EP1071958A1 - Procede de criblage de l'interaction substrat-ligands - Google Patents

Procede de criblage de l'interaction substrat-ligands

Info

Publication number
EP1071958A1
EP1071958A1 EP00913507A EP00913507A EP1071958A1 EP 1071958 A1 EP1071958 A1 EP 1071958A1 EP 00913507 A EP00913507 A EP 00913507A EP 00913507 A EP00913507 A EP 00913507A EP 1071958 A1 EP1071958 A1 EP 1071958A1
Authority
EP
European Patent Office
Prior art keywords
beads
library
ligand
polypeptide
polypeptides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00913507A
Other languages
German (de)
English (en)
Inventor
Carl Alexander Kamb
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Deltagen Proteomics Inc
Original Assignee
Arcaris Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arcaris Inc filed Critical Arcaris Inc
Publication of EP1071958A1 publication Critical patent/EP1071958A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C40COMBINATORIAL TECHNOLOGY
    • C40BCOMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00Methods of screening libraries
    • C40B30/04Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/04General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length on carriers
    • C07K1/047Simultaneous synthesis of different peptide species; Peptide libraries
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6803General methods of protein analysis not limited to specific proteins or families of proteins
    • G01N33/6845Methods of identifying protein-protein interactions in protein mixtures

Definitions

  • the technique is not well suited to screening applications such as generating protein interaction maps. Nor is the technique amenable to high throughput applications. Moreover, the technique does not provide quantitative information.
  • researchers have utilized limited-throughput screening techniques to evaluate the binding of ligands to a particular substrate. For example, a selected proteinaceous substrate, or small number of such substrates, have been immobilized by a variety of means for exposure to a select pool of ligands.
  • assays exist that immobilize known antigens or antibodies on beads or other such solid supports.
  • Roque Qi & ⁇ ., Acta Histochem. 98(4):441-451 Nov. 1996.
  • Two or three-dimensional matrices tagged with nucleic acids have been utilized to screen for DNA-binding moieties.
  • Other researchers have utilized "lawn assays" that detect protein interactions utilizing diffusion of a ligand through a colloidal matrix.
  • none of these techniques addresses the "n x n" problem, and thus none provides rapid, quantitative and/or large-scale evaluation of substrate-ligand interaction, or more specifically, protein-protein interactions.
  • the present invention provides methods for detecting substrate-ligand interactions, more particularly polypeptide-ligand interactions or polypeptide-polypeptide interactions.
  • the polypeptides may be individual polypeptides, or may alternatively be library polypeptides, including those of large or very large libraries and/or of native, endogenous polypeptides.
  • the methods utilize randomizable ligand-bearing supports bearing unique tags, and may optionally use location-determinable supports.
  • a magnetic support may be used to adhere to either the substrate or the ligand, and magnetic culling of bead aggregates that result from substrate-ligand complexes provides for an enrichment step.
  • Interacting pairs are identified by correlating (i) location information and (ii) identity information provided by each unique tag.
  • the location information may be derived from correlating back to a unique location, or alternatively by evaluating the origination of location-determinable supports.
  • the unique tags may use a variety of techniques, including fluorescent bar codes, to encode ligand identity information. By such methods, protein interaction maps for, e.g., the human organism, may be generated.
  • the invention further provides methods for identifying and quantifying such interactions.
  • the interacting substrate-ligand pairs may be detected with antibodies, for example fluorescent antibodies, and the interactions quantified via a FACS machine or CCD camera.
  • FIGURE 1 is a map of plasmid vector pSE420/trx/GFP.
  • FIGURE 2 is a map of plasmid vector pSE420/biotrx/GFP/BirA.
  • FIGURE 3 is a map of plasmid vector pSE420/Caltrx GFP.
  • FIGURE 4 is a map of plasmid vector pSE420/DHFR/GFP.
  • FIGURE 5 is a map of plasmid vector pLex biotrx GFP LbirA.
  • FIGURE 6 depicts a bead that has been derivatized for crosslinking with a methotrexate as an adhesion moiety and SANPAH as a photoactivatable crosslinker.
  • FIGURE 7 is a FACS histogram demonstrating the crosslinking of interacting proteins.
  • Peak A is streptavidin coated particles reacted with BL21 lysate and FITC- calmodulin conjugate.
  • Peak B is streptavidin coated particles reacted with a lysate having a biotin-thioredoxin-CBP fusion protein, which is then exposed to the FITC-calmodulin conjugate in the presence of calcium chelator EGTA.
  • Peak C is streptavidin coated particles reacted with a lysate having a biotin-thioredoxin-CBP fusion protein, which is then exposed to a FITC-calmodulin conjugate.
  • Peak D is streptavidin coated particles reacted with a lysate having a biotin-thioredoxin-CBP fusion protein, FITC-calmodulin conjugate and a protein crosslinking agent.
  • Peak E is streptavidin coated particles reacted with a lysate having a biotin-thioredoxin-CBP fusion protein, FITC-calmodulin conjugate, protein crosslinking agent and then EGTA.
  • FIGURE 8 depicts the enrichment of biotin-coated fluorescent beads from a mixture of fluorescent beads coated only with Bovine Serum Albumin (BSA), using streptavidin- coated magnetic beads.
  • BSA Bovine Serum Albumin
  • FIGURE 9 depicts the enrichment of beads coated with an SV40 large T antigen conjugate from a mixture of fluorescent beads coated only with BSA, using magnetic beads coated with an anti-SV40 large T antigen antibody conjugate. The antigen and antibody interact, and subsequently the aggregates are segregated from the BSA-coated beads with a magnet.
  • the methodologies of this invention provide rapid, efficient, quantitative substrate- ligand interaction screens.
  • the invention differs from prior approaches in that it does not rely on yeast-two hybrid technology or other such in vivo techniques, but instead provides a high throughput in vitro screening methodology. While the inventive methods do provide rapid, quantitative screening of individual polypeptides or other substrates against a selected ligand pool, the techniques provide for scale-up for screening small (on the order of 1 x 10 2 ) substrate populations, and advantageously may be used to screen large (on the order of 10 3 or 10 4 ) or even very large (10 5 , 10 6 or even 10 7 ) populations.
  • the invention provides its quantitative, high throughput polypeptide/ligand screening capabilities by cross-indexing (i) polypeptide (or other substrate) identity information derived from the characteristic, unique location from which one particular polypeptide (or other substrate) is derived, and (ii) ligand identity information derived from its associated randomizable support, which bears a unique tag that correlates to the identity of that ligand.
  • the polypeptide may be an individual polypeptide, or alternatively may be a member of a polypeptide library of various sizes.
  • Non-polypeptide substrates may include, e.g., small organic or inorganic molecules, of either endogenous or synthetic origin.
  • a unique polypeptide or other such substrate may be adhered to a location-determinable support, which correlates to the unique location from which a particular library polypeptide is derived, prior to exposure to the ligands.
  • the unique polypeptide or substrate remains in a lysate or other such solution, to which the randomizable ligand-bearing supports are added.
  • the supports described herein may be microbeads, or may be a fixed solid support.
  • the unique tag that identifies a particular ligand may be, for example, a fluorescent "bar code" or oligonucleotide tag.
  • the invention encompasses a number of potential substrates, including (i) non-nucleic acid, proteinaceous substrates such as individual polypeptides and library polypeptides, (ii) other non-nucleic acid substrates such as exogenous natural products, exogenous small organic molecules or endogenous non-proteinaceous products, (iii) nucleic acid substrates, and (iv) inorganic substrates.
  • the term "individual polypeptide” refers to an amino acid sequence, for example-a protein or protein domain, and also includes further derivatized amino acid sequences, such as, e.g., glycoproteins. The sequence may be that of a native molecule (i.e., endogenous to a given cell), or alternatively may be synthetic.
  • Library polypeptides encompass the same sorts of amino acid sequences, but are encoded by DNA sequences that are generated and screened en masse, and may be previously unknown or uncharacterized molecules.
  • the libraries may vary in size, and include large or very large libraries.
  • the library polypeptides may include all or substantially all native protein domains encoded by the human genome, or expressed in the human organism.
  • ligands are molecules that are screened to identify those members that interact with the polypeptides or other substrates.
  • Ligands may be proteinaceous moieties such as, e.g., polypeptides or glycoproteins from a variety of sources, or may be other organic or inorganic molecules.
  • the ligands may be endogenous molecules such as hormones, antibodies, receptors, peptides, enzymes, growth factors or cellular adhesion molecules, or may be derivatized or wholly synthetic molecules. Because of the flexibility of the invention, the identity of the ligands need not be known or pre-selected in advance, and may also be large or very large populations.
  • the present invention lends itself to automated high-throughput embodiments, in which microbeads serve as the location-determinable and/or randomizable supports.
  • microbeads may be readily dispersed by robotic means to, e.g., 384-well microtiter plates.
  • the polypeptides or other such substrates interact with ligands to form interacting pairs, termed “complexes" herein.
  • complexes When each member of the interacting pair are immobilized on supports, then the two supports are linked via the substrate/ligand complex to form an "aggregate.”
  • the aggregates and/or complexes are then sorted and identified.
  • Means for accomplishing this include a CCD camera or a fluorescence-activated cell sorter (FACS).
  • the speed and selectivity of this inventive methodology may be further enhanced by utilizing magnetic attraction to facilitate a solid-state interaction between the polypeptide or other substrate that is bound to a location-determinable support, and the ligand that is bound to the randomizable support.
  • This may be accomplished by utilizing a magnetic material for the support, and then collecting the complexes or aggregates by culling the magnetic supports with a magnetic force, for example by applying a magnetic field to the exterior of the arrays or by inserting a magnetized body such as a pin into each well of the array.
  • the invention allows for high throughput cross-screening of large or very large populations — e.g., the entire endogenous protein library of a human organism.
  • the methodologies of this invention are particularly well-suited for large-scale screening of some 1 x 10 6 proteins, which is the estimated number of proteins produced in a human being.
  • inventive methods and materials answer a long-felt need in the industry for evaluating the interactions of endogenous proteins within a human organism, to form a comprehensive human "protein interaction map.”
  • inventive methodology may be used to screen the selected library polypeptides against other ligand libraries — for example, endogenous ligand libraries such as a second polypeptide library, endogenous hormones, antibodies, receptors, peptides, enzymes, growth factors or cellular adhesion molecules, or on the other hand exogenous ligands derivatized or wholly synthetic molecules, natural products, synthetic peptides, or synthetic organic or inorganic molecules.
  • endogenous ligand libraries such as a second polypeptide library, endogenous hormones, antibodies, receptors, peptides, enzymes, growth factors or cellular adhesion molecules, or on the other hand exogenous ligands derivatized or wholly synthetic molecules, natural products, synthetic peptides, or synthetic organic or inorganic molecules.
  • a substrate pool of interest is selected - for example, a library of all or substantially all native polypeptides expressed by the human organism, or a selection of individual polypeptides of interest.
  • a corresponding set of library polypeptides or individual polypeptides are generated in cells.
  • Single colonies, each of which is expressing one particular polypeptide of interest, are selected and replated in order to generate single-cell clones (i.e., multiple copies of one particular cell, each cell expressing the same individual polypeptide or unique member of the polypeptide library).
  • each such clone is uniquely located at one particular location of an array — e.g., each particular well of a given 384 well plate contains a one particular clone.
  • the expression products of each of those clones are then harvested from the cells, for example by generating soluble lysates that correspond to each of the plated clones.
  • each well corresponds to the soluble lysate of one particular clone, which in turn corresponds to one individual polypeptide or one unique member of a polypeptide library.
  • each member of a non-proteinaceous substrate pool of interest is individually arrayed at a unique location.
  • each lysate is then either (i) kept segregated in a unique location (e.g., one particular well of a 384 well array); or (ii) exposed to a solid support that is unique to that lysate source, and whose location may be tracked in order to identify the corresponding lysate source to which it was exposed.
  • a unique location e.g., one particular well of a 384 well array
  • location-determinable support Such a solid support is termed herein, a "location-determinable support.”
  • This location- determinable support may be any solid support that is suitable for adhering a desired polypeptide from a polypeptide-containing lysate, and which can be correlated back to a particular polypeptide source — e.g., a particular microtiter well in a particular array.
  • Exemplary location-determinable supports include (i) beads that are kept segregated in microtiter wells that are derived from, and thus correspond to, the original lysate-bearing array location; and (ii) a fixed solid support such as a pin or other such probe that is suitable for dipping into one unique location in a lysate-bearing microtiter well.
  • the same strategy may be applied to non-proteinaceous substrates.
  • the ligands to be screened may advantageously may be immobilized on a solid support, although in order to screen a large variety of ligands for interaction with any particular substrate, such solid supports should be "randomizable" — i.e., in terms of this invention, (i) each such support can be dispersed into a mixture of such supports in a manner that allows for full mixing and resultant random distribution of support constructs in any subsequent aliquot of the mixture, and (ii) each such randomizable support bears with it a corresponding unique identification tag that identifies the associated ligand.
  • randomizable supports to create a fully integrated set of ligand-bearing supports increases the statistical likelihood that an aliquot taken from the fully integrated ligand set will contain a fully dispersed, representative subset of ligands.
  • randomizable supports include microparticles (e.g., small beads) in a variety of materials and sizes.
  • the unique tags may be, for example, fluorescent, oligonucleotide sequence tags, mass tags, radio tags, or any combination thereof.
  • a polypeptide library may be screened against itself to generate a "protein interaction map" ⁇ i.e., an "n x n" matrix of interactions for all or substantially all native polypeptides of a human or other selected organism.
  • native polypeptides polypeptides that are endogenous to a selected organism — i.e., that are encoded by the organism's genome and which may be expressed by that organism.
  • Native polypeptides include functional subunits or "protein domains" of endogenous proteins.
  • the polypeptides of interest serve as both substrate and ligand - i.e., each randomizable support is adhered to multiple copies of one member of the polypeptide library, and each unique array location contains- multiple copies of one member of the polypeptide library.
  • each randomizable support bears its corresponding unique library polypeptide
  • the supports are pooled into one volume and mixed to form a fully integrated ligand collection — i.e., the pooled volume represents all ligand species.
  • ligand aliquots are drawn from this fully integrated ligand collection. Each aliquot contains a randomized, representative sampling of the ligands that is statistically likely to contain at least one copy of each species of ligand present in the pooled ligand volume.
  • ligand aliquots then are presented for interaction with each of the library polypeptides, either by simply adding an aliquot of integrated ligand-bearing supports to each uniquely located library polypeptide lysate within the library array, or by first adhering the library polypeptides in the array to location-determinable supports and then exposing each such set of polypeptide-bearing supports (which bear only one type of polypeptide) to an integrated aliquot of randomizable supports.
  • a first set of library polypeptides may be screened against a second, independent polypeptide library, composed of, e.g., a separate set of native protein domains, a set of synthetic polypeptides containing, e.g., point mutations, or randomly generated synthetic polypeptide sequences.
  • a second, independent expression library is used to generate a second, independent array containing the second, independent polypeptide library.
  • a first set of polypeptides may be screened against some other ligand set — e.g., small organic molecules, natural products, hormones, receptors, antibodies, peptides, enzymes, growth factors, cellular adhesion molecules, combinatorial library components and the like ⁇ that is adhered to the randomizable support and presented to the library polypeptides.
  • some other ligand set e.g., small organic molecules, natural products, hormones, receptors, antibodies, peptides, enzymes, growth factors, cellular adhesion molecules, combinatorial library components and the like ⁇ that is adhered to the randomizable support and presented to the library polypeptides.
  • a prior cellular expression step to produce the ligands will not be necessary.
  • the methodology is completed by exposing each uniquely located substrate (either in solution or adhered to its analogous location-determinable support) to an aliquot of ligand-bearing supports.
  • any interactions will result in formation of a substrate-ligand complex - e.g., a randomizable support with consecutive layers of adhered ligand and polypeptide.
  • a substrate-ligand complex e.g., a randomizable support with consecutive layers of adhered ligand and polypeptide.
  • the substrate is first immobilized on its own support, then any substrate-ligand interaction will adhere the two supports into an aggregate.
  • aggregates may be detected and characterized in that form.
  • the aggregates may be re- suspended in a corresponding unique library polypeptide solution to displace the support- linked polypeptide with an unbound form of that polypeptide, or removed by some other procedure.
  • Interactions between substrates and ligands are then detected by fluorescent or other means, for example by use of a fluorescently tagged antibody. Interacting pairs are then culled out in a sorting or detection process, for example via FACS, so that the components of the various complexes may be identified.
  • the identity of the substrate is determined by correlating it to the unique array location from which it was derived (either directly, or via the analogous location-determinable support). If the substrate is proteinaceous, then the DNA encoding the polypeptide produced by the original single-cell clone at that unique location of the library array may then be sequenced or otherwise characterized.
  • the identity of the ligand is determined by evaluating the associated unique identification tag on the randomizable support to which that ligand is bound.
  • the unique identification tag can be further correlated back to a single clone in its corresponding array location.
  • the screening methods of the present invention can be adapted in a number of ways apparent to those of skill in the art to displacement screening.
  • the substrate-ligand pairs are first formed, and are adhered to a solid support. Subsequently, these pairs are exposed to a secondary ligand. If the secondary ligand is capable of adhering to the substrate, then in many cases it will displace the first ligand.
  • the substrate-secondary ligand pair can then be manipulate, enriched and analyzed according to the method of the invention.
  • the secondary ligand may be a proteinaceous moiety such as, e.g., a polypeptide or glycoprotein from a variety of sources, or may be some other organic or inorganic molecule.
  • the secondary ligand also may be an endogenous molecule such as a hormone, antibody, receptor, peptide, enzyme, growth factor or cellular adhesion molecule, or may be a derivatized or wholly synthetic molecule.
  • the secondary ligand is a small organic molecule.
  • an expression library may be generated first. The overall goal of this step is to generate a selection of desired individual polypeptides or library polypeptides that are suitable as either substrate or ligand (or both), for rapid, efficient ligand interaction screening. Once a desired pool of polypeptides is identified, DNA encoding each member polypeptide is incorporated into a corresponding expression construct that produces the desired levels of protein expression.
  • the DNA encoding each member polypeptide is fused in frame with DNA encoding a suitable adhesion partner to form a polypeptide/adhesion moiety fusion construct, described elsewhere herein.
  • the construct may also utilize a downstream marker that provides rapid indication of whether the fusion construct is in fact expressed in frame, and with no premature terminations, and/or in a stable, suitably folded conformation.
  • an expression library is created by standard techniques, generating a sufficient number of fragments of DNA so as to ensure that all protein domains are likely to be expressed in the library.
  • Genomic DNA, cDNA synthetic or cloned DNA sequences may be used.
  • synthesis of cDNA and cloning are accomplished by preparing double-stranded DNA from random primed mRNA isolated from, e.g., human placental tissue. Alternatively, randomly sheared genomic DNA fragments may be utilized.
  • the fragments are treated with enzymes to repair the ends and are ligated into an expression vector suitable for expression in, e.g., E. coli cells.
  • exemplary vectors include inducible systems, e.g., the trc promoter system, which is induced by addition of suitable amounts of IPTG.
  • the library polypeptide-encoding vectors may be introduced into E. coli and clones are selected.
  • the qualify of the selected library optionally may be examined. For example, a set of 100 clones can be picked and sequenced at random, looking for homologies to known genes, evidence of splicing, and such features.
  • the library representation can be explored by filter hybridization using probes of sequences of known abundance such as actin and tubulin. These sequences should be present at a frequency in the library of between 0.01% and 1.0%.
  • DNA encoding a suitable adhesion moiety may be incorporated in frame with the polypeptide encoding DNA sequences.
  • This DNA fusion construct is then placed under control of a selected promoter in an expression vector construct, so that upon induction one obtains suitably high levels of expression of the fusion construct.
  • adhesion moieties known to the art, including without limitation biotin/avidin, thioredoxin/PAO, calmodulin binding peptide/calmodulin, dihydrofolate reductase/methotrexate, maltose-binding protein/amylose, chitin-binding domain/chitin, cellulose-binding domain/cellulose, glutathione-S-transferase/glutathione, or antibody/antibody epitopes such as the FLAG epitope.
  • adhesion moiety that binds either reversibly or irreversibly to its complementary moiety.
  • KD relative spontaneous dissociation constants
  • the biotin/avidin link has a KD of approximately 10 "15 M and is therefore relatively stable and irreversible.
  • Maltose binding protein/amylase on the other hand, is less stable, with a KD of 10 " ° M.
  • One option to increase stability is to use cross-linking, for example by selecting a fusion protein with an adhesion moiety that can be cross-linked by UV light.
  • the expression vector is chosen based largely on its ability to generate moderate to high expression levels of either a given polypeptide or a fused polypeptide/adhesion moiety (termed herein, a "fusion construct"), in a host cell of interest.
  • E. coli is one such host cell, although those of skill will appreciate that other bacterial, yeast or mammalian host cells, for example 293 cells, are also suitable for use in the present invention.
  • many suitable expression vectors are known to those in the art.
  • the expression vector may employ the P , PR, P ⁇ ac, P tac , P trc, Pn- x or T7 promoters, to name only a few such promoters known to those in the art.
  • promoters are regulated such that high level expression is induced via increased growth temperature (from PL or PR through a mutant temperature-sensitive form of the lambda repressor, cI857) or by addition of a suitable inducing agent (e.g., IPTG for P ⁇ ac or P tac ) to the media.
  • a suitable inducing agent e.g., IPTG for P ⁇ ac or P tac
  • the expression vector may optionally be constructed to produce a fusion protein that consists o an N- or C- terminal recognition domain (for example, an epitope that is specifically recognized by an antibody), followed in frame by a sequence encoding the desired library polypeptide which is optionally flanked by sites to facilitate cloning, followed by an N- or C-terminal adhesion domain to enable attachment to a solid support, depending on the strategy employed.
  • a fusion protein that consists o an N- or C- terminal recognition domain (for example, an epitope that is specifically recognized by an antibody)
  • a sequence encoding the desired library polypeptide which is optionally flanked by sites to facilitate cloning, followed by an N- or C-terminal adhesion domain to enable attachment to a solid support, depending on the strategy employed.
  • the expression vector may include a suitable downstream marker such as a reporter or antibiotic resistance gene, by which one may determine whether the expression vector construct is intact and correctly in frame.
  • a suitable downstream marker such as a reporter or antibiotic resistance gene
  • This variant includes in the above-described DNA fusion construct an additional marker sequence designed to sort out viable constructs from, e.g., out of frame or inverted constructs.
  • Suitable reporter sequences include green fluorescent protein, which is one of a family of naturally occurring fluorescent proteins whose fluorescence is primarily in the green region of the spectrum, or modified or mutant forms having altered spectral properties (e.g., Cormack, B.P., Valdivia R.H. and Falkow, S., Gene 173: 33-38 (1996)).
  • GFP GFP reporter
  • this GFP reporter may be inserted into the expression construct in place of the adhesion domain if only the integrity of the library polypeptide-encoding portion of the construct is of interest.
  • Non- fluorescent markers of construct integrity may also be employed, including a variety of antibiotic resistance genes that are familiar to the art.
  • Fluorescent reporters such as GFP allow for subsequent rapid sorting of expression products using flow cytometry with a fluorescence-activated cell sorter (FACS) machine.
  • FACS fluorescence-activated cell sorter
  • This FACS sorting detects expression constructs that properly read through the GFP reporter sequence and which are expressed at desirably high levels.
  • Cells that express intact, in-frame constructs are readily separated by detecting and collecting "bright" cells, which have an intact GFP moiety that is properly in-frame with the polypeptide of interest, correctly folded, and located downstream from a functional promoter. Constructs that are not intact will be dim.
  • constructs with mutations or frame-shift deletions will eradicate the proper relationship of the GFP moiety to the promoter, and the cells bearing such constructs will be dim.
  • Collecting only bright cells in this enrichment step significantly reduces the number of underexpressed or nonfunctional fusion polypeptides that proceed into subsequent screening steps. If antibiotic resistance is used as a marker, then transformed cells are plated on antibiotic-bearing media; only those cells that read through completion of a construct that includes an intact, downstream antibiotic resistance gene will survive and grow.
  • the polypeptide or fusion construct inserts can be recovered. If the polypeptide library/adhesion moiety DNA fusion construct was screened, the GFP reporter sequence may optionally be deleted from the vector using standard restriction endonuclease fragment excision and religation, or other such techniques. If only the library polypeptide-encoding constructs were screened but fusion to an adhesion moiety is desired, then the polypeptide-encoding fragments are transferred into a vector containing the adhesion-domain, or alternatively, the adhesion-domain-encoding sequence can be inserted into the vector, or swapped into the vector in exchange for the GFP reporter sequence. Other markers such as antibiotic resistance genes may similarly be removed, if desired.
  • each substrate must be individually arrayed at a unique location.
  • each corresponding clone is arrayed separately, in a unique location, so that in subsequent steps, the identity of any particular polypeptide may be determined by cross-referencing back to its unique location in the original array.
  • Non-proteinaceous substrates may be arrayed directly, without a preceding expression step.
  • a single-cell clone is obtained as follows. Once the above-described DNA fusion constructs are assembled, selected host cells are transfected or transformed by standard gene transfer techniques such as electroporation. The transformed cells are selected by growth of colonies on selective media familiar to those of skill in the art (e.g., standard ampicillin-enriched Luria Broth). Single colonies are then picked and placed into growth media in, e.g., 384-well microtiter trays. A robot may be used for this purpose. If desired, duplicate trays may be prepared bearing host cells of identical clones in identical array locations on a separate set of microtiter trays.
  • each single-cell clone may be grown in an intermediate location of larger size or volume, so that a greater number of cells may be generated and concentrated for lysis.
  • each concentrated volume of polypeptide is then either lysed and the lysate transferred to its corresponding, unique array location, or the concentrate is transferred to that array location and then lysed in situ.
  • Each clonal lysate then is kept separate from every other, and in a unique location that can be referenced throughout the ligand screening process.
  • each soluble lysate can be correlated back to its unique library array location, and the identity of the library polypeptide ascertained thereby, as the soluble lysates are used in later ligand interaction screening steps.
  • the host cells In order to obtain the uniquely arrayed soluble lysates, the host cells first are grown until mid- or late-log phase. Expression of the DNA fusion constructs (library polypeptide and adhesion moiety) is induced by whatever method is required by the selected promoter (e.g., IPTG or by raising the growth temperature to 42° C). After one to five hours of continued cell growth under inducing conditions, the cells are lysed to free the library polypeptide/adhesion moiety fusion constructs.
  • the host cells may be treated with lysozyme to remove the cell wall, followed by hypotonic shock to disrupt the cell membranes and release the contents of the cell into the buffer.
  • the cells alternatively may be sonicated, lysed with a freeze/thaw protocol, or lysed by addition of detergent.
  • the lysate may optionally be concentrated by standard techniques prior to further process steps.
  • the library polypeptide or its corresponding fusion construct may be secreted by the cells, in which case the growth media rather than the cells are further processed.
  • the screening may seek to identify interacting pairs of endogenous polypeptides, in which case duplicate sets of soluble lysate arrays may be generated from the same set of library polypeptides.
  • a variety of other ligands may be tested for interaction with the original library polypeptides or other substrates of interest.
  • These other ligands may be proteinaceous in nature, in which case the above procedure may be modified slightly so that a set of host cells expressing the proteinaceous ligands is generated, and the corresponding array obtained.
  • exogenous ligands may be screened for interaction with the polypeptides of interest.
  • Ligands such as small molecules, natural products, hormones, receptors, antibodies, peptides, enzymes, growth factors, cellular adhesion molecules, combinatorial library components and the like may be exposed directly to an appropriate randomizable support (e.g., a support that will adsorb sufficient amounts of the ligand).
  • the ligands may require initial derivitization so as to be chemically reactive with surface functional groups on the support, in which case the ligands are, e.g., covalently linked to the support.
  • the ligands may be synthesized on the support.
  • this screening methodology can be altered slightly to serve as a displacement assay, wherein a secondary ligand such as a small molecule is exposed to the primary ligand/ substrate pair.
  • the secondary ligand may advantageously be adhered to a randomizable support with a unique tag (for embodiments in which a large or very large number of such secvondary ligands are screened).
  • a unique tag for embodiments in which a large or very large number of such secvondary ligands are screened.
  • such secondary ligands can be free in solution. In either event, pairs in which the secondary ligand displaces the primary ligand can be detected, collected and analyzed as described elsewhere herein.
  • the method In order to screen a variety of ligands for interaction with a given polypeptide, the method generally requires using a support or substrate that will serve three functions; (a) it will adhere to the ligand of interest; (b) it will be fully randomizable, so that an aliquot containing a representative sampling of ligands may be presented to each polypeptide of interest, and (c) it will carry a unique identification tag that corresponds to the particular ligand adhered to its surface, and distinguishes it from other ligand-bearing supports.
  • the randomizable support is a bead or other such microparticle. A variety of bead sizes and compositions are suitable for use in the present invention.
  • bead size may range from 50 nm to 50 microns in diameter.
  • the beads may be composed of polystyrene, glass (silica), latex, agarose, magnetic resin, or a variety of other matrices. Some beads may be obtained from commercial sources with adhesion moieties already attached; for example, numerous avidin-conjugated beads are available. Other beads can be obtained with functional groups such as hydroxyl or amino groups suitable for chemical modifications, such as attachment of adhesion moieties that will interact with the fusion protein. In yet another formulation, the beads do not require specific functional groups; rather, the interaction between the fusion protein and the bead is of a nonspecific type involving, e.g., hydrophobic interactions.
  • Beads suitable for this purpose may be polystyrene, latex, or some other plastic. If the beads require functionalization in order to bind to the selected polypeptide or ligand, then enough beads are generated in one reaction to permit numerous experiments to be performed, e.g., 10 14 beads. These beads are then stored under conditions that ensure the stability of the chemical modifications, such as low temperature. For example, in mapping protein interactions in a human cell, approximately 1 x 10 7 beads are generated for each potential expression product to be screened (e.g., in the case of the human cell, approximately 1 x 10 6 potential endogenous polypeptides, resulting in a need for some 1 x 10 13 beads).
  • each support with an identification tag that correlates to the ligand that the support will bear.
  • the beads may be tagged with DNA tags in which the tags can be amplified and fingerprinted, or detected by hybridization.
  • the beads may be tagged with fluorescent tags such as fluorescent barcodes, radio frequency tags, or mass tags detected by mass spectrometry Fluorescent barcodes Fluorescent tags for the randomizable supports are advantageous because the identification tag may be read simultaneously with quantification of the binding interaction.
  • Fluorescent barcodes may be generated as follows. Fluorescence detectors presently exist that can quantify fluorescence at up to nine separate wavelengths using multiple lasers, photo-multiplier tubes (PMTs) and filter sets. One example of such a device is the Cytomation flow cytometer that is not only capable of measuring fluorescence at multiple wavelengths in single cells or beads, but also of sorting cells and beads based on these signals.
  • PMTs photo-multiplier tubes
  • the measurements are also highly accurate, so that it is possible to distinguish easily a fluorescence value of 0 (background) from, lx, 2x, 3x, and 4x.
  • a fluorescence value 0 (background)
  • the unique signature of a particular bead is based on a fluorescence number composed of, e.g., nine digits (i.e., the nine separate wavelengths), each digit able to assume 5 values (i.e., 0 through 4x). Combining these two variables yields a set of potential unique barcodes of 5 9 , or approximately 2 million different barcodes.
  • a set of, e.g., 1 x 10 13 beads is broken into one million groups of 1 x 10 7 each. Each group of beads is placed in one well of a 384-well tray, requiring a total of about 2,600 trays. As one of skill will appreciate, this process may preferably be automated via known methods, using commercially available robotics. To the beads are added various quantities and types of fluorochrome dye such that the barcode requirements are fulfilled — i.e., that each type of bead has a unique barcode that will identify the associated ligand and distinguish it from all other ligands.
  • the fluorochromes may readily be incorporated by dissolution in organic solvent followed by exposure to the beads for sufficient time to allow full diffusion and interaction with the beads. The organic solvent is then removed and the beads dried.
  • various types of covalent chemical attachments to the beads may be employed, or the fluorescent dye may be incorporated into the bead by other methods known to the art, for example by synthesizing the beads from dye containing materials, or by encapsulating the fluorescent dye within the bead. Generation of a randomized ligand library for screening
  • the desired ligands (or secondary ligands) may be adhered to the beads, to form a series of uniquely tagged ligand sets.
  • the adhesion moiety may be, e.g., biotin/avidin, thioredoxin/phenyl arsine oxide, maltose binding protein amylose, calmodulin/calmodulin binding peptide, dihydrofolate reductase/methotrexate, chitin/chitin binding protein, cellulose/cellulose binding protein or antibody/antibody epitopes such as the FLAG epitope, as described elsewhere herein.
  • one binding moiety is expressed as part of a fusion construct in frame with the proteinaceous ligand, and the other is immobilized on the support by a covalent or noncovalent chemical linkage.
  • the compounds may be attached via a chemical linker, e.g., a hydroxyl or primary amine, or may be synthesized directly on the bead. If the ligand to be adhered is proteinaceous, then a subset of uniquely tagged, derivatized beads is exposed to a corresponding expression product lysate, which is collected in a particular location in, e.g., a 384 well array.
  • the subset of identically tagged beads is suspended in solution and added to each well by either a pipetting device or by means of a magnetic dispenser (in the event that the beads are magnetic).
  • the beads are mixed with the lysate in the well for a sufficient time to permit binding.
  • This step thus generates subsets of uniquely identified ligands on randomizable supports. It is most preferable to adhere each member ligand to its corresponding set of location-determinable supports in a substantially irreversible manner.
  • Such substantially irreversibly linked beads are ready for the next step in the process — exposure of the substrates to ligands that are firmly bound to their randomizable supports.
  • an additional step may be employed.
  • the ligands are eluted from the first set of supports (which may, in this instance, be unlabelled, as the various subsets of ligands at this juncture remain segregated) by addition of a large excess of soluble (i.e., unbound) ligand.
  • polypeptide/adhesion moiety fusion constructs In the case of polypeptide/adhesion moiety fusion constructs, one adds an excess soluble adhesion moiety so as to competitively interfere with the interaction between the bead and the adhesion domain of the fusion construct, thus displacing the fusion construct from the bead.
  • the soluble fusion construct then is re-attached via an irreversible linkage to another set of beads that are added to the solution in a location-determinable manner.
  • This interaction may involve, e.g., binding avidin-coated beads by biotinylated fusion protein, or it may involve nonspecific, hydrophobic adsorption of the soluble protein onto the bead surface.
  • the ligand subsets are collected by either a pipetting device or by the magnetic instrument and mixed into one integrated pool such that, e.g., all 1 x 10 13 ligand-labeled beads are present. This step thus disperses all the tagged ligands into a fully randomized pool that represents all of, e.g., the one million protein-bead types, each type represented 10 7 times.
  • Each bead in the aliquot bears a ligand and a corresponding unique tag to identify that ligand.
  • An aliquot of, e.g., 10 7 beads is then drawn from this integrated pool of ligand-bearing beads.
  • Each aliquot contains a statistically representative portion of the fully integrated ligand pool ⁇ i.e., a subset of beads representing a substantially full spectrum of available ligands (the degree of complete representation in any selected aliquot is determined by statistical sampling issues familiar to those in the art).
  • Each location in the substrate array receives one aliquot of integrated ligand beads. Thus each arrayed substrate has the opportunity to interact with every ligand. Preparation of a location-determinable support and exposure to substrates
  • the substrates are adhered to a location-determinable support prior to exposure to the aliquots of integrated ligand-bearing supports.
  • the two major characteristics of the location-determinable support are that (i) it is capable of adhering to the selected library polypeptide or other such substrate, and (ii) it is kept segregated so that it links the adhered substrate to the original clone array position (i.e., well) from which that substrate was derived.
  • This support can be a fixed type of support, for example a finger, pin or other such probe that is rigidly arrayed so as to match the clone array (e.g., a 384 pin hand).
  • the support can be a bead or other such microparticle, which is kept segregated in an array that directly correlates back to the original location in the substrate array (e.g., a set of beads that is kept segregated in one well of a 384 well tray, corresponding to the well of the 384 well tray from which, e.g., the original clonal polypeptide was derived).
  • Microparticles may be preferable for selections that involve large numbers of substrate-ligand interactions, or that involve relatively specific or slow-forming interactions.
  • Fixed supports offer advantages for reduced handling and/or automation. As described above, it is most preferable that the substrate be linked in a substantially irreversible manner to the location-determinable support.
  • the substrates are eluted from the first set of supports by addition of a large excess of soluble (i.e., unbound) substrate.
  • the substrate is then re-adhered to a second set of location-determinable supports in a substantially irreversible manner, as described above. Exposure of each substrate to the integrated ligand library Generally, this step requires that each uniquely located substrate (either in solution or adhered to its analogous location-determinable support) is exposed to an aliquot of integrated ligand-bearing supports.
  • these ligands will be in an appropriate buffer that mimics conditions inside the cell (i.e., reducing environment, neutral pH, 150 mM salt), and can be added directly to each array location containing a corresponding soluble or bound substrate.
  • the lysate buffer may be of the same makeup.
  • the binding buffer also may have other additives, e.g., those designed to minimize non-specific binding (e.g., detergent, bovine serum albumin). If a fixed type of location-determinable support (e.g. a pin or finger) is used, it may simply be dipped into a well containing an aliquot of the randomized ligand-bearing supports.
  • the location-determinable support is a bead or other such microparticle
  • a set of such beads containing one particular substrate may be added to a well that contains a randomized aliquot of the ligand-bearing beads, and the two sets of beads mixed thoroughly so as to maximize substrate-ligand exposure. Interaction between the substrate and any of the many different ligands thus results in the corresponding ligand-bearing bead (with its unique identification tag) adhering to the substrate, thereby forming a bead-bead aggregate.
  • soluble substrates are added to each array location that contains the corresponding bead aggregates.
  • replacement substrates are added to each array location that contains the corresponding bead aggregates.
  • the polypeptide domains of the replacement polypeptides are identical to those of the polypeptides bound to the supports.
  • the replacement polypeptides are in vast excess, and because the interactions between polypeptides and ligands in solution are generally characterized by relatively rapid off-rates, the soluble replacement polypeptides bind the ligands and displace competitively the support-bound polypeptides.
  • the location-determinable supports are displaced from the ligand-bearing randomizable supports and soluble replacement polypeptides are attached to the ligand- bearing supports in preparation for further characterization or screening.
  • the pairs may be subsequently exposed to secondary ligands, typically small organic molecules, as described herein.
  • Small organic molecules that bind to the primary ligand can displace the replacement substrate, thereby identifying small a organic molecule with potential therapeutic value as a disruptor of a protein-protein interaction.
  • DNAse treatment may release the location- - determinable beads, while the residual fiision protein remains bound by noncovalent forces to the ligands on the randomizable beads.
  • a second binding step involving the ligand-bearing beads and soluble replacement polypeptides is then performed in order to adhere the second layer (the library polypeptide layer) to the bead prior to detection of polypeptide-ligand complexes. This replacement step is generally applicable to non-proteinaceous substrates, as well.
  • Magnetic interactions In one embodiment of the invention, beads formed from a magnetic resin are used as the location-determinable support.
  • a set of magnetic beads (e.g., 10 beads per well) is apportioned into each array location, which contains a corresponding library polypeptide or other such substrate.
  • the magnetic beads have adhesion domain binding moieties that are complementary to those of, e.g., the fusion polypeptides conjugated to their surfaces, after some period of time saturating or near-saturating amounts of fusion protein will adhere to the resin, and the polypeptide-coated beads are collected. This may be accomplished by dipping a magnetic pin into each well, allowing the magnetic beads (with the adhered substrates) to be drawn to the pin, withdrawing the beads, transferring to another well, and discharging the magnetic bead by demagnetizing the pin.
  • the magnetic forces may be applied externally to pull the magnetic beads to the well wall, with subsequent removal of the remaining non-magnetic materials.
  • substrate/ligand bead aggregates are formed and collected.
  • each set of magnetic beads in the array is exposed to aliquots of non-magnetic ligand-bearing supports. After a period of time to permit interactions between substrates and ligands, the magnetized beads are again collected with the aid of a magnetic device. Any of the ligand-bearing beads that have interacted to form aggregates with the magnetized beads are pulled along with the magnetic beads to the magnet. Ligand-bearing beads that do not interact are left behind in solution. The aggregates of magnetic beads and interacting ligand-bearing beads are then collected.
  • the ligand-bearing randomizable supports may be magnetized while the location-determinable supports remain unmagnetized.
  • the magnetized randomizable supports then function analogously to gather the bead aggregates formed by the substrate/ligand complexes.
  • a "surface interaction" as opposed to solution interaction is created, and provides an enrichment for substrate-ligand interactions. This enrichment step obviates the need to examine carefully every possible substrate-ligand interaction using a quantitative, but serial device such as a flow cytometer.
  • interaction sets on the order of 10 6 x 10° polypeptides may be screened rapidly and efficiently by inserting a bead- bead interaction step. Segregating, identifying and quantifying the substrate/ligand pairs Once the substrate/ligand interactions are consummated, the interactions can be quantified, and each substrate and ligand identified as follows.
  • polypeptide layer reversibly bound to ligand-bearing randomizable supports i.e., either the randomizable supports were exposed only to soluble polypeptides, or the bead- bound polypeptides were subsequently displaced by an intervening exposure to soluble polypeptides.
  • Such polypeptide/ligand complexes may be rapidly quantified by use of a fluorescence-activated cell sorter.
  • the fluorescent signals emitted by the unique tags on the ligand-bearing supports provide the basis for rapid and accurate quantitation by this method.
  • substrate-ligand complexes can be detected by either detecting a unique recognition domain (e.g., epitope) on the polypeptide or ligand (by "unique” is meant either that the recognition domain exists on only one member of the complex, or alternatively that it is present on both members but sterically accessible only on the outer layer).
  • a unique recognition domain e.g., epitope
  • Supports that bear a ligand may be identified by a variety of immunological or fluorescence techniques known to those in the art. As one non-limiting example of such identification, a fluorescence-labeled antibody that reacts with such an epitope on the library polypeptide is utilized.
  • the beads are collected and examined by an instrument such as a FACS machine to measure the level of antibody (determined from the fluorescence signal of the particular fluorochrome attached to the antibody).
  • the randomizable support barcode can be read by fluorescence measurements at other wavelengths. This in turn reveals the identity of the fusion protein attached irreversibly to the randomizable support.
  • the identity of the soluble protein is retained based on the well from which the bead was collected (i.e. the unique array location) immediately prior to the detection step. Thus, both the identity of the primary, irreversibly attached protein and the soluble protein is known, and the approximate strength of the interaction between them can be determined from the antibody fluorescence signal.
  • a CCD camera may be utilized to detect interacting substrate- ligand complexes.
  • a CCD system can be used to visualize interacting complexes, thereby providing both detection and quantification.
  • the CCD camera can detect a variety of visual outputs, including without limitation fluorescent emissions, chemiluminescent emissions, and SPA (scintillation Proximity Assay) emissions.
  • SPA sintillation Proximity Assay
  • a detectable scintillation signal is emitted.
  • the beads can optionally be displayed on some surface, for example an identification grid with grid locations correlating to each unique array location, for scanning by the detector.
  • CCD detection of fluorescent signals utilizes a scientific grade CCD camera incorporating a high quantum efficiency image sensor.
  • the target molecules are distributed along the well bottoms of optically transparent microtiter plates.
  • the CCD fitted with lenses and optical filters, acquires images of the through the optically transparent well bottoms. Fluorescent excitation of the fluorescent molecules is generated by appropriately filtered coherent or incoherent light sources.
  • the resulting digital images are stored on a computer for subsequent analysis.
  • An exemplary detection system is composed of a PixelVision SpectraVideoTM Series imaging camera (1 100 x 330 back-illuminated array), PixelVision PixelViewTM 3.03 software, two 50-mm fl .0 Canon lenses, four 20750 Fostec light sources, four 8589 Fostec light lines, one 59345 Oriel 510-nm band pass filter, four 52650 Oriel 488-nm laser band pass filters, a 4457 Daedal stage, Polyfiltronic clear bottom microtiter plates, and supporting mechanical fixtures. Mechanical fixtures are constructed to position the PixelVision camera below a microtiter dish. Additionally, the fixtures mounted four Fostec light lines and allowed the excitation light to be focused on the viewed area of the microtiter dish.
  • the two Canon lenses were butted up against each other front to front.
  • a 510-nm filter is placed between the two lenses.
  • the front-to-front lens configuration provides 1 : 1 magnification and close placement of the target object to the imaging system.
  • the above-described techniques quantify polypeptide binding pairs or polypeptide/ligand binding pairs.
  • the exact make-up of each binding pair is ascertained by identifying (i) the unique array location from which the library polypeptide or other such substrate is derived, and (ii) the ligand identity that corresponds to the unique tag on the bead (which, in the case of creating protein interaction maps, will in turn relate back to another unique library polypeptide array location).
  • sequence information about a given interacting polypeptide is desired, one may sequence the DNA encoding the polypeptide produced by each unique location in the library array.
  • EXAMPLE 1 LYSATE LIBRARIES Expression vectors
  • the host cells of interest are transformed with such an expression vector, production of the library polypeptides is induced, and the library polypeptides are collected.
  • a variety of expression vectors are suitable for use in this invention. As one non- limiting example, an expression vector bearing an inducible trc promoter was used.
  • Plasmid pSE420 (Invitrogen) features the trc promoter, the lacO operator and lacl q repressor, a translation enhancer and ribosome binding site, and a multiple cloning site.
  • the E. coli thioredoxin gene was amplified from pTrx-2 (ATCC) in such a manner as to retain a restriction enzyme site on the 5' side of the gene, and was cloned into the pSE420 vector's multiple cloning site at the 5' Nhel and 3'NgoMIV locations, thus placing it under control of the trc promoter.
  • the thioredoxin gene can advantageously enhance recombinant protein solubility and stability.
  • cytoplasmic protein As a cytoplasmic protein, it can be produced under reducing conditions but still can be released by osmotic shock because of accumulation at adhesion zones.
  • pSE420/trxA the gene encoding GFP was inserted in frame with the thioredoxin, in order to rapidly isolate intact, in-frame constructs and thereby to eliminate constructs in which the library polypeptide would not be properly produced.
  • the gene encoding EGFP was PCR amplified from plasmid pEGFP-1 (Clontech), maintaining a Notl restriction site 3' of the EGFP sequence, and establishing a second Notl site 5' of that sequence.
  • the Notl sites may be used to readily remove the EGFP fragment from the vector after intact constructs are isolated.
  • the Notl fragment containing EGFP was then cloned into the Notl site of the pSE420/trxA vector.
  • Vectors containing the EGFP in frame and in the correct orientation were designated plasmid pSE420/trxA/EGFP.
  • Figure 1 Once the vector containing the desired promoter and other components is prepared, DNA encoding the desired adhesion moiety is introduced. For example, a biotinylation signal may be used to adhere the library polypeptides to steptavidin beads.
  • the in vivo biotinylation peptide sequence was cloned into the pSE420/trxA/EGFP vector ( Figure 1) in frame to the amino terminus of the thioredoxin gene by cutting at the 5' Ncol and 3' Nhel site and filling in the overhanging nucleotides with Klenow prior to ligation.
  • the biotinylation signal peptide is 23 residues long (Tsao et al, Gene 169:59-64 (1996)), and the sequence that encodes it can be readily synthesized on an oligonucleotide synthesizer using standard techniques.
  • the vector may advantageously be modified to include the BirA gene, which encodes the enzyme responsible for adding biotin to the recombinant biotinylation signal.
  • the BirA gene was amplified from genomic E. coli DNA by PCR. A copy of the BirA gene was added in a polycistronic fashion to the carboxyl terminus of the biotin/trxA/EGFP sequence and the resultant modified pSE420 vector was designated pSE420 biotrx GFP/BirA ( Figure 2).
  • An alternative adhesion moiety, dihydrofolate reductase (DHFR) was incorporated into the expression construct as follows. The DHFR gene was amplified from E.
  • coli genomic DNA by PCR with Ncol and Kpnl sites on the 5' and 3' ends, respectively. This fragment was cloned into the Ncol Kpnl site of pSE420. Subsequently, the Notl fragment containing EGFP (described above) was cloned in frame with DHFR into the Notl site. The resultant plasmid was designated pSE420/DHFR/GFP ( Figure 4).
  • Another promoter system suitable for use in the invention features the P promoter. This system was constructed by digesting the pLex plasmid (Invitrogen) with Ndel and Pstl and blunting the resultant ends with mung bean nuclease.
  • the pSE420 biotrxGFP/BirA construct described above was digested with Ncol and Hindlll, and the Ncol/Hindlll fragment then blunt-ended with T4 polymerase. This fragment was then inserted into the pLex construct.
  • the resulting plasmid was designated pLex/biotrx/GFP/BirA ( Figure 5).
  • the DHFR/GFP expression cassette described above may be inserted into the pLex plasmid by digesting pLex with Ndel and Pstl, blunting the ends with mung bean nuclease, and inserting the blunte-ended Ncol/Hindlll fragment from pSE420,DHFR/GFP.
  • expression was induced by introduction of the appropriate induction agent (IPTG for pSE420-based expression vectors, and tryptophan for pLex -based vectors).
  • IPTG IPTG for pSE420-based expression vectors
  • tryptophan for pLex -based vectors
  • Production of the recombinant polypeptide insert was detected by GFP fluorescence via FACS, or by western blot analysis.
  • the recombinant polypeptides were then selectively bound and removed from bacterial lysatyes of induced cultures via binding with the respective binding partner (streptavidin for biotrx/GFP and methotrexate for DHFR/GFP), which had been immobilized to beads, as described elsewhere herein.
  • DNA encoding the library polypeptides may be derived from a variety of sources, using techniques that are familiar to the art.
  • a cDNA library encoding human protein domains was prepared, using methods that are well known in the art, from human placental tissue.
  • Poly(A) RNA was isolated from placental tissue by standard methods.
  • First strand cDNA was then generated from poly(A) mRNA using a primer containing a random 9mer, a Sfil restriction endonuclease site and a site for PCR amplification (5'- ACTCTGGACTAGGCAGGTTCAGTGGCCATTATGGCCNNNNNNN).
  • the second strand was then generated using a primer consisting of a random 6mer, another Sfil site, and a site for PCR amplification (5'- AAGCAGTGGTGTCAACGCAGTGAGGCCGAGGCGGCCNNNNNN). After conducting a number of PCR amplification cycles, the DNA was cut with Sfil and the resultant fragments were size-selected for fragments of greater than about 400 bp. The selected fragments were ligated into the Sfil sites of a suitable expression vector, as described herein. The library polypeptide DNA fragments then were isolated and inserted in frame with DNA encoding a corresponding biotin adhesion moiety and thioredoxin.
  • DNA encoding the library polypeptides was prepared by cutting the DNA with Sfil and then inserted at an Sfil site placed in a linker (5' GGCCGAGGCGGCCTGATTAACGATGGCCATAATGGCC) placed at the NgoMIV-Avrll sites of plasmid vector pSE420/biotrx GFP/BirA, or of plasmid vector pET-biotrx-GFP-BirA.
  • a linker 5' GGCCGAGGCGGCCTGATTAACGATGGCCATAATGGCC
  • Such cells are expressing intact GFP, which is in frame with and downstream from the library polypeptide and TrxA sequences. Plasmid DNA is isolated and the EGFP insert then removed via Notl digestion. Once the EGFP marker has been used to sort cells and removed from the modified pSE420 vector, the modified pSE420 plasmids are again transformed into E. coli and expressed via IPTG induction. Other adhesion moieties Alternatively, the library polypeptides may adhere to calmodulin-containing beads using calmodulin binding peptide ("CBP”) as the adhesion moiety.
  • CBP calmodulin binding peptide
  • the vector constructs are prepared as described above, but an expression cassette containing CBP is inserted into the vector immediately 5' of the trxA gene via the 5' Ncol and 3' Nhel sites, as described above.
  • Figure 3 The CBP thus is used in place of the biotinylation signal peptide, and immobilizes the library polypeptides to the calmodulin beads.
  • the thioredoxin gene product may itself serve as the adhesion moiety, and will bind the fused library polypeptides to phenylarsine oxide (“PAO”) beads.
  • PAO phenylarsine oxide
  • Polystyrene beads are modified so as to covalently link phenylarsine oxide to the surface by reacting the carboxyl groups on the bead surface with p- aminophenylarsine oxide via a water soluble carbodiimide. Kaleef and Gitler, Methods of Enzymology 233:395-403 (1994).
  • the above-described pSE420/trxA/EGFP vector in this instance is used directly, i.e., no subsequent moiety is fused to the carboxyl terminus of the thioredoxin gene. Screening and expression are carried out as described above.
  • the library polypeptides may simply be adhered to polystyrene beads via hydrophobic adsorption.
  • the library polypeptides are first separated from, e.g., the host cell polypeptides by standard methods before exposure to the beads.
  • Crosslinked embodiments polypeptide substrates or ligands may be crosslinked with the supports.
  • the bacterial lysate containing the expressed recombinant fusion protein is incubated with microspheres containing a ligand specific for the fusion partner. Following binding of the fusion protein, a photoactive crosslinker on the microsphere will irreversibly bind the fusion protein.
  • Examples of possible ligand- fusion partner combinations are, but not limited to, phenylarsine oxide (PAO) and thioredoxin (Methods of Enzymology (1994) 233, 395-403), or a suicide substrate and its corresponding enzyme (e.g. clavulanic acid and beta-lactamase; J. Mol. Biol. (1994) 237, 415-422).
  • PAO phenylarsine oxide
  • thioredoxin Metals of Enzymology (1994) 233, 395-403
  • a suicide substrate and its corresponding enzyme e.g. clavulanic acid and beta-lactamase; J. Mol. Biol. (1994) 237, 415-422.
  • PAO and thioredoxin the thioredoxin fusion product is constructed as described above.
  • the PAO moiety, 4-aminophenylarsine oxide is synthesized as described in the literature (Biochemistry (1978) 17, 21
  • the 4-aminophenylarsine oxide is then reacted with a large molar excess of BS 3 (Pierce Chemical Co.) in order to place an amine reactive NHS ester and 8 carbon spacer at the 4 position of 4-aminophenylarsine oxide.
  • the NHS ester-modified PAO is then reacted in equimolar amounts with sulfo- SANPAH (Pierce Chemical Company) and 10 ⁇ m amine-functionalized latex microspheres (Polysciences, Inc.). The result of this reaction yields microspheres with approximately one- half of the available amine groups with PAO attached, while the remaining half have the photoactivatable crosslinker.
  • microspheres are then reacted with the bacterial lysate containing the expressed fusion protein.
  • Vicinal dithiol-containing proteins including the recombinant thioredoxin fusion protein, is bound to the microspheres.
  • the microspheres with the bound recombinant fusion protein are crosslinked to the microspheres via amine groups on thioredoxin by exposing to light at 320nm-350nm.
  • library polypeptides are covalently attached to the supports by adsorption to the support, followed by crosslinking.
  • the library polypeptides may be constituted as fusions with maltose binding protein.
  • These fusion constructs then are purified from the lysate using a maltose affinity resin and released with soluble maltose (J. Chrom. 633 (1993) p.273-280).
  • the purified fusion constructs then are adsorbed onto polystyrene beads, thus attaching via hydrophobic interactions.
  • the polypeptides are crosslinked with a phototactivated crosslinker, for example sulfo-SANPAH (Pierce Chemical Co.).
  • polypeptide substrates are attached to microparticles via the interaction of a DNA-binding protein and a DNA moiety or analog on a bead.
  • a DNA binding fusion library such as a Gal4 fusion is constructed.
  • the corresponding microparticles have two features ⁇ a peptide nucleic acid (PNA) oligomer for binding the protein of interest, and a photoactivatable crosslinker, e.g. sulfo-SANPAH (Pierce Chemical Company), attached to the end of the oligomer.
  • PNA peptide nucleic acid
  • crosslinker e.g. sulfo-SANPAH (Pierce Chemical Company)
  • the microparticles are placed into lysates containing the various Gal4/library polypeptide fusion constructs, and those constructs then bind to the beads via interaction between the Gal4 binding moiety and the bead oligomer.
  • the crosslinker is then photoactivated, thus forming the covalent linkage between the proteins and the beads.
  • the bacterial lysate containing the expressed recombinant fusion polypeptides are incubated with microspheres that bear a ligand specific for the fusion polypeptide. After the polyeptides bind to the beads via the ligands, a photoreactive crosslinker on the bead is activated so as to irreversibly bind the fusion polypeptide to the bead.
  • fusion polypeptide/ligand partners include DHFR/methotrexate, PAO/thioredoxin, or a suicide substrate and corresponding enzyme (e.g., clavulanic acid and beta-lactamase; J. Mol. Biol. (1994) 237:415-422).
  • 4- aminophenylarsine oxide is synthesized as described in the literature (Biochemistry (1978) 17:2189-2192), reacting the 4-aminophenylarsine oxide with a large molar excess of BS 3 (Pierce Chem. Co.) in order to place an anime reactive NHS ester and and eight carbon spacer at the 4 position of the 4-aminophenylarsine oxide.
  • the NHS-modified PAO is then reacted in equimolar amounts with sulfo-SANPAH (Pierce Chem.
  • microspheres 10 ⁇ m amine- functionalized latex microspheres (Polysciences, Inc.), yielding microspheres with approximately one half of the available amine groups with PAO attached, while the remaining half attaches the photoactibatable crosslinker.
  • the microspheres are then reacted with the bacterial lysate containing the expressed thioredoxin fusion protein. Vicinal dithiol containing polypeptides, including the recombinant thioredoxin fusion protein, are thus bound to the microspheres.
  • the microspheres with the bound recombinant fusion polypeptide are crosslinked via the thioredoxin amine groups by exposing the complexes to 320-350 n light.
  • the DHFR expression vector is as described elsewhere herein.
  • the corresponding affinity resin, sulfo-SANPAH (Pierce Chem. Co.) is reacted with the amine-functionalized latex microspheres (Polysciences Inc.) in non- saturating amounts to couple the crosslinker onto the microspheres in non-saturating amounts.
  • Methotrexate (Sigma Chem. Co.) is then reacted with EDC (Pierce Chem.
  • a bacterial lysate containing DHFR fusion polypeptide is then bound and photo-crosslinked as described for the thioredoxin/PAO system.
  • Host cells A variety of host cells are suitable for use in this invention.
  • One common species of host cell with utility here is E. coli.
  • Preferred strains of E. coli are characterized by (1) over- expressing the necessary amount of protein required to fulfill other parts of the invention (coating of the beads, etc.), (2) tolerating "leaky” expression of toxic target plasmids, and (3) being amenable to cell lysis and protein recovery.
  • Such strains include, without limitation, TOP10 (Invitrogen Corporation), BL21 (Novagen), and AD494 (Novagen).
  • BL21 (DE3) RIL (Stratagene) was selected for further study in this non-limiting Example.
  • T7 lysozyme cuts a specific bond in the peptidoglycan cell wall of E. coli.
  • High levels of expression of T7 lysozyme can be tolerated by E. coli since the protein is unable to pass through the inner membrane to reach the peptidoglycan cell wall.
  • Mild lytic treatments of cells expressing T7 lysozyme that disrupt the inner membrane results in the rapid lysis of these cells.
  • use of the pLysS plasmid should facilitate the lysis of E.
  • coli host cells expressing the library polypeptide constructs.
  • Arraying single-cell clones Prior to induction of fusion polypeptides, individual clones are arrayed at unique locations. The location from which each library polypeptide is derived will serve to identify it during subsequent screening steps. Each unique location is tracked throughout the screening, either by directly moving each segregated library polypeptide sequentially to other, correspondingly unique locations, or by indirectly tracking the origin of each library polypeptide via its corresponding location-determinable support, which is adhered to the library polypeptide via the adhesion moiety that was incorporated in the above-described fusion construct.
  • Methods for generating single-cell clones are known to the art. For example, the library is first plated to permit well-isolated colonies to grow.
  • Cells from individual colonies may be isolated manually or via automated techniques such a colony picker, and cells from each isolated colony are placed at its corresponding unique location to generate a single-cell clone.
  • Commercially available microtiter trays for example in 96 or 384 well formats, provide convenient arrays for generating and tracking a unique location for each such single- cell clone.
  • the process may be automated for generating arrays with large numbers of single cell-type clones, each of which generates a correspondingly unique library polypeptide. Lysing the host cells Following induction and expression, the host cells are harvested and lysed and the polypeptide-bearing lysate collected.
  • the cells also may be sonicated, for example with the use of commercially available sonicators designed for use with, e.g., 96 well plates (e.g., Misonix Incorporated. Model 431 - T).
  • host cells are lysed using osmotic shock. This technique is a simple method of preparing the periplasmic fraction of expressed proteins.
  • the cells are centrifuged at 15,000xg for 30 seconds, the supernatant discarded, and the pellet resuspended in the same volume of ice-cold 2.5mM EDTA, 20mM Tris-HCl pH 8.0 and incubated on ice for 10 minutes.
  • the cells are centrifuged at 15,000xg for 10 minutes.
  • the supernatant contains protein fraction released due to osmotic shock. Total protein is assessed using the BCA Protein Assay kit.
  • the host cells are lysed by employing a freeze/thaw protocol. This technique is intended for cells containing the pLysS plasmid. Such cells are resuspended in 1/10 culture volume of 50mM Tris-HCl pH 8.0, 2.5mM EDTA. The cells are frozen at -80°C and then rapidly thawed in order to lyse the cells. The cell debris are pelleted at 15,000xg for 10 minutes and the supernatant saved. To shear the DNA, a DNA nuclease solution is added and incubated for 15-30 minutes at 30°C.
  • the number of freeze/thaw cycles required is determined by monitoring lysate protein concentration.
  • the host cells are lysed by addition of a mild detergent. This technique is also intended for cells containing the pLysS plasmid. Host cells lacking the pLysS plasmid were resuspended in 1/10 culture volume of 50mM Tris-HCl pH 8.0, 2.0 mM EDTA and 100 ⁇ g/ml lysozyme. Cells were then incubated for 15 minutes at 30°C. Triton X-100 was added to a final concentration of 0.1% and incubated for 15 minutes at room temperature. The cell debris were pelleted at 15,000xg for 10 minutes and the supernatant saved.
  • a variety of supports can be used as randomizable supports for binding ligands, and location-determinable supports for binding the library polypeptides. Suitable supports include beads in a variety of sizes and compositions. Selection of a particular bead depends in part upon the type of adhesion to be used (i.e., chemical/covalent linking, or linking through biological adhesion moieties), and the size and type of library polypeptide or other ligand to be adhered to the bead.
  • polystyrene microparticles of, e.g., lO ⁇ m, to adsorb proteins onto the surface of the bead (Polysciences, Inc. or Bangs Laboratories, Inc.).
  • Library polypeptides are adhered to such supports by hydrophobic interactions between the library polypeptides and the bead surface.
  • Other ligands are adhered by, e.g., synthesizing the combinatorial ligand library on the surface of the bead itself, or by incorporating a reactive functional group into the ligand structure, by which a covalent link is formed to the bead surface.
  • the polystyrene beads are exposed to, e.g., the individual library polypeptides uniquely located in the library arrays by suspending an aliquot of the beads in a buffer that is compatible with the chosen lysate solution (e.g., for mild detergent lysis, 1% Triton X-100 may be used) and pipetting aliquots into each 384 well format microtiter well.
  • the beads are mixed by repetitive pipetting or by shaking the array plates to ensure maximal dispersion.
  • the beads are left in for approximately 5-15 minutes to several hours, depending on the scope of the population to be screened, to ensure greater than approximately 70-100% maximal adhesion of the polypeptides to the microsupports. Exact conditions are optimized by routine testing familiar to one of ordinary skill in the art.
  • the beads bearing the library polypeptides or other ligands then are removed, for example by vacuuming the soluble contents of each well through the base of a 384 well filter plate and then collecting the remaining coated beads, which are then utilized for interaction screening,
  • Another preferred embodiment utilizes streptavidin coated polystyrene beads to bind fusion proteins containing biotin.
  • Such beads feature streptavidin molecules saturated to 1.8 mgs per gram of lO ⁇ m polystyrene particle.
  • streptavidin molecules Piereptavidin molecules (Pierce) are coupled to polystyrene beads having surface carboxyl reactive groups (Polysciences, Inc. or Bangs Laboratories, Inc.) using techniques familiar to those in the art. The particles are placed in the buffer 2-[N-morpholino]ethanesulfonic acid (MES).
  • MES 2-[N-morpholino]ethanesulfonic acid
  • EDC l -ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride
  • NHS N-hydroxysuccinimide
  • the particles are reacted with EDC to form an amine-reactive O-acylurea intermediate, which can then react with the free amine on a polypeptide to covalently link the polypeptide (e.g., streptavidin) to the bead surface.
  • streptavidin e.g., 18 mgs per gram of bead
  • the derivatized beads are then ready to bind biotin-bearing fusion polypeptides.
  • Still another preferred embodiment utilizes a calmodulin surface coating to bind fusion polypeptide constructs that include the calmodulin binding peptide (CBP).
  • CBP calmodulin binding peptide
  • Such beads feature approximately 2.3 mgs calmodulin (Sigma) per 1 gram bead, covalently coupled to a lO ⁇ m polystyrene particle, via the same chemistry described above for covalently linking streptavidin.
  • the moieties may be crosslinked as follows.
  • a streptavidin coated l Oum particle (prepared as described above) was placed into a bacterial lysate in which a biotin-thioredoxin-CBP (biotrxCBP) fusion protein had been expressed, and the moieties allowed to bind.
  • the beads were then washed to remove nonspecificly bound proteins, and reacted with a commercially available purified calmodulin having FITC covalently attached to the protein (Sigma). In the presence of calcium this interaction takes place ( Figure 7). Upon the removal of calcium, the calmodulin/CBP interactions begin to dissociate.
  • Magnetic beads may be used to facilitate collection of the adhered polypeptides, ligands, or interacting pairs.
  • a magnetic bead features a magnetic core with a polystyrene exterior coating, sized from 1-10 ⁇ m (commercially available Polysciences, Inc. or Bangs Laboratories, Inc). Such magnetic beads will bind proteins by direct adsorption, via the polystyrene coating. Alternatively, streptavidin-coated magnetic beads may be used.
  • calmodulin coated magnetic particles are used. Such particles are synthesized by the same technique described above for streptavidin coated microparticles, but with the exception that calmodulin is substituted for streptavidin. Again, the starting particle is a magnetic particle with carboxy functional groups on the surface (Bangs Laboratories or Polysciences, Inc.).
  • Interactions of a protein on a 1 Oum polystyrene bead and a protein on a 150nm magnetic bead were carried out in two systems.
  • one set of lOum beads (prepared as described above) were coated with biotin, and another set of 150nm magnetic beads (Immunicon) were coated with streptavidin.
  • a reaction tube was set up with 10 BSA coated lOum beads, about 200 lOum biotin coated beads and about 10 150nm streptavidin coated particles in PBS with 0.5% BSA. Figure 8. These were reacted together for fifteen minutes to allow for binding between the biotin and streptavidin moieties.
  • a neodymium-iron-boron magnet was placed to the side of the tube and the liquid removed. After several washes with PBS the number of biotin coated and BSA coated particles were counted with a hemacytometer. It was found that the mixture had been enriched several thousand fold for the biotin coated particles.
  • the other system examined the interaction of SV40 large T antigen with an antibody to the antigen. First, streptavidin coated 10 ⁇ m beads prepared as described elsewhere herein were added to a lysate containing a biotin thioredoxin SV40 large T antigen fusion protein (prepared as described elsewhere herein).
  • a unique fluorescent dye identifies, also referred to herein as a fluorescent "bar code”.
  • the fluorescent dyes may be organic in nature, or alternatively may be fluorescent nanoparticles. Two variables contribute to the bar code ⁇ type of dye (i.e., its particular emission spectrum) and concentration of dye (i.e., intensity of its emission signal).
  • concentration of dye i.e., intensity of its emission signal.
  • a wide variety of fluorescent dyes with well-characterized excitation and emission spectra are commercially available. For example, Molecular Probes, Inc provides a variety of organic dyes; (see TABLE 1, below).
  • fluorescent nanoparticles may be obtained that feature specific excitation and emission spectra.
  • Such nanoparticles are described by Bruchez et al, Semiconductor nanocrystals as fluorescent biological labels, Science 281 : (5385):2013-16 (Sept. 1998) and Cahn, W.C. and Nie, S, Quantum dot bioconjugates for ultrasensitive nonisotopic detection, Science 281(5385):2016-18 (Sept. 1998), the disclosures of which are incorporated herein in their entireties. Indeed, it is possible to procure sets of fluorescent molecules that cover the spectrum from blue to red. Each dye has characteristic excitation and emission spectra that may be used to create a bar code.
  • a set of fluorescent bar codes is created that is sufficiently large to uniquely identify each member of a ligand pool on the order of 1 x 10 6 members (i.e., roughly each protein encoded by a human cell).
  • the corresponding set of unique tags is generated from a set of 4-10 separate fluorescent dyes.
  • the dyes are chosen so that there is optimal compatibility of their excitation and/or emission maxima when such dyes are irradiated by any one of a given FACS machine lasers, including Argon and Helium-Neon.
  • the dyes are selected further so that there is minimal overlap of their emission maxima.
  • the dyes are chosen so as to be distinguished from any autofluorescence emissions of the bead to be labeled.
  • fluorescent nanocrystals may be utilized as the fluorescent dye species forming the barcode.
  • the nanocrystal is a semiconductor material such as zinc sulfide-capped cadmium selenide.
  • the nanocrystal also may feature an outer layer to aid in derivatization and/or to aid solubility, for example mercaptoacetic acid (Chan and Nie (1998), supra), or silica derivatives (Bruchez et al. ( 1998), supra.
  • the emission spectrum of the nanocrystal is dependent upon the size of the cadmium selenide core of the crystal.
  • Fluorescent nanocrystals may be coupled with the beads in a variety of ways.
  • One general approach is to apply absorption techniques such as are used in absorbing organic fluorochromes to beads.
  • the nanocrystals can be rendered nonpolar for this purpose by coating the nanocrystals with a nonpolar coating such as an alkyl silane.
  • a polystyrene bead having a porous structure is then exposed to the nonpolar fluorescent nanocrystals, using methods familiar to those in the art.
  • the nanocrystal then equilibrates into the corresponding nonpolar interior of the polystyrene bead, and is maintained there by repulsion from an aqueous solvent.
  • more porous particles may be utilized to increase the available interior region.
  • the nanocrystals may be linked to the selected beads via covalent bonds, using a variety of different chemistries familiar to those of skill in the art.
  • both the bead surface and the nanocrystals are derivatized with surface reactive groups.
  • the bead features a porous surface, allowing the nanocrystals to diffuse into the interior regions of the bead prior to covalently cross-linking with the bead.
  • nonporous bead particles may be used, in which case the nanocrystal is crosslinked to the exterior surface of the bead.
  • a variety of beads and crosslinking chemistries are suitable for use in this invention.
  • porous silica particles having low auto fluorescence As one nonlimiting example, carboxyl coated silica particles (CPG, Inc.) of a desired size (e.g., 10 ⁇ m diameter) are selected.
  • CPG, Inc. carboxyl coated silica particles
  • the nanocrystals are first reacted with an amine silane, thereby forming an amine functional group.
  • the derivatized beads and nanocrystals are then mixed together so that the nanocrystals diffuse evenly throughout the particle.
  • a crosslinking agent such as EDC l-ethyl-3-(3- dimethylaminopropyl)carbodiimide
  • EDC l-ethyl-3-(3- dimethylaminopropyl)carbodiimide
  • a crosslinking agent such as EDC (l-ethyl-3-(3- dimethylaminopropyl)carbodiimide) is then added, thereby conjugating the nanocrystal to the derivatized silica particle.
  • other derivatized particles may readily be substituted.
  • Fluorescence barcoding uses a set of dye species chosen with the considerations enumerated above, as exemplified but not limited to those dyes in Table 1 or the nanocrystals described above.
  • the identity of each randomizable support is encoded as a numerical readout having digit placeholders equal to the number of dyes used (e.g., nine dyes create nine "digits" in the barcode).
  • Each digit in the barcode is then further defined by the amount of the specific dye, as determined from its fluorescence intensity (i.e., Ox, lx, 2x, 3x or 4x).
  • fluorescence intensity i.e., Ox, lx, 2x, 3x or 4x.
  • the beads are labeled with dyes-by mixing the selected number of dyes in defined ratios such that a specific bead receives a unique barcode. For example, using nine different dyes one defined bead type may receive dyes in the ratio of (4, 2, 3, 3, 1 , 1 , 2, 4, 2); a second bead type may receive dyes in the ratio (2, 2, 3, 3, 1, 1 , 2, 4, 2).
  • Fluorescent organic dye species may be selected from a wide variety of known dyes and incorporated into a wide variety of known beads, utilizing techniques familiar to those of skill in the art. E.g., U.S. Patent No. 5,573,909, the disclosure of which is incorporated by reference herein in its entirety.
  • an organic solvent such as, e.g., acetonitrile or dimethylformamide
  • the dyes were incorporated into polystyrene beads (Bangs Labs, Inc. PS07N) beads as follows. The selected dyes were dissolved in dimethylformamide (DMF). The beads were washed three times with absolute ethul alcohol (and stored in same). A staining mix was prepared, containing 10% DMF, 54% absolute ethyl alcohol and 36% dichloromethane (approximating a 60:40 ratio of ethyl alcohol to dichloromethane). The beads were added and rapidly stirred 1 for ten minutes. The staining solution was then removed from the beads by centrifugation or
  • oligonucleotide tags it is possible to construct a sufficient number of unique oligonucleotide tags and to attach such tags to the randomizable supports by, e.g., linking the oligonucleotide to a biotin linker and adhering that linker to a streptavidin-coated bead such as those described above.
  • the oligonucleotide tags bear unique DNA sequences, each of which can be correlated to a given ligand.
  • Such DNA tags can be built in one of several ways. For example, using techniques well known to the art, a multichannel oligonucleotide synthesizer can generate a set of DNA molecules with unique sequences of any given length. Once individual oligonucleotide tags characterized and isolated into homogeneous tag pools, the tags can be adhered to the randomizable supports in a variety of ways. For example, if the randomizable supports have a streptavidin coating, then a biotin adhesion moiety is joined to each oligonucleotide tag at the 5' end by standard synthesis techniques. If the randomizable support is coated with other adhesion moieties, the complementary adhesion moiety can be chemically coupled to a 5' amino-modified oligonucleotide tag.
  • the oligonucleotide tags may be read either by sequencing, by evaluating sequence length, or by hybridization. For sequencing information, the oligonucleotide tags resident on each bead are subjected to PCR, and then run on a sequencing gel. Alternatively, the oligonucleotide tags may be identified via exposing the tags to known hybridization probes. Mass spectrometry tags
  • Another suitable method for encoding identities of beads involves use of mass tags — i.e., labels that can be detected by mass spectrometry.
  • mass tags are known in the art and must be coupled to the beads in different amounts so as to generate a mass tag bar code. This code can be read by subjecting the beads to mass spectrometry pursuant to methods familiar to those of the art, or by use of gas chromatography.
  • Radio-frequency tags As yet another alternative for encoding identity information on beads, the beads may be engineered to emit unique, identifying radio signals of various pre-determined frequencies. Such beads may contain, e.g., miniaturized transmitter/receiver circuitry, rectifier, control logic and antenna.
  • Each set of beads thus may contain a unique label laser-etched on the internal chip within the bead. Emissions from the radio-frequency tags are detected by a corresponding radio-frequency detector. Beads with mixed tags. In some embodiments, the number of different ligand populations to be uniquely tagged will be quite large — on the order of 1 x 10 6 or more. Although a corresponding number of unique fluorescent bar code tags, mass spec tags or DNA oligonucleotide tags could be formulated as described above, in some instances it may be desirable to make tags that are some combination of fluorescent, mass spec and/or oligonucleotide information. For example, oligonucleotide tags or mass spec tags may be incorporated so as to reduce the number of fluorescent dyes used.
  • Bead-polypeptide interactions To test the bead:bead interactions of the invention, several proteins were inserted into pET-biotrx-BirA and overexpressed in BL21 (DE3) RIL cells: murine p53, SV40 large T- antigen, HPV16 E7 and the "Rb pocket" of the Retinoblastoma gene. The E7 and p53 polypeptides were bound to the beads via the associated biotinylation signal, and were detected on the beads with antibidies specific to E7 and p53, respectively.
  • FRET fluorescence resonance energy transfer
  • the goal of the process is to examine in a quantitative or semi-quantitative fashion all possible pairwise interactions between human protein domains. This involves a test of "n x n" interactions, if "n” is the number of human protein domains. Values for "n” likely fall between 100,000 and 1 ,000,000. For an interaction screen of this scope, automation of at least some of the following procedures is desirable. To summarize, one embodiment of the process involves a series of steps: (1) generation of a library of expressed human sequences in an E.
  • part of the fusion protein may serve as a recognition sequence tag for attaching labels (e.g., fluorescent antibody labels) so that the protein can be detected; (2) enrichment of the library for clones that contain constructs that are in-frame and expressed at reasonable levels; (3) a ⁇ aying of the enriched library clones in microtiter plates; (4) growth and induction of the individual library clones to produce fusion proteins inside E. coli; (5) preparation of E.
  • labels e.g., fluorescent antibody labels
  • coli lysates to release the expressed fusion proteins from cells; (6) generation of a primary set of beads barcoded with suitable combinations of fluorescent dyes to act as randomizable supports; (7) apportioning of beads to individual wells of microtiter trays to permit adhesion of lysate fusion proteins to the randomizable supports (also referred to herein as "primary beads”); (8) apportionment of secondary magnetic beads (as location-determinable supports) to microtiter wells to allow adhesion of lysate proteins as in 7; (9) mixing of primary and secondary beads to permit aggregation of beads with interacting proteins on their surfaces; (10) magnetic capture of secondary beads and attached primary beads to enrich for primary beads with proteins that interact with protein on the surface of secondary beads; (1 1) mixing of enriched primary beads with soluble fusion protein in microtiter wells to allow interaction of soluble protein with proteins on the surface of primary beads, as well as detachment of secondary beads; (13) magnetic capture and disposal of secondary beads; (14)
  • Steps 1 and 2 generation and enrichment of the polypeptide library to be cross- screened in order to generate a protein interaction may ⁇ is described in detail in Example 1 , above.
  • Step 3 involves plating out and growing up single-cell clones that produce only one of the library polypeptides at a given unique array location. To accomplish this, a commercial robot may be used (e.g., Genetix Ltd.
  • each unique location in the chosen array format will contain a lysate bearing one particular human protein domain, amongst the milieu of native E. coli proteins.
  • a single colony may be picked and transferred to a correspondingly unique intermediate container of larger volume for growing up the clone.
  • a sample is taken from the intermediate container and is concentrated and lysed as described in detail in Example 1.
  • An aliquot of the lysate is then transfened to a unique array location in a 384 well microtiter plate (40 ⁇ l volume). Step 6 involves the generation of the primary set of beads with fluorescent barcodes.
  • Example 2 describes preparation of these uniquely tagged fluorescent beads in detail. Once each primary set of beads with a corresponding unique fluorescent tag is generated, the bead sets are suspended in buffer. A sampling from each tagged bead set is then dispersed into a corresponding array location, so that the tagged primary beads adhere to the protein domains therein (step 7). This may be accomplished by e.g., automated aspiration of the beads into the wells (e.g., TecanAG GenesisTM; Matrix Technologies Corp. PlateMateTM; Carl Creative Systems, Inc.
  • automated aspiration of the beads into the wells e.g., TecanAG GenesisTM; Matrix Technologies Corp. PlateMateTM; Carl Creative Systems, Inc.
  • the secondary set of magnetic beads are prepared in situ in each of the unique locations in the library array (step 8). This is accomplished by adding an aliquot of beads to each library as in step 7.
  • a robotic hand with magnetized fingers may be used to capture the magnetic beads and then release the beads in each of the corresponding array locations on the, e.g., 384 well plate, by dipping the fingers into the lysate and demagnetizing the fingers. Aliquots taken from the fully integrated set of primary beads are then collected and dispensed into each unique array location, each of which contains a location-determinable set of secondary beads with adhered protein domains (step 9).
  • the number of primary beads should be sufficient to reduce probability of not having a particular polypeptide/bead to a small value — e.g., less than 1 : 100 probability. This may be accomplished by aspirating and dispensing, as above. This step allows complexes to form between the protein domains adhered to the primary and secondary beads at each array location, and hence forming bead-bead aggregates. Complexes of adhered beads are then retrieved magnetically (step 10) with, e.g., a neodymium-iron-boron magnet (Master Magnetics Inc.). The magnetic aggregates using relatively large magnetic beads (i.e.
  • a ferromagnetic pin is placed in the center of the well, with magnets located on the outside of the well. Geometry of the pin and magnet is selected so that the induced magnetic field on the pin will attract the beads, and beads that do not react are removed. Quantification of polypeptide-ligand complexes may be facilitated by replacement of bead-bound protein domain with a soluble, unbound form of the domain (step 1 1).
  • the beads may be exposed to the products of a separate library that contains polypeptide inserts that correspond to each polypeptide moiety that is adhered to the bead, but which has a unique labeling domain or epitope.
  • the primary beads are collected in a manner that segregates the beads in groups that correspond to each separate array location from which the protein bound to the secondary bead originated and the bound proteins crosslinked with, e.g., paraformaldehyde (step 14) to stabilize the complexes by preventing dissociation.
  • a fluorescent antibody As one non-limiting example, one may detect a bound secondary protein by using a fluorescently-labeled antibody directed against one of the fusion protein epitopes (used as a recognition domain and shared among all library constructs), e.g., a FLAG or biotin epitope.
  • the antibody is incubated with the crosslinked beads, such that it binds to exposed or unique epitopes on the secondary protein; i.e., the labeling agent must recognize an epitope that is either absent from the primary fusion polypeptide, thus necessitating construction and array of a separate library for the secondary polypeptide, or an epitope that is inaccessible on the primary polypeptide).
  • fluorescently labeled avidin may be used.
  • the beads bearing these segregated, labeled protein pairs are then examined by a detecting device to quantify conjugates that have the antibody or biotin label.
  • the fluorescence information (both wavelength and intensity signatures) are simultaneously read and used to identify the protein domain adhered to that bead.
  • the beads are decoded using familiar techniques such as sequencing or hybridization of oligonucleotide tags, or mass spectrometry to identify mass tags.
  • This sorting and/or detection step can be accomplished via one of a number of instruments. Two general categories of instrument have particular utility: a flow cytometry instrument such as a FACS machine or flow analyzer; CCD detector or photomultiplier tube scanner. Each device must have certain capabilities.
  • the fluorescent barcode is used to determine the bead identity, an identity that is linked to the well from which it was originally derived; that is, a barcode matches a well which contained the lysate fusion protein that comprises layer one on the bead.
  • sequence analysis can be accomplished simply by PCR amplification of insert sequences from each microtiter well using primers on the vector which flank the insert. Standard automated sequence analysis followed by database searches reveals details about each cloned insert. Current sequencing throughputs permit sequencing of one million inserts in a period of weeks to months.
  • the fluorescence of a labeling agent serves to quantify the amount of secondary protein attached via protein- protein interactions to a bead. If the concentration of protein in the lysate is measured or estimated, and the saturating amount of protein on the bead is known (i.e., how much secondary protein could be maximally bound if all primary protein binding sites were occupied), it is possible to determine the approximate binding constant of the protein-protein interaction from the equation:
  • ratio [xy] / [x] is simply the ratio of measured bound secondary protein over the saturating (maximal) bound amount, and [y] is concentration of soluble fusion protein in the lysate.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

La présente invention concerne de nouveaux procédés de détection des interactions substrat-ligands et plus particulièrement des procédés de détection et de caractérisation des interactions polypeptides-ligands. Dans la pratique de cette invention, il est possible de générer des cartes de l'interaction entre protéines pour les humains ou pour d'autres organismes.
EP00913507A 1999-02-17 2000-02-17 Procede de criblage de l'interaction substrat-ligands Withdrawn EP1071958A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US25136499A 1999-02-17 1999-02-17
US251364 1999-02-17
US35041999A 1999-07-08 1999-07-08
US350419 1999-07-08
PCT/US2000/004089 WO2000049417A1 (fr) 1999-02-17 2000-02-17 Procede de criblage de l'interaction substrat-ligands

Publications (1)

Publication Number Publication Date
EP1071958A1 true EP1071958A1 (fr) 2001-01-31

Family

ID=26941565

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00913507A Withdrawn EP1071958A1 (fr) 1999-02-17 2000-02-17 Procede de criblage de l'interaction substrat-ligands

Country Status (5)

Country Link
EP (1) EP1071958A1 (fr)
JP (1) JP2002537564A (fr)
AU (1) AU3494500A (fr)
CA (1) CA2329016A1 (fr)
WO (1) WO2000049417A1 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1258730A4 (fr) * 2000-02-07 2004-12-29 Kyowa Medex Co Ltd Procede de detection d'une substance
GB2360282A (en) * 2000-03-17 2001-09-19 Bioinvent Int Ab Making and using micro-arrays of biological materials
FI20002623A (fi) * 2000-11-30 2002-05-31 Inno Trac Diagnostics Oy Bioanalyyttinen määritysmenetelmä
WO2007097377A1 (fr) * 2006-02-24 2007-08-30 The Furukawa Electric Co., Ltd. Systeme de quantification de biomolecules par cytometrie de flux, procede de quantification, systeme de detection et d'echantillonnage de cellules, procede de detection et d'echantillonnage, particule de silice fluorescente a utiliser dans ces systemes et kit comprenant de multiples particules de silice combinees ensemble
KR100973428B1 (ko) * 2008-05-19 2010-08-03 한국과학기술연구원 말토오스 결합 단백질을 이용한 생리활성 폴리펩타이드의고정화 방법
KR101580360B1 (ko) * 2013-05-22 2015-12-28 김성천 연자성미세구조물을 이용한 리간드의 스크리닝 시스템 및 그 용도

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0733213A1 (fr) * 1993-12-09 1996-09-25 Novartis AG Procede de production de banques de composes combinatoires
US6060240A (en) * 1996-12-13 2000-05-09 Arcaris, Inc. Methods for measuring relative amounts of nucleic acids in a complex mixture and retrieval of specific sequences therefrom
JP4302780B2 (ja) * 1997-05-23 2009-07-29 バイオアレイ ソリューションズ エルエルシー マトリックスで結合された化合物の色別コード化とインシトゥ探索
US6455263B2 (en) * 1998-03-24 2002-09-24 Rigel Pharmaceuticals, Inc. Small molecule library screening using FACS

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0049417A1 *

Also Published As

Publication number Publication date
WO2000049417A1 (fr) 2000-08-24
WO2000049417A9 (fr) 2002-03-28
JP2002537564A (ja) 2002-11-05
AU3494500A (en) 2000-09-04
CA2329016A1 (fr) 2000-08-24

Similar Documents

Publication Publication Date Title
US20030027214A1 (en) Methods for substrate-ligand interaction screening
Astle et al. Seamless bead to microarray screening: rapid identification of the highest affinity protein ligands from large combinatorial libraries
AU2005241003B2 (en) Nucleic-acid programmable protein arrays
US8163567B2 (en) Methods and compositions comprising capture agents
US20020137053A1 (en) Collections of binding proteins and tags and uses thereof for nested sorting and high throughput screening
US20040048311A1 (en) Use of collections of binding sites for sample profiling and other applications
Mendes et al. Optimization of the magnetic recovery of hits from one-bead–one-compound library screens
Kodadek et al. Optimized protocols for the isolation of specific protein-binding peptides or peptoids from combinatorial libraries displayed on beads
WO2004071641A2 (fr) Reseaux a assemblage autonome et utilisation de ceux-ci
US20030143612A1 (en) Collections of binding proteins and tags and uses thereof for nested sorting and high throughput screening
WO2000049417A1 (fr) Procede de criblage de l'interaction substrat-ligands
WO2023049177A1 (fr) Séquençage de protéine et de peptide à molécule unique
JP4335526B2 (ja) コロイド構造体および非コロイド構造体による結合スピーシーズの検出
JP4437193B2 (ja) 核酸ライブラリー及びタンパク質ライブラリー
CA2419908A1 (fr) Procede et kit a haut rendement
US10107805B2 (en) Virus-microbead complex and use thereof
Schultz et al. The Scripps Research Institute (La Jolla, CA)
WO2014138028A1 (fr) Plate-forme de réseau liquide pour l'analyse en multiplex d'interactions molécule-protéine
AU2008200415A1 (en) Detection of binding species with colloidal and non-colloidal structures
Palzkill Protein Arrays and Protein Chips
AU2003212842A1 (en) Use of collections of binding sites for sample profiling and other applications
AU2012203152A1 (en) Nucleic-acid programmable protein arrays

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17P Request for examination filed

Effective date: 20001228

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: DELTAGEN PROTEOMICS, INC.

17Q First examination report despatched

Effective date: 20031208

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040619