EP1053341A1 - Use of negative regulation elements for nerve-specific expression of transgenes - Google Patents

Abstract

The invention concerns novel methods and constructs for controlling nucleic acid expression, in particular methods and constructs using NRSE sequences for obtaining a targeted expression of transgenes in the nerve cells in vivo or ex vivo. The invention is particularly adapted for in vivo gene transfer applications, for instance for therapeutic or scientific approach.

Description

 USE OF NEGATIVE REGULATORY ELEMENTS FOR NEUROSPECIFIC EXPRESSION OF TRANSGENES

The present invention relates to new methods, constructs and vectors containing these constructs for controlling the expression of a nucleic acid. In particular, the invention relates to methods, constructs and vectors for obtaining targeted expression of transgenes in nerve cells in vivo or ex vivo. The invention is particularly suitable for in vivo gene transfer applications, for therapeutic or scientific approaches for example.

In vivo or ex vivo gene therapy allows local and efficient transfer of genes coding for factors of interest (transgenes), in particular in the nervous system of a host organism. In this regard, different types of vectors have been successfully used for the transfer of different types of transgenes into nerve cells in vivo or ex vivo. Mention may in particular be made of viral vectors of the adenovirus, AAV or HSV type, or certain non-viral vectors of the cationic polymer type (polyethylene imine for example). Thus, these vectors have enabled efficient and stable transfer of transgenes into cells of the nervous system in vivo (WO 94/08026, WO 93/09239, WO 96/02655). The possibility of carrying out this type of transfer offers numerous applications, in particular in the medical field. Thus, these vectors can be used in gene therapy approaches in vivo or ex vivo. In this regard, various preclinical studies are currently underway concerning the transfer of trophic factors into the nervous system. These vectors can also be used for the creation of transgenic animals making it possible to test compounds or also for various labeling or bioavailability studies.

For all these applications, even if good efficiency and good transfer stability seem to be achieved today, controlling the expression of transgenes is an imperative. In this regard, various systems have been described in an attempt to restrict expression of transgenes to certain tissues only, for example using so-called "tissue-specific" promoters or complex chimeric systems requiring the use of several constructs and / or regulatory factors. As examples of specific tissue promoters, mention may in particular be made of the Glial Fibrillary Acidic Protein promoter, which is mainly active in glial nerve cells. However, the regulatory systems available or validated to date have certain drawbacks, and in particular a strength and / or selectivity which is not always satisfactory. Thus, in the vast majority of known systems, selectivity is generally obtained at the expense of the strength of the promoter, and it is therefore difficult to have an expression which is at the same time large, stable and specific.

The present invention provides methods, constructions as well as vectors containing these constructions, making it possible to remedy the drawbacks of the prior art. In particular, the present invention describes a chimeric promoter allowing neuronal targeting of expression. The invention uses negative regulation elements in this respect, preventing the expression of genes in non-neuronal cells. This type of construction has several advantages over previous systems. On the one hand, the repression sequences and the ubiquitous promoters are often short and well characterized, they can easily be associated with other regulatory elements. On the other hand, these regulatory elements can be associated in theory with any ubiquitous promoter and therefore represent a clever system making it possible to easily obtain a neurospecific expression of transgenes of interest even when the expression vector used has little or no no tropism for nerve cells.

Many studies describe cis sequences repressing the transcription of neuronal genes in non-neuronal cells. A particular type of sequence endowed with this property consists of NRSE ("Neuron Restrictive Silencer Element"), also called RE-1 (Repressor element-1). NRSE is a short sequence, around 21 bp, demonstrated upstream of several neuronal genes: SCG 10 [1], sodium channel II [2] and synapsin I [3] for example. In addition, Similar sequences have been found upstream of many other neuronal genes, although their functionality has not always been demonstrated to date [4]. These NRSE sequences repress the non-neuronal expression of genes by binding a specific transcription factor, the NRSF protein (Neuron Restrictive Silencer Factor), also called REST (RE-1 Silencing Transcription factor), present only in non-neuronal cells [ 5]. This protein belongs to the family of zinc finger transcription factors. It intervenes during development to initiate the repression of neuronal genes in non-neuronal cells and then in adulthood in the maintenance of this repression.

The teams that characterized the presence of the NRSE sequences upstream of the neuronal genes verified the capacity of these sequences to decrease the expression of reporter genes after transfection of non-neuronal cells. To this end, they have associated their NRSE sequence with a minimal heterologous promoter, that is to say a promoter allowing only a basal transcription. Thus, placed upstream of the thymidine kinase promoter for example, a copy of the NRSE sequence of the calcium channel II reduces the expression of the reporter gene by half in non-nerve cells [9]. Likewise, two copies of the NRSE sequence of synapsin I associated with the minimal promoter c-fos make it possible to reduce expression in non-nerve cells by 75% [3]. Furthermore, the presence of an NRSE sequence has also made it possible to regulate the activity of the SV40 promoter in non-neuronal cells [10].

However, the NRSE sequences have never been used to direct the expression of a strong ubiquitous promoter, nor for the purpose of gene therapy. Thus, it has never been shown whether such sequences were capable of suppressing the expression induced by a strong promoter. Likewise, it has never been shown whether these sequences, placed in a chimeric environment, were still active in vivo. More generally, the activity of these sequences combined with heterologous promoters has never been demonstrated in vivo until now. The invention relates to recombinant nucleic acids for the neurospecific expression of genes. It also relates to the vectors comprising these nucleic acids, in particular of viral origin, as well as the cells containing these nucleic acids and / or vectors. The invention also relates to particular chimeric promoters suitable for the neurospecific expression of genes in the nervous system in vivo. The invention further relates to compositions comprising these elements, and their use for gene transfer.

A first aspect of the invention therefore resides in a recombinant nucleic acid comprising:

- a promoter

- one or more NRSE sequences, and

- a therapeutic gene.

The constructs according to the invention therefore comprise a region of repression in non-neuronal cells of the active expression of the therapeutic gene, induced by the promoter. This repression region consists of one or more NRSE motifs.

The NRSE motif used in the context of the present invention advantageously comprises all or part of the following 21 bp sequence:

TTCAGCACCACGGAGAGTGCC (SEQ ID n ° 1)

This sequence corresponds to the NRSE sequence of the SCG10 gene [2]. However, it is understood that the NRSE pattern used in the context of the invention may include certain variations with respect to this sequence, insofar as it retains the repression properties mentioned above. Thus, NRSE-type sequences with certain variations have been observed in different genes, as described in the article by Schoenherr et al. [4], incorporated into the present application by reference. On the On the basis of the variants observed, a consensus NRSE sequence has been defined, corresponding to the sequence most frequently encountered. This sequence is: TTCAGCACCACGGACAGCGCC (SEQ ID No. 2). Preferred variants within the meaning of the invention include substitutions on 1 to 5 base pairs of the sequence SEQ ID No. 2 above. More preferably, they include variations on 1 to 3 base pairs. In this regard, the variations are preferably located on residues 1, 2, 10, 11, 15, 18, 19 and / or 20 of the above sequence. Substitutions may correspond to the deletion or replacement of the base concerned by any other base. Thus, an NRSE motif can be represented more generally by all or part of the following sequence: NNCAGCACCNNGGANAGNNNC (SEQ ID No. 3) in which N denotes a base chosen from A, T, C or G. Specific examples of NRSE motifs which can be used in the context of the present invention are in particular the following:

TTCAGCACCACGGACAGCGCC (SEQ ID n ° 2)

TTCAGCACCACGGAGAGTGCC (SEQ ID n ° 4)

TTCAGCACCGCGGACAGTGCC (SEQ ID n ° 5)

TTCAGCACCTCGGACAGCATC (SEQ ID n ° 6)

TTCAGCACCGCGGAGAGCGTC (SEQ ID n ° 7)

TCCAGCACCGTGGACAGAGCC (SEQ ID # 8)

TTCAGCACCGAGGACGGCGGA (SEQ ID n ° 9)

ATCAGCACCACGGACAGCGGC (SEQ ID n ° 10)

TTCAGCACCTAGGACAGAGGC (SEQ ID n ° 11)

In addition, these motifs may also contain, at one or the other or at both ends, additional bases which do not interfere with the repressive activity. mentioned above. In particular, they may be restriction sites, neutral sequences or sequences originating from cloning steps and containing, for example, regions of a plasmid or of a vector, or sequences bordering the NRSE motif in the original gene.

These different patterns can be prepared by any technique known to a person skilled in the art for the preparation of nucleic acids. Thus, they can be prepared by the techniques of automatic synthesis of nucleic acids using commercial synthesizers. They can also be obtained by screening DNA libraries, for example by hybridization with specific probes or by NRSF factor binding experiments. In addition, any other variant of the sequence SEQ ID No. 1 can be identified from DNA libraries by looking for homologies for example.

Once synthesized, the NRSE type pattern can then be functionally tested. For this, a first test notably consists in determining the capacity of the motif to bind the NRSF factor. This can be carried out under different conditions and for example by experiments of migration delay on gel according to the technique described by Mori et al. [2] or by Schoenherr et al. [5], incorporated herein by reference. In a second step, the ability of the motif to repress expression can be determined by inserting this motif in a test plasmid containing a reporter gene (Chloramphenicol Acetyl Transferase, Luciferase, LacZ, etc.) under the control of a promoter, and comparing expression levels of said reporter gene in nerve cells and in non-nerve cells. This type of methodology is described for example in Schoenherr et al. [4,5] as well as in the examples. Preferably, the motif is considered to be functional when it generates an expression differential between nerve and non-nerve cells of at least 40%>. More preferably, this differential is at least 50%, advantageously, at least 60%. As indicated above, the nucleic acids of the invention can comprise one or more NRSE motifs as defined above. It can be either the same motif repeated several times, or several variants. Preferably, the constructions of the invention comprise the same motif repeated several times. The constructions can include up to 50 patterns. Advantageously, the pattern is repeated from 2 to 20 times, and preferably from 3 to 15. As illustrated in the examples, interesting results have been obtained with repetitions of 3, 6 or 12 patterns, the results being particularly important with 6 and 12 repetitions.

The NRSE motifs can be inserted into the constructs of the invention in any non-transcribed or untranslated region or in an intron. Advantageously, they are placed in the 5 'non-coding regions, even more preferably in the proximal region of the promoter. Furthermore, the activity of these motifs being independent of their orientation, they can be inserted in the direction of transcription as well as in the opposite orientation. Finally, when several patterns are used, they are preferably inserted side by side, in the same region of the construction. It is understood that they can however be inserted in different regions.

The second element entering into the composition of the nucleic acids of the invention is a promoter, allowing the expression of the transgene in the targeted cell. Advantageously, it is an active promoter in cells or nervous tissues, in particular a eukaryotic promoter. In this regard, it may for example be a ubiquitous promoter, that is to say functional in the majority of cell types. Even more preferably, it is therefore a eukaryotic ubiquitous promoter. The promoter can be autologous, that is to say coming from the same species as the cell in which the expression is sought or xenogenic (coming from another species). As advantageous examples, eukaryotic ubiquitous promoters may be cited as strong promoters such as the promoter of the phosphoglycerate kinase 1 (PGK) gene. The term “strong promoter” is understood to mean any promoter whose activity is comparable to that of viral promoters. In eukaryotes, PGK is an enzyme involved in glycolysis. In mice, the promoter of this gene, approximately 500 bp, includes a region called "enhancer" (-440 / - 120) and a promoter region (- 120 / + 80) containing several transcription initiation sites [6]. The efficacy of this PGK promoter has already been demonstrated in previous gene transfer experiments in vitro and in vivo [7,8].

According to a preferred embodiment, the invention relates to a nucleic acid comprising the PGK promoter and one or more NRSE sequences. As illustrated in the examples, this type of construction makes it possible to direct the neurospecific expression of a transgene. In this regard, the invention also relates to a chimeric promoter comprising a strong ubiquitous promoter and one or more NRSE sequences. The invention indeed shows that these NRSE sequences can be used to effectively repress the activity of a strong promoter, including in vivo. This therefore makes it possible to use these new promoters in numerous applications. A particular chimeric promoter within the meaning of the invention is represented by the designation xNRSE-PGK in which x is an integer from 1 to 50 and preferably from 1 to 20.

Other ubiquitous eukaryotic promoters which can be used in the context of the present invention are, for example, the promoters directing the expression of genes of compulsory cell metabolism (these genes are said to be "domestic" or "household" and specify proteins necessary for functions common to all cells). These are, for example, genes involved in the krebs cycle, in cellular respiration or in the replication or transcription of other genes. As particular examples of this type of promoter, mention may be made of the promoter of the α 1 -antitrypsin, β-actin, vimentin, aldolase A or Eflα (elongation factor) genes.

The promoter used in the context of the invention can also be a eukaryotic promoter of the neurospecific type, thus making it possible to improve its neurospecificity. By way of example, mention may be made of the promoter of the NSE (Neuron Specifies Enolase), NF (Neurofilament), TH (Tyrosine Hydroxylase), DAT (Dopamine) genes. Transporter), chAT (Choline Acetyl Transferase), DBH (Dopamine β-Hydroxylase), TPH (Tryptophane Hydroxylase), GAD (Glutamic Acid Dehydrogenase) and, more generally, all promoters of synthetic enzymes or neuromediator transporters or any other promoter of genes whose expression is specific for a given neuronal or glial type or subtype.

Finally, it is also possible to envisage the use of viral promoters, such as for example the CMV (Cytomegalovirus), RSV (Rous Sarcoma Virus), TK (Thymidine Kinase), SV40 (Simian Virus) and LTR (Long Terminal Repeat) promoters.

Furthermore, the nucleic acids of the invention also comprise a therapeutic gene. The term “therapeutic gene” within the meaning of the present invention means any nucleic acid comprising at least one open reading phase encoding an RNA or a therapeutic or vaccine polypeptide. The nucleic acid can be complementary, genomic, synthetic or semi-synthetic DNA. It can be of various origins such as mammal, plant, viral, artificial, etc. The transcription or translation product therefore has therapeutic or vaccine properties. As particular examples, mention may be made of enzymes, growth factors (trophic factors in particular), neurotransmitters or their precursors, toxic factors (Thymidine Kinase for example), antibodies or antibody fragments, etc.

The use of the constructs of the invention can be envisaged to direct the expression of one or more genes coding for an RNA or a protein which one would like to address to the neuron without expression of these in non-neuronal cells, in the aim of establishing animal models or from an etiological or symptomatic, replacement or suppressive therapy perspective. They may, for example, be genes from the family of trophic factors, such as, for example, neurotrophins (NGF, BDNF, NT3, NT4-5, GMF, etc.), growth factors [family of fibroblasts growth factors FGF (a and b), family of vascular endothelial cell growth factors VEGF, family of epidermal growth factors EGF, family of Insulin growth factors IGF (I and II)], the TGFβ superfamily including the families of TGFβ, GDNF / neurturine.

It may also be genes encoding cytokincs, such as for example CNTF, LIF, Oncostatin M, Cardiotrophin 1, or proteins of the interleukin family.

It may also be genes coding for the receptors for these different factors or coding for the transcription factors regulating the expression of these different factors. It may also be genes coding for the enzymes of synthesis or degradation of the various neurotransmitters and neuropeptides or their precursors, or cofactors essential for this synthesis or this catabolism, or also transcription factors regulating the expression of these protein; as well as genes coding for the receptors for neurotransmitters / neuropeptides (or for subunits of these receptors) and for the proteins intervening in the transduction pathways.

Other genes of interest in the context of the invention are in particular genes coding for antioxidant agents such as for example SOD (Superoxide Dismutase), GPX (Glutathione Peroxidase), Catalase or an enzyme of cellular respiration ; enzymes involved in the cell cycle such as p21, or other proteins that inhibit dependent kinases as well as apoptosis genes such as ICE, Bcl2, BAX, etc.

More generally, any gene whose abnormality of expression induces a pathology of the nervous system can be expressed in the constructs of the invention, such as genes whose mutation is directly at the origin of pathologies or genes of which the products are involved in the same metabolic pathway. It may also be toxic genes, for anticancer therapy (for example Thymidine Kinase or Cytosine Deaminase), antisense RNAs, ribozymes, or even reporter genes for development, kinetic and / or bioavailability studies, such as the β-Galactosidase, Luciferase, or GFP (Green Fluorescent Protein) genes. It can also be the genes involved in the conditional recombination systems in the nervous system in order to establish animal models _, such as for example transgenic animals including the conditional knockout system.

It is understood that a person skilled in the art can easily adapt the type of gene according to the use sought.

In the nucleic acids of the invention, the various elements are arranged so that the promoter controls the expression of the therapeutic gene and the NRSE sequence or sequences control the activity of the promoter. Generally, the gene is therefore placed downstream of the promoter and in phase with it. Furthermore, the regulatory region is generally placed upstream of the promoter, although, as indicated above, this is not necessary for the activity. The distance between the regulatory region (NRSE sequences) and the promoter is variable depending on the nature of the sequences used and the number of repetitions of the NRSE motif. Advantageously, the regulatory sequences are placed at a distance of less than 2 kb from the promoter, preferably at a distance of less than 1 kb.

According to a particular embodiment of the invention, the NRSE sequences are associated with regulatory systems in order to finely control the expression of nucleic acids in the cells. Among the regulatory systems, mention may be made very particularly of the system using on the one hand the tTA transactivator controlled by tetracycline and on the other hand a sensitive tTA promoter as described in application FR 98/140080 and incorporated into the present request by reference. Briefly, the nucleic acid comprises a first region comprising a nucleic acid coding for the transactivator of the tetracycline regulatory system (tTA) under the control of a moderate promoter as well as a second region comprising a nucleic acid of interest under the control of a promoter sensitive to tTA. This sensitive promoter can be any promoter, even a strong one, whose activity is increased in the presence of said transactivator. From a structural point of view, this promoter comprises in its sequence or at a functional distance from it, at least one binding site (or operating region Op) of the factor tTA. The two preceding regions are preferably separated. For carrying out the invention, the NRSE sequences can be placed upstream of the sensitive tTA promoter although this is not necessary for the activity, including between the two regions described above.

This particular mode of the invention advantageously makes it possible at the same time to have not only a regulation of the expression of a nucleic acid by tetracycline but also a tissue specificity of the expression and in particular in the nerve cells, brought by the NRSE sequences. In addition, this fine regulation of the promoter ensures remarkable efficiency and safety in the expression of transgenes, necessary in gene therapy.

The present invention also relates to vectors comprising a nucleic acid as defined above. This vector is advantageously capable of transducing nerve cells from mammals, in particular human cells, but it does not have to have a particular tropism for said cells. Thus, the invention advantageously allows the use of any type of vector. It can be a vector of the plasmid type (plasmid, episome, artificial chromosome, etc.) or viral. Among the latter, there may be mentioned in a preferred manner the vectors derived from adenoviruses, AAVs and herpes viruses, the tropism of which for cells and nervous tissues has been strongly documented in the prior art. Mention may also be made of other viruses such as retroviruses or rhabdoviruses. In this regard, the examples provided below demonstrate that the NRSE sequences introduced into viral vectors have a very significant activity. Thus, unexpectedly, when NRSE sequences and in particular 6 and 12 sequences have been introduced into a viral vector (adenovirus), they induce a reduction of 91 to 98% respectively of the expression of a transgene in non-cells. nervous in vitro and 90 to 96% in vivo. These results advantageously show that it is possible to express specifically in nerve cells a nucleic acid of interest without expression in non-nerve cells, according to a simple system, thanks to these regulatory sequences. In addition, these NRSE sequences have the advantage by their reduced size of being particularly suitable for regulating the expression of genes incorporated in a vector in which the space for insertion of regulatory sequences is limited. Also, it is now possible to envisage associating these sequences with other regulatory systems in the same vector.

A particular object of the invention therefore resides in a defective recombinant virus comprising a nucleic acid of interest under the control of expression sequences, characterized in that said expression sequences comprise a promoter and one or more NRSE sequences.

In general, the recombinant viruses of the invention are defective, that is to say incapable of autonomous replication in a cell. The production of defective recombinant viruses is known to those skilled in the art, as illustrated for example in GRAHAM F. and PREVEC L, (In: Methods in Molecular Biology (1991) MURRAY EJ (ed), the Humana Press Inc, Clifton, NJ, chapter 1 1, ppl09-128). In particular, each of these viruses can be produced in packaging cell lines having the said deficient functions. Such lines have been described in the literature (293 and derivatives for example).

According to a particular embodiment of the invention, the defective recombinant virus is an adenovirus. In particular, for this virus, various serotypes, whose structure and properties vary somewhat, have been characterized. Among these serotypes, it is preferred to use, within the framework of the present invention, human adenoviruses of type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin (see application WO94 / 26914). Among the adenoviruses of animal origin which can be used in the context of the present invention, mention may be made of adenoviruses of canine, bovine, murine origin (example: Mavl, Beard et al, Virology 75 (1990) 81), ovine, porcine, avian or even simian (example: after-sales service). Preferably, the adenovirus of animal origin is a canine adenovirus, more preferably a CAV2 adenovirus [Manhattan strain or A26 / 61 (ATCC VR-800) for example]. Preferably, in the context of the invention, adenoviruses of human or canine or mixed origin are used.

Preferably, the defective adenoviruses of the invention comprise ITRs, a sequence allowing the packaging and a nucleic acid according to the invention. Even more preferably, in the genome of the adenoviruses of the invention, the El region at least is non-functional. The viral gene considered can be made non-functional by any technique known to those skilled in the art, and in particular by total suppression, substitution, partial deletion, or addition of one or more bases in the gene or genes considered. Such modifications can be obtained in vitro (on isolated DNA) or in situ, for example, by means of genetic engineering techniques, or by treatment with mutagenic agents. Other regions can also be modified, and in particular the region E3 (WO95 / 02697), E2 (WO94 / 28938), E4 (WO94 / 28152, WO94 / 12649, WO95 / 02697) and L5 (WO95 / 02697). According to a preferred embodiment, the adenovirus according to the invention comprises a deletion in the regions E1 and E4. According to another preferred embodiment, it comprises a deletion in region E1 at the level of which the region E4 and the nucleic sequence of the invention are inserted (Cf FR94 13355). It may also be a recombinant adenovirus, defective for the El and / or E2 and / or E4 regions for example. In the viruses of the invention, the deletion in the region E 1 preferably extends from nucleotides 455 to 3329 on the sequence of the adenovirus Ad5.

The defective recombinant adenoviruses according to the invention can be prepared by any technique known to a person skilled in the art (Levrero et al., Gene 101 (1991) 195, EP 185 573; Graham, EMBO J. 3 (1984) 2917). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid carrying inter alia a nucleic acid of the invention or a nucleic acid of interest under the control of expression sequences comprising a promoter and one or more NRSE sequences . Homologous recombination occurs after co-transfection of said adenovirus and plasmid in an appropriate cell line. The cell line used must preferably (i) be transformable by said elements, and (ii), contain the sequences capable of complementing the part of the genome of the defective adenovirus, preferably in integrated form to avoid the risks of recombination. As an example of a line, mention may be made of the human embryonic kidney line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) which contains in particular, integrated into its genome, the left part of the genome an Ad5 adenovirus (12%) or lines capable of complementing the E1 and E4 functions as described in particular in applications No. WO 94/26914 and WO95 / 02697 or in Yeh et al, J. Virol. 70 (1996) 559.

Then, the adenoviruses which have multiplied are recovered and purified according to conventional techniques of molecular biology.

According to another particular embodiment of the invention, the defective recombinant virus is an AAV. Adeno-associated viruses (AAV), are DNA viruses of relatively small size, which integrate into the genome of the cells they infect, in a stable and site-specific manner. They are capable of infecting a broad spectrum of cells, without inducing an effect on cell growth, morphology or differentiation. Furthermore, they do not seem to be involved in pathologies in humans. The AAV genome has been cloned, sequenced and characterized. It comprises approximately 4,700 bases, and contains at each end an inverted repeat region (ITR) of approximately 145 bases, serving as an origin of replication for the virus. The rest of the genome is divided into 2 essential regions carrying the packaging functions: the left part of the genome, which contains the rep gene involved in viral replication and the expression of viral genes; the right part of the genome, which contains the cap gene coding for the capsid proteins of the virus.

The use of vectors derived from AAVs for gene transfer in vitro and in vivo has been described in the literature (see in particular WO 91/18088; WO 93/09239; US 4,797,368, US5, 139,941, EP 488,528). These applications describe various constructions derived from AAVs, in which the rep and / or cap genes are deleted. and replaced by a gene of interest, and their use for transferring in vitro (on cells in culture) or in vivo (directly in an organism) said gene of interest. The defective recombinant AAVs according to the invention are defective for all or part of the Rep and / or Cap regions. They can be prepared by co-transfection, in a cell line infected with a human helper virus (for example an adenovirus), of a plasmid containing a nucleic sequence or a combination of nucleic sequences of the invention bordered by two inverted repeat regions (ITR) from AAV, and a plasmid carrying the packaging genes (rep and cap genes) from AAV. A usable cell line is, for example, line 293. Other production systems are described, for example, in applications WO95 / 14771; WO95 / 13365; WO95 / 13392 or WO95 / 06743. The recombinant AAVs produced are then purified by conventional techniques.

According to another particular embodiment of the invention, the defective recombinant virus is a retrovirus, a rhabdovirus or even an HSV. Concerning retrovims and herpes viruses, the construction of recombinant vectors has been widely described in the literature: see in particular Breakfield et al, New Biologist 3 (1991) 203; EP 453242, EP 178220, Bernstein et al. broom. Eng. 7 (1985) 235; McCormick, BioTechnology 3 (1985) 689, etc. In particular, retroviruses are integrative viruses, selectively infecting dividing cells. They therefore constitute vectors of interest for cancer applications. The genome of retroviruses essentially comprises two LTRs, an encapsidation sequence and three coding regions (gag, pol and env). In recombinant vectors derived from retroviruses, the gag, pol and env genes are generally deleted, in whole or in part, and replaced by a heterologous nucleic acid sequence of interest. These vectors can be produced from different types of retroviruses such as in particular MoMuLV ("murine Moloney leukemia virus"; also designated MoMLV), MSV ("murine Moloney sarcoma virus"), HaSV ("Harvey sarcoma virus") ; SNV ("spleen necrosis virus"); RSV ("Rous sarcoma virus") or the Friend virus. To construct recombinant retroviruses according to the invention comprising a nucleic acid of the invention or a nucleic acid of interest under the control of expression sequences comprising a promoter and one or more NRSE sequences, a plasmid comprising in particular the LTR, the packaging sequence and said nucleic acid sequence is constructed, then used to transfect a cell line known as packaging, capable of providing in trans the deficient retroviral functions in the plasmid. Generally, the packaging lines are therefore capable of expressing the gag, pol and env genes. Such packaging lines have been described in the prior art, and in particular the line PA317 (US4,861,719); the PsiCRIP line (WO90 / 02806) and the GP + envAm-12 line (WO89 / 07150). Furthermore, the recombinant retroviruses may include modifications at the level of the LTRs to suppress transcriptional activity, as well as extended packaging sequences, comprising a part of the gag gene (Bender et al., J. Virol. 61 (1987) 1639). The recombinant retrovims produced are then purified by conventional techniques.

The present application shows the possibility of using NRSE sequences to regulate the expression of a gene in vivo. In fact, the results presented in the examples below show that the sequences are always active in vivo and allow expression of a transgene in neuronal cells without having expression in non-neuronal cells.

The application also shows that the NRSE sequences are capable, depending on their arrangement (number of copies), of effectively regulating the activity of a strong promoter, which allows numerous and particularly advantageous uses. Indeed, the results obtained demonstrate that expression in neuronal cells is not only specific but also comparable to that obtained with strong promoters. The invention also surprisingly shows that the activity of NRSE sequences seems to be potentiated when these are inserted into a vector of viral origin. The latter type of construction therefore combines properties particularly attractive such as transfer efficiency and selectivity of expression.

The invention also relates to any cell comprising a nucleic acid or a vector or a vims as defined above. Advantageously, this cell is a mammalian nerve cell. It may in particular be a cell originating from an established line or a cell originating from a primary culture. These cells can be used for the production of polypeptides for example, or to test the activity of genes. They can also be used in cell therapy approaches, by implantation or injection in a subject.

In this regard, the subject of the invention is also a composition comprising a nucleic acid or a vector or a vims or a cell as defined above and an excipient. Advantageously, it is a pharmaceutical composition. For their use according to the present invention, the nucleic acid, the vector or the cells are preferably associated with one or more pharmaceutically acceptable vehicles to be formulated for topical administration and in particular stereotaxic, oral, parenteral, intranasal, intravenous administration. , intramuscular, subcutaneous, intraocular, transdermal, etc. Preferably, the nucleic acid, the vector or the cells are used in an injectable form. They can be in particular saline solutions (monosodium phosphate, disodium, sodium chloride, potassium, calcium or magnesium, etc., or mixtures of such salts), sterile, isotonic, or dry compositions, in particular lyophilized, which, by addition, as appropriate, of sterilized water or physiological saline, allow the constitution of injectable solutes.

According to a preferred embodiment, the composition according to the invention is administered by the intramuscular route, preferably by injection. Indeed, the intramuscular route chosen allows to obtain, unexpectedly, an important therapeutic effect, thanks to the retrograde transport of products from therapeutic genes and products in the muscle. In fact, these products, corresponding to the nucleic acids or derived from the vectors according to the invention, are absorbed at the level of the neuromuscular junctions (motor plates) and are conveyed to the cellular bodies of the motor neurons by retrograde transport along the motor neuron axons. In addition, this mode of administration also has the advantage of preventing undesirable effects due to the ectopic expression of therapeutic genes in the treatment of neurological diseases. By this method it therefore becomes easy to specifically infect the neuronal cells without promoting the expression of transgenes in the injected muscles or the excretion of their products in the blood circulation. Indeed, it undoubtedly fades all the drawbacks encountered so far in therapy due to the limited access of neurotrophic factors to the motor neurons, to the very short half-life of these proteins as well as to the deleterious effects incurred during administration. systemic of these products. Furthermore, given the ease of access to the place to be injected, this method is advantageously usable whatever the type of neuronal or motoneuronal pathology.

The amounts of these different elements can be adjusted by a person skilled in the art according to the applications envisaged and according to different parameters, such as in particular the site of administration considered, the number of injections, the gene to be expressed, or even the duration of treatment sought.

The invention also relates to the use, for the preparation of a composition intended for the transfer and expression of a nucleic acid of interest in a nerve tissue or cell, of a construction comprising:

- a promoter - one or more NRSE sequences, and

- said nucleic acid, arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

The use of the nucleic acids of the invention for the transfer of genes in vivo or ex vivo, for example in gene therapy, makes it possible to limit the ectopic expression of the transgenes of interest and to target the desired therapeutic effect for neuronal populations . It thus prevents possible deleterious effects due to the diffusion of the transgene in the body. We can consider the use of this system in different pathologies of the spinal cord (degenerative or traumatic) as well as in any other central, peripheral or neuropsychiatric neurological pathology specifically affecting neuronal populations. In fundamental neurology, this system should also make it possible to specify the origin (neuronal or glial) of the effects observed in vitro and in vivo.

The invention also relates to the use, for the preparation of a composition intended for the treatment of motor neuron diseases, intramuscularly, of a nucleic acid of interest in a nerve tissue or cell, of a construction comprising:

- a promoter

- one or more NRSE sequences, and - said nucleic acid, arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

The invention also relates to the use of the vectors as defined above and comprising a nucleic acid of interest under the control of expression sequences, characterized in that said expression sequences comprise a promoter and one or more NRSE sequences. The use of viral vectors is based on the natural transfection properties of vims. These vectors are particularly effective in terms of transfection. It is thus possible to use the vectors of the invention for the transfer and expression in neuronal cells of gene of interest, in vivo, in vitro or ex-vivo and in particular for gene therapy. Thus, the expression of a nucleic acid of interest under the control in particular of one or more NRSE sequences is obtained specifically in nerve cells while the ectopic expression is limited. These vectors can therefore be used in the treatment and / or prevention of various central, peripheral or neuropsychiatric neurological pathologies affecting nerve cells and in particular neurodegenerative diseases as well as various pathologies of the spinal cord. By way of example, there may be mentioned in particular Alzheimer's disease, Parkinson's disease, muscular spinal ataxia, Huntington's chorea.

These vectors can in particular be used in the treatment and / or prevention of motor neuron pathologies such as for example amyotrophic lateral sclerosis, type I spinal muscular atrophy (Werdnig Hoffman's disease), type II or III (Kugelberg's disease) Welander), bulbar spinal muscular atrophy (such as Kennedy's disease).

These vectors are particularly suitable for the treatment and / or prevention of these pathologies by the intramuscular route. As explained above, this therapeutic route makes it possible to reach the motor neurons thanks to retrograde transport.

More specifically, the invention relates to the use, for the preparation of a composition intended for the transfer and expression of a nucleic acid of interest in a nerve tissue or cell, of a vector as defined above and comprising a construction in which:

- a promoter,

- one or more NRSE sequences, and - Said nucleic acid, are arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

The invention also relates to the use, for the preparation of a composition intended for the treatment of motor neuron diseases, intramuscularly, of a nucleic acid of interest in a tissue or nerve cell, of a vector as defined above and comprising a construction in which:

- a promoter,

- one or more NRSE sequences, and - said nucleic acid, are arranged such that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

The invention also relates to a method for regulating the expression of genes in vivo comprising the insertion, upstream of said gene, of NRSE sequences and the in vivo administration of the resulting constellation and / or of the vector comprising said constellation.

The present application will be described in more detail with the aid of the following examples, which should be considered as illustrative and not limiting. These examples first describe the cloning of an increasing number of NRSE sequences upstream of the PGK promoter into plasmids containing the luciferase reporter gene, and the selection of the constructions allowing a reduction in the expression of luciferase after transfection non-neuronal cells. Secondly, corresponding adenoviral constructs were generated and tested in vitro by infection of cell lines and primary cultures, then in vivo after intramuscular injection of the recombinant adenovims in mice. The results presented illustrate the advantages of the nucleic acids of the invention. LEGEND OF FIGURES

Figure 1: Schematic representation of the plasmids carrying a chimeric promoter of the invention.

Figure 2: Functional study of plasmids by transfection into nerve (PC 12) (Fig. 2B) and non-nerve (3T3) (Fig. 2 A) cells then measurement of luciferase activity.

Figure 3: Functionality study of defective recombinant vims in vitro by measuring luciferase activity after infection:

- non-nerve cells (rat fibroblasts 3T3) (Fig 3 A)

- nerve cells (PC 12 rat pheochromocytoma) (Fig 3B)

- cultures of primary non-nerve cells, infection of primary cultures of kidneys of newborn rats (Fig 3C)

- cultures of primary nerve cells, infection of primary cultures of upper cervical ganglia from newborn rats (Fig 3D)

- cultures of non-nerve primary cells, infection of primary cultures of astrocytes from rat embryos (Fig 3E)

- cultures of primary nerve cells, infection of primary cultures of cortical neuronal cells from rat embryos (Fig 3F)

Figure 4: Functionality study of defective recombinant vims in vivo by intramuscular injection in mice and measurement of luciferase activity.

Figure 5: Functionality study of defective recombinant vims in vivo by injection into the lingual mucles in mice and measurement of luciferase activity Fig. 5 A: measurement of luciferase activity in the cells of the lingual muscles on days 8 and 35.

Fig. 5 B: measurement of luciferase activity in cells of the nervous system (bulb) on days 8 and 35.

MATERIALS AND METHOD

Cell lines and primary cultures:

The cells derived from rat pheochromocytoma (PC 12) are cultured in RPMI 1640 medium (Gibco) containing 15%) of fetal calf semm (SVF) (Boehringer). The 3T3 cells derived from rat fibroblates are maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% semm of fetal calf. Primary cultures of upper cervical ganglion (GCS) are obtained from dissections of upper cervical ganglia of Winstar rats (Iffa-Credo) newborns, 1 or 2 days old and dissociated by 3 mg / ml of dispase (Boehringer), then deposited on plates previously covered with collagen from the rat tail. The cells are cultured in 0.5 ml of Leibovitz's L-15 medium (Gibco) buffered with bicarbonate and containing several factors including 70 ng / ml of NGF (nerve growth Factor), 5%> of adult rat semm and 10 μM of cytosine arabinofuranoside.

Primary kidney cultures are prepared by trypsin dissociation of renal tissue from Winstar (Iffa-Credo) rats 1 or 2 days old. The cells are then plated in 10% FCS to allow cell divisions until infection.

Cortical cultures are derived from El 7 Sprague-Dawley (Iffa-Credo) rat embryos. The cells are obtained by mechanical dissection and dissociation and cultured in a DMEM medium containing 100 μg / ml of transferrin, 25 μg / ml of insulin, 10 μg / ml of putrescine, 5 ng / ml of sodium selenite, 6.3 ng / ml of progesterone and 2 mM of glutamine (Sigma).

The primary cultures of astrocytes are derived from rat embryonic cortical tissue (El 7 Sprague-Dawley) and cultured in DMEM medium containing 10% FCS in an atmosphere of 10% CO ₂ and 90% air.

In vitro experiments: For the transient transfection experiments, one million cells are electroporated using a Bio-Rad system at 960μF and 190V for PC cells 12 or 250V for 3T3 cells with 6μg of each plasmid tested, 7 μg of Blue Script plasmid ( Stratagene) and 2 μg of pCAT 3- control vector (Promega) which is a plasmid coding for Chloramphenicol Acetyl Transferase (CAT) allowing the control of the transfection efficiency.

The cell cultures are infected by replacing the culture medium with semm-free medium containing the viral suspension at an MOI of approximately 200 pfu and by incubating for 45 minutes. For each constuction (plasmid or adenoviral) 3 values of luciferase activity are determined on 3 different wells. The infection experiments are repeated twice with different viral stocks for each viral constellation.

The cells are harvested 48 hours after electroporation or infection in 200 μl of a lysis buffer containing 25 mM Tris phosphate pH 7.8; 0.08 rM Luciferin; 0.1 mM ATP; 8 mM MgCl ₂ ; 1 mM difhiofhreitol; 1 mM EDTA; 15% glycerol and 1% Triton. Luciferase activity is measured using a LUMAT LB9501 type luminometer (Ber hold). For transfected cells, 1%> of bovine semm albumin (BSA) is added to the lysis buffer and the activity is normalized on the basis of the CAT activity determined by the method of counting a scintillation liquid. For recombinant adenovims, luciferase activity is normalized as a function of the protein concentration of the cell extracts, determined by the Bio-Rad system (Bio-Rad Laboratories).

In vivo experiments:

Six month old male C57B16 (Charles River) mice are anesthetized with a mixture of Rompun (Bayer) / Ketamine (UVA) and the Ad-PGK-luc and

Ad-NRSE-PGK-luc are slowly injected (2.5 μl / ml) into the tongue (10 pfu /

4x2.5μl) and / or in the gastrocnemius muscle at a dose of 2.10 pfu / muscle (30μl). The mice are sacrificed with pentobarbital (Sanofi) 7 to 35 days after infection. The bulbs, tongues and muscles are removed to measure luciferase activity. The bulbs are mechanically dissociated in 200 μl of lysis buffer. The muscles and the tongues are dissociated using a DIAX 900 polytron (Heidolph) type system in 1 and 2 ml of lysis buffer respectively.

EXAMPLES

1. Construction of chimeric promoters and plasmid vectors

The purpose of this example is to describe the production of chimeric promoters as well as the contributions of plasmid vectors comprising these particular promoters.

The plasmid pPGK-Luc comprises the Luc gene under the control of the ubiquitous eukaryotic promoter PGK. To obtain the plasmid pPGK-Luc, the 500 bp of the murine PGK promoter were inserted into a commercial plasmid pUT 103 (CAYLA FRANCE) comprising the reporter gene luciferase fused to zeocine and a polyadenylation sequence of SV-40 in "early" configuration "(PolyA).

Then, one, two, three, six and twelve copies of the NRSE sequence of the SCG10 gene (TTCAGCACCACGGAGAGTGCC, SEQ ID No. 1) [2] were inserted in an antiparallel configuration upstream of the PGK promoter. For this, a 26 bp fragment containing the NRSE sequence described above framed by 2 MluI sites was formed by hybridization of 2 corresponding synthetic oligonucleotides. This fragment was inserted in one or more copies at the MluI site of pPGK-Luc and made it possible to obtain the plasmids comprising 1, 2 and 3 NRSE copies. The plasmid comprising 6 NRSE copies was obtained from the plasmid comprising 3 (pNRSE3-PGK-Luc) according to the following strategy: a BamHI / Xhol fragment containing 3 NRSE copies is extracted from pNRSE3-PGK-Luc and introduced at the level of Xhol site of pNRSE3-PGK-Luc, which generates p6NRSE-PGK-Luc. Likewise, the plasmid comprising 12 copies NRSE was obtained from the plasmid comprising 6 (p6NRSE-PGK-Luc) by introducing the BamHI / Xhol fragment in double copy into p6NRSE-PGK-Luc.

Finally, the PGK expression cassette (with or without NRSE) -Luc-PolyA of the various plasmids described above was introduced into a shuttle plasmid which can be used for the construction of defective recombinant vims, between the left ITR sequence of the adenovirus (Inverted Terminal Repeat, origin of replication) and the sequence coding for the polypeptide IX (protein of the viral capsid) (FIG. 1).

It is understood that, according to the same protocol, any other plasmid can be constituted incorporating from 1 to 50 copies of an NRSE motif, associated with a eukaryotic ubiquitous promoter other than PGK, under the control of which any transgene of interest can be inserted. .

2. Functional analysis by transfection of cell lines

The purpose of this example is to demonstrate that the plasmid contributions comprising the chimeric promoter comprising the NRSE sequences are functional and allow expression in cells of a gene of interest.

The plasmid functions described in Example 1 were tested by transient transfection (electroporation) of PC 12 neuronal lines (rat pheochromocytoma) and non-neuronal 3T3 lines (rat fibroblasts). The luciferase activity values obtained are normalized with respect to the CAT (Chloramphenicol Acetyl Transferase) activity measured in a solution containing 125 mM Tris phosphate pH 7.8, 125 μM of chloramphenicol and 0.12 μM of radiolabelled acetylcoenzyme A . The assays are carried out in the presence of an Econofluor scintillation fluid using a KONTRON counter after one hour of incubation at 37 ° C. For each plasmid constuction, 3 values of luciferase activity were determined and the means and standard errors obtained are presented in Figure 2.

The results obtained show that the functions comprising 6 and 12 NRSE copies are capable of decreasing the expression of luciferase by 66 and 82% respectively, in non-nerve cells (3T3), ie a loss of almost a logarithm of expression in relation to the pPGK-Luc constmction. The results also show that the presence of NRSE motifs in the PC 12 nerve cells does not decrease the expression of luciferase, or even is capable of increasing it. A statistically significant 25% increase is indeed observed between pl2NRSE-PGK-Luc and pPGK-Luc.

Thus, it is demonstrated by the results obtained that the plasmid contributions comprising the chimeric promoter comprising the NRSE sequences are functional and allow the expression in cells of a gene of interest in neuronal cells only while very significantly inhibiting l expression of said gene in non-neuronal.

3. Construction of defective recombinant viruses

The purpose of this example is to describe the production of chimeric promoters as well as the contributions of viral vectors comprising these particular promoters.

In order to complete this in vitro and in vivo study, the three corresponding adenoviral functions were generated: Ad-PGK-Luc, Ad-6NRSE-PGK-Luc and Ad-12NRSE-PGK-Luc. These recombinant vims were constructed according to known techniques of biology, by co-transfection, in a packaging line (cells 293) of the shuttle plasmids described in example 1 and of a defective adenoviral genome of type 5. The plasmids shuttle were first linearized by enzymatic cleavage at the Fspl site and co-transfected with the long ClaI fragment of adenovims in the cell line 293 by the method of DNA calcium phosphate precipitation. The encapsidated recombinant genomes are then purified according to conventional techniques and in particular by the plaque purification technique. The integrated fragment is then verified by analysis of the restriction fragments and by PCR. The virus stocks were prepared by propagation of the recombinant adenovim in cell 293 then by ultracentrifugation in particular in cesium chromium gradient and purification on a purification column of Sephadex G25M type (Pharmacia). Viral titers were determined by reading the optical density and further verified by the plate method. All the stocks of vims had a titer around 2.10 ⁸ pfu / μl.

4. In vitro functional analysis

The purpose of this example is to demonstrate that the viral contributions described in Example 3 and comprising the chimeric promoter comprising the NRSE sequences are functional and allow the promoter to be controlled in different cell types.

The three adenovims constituted in example 3 above were tested in vitro by infection of cell lines and primary cultures at a dose of 20 and 200 pfu / cell respectively. The measurements are carried out as described above on 50 μl of supernatant and normalized with respect to the amount of total protein, obtained using a Bio Rad protein assay kit system (Bio-Rad). For each adenovirus, 3 values of luciferase activity were determined on different wells. The mean values and standard errors obtained are illustrated in Figure 3 for the lines and Figure 4 for the primary cultures.

The expression of the reporter gene luciferase is reduced by 97% and 99% respectively with the recombinant adenovims Ad-6NRSE-PGK-Luc and Ad-12NRSE-PGK-Luc in the non-neuronal line 3T3.

In the PC 12 neuronal line, the luciferase activity of the two adenovims comprising NRSE sequences is greater than that observed with the adenovims Ad-PGK-Luc. Similarly, after infection of primary cultures of the upper cervical ganglion (GCS) of newborn rats, the luciferase activity is similar for the 3 adenoviral functions (an analysis of overall variance with an ANOVA factor does not show any significant difference between the three groups). On the other hand, the expression of luciferase is reduced from 91 to 98% after infection of the primary cultures of kidneys of newborn rats with the recombinant adenoviruses Ad-6NRSE-PGK-Luc and Ad-12NRSE-PGK-Luc, i.e. loss of 2 logarithms of PGK expression in the presence of 12 NRSE copies.

Confirming the previous results, infection with the 3 constrictions of astrocytes and neuronal cortex cells from embryos of 17-day-old rats, shows as expected that the luciferase activity is very significantly reduced (by a factor of 10 ) in the astrocytic cells for the functions comprising 6 or 12 NRSE sequences (fig 3 E). As also expected, the luciferase activity is comparable in the cells of the cortex, for the three types of viral constuction previously mentioned (FIG. 3F).

These results are particularly surprising and remarkable insofar as they show (i) that the chimeric promoters of the invention are functional on primary cultures, (ii) that the promoters are functional in a viral context and (iii) that the Repression activity is greater in the adenoviral context than in the corresponding plasmid vector (see Figures 2 and 3).

Thus, this example made it possible to demonstrate that the viral contributions comprising the chimeric promoter comprising the NRSE sequences are functional and allow the expression in cells of a gene of interest in neuronal cells only while very significantly inhibiting the expression of said gene in non-neuronal cells. 5. In vivo functional analysis

The purpose of this example is to demonstrate that the viral contributions described in Example 3 and comprising the chimeric promoter comprising the NRSE sequences are functional and allow in vivo control of the promoter.

In view of the very encouraging results described in Example 4, the activity of the constituents of the invention was tested in vivo, by measuring the expression of luciferase after intramuscular injection (gastrocnemius muscle and tongue muscle). these 3 recombinant adenovims in mice.

5.1 Injection into the gastrocnemius muscle

Each adenoviral component was injected at 3 points into the right gastrocnemius muscle of 7 mice at a dose of 2.10 pfu / muscle, in a volume of 30 μl. The injected muscles were removed 7 days after the injection and dissociated in 1 ml of buffer for the purpose of determining the luciferase activity carried out on 150 μl of supernatant. The means and standard errors of the 7 values of luciferase activity obtained, related to the amount of protein, are presented in FIG. 5.

These results show that the expression of luciferase is reduced by 90 and 96% with the recombinant adenovims Ad-6NRSE-PGK-Luc and Ad-12NRSE-PGK-Luc one week after the injections.

The expression of luciferase after intramuscular injection of Ad-12NRSE-PGK-Luc and Ad-PGK-Luc was compared in the longer term in mice. A decrease in luciferase activity is always observed with Ad-12NRSE-PGK-Luc one month (95%) and three months (91%) after the injections.

5.2 Injection into the tongue muscles Retrograde transport was used to compare the expression of the two functions Ad-PGK-Luc and Ad-12NRSE-PGK-Luc in the bulb and in the muscles of the tongue after intramuscular injection in the tongue of mice.

In a manner comparable to those already obtained, the luciferase activities of the two functions are similar in the nervous system, one week after administration (FIG. 5 B). Conversely, the luciferase activity decreases by 90% in the muscles injected with the Ad-12NRSE-PGK-Luc structure compared to the muscles injected with the Ad-PGK-Luc structure (fig. 5 A). This repression is maintained over time and for at least 35 days after infection. Interestingly, although the level of expression at 35 days is lower than that obtained at 8 days after infection, the difference in expression between the two previous viral functions remains very significant.

Once again, these results confirm the functionality of the invention's constituents in vivo, and reveal a repression factor even greater than those observed in vitro after transfection of the plasmids into non-neuronal cells.

These results further demonstrate the high efficiency of the constiments of the invention in vivo for targeting the expression of a gene of interest in neuronal cells. The use of this approach in gene therapy makes it possible to limit the ectopic expression of the transgenes of interest and to prevent possible deleterious effects due to the diffusion of the transgene in the organism.

BIBLIOGRAPHY

[1] Mori N., Stein R., Sigmund O. And Anderson D.J.

Neuron, 4: 583-594 (1990)

[2] Mori N., Schoenherr C, Vandenbergh D.J. And Anderson D.J.

Neuron, 9: 45-54 (1992)

[3] Li L., Suzuki T., Mori N. And Greencard P. PNAS USA, 90: 1460-1464 (1993)

[4] Schoenherr C.J., Paquette A.J. and Anderson D.J.

PNAS USA, 93: 9981-9886 (1996)

[5] Schoenherr C.J. and Anderson D.J.

Science, 267: 1360-1363 (1995)

[6] McBurney, Sutherland, Adra, Leclair, Rudnicki, Jardine

Nucleic Acids Research, Vol. 19, No. 20: 5755-5761 (1991)

[7] Moullier P., Maréchal V., Danos O. And Heard J.M.

Transplant, 56: 427-432 (1993)

[8] McDonald R.J., Lukason M.J., Raabe O.G., Canfield D.R., Burr E.A., Kaplan J.M., Wadsworth S.C. and St George J.A.

Hmm. Gene Ther., 8: 41 1-422 (1997)

[9] Maue R.A., Kraner S.D., Goodman R.H. and Mandel G.

Neuron, 4: 223-231 (1990).

[10] Bessis A., Champtiaux N., Chatelin L. and Changeux J.P. PNAS USA, 94: 5906-591 1 (1997).

Claims

1. Recombinant nucleic acid comprising:

- a promoter

- one or more NRSE sequences, and - a therapeutic gene, arranged so that the expression of said therapeutic gene is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

2. Recombinant nucleic acid according to claim 1 characterized in that the promoter is a eukaryotic or viral promoter active in cells or nervous tissue.

3. Recombinant nucleic acid according to claim 2 characterized in that the promoter is a ubiquitous eukaryotic promoter, neurospecific or specific to a neuronal type.

4. Recombinant nucleic acid according to claim 3 characterized in that the promoter is a domestic promoter.

5. Recombinant nucleic acid according to claim 4 characterized in that the promoter is chosen from the promoter of the PGK, Eflα, βactin, vimentin, aldolase A or αl-antitrypsin genes.

6. Recombinant nucleic acid according to claim 1 characterized in that the promoter is a so-called strong promoter.

7. Recombinant nucleic acid according to claim 1 characterized in that it comprises from 1 to 20 NRSE sequences, preferably from 3 to 15.

8. Recombinant nucleic acid according to claim 7 characterized in that it comprises 3, 6 or 12 NRSE sequences.

9. Recombinant nucleic acid according to claim 8 characterized in that the NRSE sequence comprises all or part of the sequence SEQ ID No. 3 in which N is A, G, C or T.

10. Recombinant nucleic acid according to claim 9 characterized in that the NRSE sequence is chosen from all or part of the sequences SEQ ID No. 1, 2, 4- 1 1 or variants thereof.

1 1. Recombinant nucleic acid according to one of the preceding claims, characterized in that it comprises either the same motif or variant motifs defined according to claim 9 or 10, repeated several times.

12. Recombinant nucleic acid according to one of the preceding claims, characterized in that the NRSE sequence or sequences are placed upstream of the promoter.

13. Recombinant nucleic acid according to claim 1 characterized in that the therapeutic gene is a nucleic acid comprising an open reading phase encoding an RNA or a therapeutic or vaccine polypeptide.

14. Recombinant nucleic acid according to claim 13 characterized in that the therapeutic gene is a nucleic acid comprising an open reading phase coding for a trophic factor.

15. Recombinant nucleic acid according to claim 13 characterized in that the therapeutic gene is a nucleic acid comprising an open reading phase coding for an antioxidant agent.

16. Recombinant nucleic acid according to claim 1 characterized in that it comprises regulatory elements in addition to the NRSE sequences.

17. Regulatory elements according to claim 16 characterized in that it is a tetracycline operator / repressor system.

18. Vector comprising a nucleic acid according to one of claims 1 to 16.

19. Vector according to claim 18 characterized in that it is a viral vector.

20. Defective recombinant Vims comprising a nucleic acid of interest under the control of expression sequences, characterized in that said expression sequences comprise a promoter and one or more NRSE sequences.

21. Vims according to claim 20 characterized in that it is an adenovim.

22. Vims according to claim 20 characterized in that it is an AAV.

23. Vims according to claim 20 characterized in that it is a retrovims.

24. Vims according to claim 20 characterized in that it is a rhabdovims.

25. A cell comprising a nucleic acid according to claim 1 or a vector according to claim 18 or a vims according to claim 20.

26. Cell according to claim 25 characterized in that it is a mammalian nerve cell.

27. Use, for the preparation of a composition intended for the transfer and expression of a nucleic acid of interest in a nerve tissue or cell, of a composition comprising:

- a promoter - one or more NRSE sequences, and

- said nucleic acid, arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

28. Use, for the preparation of a composition intended for the treatment of motor neuron diseases by the intramuscular route, of a nucleic acid of interest in a nerve tissue or cell, of a composition comprising:

- a promoter

- one or more NRSE sequences, and

- Said nucleic acid, arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

29. Use of a defective recombinant vims comprising a nucleic acid of interest under the control of expression sequences, characterized in that said expression sequences comprise a promoter and one or more NRSE sequences.

30. Use according to claim 29 for the transfer and expression of gene of interest in neuronal cells in vivo, in vitro or ex-vivo.

31. Use, for the preparation of a composition intended for the transfer and expression of a nucleic acid of interest in a tissue or nerve cell, of a vector comprising a composition in which:

- a promoter,

- one or more NRSE sequences, and - Said nucleic acid, are arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

32. Use, for the preparation of a composition intended for the treatment of motor neuron diseases, by the intramuscular route, of a vector comprising a composition in which:

- a promoter,

- one or more NRSE sequences, and

- Said nucleic acid, are arranged so that the expression of said nucleic acid is controlled by said promoter and that the activity of said promoter is controlled by said sequence (s).

33. Use according to one of claims 31 or 32 characterized in that the vector is a vims.

34. A composition comprising a nucleic acid according to claim 1 or a vector according to claim 18 or a virus according to claim 20.

35. Composition according to claim 34 characterized in that it is formulated for administration by the intramuscular route, preferably by injection.

36. Chimeric promoter comprising a ubiquitous promoter and one or more NRSE sequences.

37. Chimeric promoter xNRSE-PGK in which x is an integer from 1 to 50.