. caninum and T. gondii genes are composed of two exons and a single intron and are highly expressed in tachzyoites (as detected by northern blotting and EST sequencing) as a very abundant messenger RNA.

Early research on the T. gondii antigen showed it to have a submembraneous location in the tachyzoite although more recent work has now demonstrated that the TgGra2 protein is located in the dense granules of the tachyzoite. Upon infection TgGra2 is secreted into the parasite- containing vacuole where it is rapidly and specifically targeted to a network of membranous tubules which connect with the vacuolar membrane. The subcellular location and function of NcGra2 is currently not known, however, it is likely to fulfil a similar function to TgGra2. Although the protein sequence of NcGra2 is only 52% similar to TgGra2, the secondary structure predictions made, using a wide variety of algorithms, indicate a high degree of support for both proteins containing several amphipathic helices separated by loops and turns. Thus although the present results show that the protein sequence of Gra2 is not highly conserved, it would appear maintenance of secondary structure has occurred during the evolution of these molecules. Sufficient dissimilarity exists, however, between the T. gondii and N. caninum proteins for us to hypothesise that they are antigenically distinct. For example, the carboxy termini differs between NcGra2 and TgGra2. This region contains, in T. gondii, an epitope recognised by antibodies from naturally infected humans. Expression of the entire GBA2 ORF in a prokaryotic expression vector (the plasmid pTrcHisB) was achieved. A purification procedure was used to isolate the recombinant protein, of apparent molecular weight 35 kDa, from E. coli. The molecular weights reported here are somewhat anomalous, because predictions of the protein size from the open reading frame for the bacterially expressed protein (including vector encoded amino acids) suggest a size of 26, and not 35 kDa. The anomalous mobility may simply be the influence of the proteins shape because two or three helices were predicted, by many different types of computer algorithms, to exist in the secondary structure of this protein. Although post-translational modifications, such as glycosylation, have been shown to occur in T. gondii such modifications were discounted because they do not occur in E. coli. Despite the anomalous mobility, the purified recombinant protein maintained its antigenicity as determined by western blotting with sera from mice immune to neosporosis. Extensive evidence now indicates that the route of delivery of a DNA vaccine may effect the outcome of the immunisation process (reviewed by Cohen et al. 1998). Injection of DNA into the pinna or intramuscularly via the footpad or leg was investigated because of the requirement to induce a Thl response which is probably the basis of protective immunity against IV. caninum infections. DNA vaccination into the pinna, footpad and leg have all been shown to be an effective way of inducing such a response in other situations. Surprisingly, it was shown that mice immunised with DNA into either of these three different sites gave a different outcome when challenged with N. caninum. Injection of VR1012 or pGRA2 into the pinna or footpad induced a significant level of partial protection against weight loss in the

CNS model used. That the plasmid VR1012 induced partial protection on its own, irrespective of injection location, suggests that adjuvant activity supplied by the vector alone is an important constituent of the immunity demonstrated here. The nature of this activity is thought to result from the presence of immunostimulatory sequences, such as CpG motifs, in the vector leading to a preferential induction of a Thl response.

Systems for the stable introduction of recombinant DNA (transformation) into parasites such as T. gondii and N. caninum have been developed. Several strategies such as chloramphenicol selection, complementation of tryptophan auxotrophy, pyrimethamine resistance and bleomycin resistance have been used to achieve stable transformation These systems can now be exploited for the homologous and heterologous expression of genes {Howe et al. 1997). In addition, the creation of "knockout" mutants is considered the state of the art at this current time and provides a method for attenuating wild-type organisms in order to create novel live vaccines (Soldati et al. 1995). Knock-out mutants may be created by placing NCGRA2 sequences onto either side of a selectable marker, that upon transformation into N. caninum tachyzoites, will integrate into genomic NCGfiA2 and "knock-out" endogenous expression. Changes in gene expression such as this ultimately may lead to the creation of novel lines of N. caninum that are attenuated in their ability to cause disease. Such mutant lines therefore have the ability to act as both live and killed vaccines against neosporosis. It will be appreciated that the nucleic acid molecules according to the present invention would be suitable candidates for the development of knock out mutants of N. caninum. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

REFERENCES

Atkinson, R.A., Harper, P.A.W.. Ryce, C. Morrison. D.A. & Ellis, J.T. (1999) Comparison of the biological characteristics of two isolates of Neospora caninum. Parasitology 118, 363-371. Barber, J.S., Holmdahl, O.J.M., Owen, M.R., Guy, F., Uggla, A. & Trees,

A.J. (1995) Characterisation of the first European isolate of Neospora caninum. (Dubey, Carpenter, Speer, Topper and Uggla) Parasitology 111, 563- 568.

Chakrabarti, P. & Chakrabarti, S. (1998) C-H center dot center dot center dot O hydrogen bond involving proline residues in alpha-helices. J.

Mol. Biol. 284, 867-873.

Chou, P.T. & Fasman. G.D. (1973) Structural and functional role of leucine residues in proteins. J. Mol. Biol. 74. 263-281.

Cohen, A.D., Boyer, J.D. & Weiner, D.B. (1998) Modulating the immune response to genetic immunisation. FASEB J. 12, 1611-1626.

Deleage, G. & Roux, B. (1987) An algorithm for protein secondary structure prediction based on class prediction. Protein Eng 1, 289-294

Dubey, J.P., Carpenter, J.L., Speer. C.A., Topper, M.J. & Uggla A. (1988) Newly recognised fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 192. 1269-1285.

Dubey, J.P., Koestner, A. & Piper, R.C (1990) Repeat transplacental transmission of Neospora caninum in dogs. J. Am. Vet. med. Assoc. 197, 857- 860.

Dubey, J.P. & Lindsay, D.S. (1996) A review of Neospora caninum and neosporosis. Vet. Parasitol. 67, 1-52.

Frishman, D. & Argos, P. (1996) Incorporation of non-local interactions in protein secondary structureprediction from the amino acid sequence. Protein Eng. 9, 133-142

Gamier, J, Osguthorpe, DJ. & Robson, B. (1978) Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J. Mol. Biol. 120. 97-120.

Gamier, J.. Gibrat, J-F. & Robson, B. (1996) GOR secondary structure prediction method version IV. Meth. Enzymol. 266, 540-553.

Geourjon, C. & Deleage. G. (1994) SOPM: a self-optimized method for protein secondary structure prediction. Protein Eng 7, 157-164. Geourjon. C. & Deleage, G. (1995) SOPMA: significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Comput. Appl. Biosci. 11, 681-684.

Gibrat, J.F., Gamier, J. & Robson, B. (1987) Further developments of protein secondary structure prediction using information theory. New parameters and consideration of residue pairs. }. Mol. Biol. 198, 425-443.

Guermeur, Y Combinaison de classifieurs statistiques. Application a la prediction de structure secondaire des proteines PhD Thesis

Howe, D.K., Mercier, C, Messina, M. & Sibley, L.D. (1997) Expression of Toxoplasma gondii genes in the closely-related apicomplexan parasite

Neospora caninum. Mol. Biochem. Parasitol. 86, 29-36.

Lally, N.C, Jenkins, M.C & Dubey, J.P. (1996) Evaluation of two Neospora caninum recombinant antigens for use in an Enzyme-Linked Immunosorbent Assay. Clin. Diagn. Lab. Immunol. 3. 275-279. Levin, J., Robson, B. & Gamier, J. (1986) An algorithm for secondary structure determination in proteins based on sequence similarity. FEBS 205, 303-308

Levin, J. (1997) Exploring the limits of nearest neighbour secondary structure prediction. Protein Eng. 7, 771-776. Lindsay, D.S., Lenz, S.D., Cole, R.A., Dubey, J.P. & Blagburn, B.L.

(1995) Mouse model for central nervous system Neospora caninum infections. J. Parasitol. 81, 313-315.

McAllister, M.M., Dubey, J.P., Lindsay, D.S., Jolley, W.R., Wills, R.A. & McGuire, A.M. (1998) Dogs are definitive hosts of Neospora caninum. Int. J. Parasitol 28,1473-1478.

Mercier, C, Lecordier, L., Darcy, D., Deslee, A., Murray, B., Tourvielle. P., Maes, A., Capron, A. & Cesbron-Delauw, M.F. (1993) Toxoplasma gondii: molecular characterisation of a dense granule antigen (GRA2) associated with the network of the parasitophorous vacuole. Mol. Biochem. Parasitol. 58, 71- 82.

Mehta, P.K., Heringa, J. & Argos, P. (1995) A simple and fast approach to prediction of protein secondary structure from multiply aligned sequences with accuracy above 70%. Protein Sci. 4, 2517-2525.

Prince, J.B., Araujo, F.G., Remington, J.S., Burg, J.L., Boothroyd, J.C & Sharma, S.D. (1989) Cloning of cDNAs encoding a 28 kilodalton antigen of

Toxoplasma gondii. Mol. Biochem. Parasitol. 34. 3-14. Rost, B. & Sander, C. (1993) Prediction of protein structure at better than 70% accuracy. J. Mol. Biol. 232, 584-599.

Rost, B. & Sander, C. (1994) Conservation and prediction of solvent accessibility in protein families. Proteins 20, 216-226. Rost, B. (1996) PHD: predicting one-dimensional protein structure by profile based neural networks. Meth.Enzymol. 266, 525-539.

Salamov, A.A. & Solovyev, V.V. (1995) Prediction of protein secondary structure by combining nearest-neighbor algorithms and multiple sequence alignments. J. Mol. Biol. 247. 11-15. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular cloning: A laboratory manual. 2nd edition. Cold Spring Harbour Press. New York.

Soldati, D., Kim, K., Kampmeier, J., Dubremetz, J-F. & Boothroyd, J.C (1995) Complemetation of a Toxoplasma gondii ROPl knock out mutant using phleomycin selection. Mol. & Biochem. Parasitol. 74, 87-97. Stenlund, S., Bjorkman, C„ Holmdahl, O.J.M., Kindahl, H. & Uggla, A.

(1997) Characterisation of a Swedish bovine isolate of Neospora caninum. Parasitol. Res. 83, 214-219.

Stultz, CM., White, J.V. & Smith, T.F. (1993) Structural analysis based on state-space modelling. Protein Sci. 2, 305-314. von Heijne, G. (1986) A new method for predicting signal sequences cleavage sites. Nucleic Acids Res. 14, 4683-4690.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT:

(A) NAME: Insearch Limited

(B) STREET: Level 2, 187 Thomas Street

(C) CITY: Haymarket

(D) STATE: New South Wales

(E) COUNTRY: Australia

(F) POSTAL CODE (ZIP): 2000

(ii) TITLE OF INVENTION: Parasite Antigens (iii) NUMBER OF SEQUENCES: 6

(iv) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (EPO)

(2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1387 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

CGAGCACCCA CAAGTAACTG TGTTGACTAT TTACTGCTGT TTTTGCGTAG CACCACACGA 60

TGTTCACGGG GAAACGTTGG ATACTTGTTG TTGCCGTTGG CGCCCTGGTC GGCGCCTCGG 120

TAAAGGCAGC CGATTTTTCT GGCAGGGGAA CCGTCAATGG ACAGCCGGTT GGCAGCGGTT 180

ATTCCGGATA TCCCCGTGGC GATGATGTTA GGTAGGTTAC CACAACTTGC TGCGAACCCA 240

AGGGTTAAAG GGTAGAGCTG GCTAGATTTT CCAACACTGT ATCATGTACC TCCGTCTGTT 300

TCATCGGGCA GTAGTAGCAT GGGAGTGCTC GTCACAAGCC GTTGGGGGCA AGGTTTCTGT 360

TGTCTTGCCA TGCGTGTATC GCCCGCTCCT GGTTCATGCT TATATGCGAT CTAGTGCCCC 420

ACGCGCGATG CTCAATGCAA TTGCCTTTTG CAGAGAATCA ATGGCTGCAC CCGAAGATCT 480

GCCAGGCGAG AGGCAACCGG AGACACCCAC GGCGGAAGCT GTAAAACAGG CAGCGGCAAA 540 AGCTTATCGA TTACTCAAGC AGTTTACTGC GAAGGTCGGA CAGGAAACTG AGAACGCCTA 600 CTACCACGTG AAGAAAGCGA CAATGAAAGG CTTTGACGTT GCAAAAGACC AGTCGTATAA 660 GGGCTACTTG GCCGTCAGGA AAGCCACAGC TAAGGGCCTG CAGAGCGCTG GCAAGAGCCT 720 TGAGCTTAAA GAGTCGGCAC CGACAGGCAC TACGACTGCG GCGCCGACTG AAAAAGTGCC 780 CCCCAGTGGC CCGTGATCAG GTGAAGTTCA ACGTACTCGT AAGGAGCAAA ATGACGTGCA 840 GCAAACCGCA GAGATGTTGG CTGAGGAAAT TCTTGAGGCT GGGCTTAAGA AGGACGATGG 900 AGAAGGACGG GGAACGCCAG AAGCTGAAGT CAATTAAGAA AATCACTAAA CGTCAAGTTC 960 TTTATGACTG CTGTACACCA CCACCCCCCT GGACTGCTTA AGACAGCTAA CAAGCGTTGG 1020 ATTTCAATAT CCTACTTAAG GTATGTGGGG CGGATGTCGT GTCACGGTGT GTATGGCGTT 1080 AAAAAACGGC ACACGGCATT AAATGCAGTG CAAGTATGAA TTGTGCGCAG GATGACAACA 1140 TCTGTTGCAA ACAGCTCTTG GGGGCGAACG AGAATGAGAC CGTTGCATTC GCGTACGTGC 1200 ATACGATGGC CCATTTTCGG GTGCCAATAG TTGTGTGTGA CATTTTTCGG ATGTCCTGGG 1260 CTTTGTGTGC GTGCGNNGGC TGCGAAGAGA ATTAGNTTTA TTTCTTGCGA NTGCNANNNN 1320 TANTTTGTTG CATCCGTTAT GGTCATGAAA AAATTGCTAA CGACACACAT AAACGATGGA 1380 GCAAATT 1387

[ 2 ) INFORMATION FOR SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 636 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

ATGTTCACGG GGAAACGTTG GATACTTGTT GTTGCCGTTG GCGCCCTGGT CGGCGCCTCG 60

GTAAAGGCAG CCGATTTTTC TGGCAGGGGA ACCGTCAATG GACAGCCGGT TGGCAGCGGT 120

TATTCCGGAT ATCCCCGTGG CGATGATGTT AGAGAATCAA TGGCTGCACC CGAAGATCTG 180

CCAGGCGAGA GGCAACCGGA GACACCCACG GCGGAAGCTG TAAAACAGGC AGCGGCAAAA 240

GCTTATCGAT TACTCAAGCA GTTTACTGCG AAGGTCGGAC AGGAAACTGA GAACGCCTAC 300

TACCACGTGA AGAAAGCGAC AATGAAAGGC TTTGACGTTG CAAAAGACCA GTCGTATAAG 360 GGCTACTTGG CCGTCAGGAA AGCCACAGCT AAGGGCCTGC AGAGCGCTGG CAAGAGCCTT 420

GAGCTTAAAG AGTCGGCACC GACAGGCACT ACGACTGCGG CGCCGACTGA AAAAGTGCCC 480

CCCAGTGGCC CGTGATCAGG TGAAGTTCAA CGTACTCGTA AGGAGCAAAA TGACGTGCAG 540

CAAACCGCAG AGATGTTGGC TGAGGAAATT CTTGAGGCTG GGCTTAAGAA GGACGATGGA 600

GAAGGACGGG GAACGCCAGA AGCTGAAGTC AATTAA 636

INFORMATION FOR SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1712 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

AATTCGGCAC GAGTTTTTCG TCATTTCCCT TGTAAGCTGT GTCAAGCCGT TTTTAGAACC 60

AAT AAGCCT ATCTCTGCGT AGGCATTCTT CTTTTTTGCA GTAGAGGCTT CTATTTCACT 120

GAACCATTGT GCCTTCGCTA CCGGACGGGT GCGTAGTTTG AGTCGTAACC GGGGCTCAAC 180

CGTGGCAGTC CGCTGTTTTG CGGATACGCT GTCATTGTGG TCCTTTCGTT CATTTTCGTG 240

ATTTCCTTCC CTTGTAGTGA CTTCCTCGGC ACTCTGCCTT TAGTTAACGT TTAAAATTCA 300

GCTTTGTTGT CGCGACTGCA TTCCAATAGT CCAGGAAGAG ATTTGTGCAC GTGGCGGACC 360

GAGCCAGCGA CCTCGTGGAG GCTTGACGTG ACGTGCAGCA GCAAGAGGCA AGAGAAGGTG 420

CGTGCGCCGC CCACAGCCAA GGTCAACTTA CGGTAGCATA ATAGGACTCT TTTTGTGCTG 480

TTGAGCGATT CCGAAACAAC TCGAAAAGAA AGGACTTCGT GGGAGGCCGT AACTGTCGTC 540

GTCCTGGTGT GTTTTCCAAA CCACTGCTCA ACTACATTTT TACCGCTTCA CCACCATCTG 600

TTGCGCTCCG AGGTAGTGCA GAGGCACAGT CTCCCCGTGC AACTATATTT GAAGGAAACA 660

TGGATCCTAA AGTGGAGAGT CAAACAAATG TGCCATCCGT CGCAGAGGCA GAGCAGCCCA 720

AGGCAGGAGA GGCACAAGCA ACTGTGGAGA ACGGTAATAC TTCAGCTCCG GATGCTCAGG 780

TGAAAGTCCC AAGCGTCCTC CGAAGATGTG GTAGCGCAGT CGTCAGAAGA CTTCAGCGGA 840

AAGCTTCAGG CCAACTCAGG CATTGTGAGC TTCGGAGACT CTGCTGCTGG AAGTGGTGCG 900 TTCAACAGTA TGGACGTGCA GAACTTTCTC CAGCGTTACG CAACGAGCAA GATGTTTGGA 960

GTTCCGCCGC ATTTCTTCCA AAGCAGAGAA AGCCTCCGAG TCTGGGGAGC TGACCACCTC 1020

ACCGATCCCA TGGTGCAGCC TTACGAGAAA GACGATCAGA ACCTACCCAA TCCCTTTCAT 1080

GTTTCGCTAC CTGGGTACTC TCCGTCTCTC TGCAAGTACG TTCTGACCAA GGGCGAGAAG 1140

CCTCCCCGCG ATCCCCTCCT CGGACCTGAG ATTACCATTT ACCCGCCTAC GTGGATTCCG 1200

CACTGGGAAC CCGATCCCAA TTTCAAGCCA CAGGCTTACA ATTTCAACTG GGAGGAGAAC 1260

GGCACATTTC AGATGGAACG GTTGCCGTAC GCGAAAGCGG TCTTCGATCC AGCAGACGGC 1320

TCAGCACACG GCATGTACAA GCAAGCCTAC CCTTACACAG CGTATCCATA CGGTGTTCCG 1380

CGCGTCTAGA TAGCATAAAC ATTGTTTTCC TCTTGGGATA AAAGCACAGG CAAAACAAGG 1440

GATCGTTCCT CTTAGTCAAC GACTGCTGAA CAGCAGTCAG TCAGTTCAGG GCGTGGCCCT 1500

GACGGGTTCA TCAGCCCATT TTTTTGGTCG AGTCACTGTT TGTTCCGGGG ATCTGGCTGT 1560

GGCACCGAAG GCAATCTTGC CTTGCTGCCT ATAAAAATTC CTCATTCTGT TTGTACGCTT 1620

ACTAAGCTTC CTGGCCTCGT CGTTTGGCTG TGGTCCATCC TCTACAAACT TATCTCCATC 1680

CTCAACAAGG CCATAAAAAA CCTGTTTTAT TC 1712

((2) INFORMATION FOR SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 211 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

Met Phe Thr Gly Lys Arg Trp Ile Leu Val Val Ala Val Gly Ala Leu 1 5 10 15

Val Gly Ala Ser Val Lys Ala Ala Asp Phe Ser Gly Arg Gly Thr Val 20 25 30

Asn Gly Gin Pro Val Gly Ser Gly Tyr Ser Gly Tyr Pro Arg Gly Asp 35 40 45

Asp Val Arg Glu Ser Met Ala Ala Pro Glu Asp Leu Pro Gly Glu Arg 50 55 60

Gin Pro Glu Thr Pro Thr Ala Glu Ala Val Lys Gin Ala Ala Ala Lys 65 70 75 80

Ala Tyr Arg Leu Leu Lys Gin Phe Thr Ala Lys Val Gly Gin Glu Thr 85 90 95

Glu Asn Ala Tyr Tyr His Val Lys Lys Ala Thr Met Lys Gly Phe Asp 100 105 110

Val Ala Lys Asp Gin Ser Tyr Lys Gly Tyr Leu Ala Val Arg Lys Ala 115 120 125

Thr Ala Lys Gly Leu Gin Ser Ala Gly Lys Ser Leu Glu Leu Lys Glu 130 135 140

Ser Ala Pro Thr Gly Thr Thr Thr Ala Ala Pro Thr Glu Lys Val Pro 145 150 155 160

Pro Ser Gly Pro Glx Ser Gly Glu Val Gin Arg Thr Arg Lys Glu Gin 165 170 175

Asn Asp Val Gin Gin Thr Ala Glu Met Leu Ala Glu Glu Ile Leu Glu 180 185 190

Ala Gly Leu Lys Lys Asp Asp Gly Glu Gly Arg Gly Thr Pro Glu Ala 195 200 205

Glu Val Asn 210

(2) INFORMATION FOR SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 57 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

Asp Pro Pro Gly Cys Arg Asn Ser Ala Arg Val Phe Arg His Phe Pro 1 5 10 15

Cys Lys Leu Cys Gin Ala Val Phe Arg Thr Asn Lys Ala Tyr Leu Cys 20 25 30

Val Gly Ile Leu Leu Phe Cys Ser Arg Gly Phe Tyr Phe Thr Glu Pro 35 40 45

Leu Cys Leu Arg Tyr Arg Thr Gly Ala 50 55 NFORMATION FOR SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 159 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Met Asp Val Gin Asn Phe Leu Gin Arg Tyr Ala Thr Ser Lys Met Phe 1 5 10 15

Gly Val Pro Pro His Phe Phe Gin Ser Arg Glu Ser Leu Arg Val Trp 20 25 30

Gly Ala Asp His Leu Thr Asp Pro Met Val Gin Pro Tyr Glu Lys Asp 35 40 45

Asp Gin Asn Leu Pro Asn Pro Phe His Val Ser Leu Pro Gly Tyr Ser 50 55 60

Pro Ser Leu Cys Lys Tyr Val Leu Thr Lys Gly Glu Lys Pro Pro Arg 65 70 75 80

Asp Pro Leu Leu Gly Pro Glu Ile Thr Ile Tyr Pro Pro Thr Trp Ile 85 90 95

Pro His Trp Glu Pro Asp Pro Asn Phe Lys Pro Gin Ala Tyr Asn Phe 100 105 110

Asn Trp Glu Glu Asn Gly Thr Phe Gin Met Glu Arg Leu Pro Tyr Ala 115 120 125

Lys Ala Val Phe Asp Pro Ala Asp Gly Ser Ala His Gly Met Tyr Lys 130 135 140

Gin Ala Tyr Pro Tyr Thr Ala Tyr Pro Tyr Gly Val Pro Arg Val 145 150 155

Claims

CLAIMS:

1. An isolated nucleic acid molecule encoding a Neospora caninum antigen, the molecule including a nucleotide sequence substantially as shown SEQ ID NO: 2 or SEQ ID NO: 3, functionally equivalent nucleotide sequences thereof, portions thereof encoding a N. caninum antigen, sequences which hybridise to the nucleotide sequences of SEQ ID NO: 2 or SEQ ID NO: 3, or sequences which show at least 60% homology with the nucleotide sequences of SEQ ID NO: 2 or SEQ ID NO: 3.

2. The nucleic acid molecule according to claim 1 having at least 80% homology with the nucleotide sequences of SEQ ID NO: 2 or SEQ ID NO: 3.

3. The nucleic acid molecule according to claim 2 having at least 90% homology with SEQ ID NO: 2 or SEQ ID NO: 3.

4. The nucleic acid molecule according to claim 1 having the sequence substantially as shown in SEQ ID NO: 2 or SEQ ID NO: 3.

5. A nucleic acid molecule which hybridises to the sequence shown in

SEQ ID NO: 2 or SEQ ID NO: 3.

6. The nucleic acid molecule according to claim 5 having at least 15 nucleotides.

7. An isolated polypeptide forming aNeospora caninum antigen encoded by the isolated nucleic acid molecules according to any one of claims 1 to 4.

8. The polypeptide according to claim 7 selected from the group consisting of SEQ ID NO: 4. SEQ ID NO: 5 or SEQ ID NO: 6. antigenic portions thereof, and functionally equivalent polypeptides thereof.

9. The polypeptide according to claim 7 selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6.

10. A vector including a nucleic acid molecule according to any one of claims 1 to 4.

11. The vector according to claim 10 comprising a plasmid.

12. The vector according to claim 11 comprising plasmid pTrcHisB or VR1012 including SEQ ID NO: 2 or SEQ ID NO: 3.

13. A composition for use in raising an immune response in an animal against neosporosis, the composition comprising a carrier and a polypeptide according to any one of claims 7 to 9.

14. The composition according to claim 13 wherein the polypeptide has an amino acid sequence substantially as shown in SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, mixtures thereof, or immunogenic fragments thereof.

15. The composition according to claim 14 wherein the polypeptide has an amino acid sequence substantially as shown in SEQ ID NO: 5.

16. The composition according to any one of claims 13 to 15 further including a suitable adjuvant.

17. The composition according to claim 16 wherein the adjuvant is selected from the group consisting of aluminium salts, water-in-oil emulsions, oil-in-water emulsions, saponin, QuilA and derivatives, iscoms, liposomes, cytokines including gamma interferon or interleukin 12, DNA including plasmid DNA, microencapsulation in a solid or semi-solid particle, Freunds complete and incomplete adjuvant or active ingredients thereof including muramyl dipeptide and analogues, DEAE dextran/mineral oil, Alhydrogel, Auspharm adjuvant, and Algammulin.

18. A composition for use in raising an immune response in an animal against neosporosis, the composition comprising a carrier and a vector according to any one of claims 10 to 12.

19. The composition according to claim 18 wherein the vector is plasmid VR1012 including SEQ ID NO: 2 or SEQ ID NO: 3.

20. A method of obtaining a protective effect against neosporosis in an animal, the method comprising administering to the animal a composition according to any one of claims 13 to 19.

21. The method according to claim 20 wherein the administering of the composition is by injection via intramuscular, subcutaneous, intradermal or intraperitoneal routes, or included as an additive in feed or water.

22. Use of one or more of the polypeptides according to any one of claims 7 to 9 in methods for detecting antibodies reactive or specific to Neospora.

23. The use according to claim 22 wherein the polypeptide has the amino sequence of SEQ ID NO: 4.