AU3948100A - Parasite antigens - Google Patents

Description

WO 00/63244 PCT/AU00/00354 1 Parasite Antigens Technical Field The present invention is directed to parasite antigens, particularly Neospora antigens and uses thereof. 5 Background Art Neospora caninum is a cyst-forming coccidian parasite which was described during a retrospective study of dogs previously diagnosed with fatal toxoplasmosis in 1988. The genus Neospora was established in the family Sarcocystidae of the phylum Apicomplexa because of the close 10 similarity in morphology between Neospora and other cyst-forming coccidia such as Toxoplasma. The complete life cycle of Neospora is not known but congenital transmission has been recorded in dogs, cats, sheep, cattle, goats and horses. Abortion is a major cause of economic loss to both the dairy and beef 15 industries, estimated at 2-5% annually on most farms in Australia but occasionally reported to be as high as 20-30% per annum. In a review of 500 abortions, suspected neosporosis was found to be the major cause of abortion in cattle, particularly in northern coastal NSW. Protozoal abortion is estimated to cause at least $0.5 million and $1 million in direct losses 20 annually to north eastern dairy farmers and beef producers respectively, with estimated potential losses of $85 million and $25 million to the Australian dairy and beef industries, respectively. In Australia and other countries of the world a diagnosis of Neospora abortion in cattle is made when there is evidence of focal or multifocal nonsuppurative inflammation in the brain, 25 heart, liver and occasionally other organs, and less commonly, demonstration of tachyzoites or cysts in tissue sections. Parasites may be found adjacent to necrotic foci, but they are difficult to locate in routine haematoxylin and eosin (H&E) stained sections. Parasites are more readily demonstrated by an immunoperoxidase test performed on formalin-fixed, paraffin-embedded 30 tissue using specific anti-N. caninum sera made in rabbits. Using a mixture of these techniques N. caninum was demonstrated in the brains of aborted calves from cases collected from NSW and Tasmania, confirming that neosporosis is the main cause of bovine abortion in Australia. However, the immunoperoxidase procedure is not very sensitive and depends on the 35 presence of large numbers of organisms in tissue sections to make a firm diagnosis. There are also cross reaction problems associated with its use.

WO 00/63244 PCT/AU00/00354 2 Consequently, during 1994 and 1995 the present inventors and others developed a prototype diagnostic test based on the polymerase chain reaction (PCR) for the detection of Neospora DNA and DNA derived from formalin fixed paraffin embedded tissue sections that will detect as little as 1 fg of 5 target DNA by a single-tube nested PCR. Methods for the serological diagnosis of Neospora infections in dogs and cattle have also been described. An IFAT test was developed although cross-reactivity with T. gondii and Hammondia hammondi has been demonstrated in sera from cattle believed to be infected with Neospora. This 10 test has subsequently been superseded by an ELISA test based on cell-free lysates of Neospora. Neospora caninum is recognised as a major cause of bovine abortion and morbidity in dogs worldwide. Losses may be extremely significant in areas with large dairy and beef cattle industries such as the USA, Europe and 15 Australia. Commercial vaccines against N. caninum are not yet available, although a vaccine based on a crude lysate has been conditionally released in the United States of America by the Bayer Corporation. Several antigens from N. caninum have also been described including NcSAG1 (Ncp29/NCp36), NcSRS-2 (Ncp35/NCp43), NCGRA6 (NCDG2), NCGRA7 20 (NCDG1), NC-p65, and more recently, NCGRA2. These antigens have all been cloned and most appear associated with the parasite cell membrane or localised to dense granules. Homologues to some of these antigens in Toxoplasma gondii, (a close relative to N. caninum), have been extensively evaluated for diagnosis or for the induction of protective immunity. 25 However, the selection of appropriate candidates for vaccine development requires careful consideration. For example, antigens which induce proliferation of humoral and cellular immune responses in Neospora-infected calves may be considered suitable candidates for further study. The present inventors have isolated and characterised a new gene from 30 N. ccaninum (called NCP20), which was isolated by immunoscreening a cDNA library with pooled sera from mice made resistant to a lethal challenge of N. caninumn. The gene encodes a polypeptide that is antigenic and has been found to be a good candidate for immunising animal against neosporosis.

WO 00/63244 PCT/AU00/00354 3 Disclosure of Invention In a first aspect, the present invention consists in an isolated polynucleotide molecule encoding a N. caninum antigen, the polynucleotide molecule having a sequence as set out in Figure 1 (SEQ ID NO: 1), or 5 polynucleotide molecules which hybridise thereto under stringent conditions. When used herein, stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0/1% NaDodSO 4 at 65 0 C; (2) employ during 10 hybridisation a denaturing agent such as formamide, for example, 50% (vol/vol) formamide with 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mlvi NaC1, 75 mM sodium citrate at 42 0 C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaC1, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 15 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 420C in 0.2 x SSC and 0.1% SDS. Also provided are vectors including such polynucleotides, host cells transformed with such vectors, and recombinant polypeptides encoded by 20 such polynucleotides. The vectors may be adapted to be used in bacterial or mammalian cells as known to the art. Due to differences in the mechanism of gene expression between prokaryotic and eukaryotic cells, it will be appreciated that different polypeptides may be produced from the same polynucleotide using the two expression systems. 25 In a second aspect, the present invention provides an isolated N. caninum polypeptide encoded by the isolated polynucleotide according to the first aspect of the present invention, or functionally equivalent polypeptides, or immunogenic fragments thereof. In one preferred embodiment of the second aspect of the present 30 invention, the isolated N. caninum polypeptide is produced in a prokaryotic expression system, preferably using Escherichia coli, such that the polypeptide has amino acid sequence substantially as shown in Figure 2 (SEQ ID NO: 2), or functionally equivalent amino acid sequences. In another preferred embodiment of the second aspect of the present 35 invention, the isolated N. ccaninum polypeptide is produced in a eukaryotic expression system from the polynucleotide molecule shown in Figure 1 (SEQ WO 00/63244 PCT/AU00/00354 4 ID NO: 1). As eukaryotic cells express genes differently from prokaryotes, the polypeptide produced by such a system as shown in Figure 2 (SEQ ID NO: 2) may be post-translationally modified in some way. The polypeptide produced by the bacterial expression of the cDNA 5 sequences according to the first aspect of the present invention react with antibodies present in mice that have been infected by N. ccaninum. Accordingly, it will be appreciated that the polypeptide will have the same or similar antigenic epitopes as present on the native polypeptide of Neospora. Thus, the polypeptide according to the second aspect of the present 10 invention, whether produced by in prokaryotic or eukaryotic expression systems, should be a good candidate for antigens to raise protective antibodies to N. caninum in animals. In a third aspect, the invention provides a composition for use in raising an immune response in animals against neosporosis, the composition 15 comprising a carrier and a polypeptide having an amino acid sequence substantially as the sequence shown in Figure 2 (SEQ ID NO: 2), functionally equivalent polypeptides, or immunogenic fragments thereof. It will be appreciated by those skilled in the art that a number of modifications may be made to the polypeptides and fragments of the present 20 invention without deleteriously effecting the biological activity (immunogenicity) of the polypeptides or fragments. This may be achieved by various changes, such as sulfation, phosphorylation, nitration and halogenation; or by amino acid insertions, deletions and substitutions, either conservative or non-conservative (eg. D-amino acids, desamino acids) in the 25 peptide sequence where such changes do not substantially alter the overall biological activity of the peptide. Preferred substitutions are those which are conservative, i.e., wherein a residue is replaced by another of the same general type. As is well understood, naturally-occurring amino acids can be subclassified as acidic, basic, neutral and polar, or neutral and nonpolar. 30 Furthermore, three of the encoded amino acids are aromatic. It is generally preferred that encoded peptides differing from the determined polypeptide contain substituted codons for amino acids which are from the same group as that of the amino acid replaced. Thus, in general, the basic amino acids Lys, Arg, and His are interchangeable; the acidic amino acids.Asp and Glu are 35 interchangeable; the neutral polar amino acids Ser, Thr, Cys, Gln, and Asn are interchangeable; the nonpolar aliphatic amino acids Gly, Ala, Val, Ile, WO 00/63244 PCT/AU00/00354 5 and Leu are conservative with respect to each other (but because of size, Gly and Ala are more closely related and Val, Ile and Leu are more closely related), and the aromatic amino acids Phe, Trp and Tyr are interchangeable. It should further be noted that if polypeptides are made synthetically, 5 substitutions by amino acids which are not naturally encoded by DNA may also be made. For example, alternative residues include the omega amino acids of the formula NH 2

(CH

2 )nCOOH wherein n is 2-6. These are neutral, nonpolar amino acids, as are sarcosine, t-butyl alanine, t-butyl glycine, N methyl isoleucine, and norleucine. Phenylglycine may substitute for Trp, 10 Tyr or Phe; citrulline and methionine sulfoxide are neutral nonpolar, cysteic acid is acidic, and ornithine is basic. Proline may be substituted with hydroxyproline and retain the conformation conferring properties. In a further preferred embodiment of the third aspect of the invention, the composition further includes a suitable adjuvant. Preferred adjuvants 15 include Freund's complete adjuvant, Freund's incomplete adjuvant, glucosaminylmuramyl dipeptide, Quil A, DEAE Dextran/mineral oil, Alhydrogel, Auspharm adjuvant and Algammulin. In a fourth aspect, the present invention provides a method of obtaining a protective effect against neosporosis in mammals, the method 20 comprising inoculating the mammal with a polypeptide according to the second aspect of the present invention. In a fifth aspect, the present invention relates to use of the polypeptide according to the second aspect of the present invention in methods for detecting antibodies reactive or specific to N. caninum. 25 One particularly suitable use would be in a recombinant ELISA assay where detection of antibodies in a serum or blood sample from an animal that bind to one or more of the polypeptides would be indicative of the exposure to and/or infection of that animal with N. ccninum. Screening of animal herds for the presence of an immune response to Neospora can be 30 carried out using the polypeptide according to the present invention in suitable immunological assays known to the art. Such tests would also be useful to determine whether immunisation with a vaccine according to the third aspect of the present invention of an animal was successful at raising antibodies to the N. caninum. 35 Furthermore, antibodies raised against the polypeptides according to the present invention could be used in assays to identify or diagnose the WO 00/63244 PCT/AU00/00354 6 presence of N. caninurn. The antibodies could be raised in animals, for example laboratory animals, and purified for use by standard techniques. Similarly, monoclonal antibodies could also be produced in the usual manner from rodents immunised with a polypeptide so as to produce 5 antibodies specific to N. caninurm. In a sixth aspect, the present invention consists in a suitable vector for the replication and/or expression of a polynucleotide molecules according to the first aspect of the present invention. The vector may be, for example, plasmid, virus or phage vector 10 provided with an origin of replication, and preferably a promoter for the expression of the polynucleotide, and optionally a regulator of the promoter. The vector may contain one or more selectable markers, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian expression vector. The vector may be used 15 in vitro, for example for the production of RNA or used to transfect or transform a host cell. In a seventh aspect of the present invention relates to host cells transformed or transfected with the vector according to the sixth aspect of the present invention. 20 Suitable host cells for cloning or expressing the protein(s) disclosed herein are the prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include eubacteria, such as Gram-negative or Gram-positive organisms, for example, Escherichia coli, Bacilli such as B. subtilis or B. thuringiensis, Pseudornonas species such as P. aeruginosa, Salmonella 25 typhimurium or Serratia marcescens. Eukaryotic microbes such as filamentous fungi or yeast are suitable hosts for expressing the protein(s) of the present invention. Saccharornmyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, 30 species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as e.g. K lactis; filamentous fungi such as, e.g. Neurospora, or Penicillium; and Aspergillus hosts such as A. nidulans and A. niger. Other parasites, such as T. gondii, are also appropriate hosts for expressing the protein according to the present 35 invention.

WO 00/63244 PCT/AU00/00354 7 Suitable higher eukaryotic host cells can be cultured vertebrate, invertebrate or plant cells. Insect host cells from species such as Spodoptera frugiperda, Aedes aegypti, Aedes albopictus, Drosophila melanogaster, and Born byx mori can be used. Plant cell cultures of cotton, corn, potato, 5 soybean, tomato, and tobacco can be utilised as hosts. Typically, plant cells are transfected by incubation with certain strains for the bacterium Agrobacterium tumefaciens. Propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years. Examples of useful mammalian host cell 10 lines are monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture); baby hamster kidney cells (BHK ATCC CCL 10); Chinese hamster ovary cells/-DHFR (CHO); mouse sertoli cells, monkey kidney cells (CV1 ATCC CCL 70); human cervical carcinoma cells (HELA, 15 ATCC CCL 2); canine kidney cells (MDCK ATCC CCL 34), and a human hepatoma cell line (Hep G2). Preferred host cells are canine kidney cells and Chinese hamster ovary cells. Host cells are transfected and preferably transformed with expression or cloning vectors of this invention and cultured in conventional nutrient 20 media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. Transformation means introducing DNA into an organism so that the DNA is replicable. either as an extrachromosomal element or by chromosomal integration. Depending on the host cell used, transformation is done using 25 standard techniques appropriate to such cells. In a eighth aspect, the present invention consist in a process for preparing a polypeptide according to the second aspect of the present invention, the process comprising cultivating a host cell transformed or transfected with an (expression) vector of the seventh aspect of the present 30 invention under conditions providing for expression of the polynucleotide encoding the polypeptide, and recovering the expressed polypeptide. Such cells can be used for the production of commercially useful quantities of the encoded protein. In a ninth aspect, the present invention provides an oligonucleotide 35 probe or primer, the probe or primer having a nucleotide sequence that WO 00/63244 PCT/AU00/00354 8 hybridises selectively to a polynucleotide molecule according to the first aspect of the present invention. In a preferred embodiment of the ninth aspect, the oligonucleotide probe or primer includes at least 15 nucleotides, more preferably at least 18 5 nucleotides and more preferably at least 25 nucleotides. In a further preferred embodiment, the oligonucleotide probe or primer is used as a detectable probe where the oligonucleotide is conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule. 10 In a tenth aspect, the present invention provides an isolated antibody, or fragment thereof, reactive to the polypeptide according to the second aspect of the present invention. The present inventors have obtained a new gene of N. caninum coding an antigen recognised by sera from mice that are immune to infection by this 15 parasite. Thus: a) proteins encoded by this gene have value for diagnosis of neosporosis in animals by virtue of their antigenicity; b) proteins encoded by this gene are useful for vaccination of animals against neosporosis; 20 c) DNA encoding these antigenic proteins are useful for vaccination of animals against neosporosis in the form of a DNA vaccine; d) DNA encoding these proteins are suitable to form the basis of a DNA based detection system for N. caninum by the development of DNA probes, PCR or other applicable technology; and 25 (e) antibodies to the protein have value in diagnosis of neosporosis by providing a means of directly demonstrating the presence of the parasite in mammalian tissues. Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will 30 be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps. In order that the present invention may be more clearly understood, preferred forms will be described with reference to the following examples 35 and drawings.

WO 00/63244 PCT/AU00/00354 9 Brief Description of Drawings Figure 1 shows the DNA sequence of N. caninum NCP20 (5'-3') cDNA (SEQ ID NO: 1). Figure 2 shows the predicted amino acid sequence coded by the N. 5 caninum gene for NCP20 (SEQ ID NO: 2). Figure 3 shows the results of a vaccination trial using recombinant NCP20 protein. The graph shows a plot of mean group body weight (MGW) against days post infection (DPI) with N. caninum. Figure 4 shows ELISA optical density (absorbance) reading for three 10 independent test sera of mice for the presence of antibodies to NCP20. Modes for Carrying Out the Invention General molecular biology Unless otherwise indicated, the recombinant DNA techniques utilised in the present invention are standard procedures, well known to those skilled 15 in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory Press (1989), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 20 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (Editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present) and are incorporated herein by reference. 25 Gene/DNA isolation The DNA encoding a protein may be obtained from any cDNA library prepared from tissue believed to express the gene mRNA and to express it at a detectable level. DNA can also be obtained from a genomic library. Libraries are screened with probes or analytical tools designed to 30 identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal or polyclonal antibodies that recognise and specifically bind the protein; oligonucleotides of about 20-80 bases in length that encode known or suspected portions of cDNA from the same or different species; and/or complementary or 35 homologous cDNAs or fragments thereof that encode the same or a hybridising gene. Appropriate probes for screening genomic DNA libraries WO 00/63244 PCT/AU00/00354 10 include, but are not limited to, oligonucleotides; cDNAs or fragments thereof that encode the same or hybridising DNA including expressed sequence tags and the like; and/or homologous genomic DNAs or fragments thereof. Screening the cDNA or genomic library with the selected probe may be 5 conducted using standard procedures as described in chapters 10-12 of Sambrook et al. An alternative means to isolate a gene encoding is to use polymerase chain reaction (PCR) methodology as described in section 14 of Sambrook et a]. This method requires the use of oligonucleotide probes that will 10 hybridise to the gene. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimised. The actual nucleotide sequence(s) is usually based on conserved or highly homologous nucleotide sequences or regions of the gene. The 15 oligonucleotides may be degenerate at one or more positions. The use of degenerate oligonucleotides may be of particular importance where a library is screened from a species in which preferential codon usage in that species is known. The oligonucleotide must be labelled such that it can be detected upon hybridisation to DNA in the library being screened. The preferred 20 method of labelling is to use 32 P-labelled ATP with polynucleotide kinase, as is well known in the art, to radiolabel the oligonucleotide. However, other methods may be used to label the oligonucleotide, including, but not limited to, biotinylation or enzyme labelling. Nucleic acid having all the protein coding sequence is obtained by 25 screening selected cDNA or genomic libraries, and if necessary, using conventional primer extension procedures as described in section 7.79 of Sambrook et al., to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA. Another alternative method for obtaining the gene of interest is to 30 chemically synthesise it using one of the methods described in Fingels et al. (Agnew Chem. Int. Ed. Engl. 28: 716-734, 1989). These methods include triester, phosphite, phosphoramidite and H-Phosphonate methods, PCR and other autoprimner methods, and oligonucleotide syntheses on solid supports. These methods may be used if the entire nucleic acid sequence of the gene is 35 known, or the sequence of the nucleic acid complementary to the coding strand is available, or alternatively, if the target amino acid sequence is WO 00/63244 PCT/AU00/00354 11 known, one may infer potential nucleic acid sequences using known and preferred coding residues for each amino acid residue. Mutants, variants and homology - nucleic acids Mutant polynucleotides will possess one or more mutations which are 5 deletions, insertions, or substitutions of nucleotide residues. Mutants can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagensis on the DNA). It is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant (that is to say prepared using 10 recombinant DNA techniques). An allelic variant will be a variant that is naturally occurring within an individual organism. Nucleotide sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of the 15 polynucleotide will be the equivalent polynucleotide which occurs naturally in another species. Within any one species a homologue may exist as numerous allelic variants, and these will be considered homologues of the polynucleotide. Allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art. Preferred 20 species homologues include those obtained from representatives of the same Phylum, more preferably the same Class and even more preferably the same Order. A polynucleotide at least 70% identical, as determined by methods well known to those skilled in the art (for example, the method described by 25 Smith, T.F. and Waterman, M.S. (1981) Ad. Appl. Math., 2: 482-489, or Needleman, S.B. and Wunsch, C.D. (1970) J. Mol. Biol., 48: 443-453), to the that of the present invention are included in the invention, as are proteins at least 80% or 90% and more preferably at least 95% identical to the polynucleotide of the present invention. This will generally be over a region 30 of at least 60, preferably at least 90, contiguous nucleotide residues.

WO 00/63244 PCT/AU00/00354 12 Mutants, variants and homology - proteins Mutant polypeptides will possess one or more mutations which are deletions. insertions, or substitutions of amino acid residues. Mutants can be either naturally occurring (that is to say, purified or isolated from a natural 5 source) or synthetic (for example, by performing site-directed mutagensis on the encoding DNA). It is thus apparent that polypeptides of the invention can be either naturally occurring or recombinant (that is to say prepared using recombinant DNA techniques). An allelic variant will be a variant that is naturally occurring within an 10 individual organism. Protein sequences are homologous if they are related by divergence from a common ancestor. Consequently, a species homologue of the protein will be the equivalent protein which occurs naturally in another species. Within any one species a homologue may exist as numerous allelic variants, 15 and these will be considered homologues of the protein. Allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art. Preferred species homologues include those obtained from representatives of the same Phylum, more preferably the same Class and even more preferably the same Order. 20 A protein at least 50% identical, as determined by methods well known to those skilled in the art (for example, the method described by Smith, T.F. and Waterman, M.S. (1981) Ad. Appl. Math., 2: 482-489, or Needleman, S.B. and Wunsch, C.D. (1970) J. Mol. Biol., 48: 443-453), to the that of the present invention are included in the invention, as are proteins at least 70% or 80% 25 and more preferably at least 90% identical to the protein of the present invention. This will generally be over a region of at least 20, preferably at least 30, contiguous amino acids. Protein variants Amino acid sequence variants can be prepared by introducing 30 appropriate nucleotide changes into DNA, or by in vitro synthesis of the desired polypeptide. Such variants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence. A combination of deletion. insertion and substitution can be made to arrive at the final construct, provided that the final protein product possesses the 35 desired characteristics. The amino acid changes also may alter post translational processes such as changing the number or position of WO 00/63244 PCT/AU00/00354 13 glycosylation sites, altering the membrane anchoring characteristics, altering the intra-cellular location by inserting, deleting or otherwise affecting the transmembrane sequence of the native protein, or modifying its susceptibility to proteolytic cleavage. 5 In designing amino acid sequence variants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) 10 deleting the target residue, or (3) inserting residues of other ligands adjacent to the located site. A useful method for identification of residues or regions for mutagenesis is called "alanine scanning mutagenesis" as described by Cunningham and Wells (Science (1989) 244: 1081-1085). Here, a residue or 15 group of target residues are identified (e.g., charged residues such as Arg, Asp, His, Lys, and Glu) and replaced by a neutral or negatively charged amino acid (most preferably alanine or polyalanine) to affect the interaction of the amino acids with the surrounding aqueous environment in or outside the cell. Those domains demonstrating functional sensitivity to the 20 substitutions then are refined by introducing further or other variants. Thus, while the site for introducing an amino acid sequence variation is predetermined, the nature of the mutation per se need not be predetermined. For example, to optimise the performance of a mutation at a given site, alanine scanning or random mutagenesis may be conducted at the target 25 codon or region and the expressed variants are screened for the optimal combination of desired activity. There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. These may represent naturally occurring alleles or predetermined 30 mutant forms made by mutating the DNA either to arrive at an allele or a variant not found in nature. In general, the location and nature of the mutation chosen will depend upon the characteristic to be modified. Amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues and typically about 1 to 5 35 contiguous residues.

WO 00/63244 PCT/AU00/00354 14 Amino acid sequence insertions include amino and/or carboxyl terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Other insertional variants include 5 the fusion of the N- or C-terminus of the proteins to an immunogenic polypeptide e.g. bacterial polypeptides such as betalactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, bovine serum albumin, and chemotactic polypeptides. C-terminal fusions with proteins having a long half-life such as immunoglobulin constant regions (or other immunoglobulin 10 regions), albumin, or ferritin, are included. Another group of variants are amino acid substitution variants. These variants have at least one amino acid residue in the protein molecule removed and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis include sites identified as the active 15 site(s). Other sites of interest are those in which particular residues obtained from various species are identical. These positions may be important for biological activity. These sites, especially those falling within a sequence of at least three other identically conserved sites, are substituted in a relatively conservative manner. Such conservative substitutions are shown in Table 1 20 under the heading of "preferred substitutions". If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 1, or as further described below in reference to amino acid classes, are introduced and the products screened. Substantial modifications in function or immunological identity are 25 accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydro-phobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups 30 based on common side chain properties: (1) hydrophobic: norleucine, met. ala. Val, Leu. Ile: (2) neutral hydrophilic: Cys, Ser. Thr: (3) acidic: Asp, Glu; (4) basic: Asn, Gln, His, Lys, Arg; 35 (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe WO 00/63244 PCT/AU00/00354 15 TABLE 1 Preferred amino acid substitutions Original Exemplary Preferred Residue Substitutions Substitutions Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Lys; Arg Gln Asp (D) Glu Glu Cys (C) Ser Ser Gln (Q) Asn Asn Glu (E) Asp Asp Glv (G) Pro Pro His (H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu norleucine Leu (L) norleucine, Ile; Val; Ile Met: Ala; Phe Lys (K) Arg; Gln; Asn Arg Met (Mi) Leu; Phe; Ile; Leu Phe (F) Leu; Val; Ile; Ala Leu Pro (P) Gly Gly Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe Leu Ala; norleucine WO 00/63244 PCT/AU00/00354 16 Non-conservative substitutions will entail exchanging a member of one of these classes for another. Substantially purified By "substantially purified" the present inventors mean a polypeptide 5 that has been separated from lipids, nucleic acids, other polypeptides, and other contaminating molecules. Active fragment By "active fragment" the present inventors mean a fragment of an amino acid sequence shown in Figure 2 (SEQ ID NO: 2) which retains 10 immuno-activity of the native polypeptide. MATERIALS AND METHODS Parasite culture N. caninum isolates NC-Liverpool (Barber et al. 1995, Parasitology 111, 563-568) and NC-SweB1 (Stenlund et al. 1997, Parasitology Research 83, 214 15 219) were propagated in vitro in Vero host cells according to established procedures (Barber et al. 1995). Immunoblotting Female Balb/C mice were made resistant to an acute, lethal infection of NC-Liverpool by 2 infections of NC-SweB1 as described (Atkinson et al. 1999, 20 Parasitology 118, 363-370). Immunoblotting was used to compare antibody responses of these resistant mice and a separate group of acutely infected, naive mice (Atkinson et a]. 1999). Affinity purified antibodies (APAbs) were prepared (Hemphill et al. 1997b, Parasitology 115, 371-380) by immunoblotting 100 pIg of NC-Liverpool 25 antigen separated by SDS-PAGE onto PDVF. A portion of the PDVF was cut out from either side of the PVDF membrane and a section covering the 15-30 kDa size range were visualised by immunoscreening. The portions were then realigned with the main strip of PVDF and the region spanning antigens 15 30 kDa excised. Polyclonal antibody from the resistant mice (n=5, pooled) 30 was then bound to the excised PVDF for 6 hours at RT at a dilution of 1/10. The polyclonal antibody was removed and the antigen strip was washed thoroughly in Tris-buffered saline/Tween (TBS-Tween) 3 times for 20 mins. Bound antibody was eluted in a low pH buffer (50 mM Tris, 50 mM Glycine; pH 2.8) for 5 mins at RT. After neutralisation with 1/10 volumes of 1 M Tris, 35 the eluate was diluted with TBS and 5% skim milk powder to a final volume of approximately 10 ml for use in immunoscreening a cDNA library.

WO 00/63244 PCT/AU00/00354 17 cDNA library construction Total cellular RNA was isolated from tachyzoites of N. caninum (NC Liverpool) which were grown in Vero cells in vitro. Essentially, tachyzoites were lysed in lysis buffer containing 5.7 M guanidinium thiocyanate, 100 5 mM sodium acetate pH 5.2, 10 mM EDTA containing 100 mM 2 mercaptoethanol. Insoluble debris was removed by centrifugation at 10,000g for 10 min at room temperature. The supernatant was collected and 0.1 volumes of 3 M sodium acetate pH 5.2 was added to it along with 0.75 volumes of ethanol. After precipitation overnight, RNA was pelleted at 10 12,000g for 15 min at 40C. The pellet was dissolved in lysis buffer containing 4.5 M guanidinium and the RNA solution was extracted with an equal volume of phenol/chloroform. After centrifugation to break the phases, the aqueous phase was mixed with 2 volumes of ethanol and RNA precipitated overnight. The RNA was collected by centrifugation, washed in 15 70% ethanol and stored at -700C until required. RNA pellets from storage were centrifuged (20 minutes, 10000g, 40C), pooled and resuspended in 5 ml of TS buffer (10 mM Tris, 0.1% SDS) for 15 minutes at 650C. The solution was then cooled rapidly on ice and sodium chloride added to a final concentration of 400 mM. Purification of mRNA followed an established 20 procedure. Briefly, the solution was passed through a sterile syringe containing oligo-dT cellulose (Clontech), eluate was collected in baked cuvettes and the A 260 of consecutive fractions was read on a spectrophotometer. After the major peak of poly-A- (rRNA) was eluted off, the bound poly-A + (mRNA) was collected by flushing the column with TS 25 buffer. Fractions containing the poly-A+ A 26 0 peaks were then precipitated and stored at -70 0 C. Reagents and equipment for cDNA library construction were supplied by Stratagene. Approximately 4 tg of mRNA was centrifuged and resuspended in DEPC-treated water for 15 minutes at 650C. The solution was 30 cooled rapidly on ice and single stranded cDNA was synthesised in a buffer containing a poly-dT primer with an internal Xhol restriction site. Second strand synthesis, blunt-ending, addition of EcoR1 adaptors and Xhol digestion were performed following instructions provided by the manufacturer. Double stranded cDNA was then size fractionated on a 35 Sephacryl S-500 column (Clontech) to remove molecules less than approximately 400 bp in size. cDNA was ligated into EcoR1/Xhol digested WO 00/63244 PCT/AU00/00354 18 arms of the UNI-ZAP XR bacteriophage vector and packaged into viable phage using Gigapack Gold III packagene extracts. The titre of the cDNA library was determined by plating serially diluted aliquots onto Escherichia coli. The primary cDNA library contained 1.1 x 106 recombinant clones. 5 Immunoscreening cDNA library The APAb was used to screen 10,000 clones of the cDNA library following standard immunoscreening procedures (Sambrook, Fritz & Maniatis, 1989, Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York). The clones were 10 adsorbed to IPTG impregnated PVDF membranes (2 h, RT). Membranes were then probed with the APAb (45 min, RT). After washing (3 x10 min) in TBS Tween the membranes were placed in anti-mouse IgG (Sigma) diluted in 1/1000 in TBS and 5% skim milk powder (45 min, RT). Washing was repeated and development took place in alkaline phosphatase buffer 15 containing nitroblue tetrazoleum and 5-bromo-4-chloro-3-indolyl-phosphate (Sambrook, Fritz & Maniatis, 1989). Positive clones were rescreened until plaque pure. Characterisation of cDNA clones Plaque pure positive clones were picked, placed in 100 p l sterile water. 20 boiled and subject to PCR and sequencing (Ellis et al. 2000, Parasitology 120, 383-390). Sequences were blasted (BlastN and TblastX) using the Australian Genome Information Service (ANGIS) against the GenBank or NR Nucleic Acid database. This latter database is compiled by ANGIS and contains non redundant data from GenBank, EMBL and PDB. Matches were considered 25 significant if scores were returned with a probability greater than 106. DNA sequences were also blasted against the Toxoplasma Database of Clustered ESTS (ToxoDB; http://www.cibil.upenn.edu/agi bin/ParaDBs/Toxoplasma/index.html). Protein structure predictions 30 The protein sequence of NCP20 was submitted to the PSA server (http://bmerc-www.bu.edu/psa/) and a secondary structure prediction made using a Type-1 analysis and the DSM model of Stultz et al. (1993, Protein Science 2. 305-314) which presumes the protein is a monomeric, single domain, globular, water-soluble protein.

WO 00/63244 PCT/AU00/00354 19 Expression of NCP20 in E. coli Since there was three potential start codons in the mRNA encoding NCP20, the open reading frame (ORF) of NCP20 was PCR amplified from EST clone P06 with either 5 P20-ATG1F (5'ACGTATGGATCCGTTTTGTCAGGTGTTCTTG3') (SEQ ID NO: 3) ; P20-ATG2F (5'ACGTATGGATCCGGCTTTGTCTACGATGAAC3') (SEQ ID NO: 4); P20-ATG3F (5'ACGTATGGATCCGAACAAGCCCGGGCCGTTT3') 10 (SEQ ID NO: 5); or P20-pTrcR (5'ACGCATGAATTCTGTTTCTGAGTTCCCGCT3') (SEQ ID NO: 6). These primers place unique BamH1 and EcoR1 restriction sites on the five and three prime sides of the NCP20 ORF, respectively. The PCR 15 products obtained were checked on a 1% agarose gel for size and purified using a Qiaquick PCR purification kit. DNA from the purified PCR product and pTrcHisB vector (Invitrogen) were then digested with both BamHI and EcoR1 restriction enzymes for three hours at 370C. The digested DNA were purified using a Qiaquick column and checked on a 1% agarose gel. The 20 three PCR products of NCP20 were then ligated separately into the pTrcHisB vector and transformed into E. coli DH5ca. Individual recombinants were screened for inserts by PCR using primers pTrcHisFwd (5'GAGGTATATATTAATGTATCG3') (SEQ ID NO: 7) and P20-pTrcR. The sequence of the constructs made were confirmed by cycle sequencing. This 25 strategy ensured the initiation codon of NCP20 was cloned in-frame into the pTrcHisB vector, which following transcription and translation should produce a polypeptide. Subsequently, E. coli containing recombinant DNA were grown in LB medium containing ampicillin and at mid-log phase were induced with 1 mM IPTG. After several hours, the bacteria were collected by 30 centrifugation and solubilised in guanidinium lysis buffer. His-tagged protein was purified using Ni-NTA (Qiagen) resin following the manufacturer's instructions for preparation of denatured E. coli cell lysate. Proteins were analysed on 14% SDS-PAGE gels by staining with Coomassie blue.

WO 00/63244 PCT/AU00/00354 20 Identification of native NCP20 antigen One microgram of recombinant NCP20 purified from E. coli, was injected subcutaneously into five, 9 week-old QS mice with Freund's complete or Freund's incomplete adjuvant 4 weeks apart. Mice were bled 5 from the tail vein 3 weeks after the boost. Sera were pooled and used in immunoblotting against reduced tachyzoite antigen. Vaccination trial Ten groups of 9 mice were injected twice, subcutaneously in the scruff of the neck, 4 weeks apart, with one of the following treatments (ANZCCART 10 1998, ISBN 0 646 24923 1): Group 1: 0.1 mil Freund's complete adjuvant (FCA) followed by a boost with 0.1 ml Freund's incomplete adjuvant (FIA) only; Group 2: 0.1 ml FCA plus 1 pg NCP20; 15 Group 3: 0.1 ml FIA only; Group 4: 0.1 ml FIA plus 1 tg NCP20; Group 5: 0.1 ml FIA plus 25 pg glucosaminylmuramyl dipeptide (GMDP); Group 6: 0.1 ml FIA plus 25 ptg GMDP plus 1 jlg NCP20; Group 7: 0.1 ml 0.9% NaCl containing 10 ig Quil A only; 20 Group 8: 0.1 ml 0.9% NaCl containing 10 4g Quil A plus 1 pg NCP20; Group 9: saline (+ve control) Group 10: no treatment (-ve control). Mice (all groups except group 10) were then challenged three weeks 25 after the second injection with 7.5x10 5 culture-derived tachyzoites of NC Liverpool subcutaneously. Changes in mean group body weight (MGW) between 14 - 27 days post infection (DPI) with N. caninum were determined and analysed by a one-factor-repeated measures analysis of variance, with treatment as the factor and time as the repeated measure. All the sampling 30 times were included in the analysis. Two mice (one in group 1 and one in group 6) were removed from the analysis because their changes in body weight were anomalous. The details of the differences among treatments were assessed using a posteriori Tukey HSD multiple comparison test.

WO 00/63244 PCT/AU00/00354 21 Enzyme-linked immunosorbent assay using NCP20 Histidine-tagged, recombinant NCP20 (purified on Ni-NTA resin as described previously) was coated onto 96-well microtitre plates at 1 Pg/well diluted in ELISA buffer 1 (70 mM NaHCO3, 29 mM Na2CO3, 3.1 mM NaN3, 5 pH 9.6). Following overnight incubation at 4oC, the plates were washed 3 times in wash buffer (PBS, 0.03% Tween 20, pH 7.2). Serum samples were diluted 1:25 using ELISA buffer 2 (0.5 g bovine haemoglobin, 0.3% Tween 20, 3.1 mM NaN3, pH 7.2 in PBS), and 100 jl of each sample was added in duplicate. The plates were incubated overnight at 4oC and then washed as 10 before. One hundred 41 of biotinylated antibody to mouse IgG (The Binding Site, UK) was added to each well at a dilution of 1:6000 in ELISA buffer 2. Following a 1 hour incubation at 37oC and washing, each well was coated with 100 pl of ExtrAvidin alkaline phosphatase (Sigma, USA) at a dilution of 1:5000 in ELISA buffer 2. After incubation for 1 hour at 37 0 C the plates were 15 again washed and 100 pl of Alkaline Phosphatase Substrate 104 (Sigma, USA) was added at a concentration of 1 mg/ml in ELISA buffer 3 (58 mM NaHCO3, 42 mM Na2CO3, 2 mM MgC12.6H20, pH 9.8). The plates were incubated at 37oC for 30 min, allowing sufficient colour development. The absorbance reading of each well at 405 nm was determined using an electronic plate 20 reader (Biorad). RESULTS Identification of antigens for APAb preparation Immunoblotting of sera from resistant (vaccinated) and acutely infected naive Balb/C mice to antigen from NC-Liverpool and NC-SweB1 25 were studied. A group of antigens were identified by blotting using sera from resistant mice in the range 15-30 kDa which were absent or significantly less immunogenic in tracks probed with sera from acutely infected naive mice. An APAb was therefore prepared from antigens over this specific size range. The specificity of the APAb to N. caninum antigen was investigated by 30 immunoblotting. Immunoreactive bands of approx. 17-18 kDa were faintly detected under non-reducing and reducing conditions respectively. Gene isolation and characterisation Four positive clones were isolated from the cDNA library by immunoscreening with the APAb. PCR products were obtained from the 35 cDNA clones with sizes of approximately 1200, 1000, 900 and 800 bp. Sequence from the 1200 bp clone was homologous to NCGRA7/NCDG1 (Lally WO 00/63244 PCT/AU00/00354 22 et a. 1996, Clinical and Diagnostic Laboratory Immunology 3, 275-279; Lally et al. 1997. Molecular and Biochemical Parasitology 87, 239-243) and not studied further. Sequence from the 1000 bp clone predicted limited protein sequence homology of the gene product with the Gral protein of T. gondii 5 (Cesbron-Delauw et al. 1989, Proceedings of the National Academy of Sciences of the United States ofAmerica 86, 7537-7541) which was detected by a TblastX search of the GenBank database. Hence this gene was called NCGRA1 (GenBank accession number AF199030) and is described elsewhere. The remaining two cDNA sequences isolated from the cDNA library 10 were homologous to each other. Eight additional cDNA sequences (ESTs) homologous to these cDNAs, were also identified amongst a small EST database maintained at UTS and a consensus DNA sequence was derived from all of them extending the data to approximately 1088 bp (Figure 1). The final cDNA consensus was 280 bases longer at the 5' end than the original 15 two cDNAs isolated and possessed three potential initiation codons at positions 1, 160 and 175. NCP20/NCP20 clustered in the ToxoDB with Ctoxqual_1252, a cluster containing 22 ESTs of T. gondii. Of potential significance is that the two most similar T. gondii sequences (with the highest probability of a match) 20 were ESTs derived from a bradyzoite cDNA (TgEST zz70do9.rl and TgESTzz46do3.rl). Thus it was concluded that a T. gondii homologue of NCP20 exists. Identification of native tachyzoite antigen encoded by NCP20 cDNA sequence analysis predicted the presence of three potential start 25 codons in NCP20. Consequently, primers were designed to PCR amplify the ORF from each of these potential start codons and the products were cloned individually, in-frame into pTRcHis. E. coli containing PCR product derived from primers P20-ATG3F and P20-pTrcR, encoding the shortest ORF (from 170 through to 480), expressed a protein with a mobility of approximately 30 30 kDa which could be purified from bacterial extracts by chromatography. No recombinant protein was obtained from E. coli containing the other two constructs. Injection of purified protein into QS mice generated IgG antibodies which detected, by immunoblotting, a 20 kDa tachyzoite antigen in NC-SweB1. No antigen was detected by this pooled sera in extracts of NC 35 Liverpool.

WO 00/63244 PCT/AU00/00354 23 It is believed that NCP20 is encoded by the ORF spanning positions 160 to 480. Translation of this ORF in the DNA sequence of NCP20 gives a protein of approximately 11.8 kDa (with an isoelectric point of 11.04) containing 107 amino acids (Figure 2) which is predicted to be rich in 5 alanine. leucine and arginine. A prediction of the protein structure indicated NCP20 probably contains several helical regions separated by turns. Vaccination experiment The statistical analysis was a one-factor analysis of variance, with the various treatments as the factor. The data analysed were the change in 10 mouse weight through time, calculated using a separate linear regression for each mouse (Figure 3). Only mice with data for all of the days were used in the analysis. The significant factor (P<0.001) indicated that the mice change weight differently among some of the groups. A multiple comparison test showed that groups 1 (FCA) and 2 (FCA+NCP20) were not different from 10 15 (the negative control) in that they maintained their body weight close to their starting weight. Mice in all the other groups behaved like those in group 9 (the positive control) in that they lost weight over the course of the experiment. Thus it was concluded that injection of mice with either FCA with or without recombinant NCP20 provided complete protection against 20 weight loss that normally occurs during an acute infection of N. caninum. All mice infected with N. caninum showed clinical signs associated with the infection, which were a ruffled coat from day 14 post infection. Enzyme-linked immunosorbent assay using NCP20 Figure 4 shows the results obtained by ELISA using recombinant 25 NCP20 and three test sera from mice. The negative control serum is derived from a pregnant QS mouse injected with saline at day 8 of gestation whereas the other 2 sera (labeled positive sera) are from pregnant QS mice injected subcutaneously at day 8 of gestation with 1 million tachyzoites of NC Liverpool. All mice were bled from the heart on day 21 of gestation and sera 30 prepared by standard procedures. The antibody response to NCP20 in the pregnant mice receiving NC-Liverpool, as determined from the ELISA OD readings, was significantly higher than that found in the pregnant mouse receiving saline, thereby indicating the ELISA detected IgG antibodies in those mice infected with N. cancinum.

WO 00/63244 PCT/AU00/00354 24 DISCUSSION The isolation and characterisation of a new gene from N. caninum, called NCP20 is reported. The gene was isolated by modifying a strategic immunoscreening technique. The immunoscreening strategy used was 5 devised in order to avoid isolating antigen sequences that are cross-reactive to the dense granule antigen NCDG1 of N. caninurn which is highly immunogenic. Consequently, antigens blotted onto PVDF membranes that were smaller than 30 kDa were used to select antibody from pooled sera of mice made resistant to a lethal challenge of NC-Liverpool by previous 10 infection with NC-SweB1. The selected antibody was then used to immunoscreen the cDNA expression library. Two genes, previously undescribed from N. caninum were isolated by immunoscreening, one of which was homologous to the GRA1 gene of T gondii which is described elsewhere. GRA1 was the first dense granule 15 antigen of T. gondii cloned because it formed a major reactive component of the excretory/secretory fraction from T. gondii (Darcy et al. 1988, Parasite Immunology 10, 553-567; Cesbron-Delauw et al. 1989, Proceedings of the National Acadernv of Sciences of the United States of America 86, 7537-7541). This fraction contains antigens which induce a protective antibody response 20 and thus prompted the isolation and characterisation of many dense granule antigens from T. gondii to date. Homologues of four of the genes coding for these antigens have now been described for N. caninum: NCGRA1, NCGRA2, NCGRA6 and NCGRA7. GRA1 is released from bradyzoites of T. gondii and so is thought to be a 25 marker of chronic infection in toxoplasmosis. In N. caninum, a similar function may also apply to NcGral and NCP20 since the sera used for the isolation of these clones was derived from mice made resistant to an acute infection of NC-Liverpool by prior infection with NC-SweB1. The gene encoding NCP20 has not been previously described in any 30 organism. The NCP20 cDNA contained three potential initiation codons, all in the same reading frame. Expression in E. coli demonstrated that the third AUG gave rise to a gene product which induced an antibody that recognised the native protein, thereby confirming the reading frame. However, the context of the second AUG codon in the NCP20 mRNA at position 160 35 (5'TGCAAAATGG3') is very similar to the consensus sequence derived for the T. gondii translation initiation site (5'GNCAAAATGG3': Seeber 1997, WO 00/63244 PCT/AU00/00354 25 Parasitology Research 83, 309-311). This leads to the belief that in N. caninum, position 160 is the real start of translation initiation for NCP20. This conclusion is also supported by the observation that the ATG codon beginning at position 160 is also conserved in many of the T. gondii ESTs 5 analysed, whereas the codon beginning at 175 is not. NCP20 is a relatively small polypeptide (approximately 12 kDa) which was highly expressed in E. coli. Western blot analysis using N. caninum extracts demonstrated the size of the native tachyzoite antigen to be approximately 20 kDa. The discrepancy between the predicted and actual 10 sizes of the native NCP20 is presumed to result from some kind of post translational modification which occurs in the parasite. A homologue of NCP20 was detected in T. gondii by searching the GenBank database with the NCP20 sequence. Other parasite taxa, such as Neospora hughesi, Hammondia hevdorni and Hammondia hammondi are therefore also expected 15 to contain homologues of NCP20, because these taxa are very closely related to N. caninum. As the present inventors have shown that the NCP20 protein is suitable to raise high titres of protective antibodies in mice, it will be expected that the protein will act similarly in other animals upon immunisation. 20 The high prevalence of N. caninum in cattle along with its high rate of congenital transmission suggests the development of vaccines are warranted. Prior evidence suggests a role for low molecular weight antigens during the induction of cellular immunity in neosporosis. Antigens in the 15-30 kDa range induce proliferation of CD4 + cells thereby stimulating increased 25 production of gamma interferon which in turn suppresses the growth of N. caninum tachyzoites and encourages resistance against N. caninum. These low molecular weight antigens also appear more immunogenic in immune mice and outbred (QS strain) mice resistant to clinical disease. Thus low molecular weight antigens such as NCP20 may well have a role in inducing 30 cell mediated immunity against N. caninum. Recombinant NCP20, purified from E. coli, was evaluated in a variety of vaccine formulations for its ability to protect susceptible mice against an acute infection of N. caninum. Freund's complete adjuvant, with or without recombinant NCP20. was able to provide complete protection against weight 35 loss associated with the acute infection of N. caninum.

WO 00/63244 PCT/AU00/00354 26 In summary, a new gene of N. caninum have been isolated and characterised, called NCP20. Its isolation is significant because this is the first report of using sera, from animals shown to be resistant to an acute infection with N. caninum, for immunoscreening of cDNA expression 5 libraries. It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to 10 be considered in all respects as illustrative and not restrictive.

Claims (20)

1. An isolated polynucleotide molecule encoding a Neospora caninum antigen, the polynucleotide molecule comprising a DNA sequence as set out in Figure 1 (SEQ ID NO: 1), or a polynucleotide molecule which hybridises 5 under stringent conditions to the DNA sequence as set out in Figure 1 (SEQ ID NO: 1).

2. The isolated polynucleotide molecule according to claim 1 comprising the DNA sequence as set out in Figure 1 (SEQ ID NO: 1).

3. An isolated N. ccaninum polypeptide encoded by the isolated 10 polynucleotide molecule according to claim 1 or 2.

4. The isolated N. caninum polypeptide according to claim 3 comprising the amino acid sequence as shown in Figure 2 (SEQ ID NO: 2), functionally equivalent polypeptides, or immunogenic fragments thereof.

5. The isolated N. caminum polypeptide according to claim 4 comprising 15 the amino acid sequence as shown in Figure 2 (SEQ ID NO: 2).

6. A composition for use in raising an immune response in a mammal against neosporosis, the composition comprising a carrier and a polypeptide having an amino acid sequence as shown in Figure 2 (SEQ ID NO: 2), functionally equivalent polypeptides, or immunogenic fragments thereof. 20

7. The composition according to claim 6 wherein the polypeptide comprises the amino acid sequence as shown in Figure 2 (SEQ ID NO: 2).

8. The composition according to claim 6 or 7 further comprising an adjuvant.

9. The composition according to claim 8 wherein the adjuvant is selected 25 form the group consisting of Freund's complete adjuvant, Freund's incomplete adjuvant. glucosaminylmuramyl dipeptide, Quil A. DEAE Dextran/mineral oil, Alhydrogel, Auspharm adjuvant, and Algammulin.

10. A method of obtaining a protective effect against neosporosis in a mammal, the method comprising inoculating the mammal with a polypeptide 30 according to any one of claims 3 to 5.

11. A method of obtaining a protective effect against neosporosis in a mammal, the method comprising inoculating the mammal with a composition according to any one of claims 6 to 9.

12. Use of the polypeptide according to any one of claims 3 to 5 in 35 methods for detecting antibodies reactive or specific to N. caninum. WO 00/63244 PCT/AU00/00354 28

13. The use according to claim 12 comprising assaying for N. caninum antibodies in a serum or blood sample from a mammal that bind to the polypeptide and detection of antibodies being indicative of exposure to and/or infection of that animal with N. caninum. 5

14. An isolated antibody, or fragment thereof, reactive to the polypeptide according to any one of claims 3 to 5.

15. A vector comprising the polynucleotide molecule according to claim 1 or 2 for replication and/or expression of the polynucleotide molecule in a host prokaryotic or eukaryotic cell. 10

16. The vector according to claim 15 selected from the group consisting of plasmid, virus, and phage.

17. The vector according to claim 16 further comprising an origin of replication, a promoter for the expression of the polynucleotide and a regulator of the promoter. 15

18. A host cell transformed or transfected with the vector according to any one of claims 15 to 17.

19. An oligonucleotide probe or primer comprising a nucleotide sequence that hybridises selectively to the polynucleotide molecule according to claim 1 or 2.

20 20. The oligonucleotide probe or primer according to claim 19 comprising at least 15 nucleotides, preferably at least 18 nucleotides, and more preferably at least 25 nucleotides.