Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
  • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
  • C07K14/245—Escherichia (G)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/67—General methods for enhancing the expression
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/70—Vectors or expression systems specially adapted for E. coli

Definitions

• the invention relates to the control of bacterial gene expression, especially the regulation of bacterial gene expression under conditions of physiological stress. More specifically, the invention relates to the regulation of bacterial gene expression under
• the regulation of bacterial gene expression occurs at many levels, including transcriptional control, or control of the synthesis of mRNA from a given gene; translational
• mRNA stability or the efficiency at which a given mRNA population within the cell is degraded and rendered inactive.
• the response of bacteria to physiological stress involve the tightly controlled expression of a small number of genes that function to allow the cell to adapt to and function under stress conditions. For example, when bacterial cells are exposed to temperatures above the normal physiological temperature for that organism, a set of genes, designated the heat
• cs genes are expressed. This response to elevated temperatures is well known and described in the prior art. Conversely, when bacterial cells are exposed to lower than physiological temperatures, a different set of genes, designated as cold shock (cs) genes, are expressed. Expression of the cs genes allow the cell to first adapt to the physiological stress, and subsequently grow under conditions of physiological stress. This invention relates to the specific processes that regulate the expression of cs genes.
• cspA can bind to single-stranded DNA and RNA without high sequence specificity and has
• cold-shock domain of eukaryotic Y-box protein family, such as human YB-1 and Xenopus FRGY-2, shares more than 40% identity with E. coli cspA (for review, see Wolffe et ⁇ l., 1992), indicating that the cold-shock domain
• cspA transiently induced upon cold shock during the growth lag period called acclimation period. This period is considered to be required for cells to adapt to a new environmental condition.
• proteins involved in translation such as CsdA (Jones et ⁇ l., 1996), RbfA (Jones and Inouye, 1996) and CspA (Goldstein et ⁇ l., 1990) are specifically produced, which are considered to play important roles in enhancing translation efficiency for non-cold-shock proteins at low temperature (for
• cspA has been quite extensively investigated for the mechanism of its cold-shock induction (for review, see Yamanaka et /., 1998).
• the cspA promoter is highly active at 37°C, even if CspA is hardly detected at this temperature (Fang et ⁇ l., 1997; Mitta et ⁇ l., 1997). Even if the cspA promoter was replaced with the Ipp promoter, a constitutive promoter for a major outer membrane
• cspA expression is still cold-shock inducible (Fang et ⁇ l., 1997), indicating that the cspA induction at low temperature occurs mainly at levels of mRNA stability and its translation.
• the cspA promoter contains an AT-rich upstream element (UP element) (Ross et ⁇ l., 1993) immediately upstream of the -35 region (Fang et ⁇ l., 1997; Goldenberg et al, 1997; Mitta et al, 1997), which is considered to play an important role in
• the 5'-UTR is considered to play a crucial role
• DB downstream box
• ribosomal protein S2 decreased at 42°C. It was proposed that the anti-DB sequence in S2 deficient ribosomes indirectly becomes more accessible to DB, resulting in enhancement of
• cspA expression is regulated in a complex manner at levels of transcription, mRNA stability and translation.
• the 5'- UTR plays a major role in translation efficiency of the cspA mRNA to enhance cspA expression upon cold shock. Specific regions of the 5'-UTR have been found to mediate the regulatory processes described above.
• FIG. 1 shows the plasmid pJJG78 and the effects of the cspA upstream region on the
• Fig. 2 shows the prolonged expression of CspA and inhibition of cold-shock adaptation by pJJG78 and pUC 19-600.
• Fig.3 shows deletion analysis of the cspA upstream region for the cspA derepression function
• Fig. 4 shows the level of transcripts from the chromosomal and plasmid cspA.
• Fig. 5 shows the requirement for the transcription of the 5' untranslated region of the cspA mRNA for the prolonged expression of cspA and inhibition of cold-shock adaptation.
• Fig. 6 shows the effects of over-production of the 5' untranslated region of the cspA mRNA on the production of other cold-shock proteins and non-cold-shock protein.
• Fig. 7 shows the effects of co-ove ⁇ roduction of cspA together with the 5 1 untranslated region of the cspA mRNA on the cold-shock response.
• Fig. 8 shows the effects of ove ⁇ roduction of the first 25-base sequence of the cspA 5' UTR
• FIG. 9. shows cold-shock induction of ⁇ -galactosidase: (A) Construction of cspA-lacZ
• the wild-type cspA is shown on the top.
• the cspA-lacZ fusion in each expression plasmid is shown from the 5' end of the cspA promoter upstream region to lacZ.
• Nucleotide numbers are given starting from the transcription initiation site as +1, determined by Tanabe et al, 1992.
• the crossed hatched, open, dotted and slashed bars represent the cspA promoter, its 5' untranslated region, the cspA coding region and the lacZ coding region, respectively.
• the solid boxes indicate the SD sequence. The positions of deleted regions are shown with nucleotide numbers.
• Fig. 10 shows the analysis of the mRNA stability.
• RNAs were extracted at 0 (lane 1), 1 (lane 2), 3 (lane 3) and 5 min (lane 4) after the addition of rifampicin.
• pMM022 (•); pMM023 ( ⁇ ); pMM024 ( ⁇ ); pMM025 ( ⁇ ); and pMM026 (A).
• Fig. 11 shows the analysis of the mRNA level and translational efficiency.
• mRNA is the average of relative mRNA amounts at 0.5, 1 and 2 h after temperature downshift. Relative translational efficiency of each mRNA was calculated using the efficiency of mRNA of pMM67 as 100%. Column 1, pMM67; column 2, pMM022; column 3, pMM023; column 4, pMM024; column 5, ⁇ MM025; and
• Fig. 12 shows sequence similarities of cspA, cspB, cspG, and cspl mRNAs around the SD sequence and potential base pairing between cspA mRNA and 16S rRNA. Nucleotide numbers of cspA (Tanabe et al, 1992), cspB (Etchegaray et al, 1996), cspG (Nakashima et al, 1996), and cspl mRNA (Wang et al, 1999) are given starting from the major transcription
• initiation site as +1.
• the sequence of 16S rRNA is from Brosius et al, 1978. Nucleotides identical in the three csp mRNAs are shown in bold letters. The 13-base homologous sequence in cspA, cspB, cspG, and cspl are boxed (the upstream box). Positions of the SD sequence and the initiation codon are underlined. Potential base pairings between cspA mRNA and 16S rRNA are indicated by vertical lines. Positions of RNase VI sensitive sites
• Fig. 13 shows the role of the 13-base upstream box sequence in the csp A 5'-UTR region in the
• pKNJ37 is identical to pMM007 except for the deletion of the
• pKNJ38 is identical to pKM67 (Mitta, et al, 1997) except for the addition of the 13-base
• Fig. 14 shows a comparison of the secondary structures of the 5'-UTRs for the deletion
• csp_3-DB-anti-DB complementarity the cspB-OB sequence is boxed and encompasses the region from codons 5 to 9 (Mitta et al., 1997). Additional cspB mRNA-16S rRNA possible base pairings downstream of DB are also shown.
• the AUG codon is circled, the SD sequence is boxed and
• cspB-lacZ fusion constructs On the top, the E. coli cspB gene is depicted from its 5' end. In pB3, pB13 and pB17, the lacZ gene is fused to cspB at residue +177 (3 aa), +200 (13 aa) and +212 (17 aa), respectively.
• the pB13sd and pB17sd are the same as pB13 and pB17, respectively, except that their SD sequences are changed from 5'-AGGA-3' to 5'-CTTC-3'.
• E. coli AR137 cells were transformed with pB3, pB13, pB13sd, pB17 and pB17sd were grown in medium, and at mid-log phase (OD 600
• cspB-lacZ mRNAs were detected by primer extension before temperature downshift (time 0)
• the cspB-lacZ mRNAs were detected by primer extension.
• Fig. 16 shows the effect of a perfectly matching DB enhancing the translation of cspA.
• pJJG78DB 1 and pJJG78DB2 were constructed from pJJG78 as described in Experimental Procedures.
• the DB sequences of pJJG78DBl (12 matches) and pJJG78DB2 (15 matches) are shown at the bottom.
• E. coli AR137 cells transformed with pJJG78, pJJG78DBl and pJJG78DB2 were grown as described above. At mid-log phase, the cultures were shifted to 15°C and after 30 minutes rifampicin was added to a final concentration of 0.2 mg/ml (time 0). Total RNA was extracted at 5, 10 and 40 minutes after rifampicin addition. The cspA-lacZ mRNAs were detected by primer extension. Fig. 17 shows that a perfectly matching DB enhances translation at 37°C: (A) pIN-/ ⁇ cZ
• the Xbal-Sall fragment from pJJG78 or pJJG78DB2 was inserted into the Xbal- SaR sites of pIN-III to create pINZ and pINZDBl, respectively which then were used to create pINZDB2, pINZDB3 and pINZDB4.
• IPTG (1 mM) was added at mid-log phase to each culture.
• ⁇ -Galactosidase activity was measured before (time 0) and at 0.5, 1, 2 and 3 hr after IPTG addition.
• pINZDBl were grown at 37°C under the same conditions described above. IPTG (1 mM) was added at mid-log phase to each culture. Rate of ⁇ -galactosidase synthesis was measured before (time 0) and 0.5, 1, 2, 3 and 4 hr after IPTG addition. Cells were pulse-labeled with trans-[ 35 S]-methionine. Cell extracts from each time point were analyzed by 5% SDS-PAG ⁇ and the ⁇ -galactosidase synthesis was measured by phosphorimager. The ratio of ⁇ - galactosidase synthesis of pINZ and pINZDBl is shown at each time point. Fig. 18 shows ribosomal fractionation of E.
• Fig. 20 shows cell-free synthesis of ⁇ -galactosidase from pINZ and pINZDBl.
• A pINZ or
• pINZDBl DNA 160 ng; 1 ⁇ l was added to the E. coli 30S extract (20 ⁇ l) (Promega) and the transcription-translation coupled reaction was carried out. Lane 1, pINZ DNA; lane 2,
• pINZDBl was carried out as described above. Samples were taken after 15, 30, 60 and 120
• Fig. 22 shows translational enhancement of pINZDBl in cells with S2-depleted ribosomes
• the invention comprises an isolated nucleic acid molecule that prolongs the expression of cold-shock inducible genes under conditions of physiological stress that elicit the cold-shock response in bacteria.
• the invention further comprises an isolated nucleic acid molecule that represses the expression of cold-shock inducible genes under physiological conditions.
• the invention further comprises an isolated nucleic acid molecule that enhances translation of cold-shock inducible genes under conditions of physiological stress that elicits a
• promoters e.g., promoters, downstream boxes and transcriptional terminator sequences
• the invention also comprises transformed bacteria carrying the vectors
• target sequence can be a cold-shock gene sequence or a heterologous gene
• the DB binds to a portion of
• the 16S rRNA is not capable of participation in the translation of cellular mRNAs other than the annealed overexpressed mRNA. It has been further discovered that the entire protein-making machinery of a bacterium may be shut down by providing to the bacterium an mRNA, which encodes a DB which is substantially
• Homologous refers to molecules which have substantially the same molecular sequence of the referenced nucleic acid sequence, but may contain additions, deletions, or substitutions. Homologous molecules are defined as those molecules which hybridize under low or high stringency conditions to a nucleic acid molecule that is precisely
• low stringency conditions for hybridization are: Filters containing DNA are pretreated for 6 hours at 40°C in a solution of 35%
• high stringency conditions may be as
• EDTA 0.02% PVP, 0.02% Ficoll, 0.02% BSA and 500 ⁇ g/ml denatured salmon sperm DNA.
• the filters are hybridized for 48 hours at 65 °C in a prehybridization mixture containing 100
• the ADB is a nucleotide sequence of about 14 bases which is positioned
• the ADB can be readily identified by comparison to
• sequence of the ADB in a bacterium in which the sequence is known for example E. coli.
• a DB complementary to the ADB can be constructed, and
• the mRNA of the invention is an isolated mRNA or an mRNA which has been transcribed from an isolated DNA.
• the mRNA comprises an initiation codon, which codon is preferably AUG.
• Other suitable initiation codons for the mRNA include GUG and UUG.
• the mRNA of the invention further comprises a downstream box sequence, which is typically 3' to the initiation codon.
• the codons of the DB may or may not be in-frame with the initiation codon.
• the DB sequence may be immediately adjacent to the initiation codon so that there are no intervening nucleotides.
• the DB is separated from the initiation codon by an intervening nucleotide sequence between 1 and 30 nucleotides long.
• the base sequence of the intervening sequence is immaterial and may be constituted of any sequence of nucleotides.
• the intervening nucleotide sequence is 9 to 15 nucleotides in length, with a most preferred length of 12 nucleotides.
• the DB may overlap the initiation codon. That is, any one of the three nucleotides of the initiation codon of the mRNA of the invention may form the 5' end of the DB.
• the DB sequence of the mRNA of the invention is a nucleotide sequence which is complementary to the ADB of the 16S rRNA of a bacterium.
• the DB is between 6 and 20 bases long, preferably between 8 and 14 bases long, although the DB may be longer than 20 bases.
• the DB may comprise nucleotides which are complementary to nucleotides 3* or 5', or both, to the ADB. Regardless of length of the DB, a higher degree of
• complementarity between the DB and the ADB is associated with more effective annealing, resulting in more efficient inhibition of bacterial protein synthesis, in accordance with the method of the invention.
• the mRNA In addition to the initiation codon, the DB, and any intervening sequence, the mRNA
• construct of the invention may comprise a nucleotide sequence 5' to the initiation codon or 3' to the DB.
• the mRNA construct may comprise a sequence 3' to the DB which encodes a polypeptide or may comprise a termination codon.
• the mRNA construct may comprise an untranslated sequence and/or a Shine-Dalgarno sequence 5' to the initiation codon.
• the length of the mRNA construct may be any length between 8 nucleotides to about 45 nucleotides.
• the mRNA may be much longer, up to several hundreds of nucleotides in length.
• the mRNA construct is free of sites for RNA endonucleases.
• the portion of the mRNA construct comprising the essential portions of the construct, that is the initiation codon and the DB be free of sites for RNA endonucleases, which might otherwise degrade the mRNA construct and free the bacterial 16S rRNA to bind to bacterial mRNAs.
• the mRNA construct of the invention may have a sequence which is similar or identical to an mRNA sequence found naturally in a bacterium.
• E. coli proteins comprise a Shine-Dalgarno sequence, an initiation codon, and a downstream box substantially complementary to the ADB of the E. coli 16S rRNA.
• E. coli mRNAs which contain a Shine-Dalgarno sequence, an initiation codon, and a downstream box complementary to the E. coli ADB include RecA, Hns, NusA, InfB, and
• Each of the following DB is substantially complementary to the ADB of the E. coli 16S rRNA which ADB has the sequence: ADB 3' (-1481) UACUUAGUGUUUCA (-1469) 5' (SEQ ID NO:l)
• DB #3 5' AUG ACUGGUUUAGU 3' (SEQ ID NO:4)
• DB #4 5' AUGAGUUAUGUAGA 3' (SEQ ID NO:5)
• a suitable mRNA construct according to the invention can be constructed using any of
• the DNA of the invention is any isolated DNA which encodes for a mRNA which is suitable for the mRNA construct of the invention, as described above.
• the DNA may further comprise an additional nucleotide sequence 5' to the initiation codon, which sequence may include a promoter sequence. Such promoter sequences may be used to control transcription of the mRNA construct.
• the DNA may comprise a sequence 5' to the initiation codon which sequence has a function other than as a promoter, such as a Shine-Dalgarno sequence, and/or a sequence which has no known function.
• the DNA may comprise a sequence 3' to the portion encoding the DB of the mRNA construct, which sequence may include, for example, a termination codon, or may encode a polypeptide, and a sequence required for transcription
• An example of a suitable DNA which encodes for the mRNA construct of the invention is: 5' ATGY (n) ATGACTGGTATCGT 3' (SEQ ID NO:8) where n is a whole number from 0 to 30, and Y is G, C, T, or A, wherein each occurrence of Y may be the same as or different from any other occurrence of Y.
• the 5' end of the DB overlaps the initiation codon, ATG.
• the DNA may contain additional sequences, as stated above, at the 5' and/or 3' end of the DNA.
• the DNA sequence of the invention may be contained within a vehicle or cloning vector, such as in a plasmid or phage vector.
• the DNA sequence in the vector may be under the control of a promoter sequence located 5' to the initiation codon.
• These vectors containing the DNA of the invention may be used to transform a host bacterium which may be used to overexpress the mRNA of the invention, that is to produce the mRNA in the bacterium at levels higher than produced in similar non-transformed bacteria. Any bacterium which may be transformed by means of a cloning vector is a suitable host for the DNA sequence of the invention.
• the construct producing the mRNA may be packaged in a bacteriophage which would permit the mRNA to be used as a disinfectant or as a topical antibiotic preparation. It is conceivable that strategies for delivery will be devised to permit transformation of bacteria which are causing infection of a plant or animal, such as a mammal like humans, dogs, cats, cattle, horses, and livestock. Such antibiotics are safe for use in eukaryotes, as eukaryotes lack the 16S rRNA that is present in bacteria.
• a mRNA comprising an initiation codon and a DB which is complementary to the ADB of the 16S rRNA of a bacterium is caused to be overexpressed in a bacterium, and is then allowed to anneal to the ADB of the 16S rRNA of the bacterium, thereby inhibiting production of proteins encoded by other mRNAs in the bacterium.
• the bacterium may be transformed by means of a vehicle harboring a DNA sequence which codes for the mRNA of the invention.
• expression of the mRNA sequence of the invention is controlled by placing the DNA sequence under the control of an inducible promoter.
• an inducible promoter For example, if it is desired to kill a harmful bacterium or block its growth while sparing a beneficial bacterium, the DNA sequence may be placed under the control of a promoter which is responsive to a product which is present only in the first bacterium. In this way, the lethal antibiotic effect of the
• mRNA of the invention will affect only the undesirable, harmful bacterium.
• Another means of controlling the expression of the protein production- inhibiting mRNA sequence is to employ a DNA sequence which codes for an mRNA which is unstable under certain conditions.
• shock protein CspA
• CspA contains a region immediately 5' to the Shine-Dalgarno region which is susceptible to degradation, presumably by RNase ⁇ , at physiological growth temperatures of about 37°C. Therefore, the cspA mRNA containing the 5' UTR is unstable under normal growth conditions, having a half life estimated to be approximately 12 seconds.
• Other cold- shock proteins such as E. coli CspB and CsdA, are similarly unstable at physiological growth temperatures due to instability of their mRNAs.
• the half life of the cspA mRNA increases dramatically, to about 15 minutes, an increase in stability of about 75 times over the mRNA at normal physiological growth temperatures.
• this region can be used to control the expression of the mRNA sequence of the invention, so that its antibiotic effect occurs only below physiological growth temperatures, such as under cold-shock conditions.
• the antibiotic effect of the method of the invention is augmented at cold-shock conditions because a cold- shocked bacterium requires new ribosomal factors, whose synthesis is blocked by ove ⁇ roduction of an mRNA containing the DB sequence.
• the antibiotic effect of the method of the invention in which the mRNA of the invention is caused to be overexpressed within a bacterium is increased concomitantly with an increase in copy number of the mRNA which is to be expressed. That is, whereas a minimal overexpression of the mRNA of the invention will inhibit the production of proteins by the bacterium, such an inhibition may not be sufficient to prevent further growth of the
• a similar effect is noted with respect to complementarity of the DB of the overexpressed mRNA and the ADB of the bacterial 16S rRNA.
• Overexpression of an mRNA comprising a DB with 100% complementarity will be more efficient in binding to the ADB than will be an mRNA comprising a DB with lesser (75%) complementarity.
• the protein blocking effect of an mRNA having a more highly complementary DB will be more pronounced compared to that of an mRNA having a less complementary DB. Therefore, when using an mRNA having a less complementary DB, it may be useful to express the mRNA in a higher copy number to achieve the same or similar antibiotic results as with an mRNA having a more complementary DB.
• the translational inhibitory properties of the downstream box are also advantageous for overexpressing a heterologous gene in a transformed bacterium after cold shock. Inhibition of the translation of endogenous bacterial proteins will allow the heterologous gene product to accumulate to very high levels in the transformed organism. Furthermore, a construct containing the downstream box in conjunction with a strong promoter and the 5' untranslated region of a cold shock inducible gene, which functions to stabilize the mRNA transcript at reduced temperature, will direct efficient high level expression of the heterologous gene at reduced temperature. Another important embodiment of the invention relates to the role of the 5' -end untranslated region of the mRNA for cspA, the major cold- shock protein of E. coli, in cold
• cold-shock response a specific pattern of gene expression called cold-shock response, which includes induction of a set of proteins defined as cold-shock proteins (Jones et al. 1992; for review, see Jones and Inouye 1994).
• the cold-shock response occurs during the lag period of cell growth, and is considered to be required for cellular adaptation to low temperature.
• CspA the major cold-shock protein in E. coli, is dramatically induced upon temperature downshift, whose production reaches as high as 13% of total protein synthesis (Goldstein et al. 1190).
• CspA production during cold-shock response is dramatically induced upon temperature downshift, whose production reaches as high as 13% of total protein synthesis.
• CspA consists of 70 amino acid residues, and shows 43% identity to the "cold- shock domain" of the eukaryotic Y-box protein family which is known to be associated with gene regulation and mRNA masking (for review, see Wolffe et al. 1992; Wolffe 1993).
• the three-dimensional structure of CspA has been determined, consisting of five anti-parallel ⁇ - sheets which form a ⁇ -barrel structure (Newkirk et al. 1994; Schindelin et al. 1994).
• Two RNA binding motifs, RNP1 and RNP2 are identified on ⁇ 2 and ⁇ 3 sheets, respectively.
• a DNA sequence is capable of prolonging the
• the DNA sequence that is competent to confer this activity comprises the 5'-UTR or at least a portion of the 5'UTR of a cold shock inducible mRNA transcript and a promoter, active under conditions of physiological stress that induce the cold shock response in a bacterium. Furthermore, it was found that not the entire 5'-UTR was essential, but that the sequence responsible for blocking the transient expression of the cold shock genes, like cspA, resides within the first twenty five nucleotides of the 5'-UTR.
• cold shock genes showed that cspB, cspG and csdA possessed similar sequences within their respective 5'-UTR and were expressed in a transient manner in response to physiological stress that induces the cold shock response. This suggests that these genes are regulated in a similar manner to csp A. Based upon these sequence comparisons, the sequence responsible for this activity, hereafter designated the cold box, was shown to be situated between nucleotides +1 and +11 of the 5'-UTR of cspA, cspB, cspG and csdA.
• the cold box normally functions to down regulate the expression of cold shock genes. This was shown by hyper-expression of just the cspA 5'-UTR in E. coli, which resulted in a prolongation of the expression of cold shock inducible genes in these cells.
• the cold box functions probably by interacting with the CspA protein itself, or with another protein whose function is dependent upon CspA. This was shown by subsequently hyper-expression of the
• the cold box appears to comprise a repressor binding site that functions to repress the expression of cold shock genes after their induction, resulting in transient expression of these genes.
• the CspA protein begins to interact with the cold box , either directly by binding the cold box sequence or indirectly by stimulating another factor to interact with the cold box, resulting in repression of the cold shock inducible genes.
• the 5' UTR is unique is that it is longer than most E. coli 5'UTRs. It plays multiple functions in cspA expression. It represses cspA expression at 37°C.
• the UTR also has a positive effect on mRNA stability at 15°C. This was determined by noting an increase in steady state levels of mRNA of constructs having the UTR. However, even though more mRNA was present in these experiments, the mRNA was not
• the 5'-UTR enhances the translatability of cspA transcripts through a sequence situated between +117 and +143 of the 5' UTR. Comparison of this region between different cold shock inducible revealed a 13 base sequence (+123 - +135) having the sequence 5'- GCCGAAAGGCACA-3' (SEQ ID NO:48) that was conserved among cspA, cspB, and cspG and may represent enhancer of translation. Thus, this sequence mediates efficient translation of the mRNA that possesses it. This 13 base region exhibits homology with the 16S rRNA, similar to what was previously observed with the DB, but the new translational enhancer region is complementary to a different region of the 16S rRNA than DB. Therefore, this region of the 5'-UTR may also assist in translating csp mRNAs by a mechanism similar to the downstream box interactions with ribosomal RNA.
• expression plasmids capable of high level expression of cold shock inducible genes, or of a heterologous gene, are constructed.
• Such expression plasmids contain DNA fragments encoding the 5'UTR or a portion or portions thereof of a cold shock inducible gene, comprising one or more of the regulatory elements described above, positioned downstream of a promoter that is functional under conditions of physiological stress that induce the cold shock response in a bacterium.
• promoters may be selected from the group including the cspA, cspB, cspG or csdA promoters, the E. coli Ipp promoter, or any other such promoter that is active under conditions of physiological stress.
• Such expression plasmids may also contain downstream of the promoter and DNA fragment encoding the 5'-UTR comprising one or more of the regulatory elements described, and a
• transcriptional terminator sequence examples include sequences such as the E. coli rrnB terminator.
• the expression plasmids of the invention may also comprise a restriction site, or a sequence comprising multiple restriction sites, such site or sites situated between the 5'-UTR encoding one or more of the regulatory elements and the transcriptional terminator to facilitate the insertion of a heterologous gene.
• the expression plasmids of the invention may comprise additional sequences known in the art to facilitate the efficient translation of the expressed gene.
• sequences may include a Shine-Dalgarno sequence, situated between the 5'UTR sequence and the restriction site(s) and/or a DNA fragment encoding a downstream box, situated between the Shine-Dalgarno sequence and the restriction site(s).
• the source of the Shine-Dalgarno sequence is not especially limited, and may be derived from cold shock proteins or may be from another gene.
• Such expression plasmids are capable of directing high level expression of a heterologous gene for a prolonged period of time under conditions of physiological stress that elicit the cold shock response of a bacterium. Under these conditions, the synthesis of endogenous proteins by the host bacterium is blocked, allowing the product of the heterologous gene to accumulate to high levels within the cell.
• the expression vector comprises a promoter, a 5'UTR, cold box, Shine-Dalgarno sequence and a downstream box (DB).
• This expression vector may be used so that a nucleic acid molecule encoding a target protein may be ligated into the expression vector using at least one restriction site.
• nucleic acid molecules encoding proteins that are unstable, or that fold improperly in the bacterial host cell at physiological temperatures can be expressed at temperatures below the physiological temperature of the host bacterium.
• Such nucleic acid molecules may be inserted, preferably in-frame to the restriction site or sites to allow transcription of the nucleic acid and translation of the resulting mRNA.
• conditions may facilitate the proper folding, increase the stability or decrease the rate of
• the plasmids or vectors may be used to transform bacteria by any method known in the art, including, but not limited to calcium chloride transformation, electroporation, and the like.
• the bacterial species which may be transformed is not particularly limited. In a preferred embodiment, E. coli is used.
• the transformed bacteria may be used to overexpress a target protein of interest, or may be used to produce large amounts of the plasmids or vectors for subsequent isolation and purification.
• a nucleic acid molecule encoding a target protein is ligated into the plasmid using one or more restriction sites, preferably in-frame to the initiation codon, if an initiation codon is provided upstream of the insertion site for the target protein.
• the nucleic acid molecule encoding the target protein may be ligated into the plasmid such that its own initiation codon will serve as the initiation codon in the transcript.
• the constructs may be designed and assembled to include a selectable marker. That is, for example, a drug resistance gene which allows transformed bacteria to grow in the presence of a drug which does not permit the growth of non-transformed bacteria. Any selectable marker known in the art may be used. Examples of selectable markers include, but are not limited to ampicillin resistance, neomycin resistance, kanamycin resistance and tetracycline resistance.
• the constructs may also include an inducible promoter.
• the inducible promoter may be any inducible promoter.
• a lacZ promoter may be included which may be induced by the addition of IPTG
• the constructs will contain a promoter which is active
• overexpression of a target protein in conditions that elicit a cold-shock response reduces the synthesis of at least one native bacterial protein. More preferably, the synthesis of many native proteins is reduced or blocked.
• pJJG02 was constructed from pJJGOl (Goldstein et al, 1990) as follows: A 998-bp fragment which contains the entire csp A gene was obtained from pJJGOl by Hindl ⁇ l and Xmnl digestion. This fragment was then treated with the Klenow fragment of DNA polymerase (Life Technologies), and inserted into the Sm ⁇ l site of pUC9.
• pJJG21 was constructed from pJJG02 by creating an Xbal site immediately upstream of the Shine-Dalgarno sequence of cspA as follows: +13AATTT_(A)C(T)TAG(A)AGGTAA+153 (SEQ ID NO:9)(the original nucleotides in the parentheses were substituted by the underlined nucleotides; ref. 1).
• pJJG81 was constructed from pJJG02 by creating an_Yb I site immediately downstream of the transcription initiation
• cspA site of cspA as follows: +1ACGGTTCTAGACGTA+15 (SEQ ID NO:10)(nucleotides underlined represent the inserted bases).
• pJJG78 is a transcriptional fusion of the 0.6-kb csp A upstream region and lacZ as follows: the 1-kb EcoRllBamHl fragment containing cspA from pJJG21 was filled in with Klenow enzyme and ligated into the Smal site of pUC19. Then, the 0.6-kb Xbal fragment containing the cspA regulatory region (from -457 to +143) was excised and ligated into the Xbal site in pKM005 (Inouye, " M. et al, 1983) in the correct orientation.
• pUC 19-600 was constructed by insertion of the 0.6-kb EcoRllXbal fragment from pJJG21 into the EcoRllXbal sites of pUC19.
• pJJG81/X,S containing fragment 1 ( Figure 3) was constructed by removing the 0.74-kb Xb ⁇ llSa . fragment from pJJG81. Both ends were treated with Klenow fragment, followed by self-ligation. All the other constructs shown in Fig. 3 were made by PCR (Boehringer Mannheim protocol). PCR amplified fragments were inserted into the Sm l site of pUC19. All PCR products were confirmed by DNA sequencing
• p2JTEK was constructed as follows: PCR product by primer 3549 5'- CGGCATTAAGTAAGCAGTTG-3' (SEQ ID NO:l 1) and primer 4428 5'- CTGGATCCTTTAATGGTCTGTACGTCAAACCGT-3' (SEQ ID NO: 12) was cloned into the Smal site of pUC19.
• This PCR product contains cspA from -146 to +25 as the cspA transcription start site is defined as +1.
• telomere sequence was amplified by PCR using primer 6290 5'-CGGAATTCAGCCTGTAATCTCT-3' (SEQ ID NO: 13) and 4860 5'- CTGTCGACTTACTTACGGCGTTGC-3' (SEQ ID NO.14).
• the PCR product was then digested with EcoRI then cloned into the plasmid described above which was digested with EcoRI and Sspl.
• the 52-bp Kpnl and EcoRI fragment from Bluescript II SK was then cloned into the EcoRI and Kpnl site. All PCR products were confirmed by DNA sequencing (Sanger et al, 1977).
• p ⁇ mT ⁇ K was constructed in the same way as p2JTEK except that the first PCR was
• primer 3552 5'-GACAGGATTAAAAATCGAG-3' (SEQ ID NO: 15) and 6196 5'-AACCGTTGATGTGCA-3' (SEQ ID NO: 16).
• cspA from -278 to +6 as the csp A transcription start site is defined as +1. All PCR products were confirmed by DNA sequencing (Sanger et al, 1977).
• primer DIR 5'-ACTACACT/TTGATGTGCATTAGC-3' (SEQ ID NO:19)(complementary to -15 to +1 / +28 to +35), primer D2R, 5'-CAACGATAA GCTTTAATGGTCTGT-3' (SEQ ID NO:20) (complementary to +13 to +27 / +56 to +64), primer D3R,
• primer D4R 5'-CGGCGATAT/AATGTGCACTACGAGGG-3' (SEQ ID NO: 22) (complementary to +69 to +85 / +118 to +126), and primer D5R, 5'-TACCTTTAA/GGCGTGCTTTACAGATT-3' (SEQ ID NO:23)(complementary to +101 to +117 / +144 to +152) was used as the mutation primer R and primer D1F,
• primer D3F 5'-TCAAGAG/CCTTTAACGCTTCAAAA-3' (SEQ ID NO:26)(nucleotide +49 to +55 / +86 to +102), primer D4F, 5'-GCACATT/ATATCGCCGAAAGGC-3' (SEQ ID NO:27)(nucleotide +79 to +85 / +118 to +132), and primer D5F, 5'-AAAGCACGCC/TTAAAGGTAATACACT-3' (SEQ ID NO:28)(nucleotide +108 to +117 / +144 to +159), was used as the mutation primer F, respectively, where the position of each deletion is indicated by a slash.
• a plasmid, pJJG02 Goldstein et al. (1990), which contains the wild-type cspA, was used as template DNA.
• each set of the first PCR products were mixed, heat denatured, annealed, and extended by Taq polymerase.
• the resulting products were further amplified by PCR using primer 67F and primer #4311.
• the final PCR products were digested with Nhel and BamKl, and inserted into the Xbal-BamHl site of ⁇ KM005 (Inouye 1983).
• the PCR fragment was cloned into the Xbal-BamRl site of pRS414X, a pRS414 derivative (Simons et al, 1987), in which the unique S ⁇ l site has been changed to an Xbal site.
• PCR was carried out using primer 67F and primer #4311 as primers and pJJG02 as a template.
• the PCR fragment was digested with Nhel and BamKl, and inserted into the Xbal-BamRl site of pRS414X.
• pKNJ38 was constructed as follows: oligonucleotide #8509,
• CTAGCCGAAAGGCACAAATTAAGAGGGTATTAATAATGAAAGGGGGAATTCCA- 3' SEQ ID NO:29
• oligonucleotide #8510, 5'-AGCTTGGAATTCCCCCTTTCATTATTAATACCCTCTTAATTTGTGCCTTTCGG-3' SEQ ID NO:30
• E. coli AR137 harboring different plasmids was grown at 37°C to mid-log phase in 15 ml of M9-Casamino acid medium using a 125-ml flask. The culture was then transferred to a 15°C shaking water bath. Culture temperature reached 15°C from 37°C within 2 to 3 min under the condition used. A 1.5-ml culture was taken immediately before the temperature
• ⁇ -galactosidase activity of the culture was measured according to Miller (1972). The assay was done in duplicate at each time points.
• cspB DNA fragments were amplified by PCR using synthetic oligonucleotide primers containing the BamHI site at the 5' end.
• a plasmid, pSJ7 (Lee et al, 1994) carrying the wild- type cspB gene was used as a template DNA to create the PCR fragments B3, B13 and B17.
• the 5'-end oligonucleotide primer used ineach of the above PCR reactions is 5'-
• primers for the PCR products B3, B13, and B17 were 5'- CCGGATCCAGATTTGACATTCTACA-3' (SEQ ID NO:32), 5'- CCGGATCCAGGTTAAACCATTTT-3' (SEQ ID NO:33), and 5'CCGGATCCAGACCTTTATCAGCGTT-3' (SEQ ID NO:34), respectively.
• the SD sequence in the cspB gene was created by site-directed mutagenesis using the QuickChangeTM Site Directed Mutagenesis Kit (Stratagene). The PCR reaction was carried
• pSJ7sd was used as a template to make the PCR fragments B13sd and B17sd.
• end oligonucleotide primers used in these PCR reactions are the same as the ones used for the PCR fragments B13 and B17. All of the above PCR products wre cloned at the BamHI site of pRS414 vector (Simmons et al, 1987; Lee et al, 1994) to create the pB3, ⁇ B13, pB13sd, pB17, and pB17sd constructs.
• the cspA-lacZ fusion constructs were made by the insertion of annealed
• oligonucleotides DB1 (5'-AATTAATCACAAAGTGGG-3') (S ⁇ Q ID NO:37) with DB1'
• the pIN-/ ⁇ cZ constructs were made by inserting the Xbal-Sall fragments from pJJG78
• ZDB2' (5 '-AATTCCCACTTTGTGATTCATAATTCCCCCTTTCATTATTAATAAGGG-
• plasmids were grown at 37°C to mid-log phase in 20 ml of LB medium containing 50 ⁇ g/ml of ampicillin in a 125 ml flask. The cultures were then transformed to a 15°C shaking water bath or isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) was added to a final concentration of 1
• E. coli AR137 harboring different plasmids was grown under the same conditions used for the ⁇ -galactosidase assay described above.
• a 1.5-ml culture was taken at each time point and RNA was extracted by the hot-phenol method as described by Sarmientos et al., 1983.
• rifampicin was added at 1 hr after the temperature downshift at a final concentration of 200 ⁇ g/ml to stop transcription, and a 1.5-ml culture was taken at each time point.
• the culture was first shifted to 15°C for 30 min to accumulate the mRNAs. Then, a 5-ml culture was taken and mixed with a 5 ml of the medium containing 400 ⁇ g/ml rifampicin in a glass flask kept in
• the cspA-lacZ mRNAs were detected by the primer extension method as described previously (Jiang et al. 1993) using a 32 P-labeled primer Ml 3-47,
• E. coli JM83 (pcnB * ) cells carrying pINZ or pINZDBl were grown in 600 ml of LB medium in a 4-liter flask under the same condition as described above. At mid-log phase IPTG (1 mM) was added to each culture. Ribosomal particles were isolated by the procedure described by Dammel and Noller (1995), with some modifications: An 100-ml aliquot from the original culture was taken at each time point and chloramphenicol was added to a final concentration of 0.1 mg/ml to stop cell growth. Cells were immediately collected by centrifugation (5,000 x g for 10 min at 4°C), resuspended in buffer 1 [20 mM Tris-HCl
• the cell extracts (0.5 ml) were then layered on top of a 5-40 % (w/w) sucrose gradient (7.5 ml) and the polysomes and ribosomal subunits were separated by centrifugation at 151,000 x g for 2.5 hr at 4°C using a Beckman SW-41 rotor.
• the polysome profiles were detected by an FPLC system and a total of 15 fractions of 0.5 ml each were collected.
• lacZ-mRNA was estimated by phosphorimager.
• EXAMPLE 3 Multicopy effects of the cspA upstream region on cold-shock adaptation.
• transient production of CspA corresponds to the duration of growth arrest, known as the lag
• cspA expression of cspA is considered to be required for cellular adaptation to lower temperatures.
• pJJG78 was first constructed, in which the 600-bp cspA upstream region was transcriptionally fused to the lacZ gene (Fig. 1 A).
• This 600-bp upstream region of cspA encompasses the region from -457 to +143 which is right before the Shine-Dalgarno sequence of cspA, as the cspA transcription initiation site is defined +1 (Goldstein et al, 1990).
• E. coli strain CL83 was transformed with pJJG78 and the production of ⁇ -galactosidase was examined by pulse-labeling cells with [ 35 S]-methionine at 0, 0.5, and 3 hr after temperature
• the 600-bp cspA upstream region cloned in pJJG78 may sequester a factor responsible for the inhibition of csp A production after cold shock, resulting in the prolonged expression or the derepression of csp A.
• the 600-bp upstream region of cspA was re-cloned into pUC19.
• the plasmid is called pUC 19-600. Note that the copy number of pUC19 (300 copies/cell) is about 10 times higher than pJJG78 derived from pBR322 (30 copies/cell).
• EXAMPLE 4 Overproduction of the 5' untranslated region of the cspA mRNA. In order to determine the precise region within the 600-bp sequence required for the
• fragment 3 (186-base deletion)
• fragment 2 (186-base deletion)
• fragment 2 was further dissected into fragment
• Fragment 2F which is longer by 33 bp at the 5' end than fragment 2B was also
• fragment 2 is functional for both the cspA derepression and the inhibition of cold-shock adaptation, while fragment 2 A is not, indicates that the cspA promoter region alone is not sufficient for the functions of the 600-bp fragment. Furthermore, the fact that functional fragment 2G is longer at the 5' end by 31 bp than the non-functional fragment 2F suggests a possibility that the both functions require the full cspA promoter for the transcription of the 5' UTR of the csp A mRNA. Note that the csp A mRNA has a 159-base untranslated sequence at the 5' end (Goldstein et al, 1990).
• cspA transcripts produced from the cloned fragments were examined by primer extension.
• primer extension was performed with two independent primers; primer 3550 which corresponds to the sequence from +124 to
• primer 3551 which corresponds to a part of the csp A coding sequence from +224 to +243.
• the former primer detects the csp A mRNA transcribed from both the plasmid and the chromosome, while the latter detects the mRNA only from the chromosomal csp A gene, since none of the plasmids contains the csp A coding region.
• the amounts of the transcript from the chromosomal cspA gene indicated by primer 3551 were basically the same among all constructs (Fig. 4, lanes 1 to 6).
• the amount of the csp A transcripts encompassing the 5' UTR indicated by primer 3550 showed two different levels.
• the amounts of the transcripts detected by primer 3550 were almost identical to that with pUC19 (lane 1 in Fig. 4), indicating that the cspA regions cloned in these plasmids were not transcribed.
• cspA mRNA is required for both the cspA derepression and the inhibition of cold-shock adaptation
• the entire promoter fragment (-457 to -1) plus 6-base (+1 to +6) region from cspA was cloned into pUC19. This fragment was designated fragment 1 (see Fig. 3).
• fragment 1 most of the 5' UTR of the cspA mRNA was deleted in fragment 1.
• Fig. 5B fragment 1 was incapable of derepressing cspA, in spite of the fact that the transcripts from the cspA promoter were clearly detectable by primer extension (Fig. 5A). From these results, it is concluded that at least a portion of the cspA 5'UTR from +1 to +143 has to be transcribed to exert the effect on the cspA expression and the cold-shock adaptation.
• the protein expression pattern of the cold-shocked cells ove ⁇ roducing the cspA 5' UTR was analyzed by two-dimensional electrophoresis.
• the plasmid pJJG21/X,S contains the entire cspA promoter and most of the 5' UTR of the cspA mRNA (+1 to +143), while pJJG81/X,S contains the entire csp A promoter but only the first 6-base region of the 5'UTR of the cspA mRNA.
• mRNA causes the concomitant inhibition of other cellular proteins. This implies that cell growth upon cold shock would be more severely inhibited with the cells ove ⁇ roducing the 5'UTR of the cspA mRNA than that with the wild type cells.
• the growth of cells harboring pUC 19-600 or pUC19-2G (see Fig. 3) was indeed severely inhibited. This was characterized by a longer lag period (data not shown).
• EXAMPLE 7 Identification of a repressor binding site We attempted to identify the specific region responsible for the cspA derepression
• ⁇ -galactosidase activities were 10 fold higher in cells harboring pMM024 ( ⁇ 56-86) and pMM025 ( ⁇ 86-117) than in cells harboring the wild-type pMM67, while other deletion mutants [pMM022 ( ⁇ 2-27), pMM023 ( ⁇ 28-55) and pMM026 ( ⁇ l 18-143)] showed very low ⁇ -galactosidase activities.
• UTR region from base +56 to +117 is involved in the repression of cspA expression at 37°C.
• ⁇ -galactosidase activity increased almost 5 fold with pMM024 ( ⁇ 56-86) after temperature downshift, while it increased only less than 2 fold with pMM025 ( ⁇ 86-117), suggesting that the region deleted in pMM025 ( ⁇ 86-117) plays an important role in cold- shock induction of cspA. Similar to pMM025 ( ⁇ 86-117), ⁇ -galactosidase activity with pMM023 ( ⁇ 28-55) was poorly induced at low temperature.
• the region deleted in pMM026 ( ⁇ l 18-143) appears to play a crucial role in csp A expression at both high and low temperatures, since ⁇ -galactosidase activity was very low at both 37 °C and 15°C (Fig. 9B).
• the deletion of the region from base +2 to +27 (pMM022) containing the cold-box sequence involved in cspA autoregulation (Jiang et al, 1996) has little effect on the cold- shock induction of cspA as predicted (Fig. 9B).
• csp A promoter is known to be active even at 37°C (Goldenberg et al, 1997; Fang et al, 1997; Mitta et al, 1997). Since all the deletion constructs have the intact csp A promoter (Fig. 9 A), transcription efficiencies of these constructs are likely to be identical.
• the cspA mRNA stability is significantly different depending on growth temperatures (Brandi et al, 1996; Goldenberg et al, 1996; Bae et al, 1997; Fang et al, 1997; Goldenberg et al, 1997; Mitta et al, 1997). Therefore the effect of the deletion mutations on the csp A expression at low temperature may be due to different mRNA stabilities of the constructs.
• the primers the primer
• strain AR137 a pcnB mutant
• strain AR137 a pcnB mutant
• Fig. 10B All the transcripts were unstable at 37°C with their half-lives estimated between 30 and 45 s. At 15°C, however, they became very stable with half-lives between 20 and 40 min. These half-lives are similar to those for the wild-type construct pMM67 obtained previously (Mitta et al, 1997) as well as to those for the wild-type chromosomal cspA (Fang et al, 1997; Goldenberg et al, 1997). It is important to note that in contrast to the similar mRNA half-lives at low temperature, ⁇ -galactosidase activities induced at 15°C were widely varied among all these constructs as shown in Fig. 9B.
• transcripts for pMM022 ( ⁇ 2-27) and pMM024 ( ⁇ 56-86) were very similar to that of the wild-type construct pMM67 (column 1 in Fig. 1 IB). It should be noted that ⁇ - galactosidase activity of pMM024 ( ⁇ 56-86) at 37°C was more than 10 times higher than that of pMM022 ( ⁇ 2-27) (see Fig. 9B). In the case of pMM023 ( ⁇ 28-55), pMM025 ( ⁇ 86-117) and pMM026 ( ⁇ l 18-143), the amounts of transcripts at 37°C are approximately half of that of pMM67.
• ⁇ -galactosidase activity of pMM025 was 10 times higher than those of pMM023 ( ⁇ 28-55) and pMM026 ( ⁇ l 18-143) (Fig. 9B).
• EXAMPLE 10 Translational Regulation by the 5'-UTR After temperature downshift, the amounts of the cspA-lacZ mRNAs dramatically increased in all the constructs and the induction patterns are shown in Fig. 11 A and 1 IB. They showed very similar pattern in accumulation of the transcripts as that of the wild-type
• pMM67 such that the maximal induction was observed at 1 h after temperature downshift.
• the patterns of mRNA levels were very similar between pMM67 and pMM024 ( ⁇ 56-86), while the others also showed a similar induction pattern although the amounts of their mRNAs were approximately a half of that of the pMM67 mRNA at each time point. Since the promoter activity of all the deletion constructs are considered to be the same, and in addition their mRNA stabilities were also very similar to that of the wild-type construct (Fig. 10B), lower amounts of mRNAs for all the deletion constructs except for pMM024 ( ⁇ 56-86) are probably due to their slower transcription elongation rate and/or transcription attenuation within the 5'-UTR.
• cspA expression is regulated at the levels of transcription, mRNA stability and translation as follows: (I) The cspA gene has a strong promoter equipped with the UP element, which works at both 37°C and 15°C (Fang et al,
• the cspA mRNA contains the downstream-box (DB) sequence downstream of the initiation codon, which plays a major role in enhancement of translation initiation at low temperatures (Etchegaray and Inouye, unpublished; Mitta et al, 1997).
• DB downstream-box
• the cspA mRNA has an unusually long 5'-UTR (Tanabe et al, 1992), consisting of 159 bases, and is extremely unstable at 37°C (Brandi et al, 1996; Goldenberg et al, 1996; Bae et al, 1997; Fang et al, 1997; Jiang et al, 1997; Goldenberg et al, 1997; Mitta et al, 1997).
• the cspA mRNA becomes stable. Again, this stabilization of mRNA upon cold shock does not require any de novo protein synthesis.
• the 5'-UTR makes the cspA mRNA extremely unstable at 37°C, in such a way as cspA is cold-shock inducible. It is worth mentioning that although the cspA mRNA becomes stable and is accumulated at the nonpermissive temperature in the temperature- sensitive RNaseE mutant, CspA production was not detected under this condition (Fang et al, 1997), suggesting that in addition to the stability of mRNA another role may exist in the
• 5*-UTR 5*-UTR.
• ⁇ MM022 ( ⁇ 2- 27), pMM023 ( ⁇ 28-55) and pMM026 ( ⁇ l 18-143) showed the similar ⁇ -galactosidase activities as the wild-type pMM67, while pMM024 ( ⁇ 56-86) and pMM025 ( ⁇ 86-117) showed more than 10 fold higher ⁇ -galactosidase activities than pMM67, indicating that the region from base +56 to +117 is involved in the repression of cspA expression at 37°C.
• mutants Based on the ⁇ -galactosidase activities after temperature downshift, mutants can be
• pMM026 In pMM026 ( ⁇ l 18-143), the deletion mutation is clearly affecting the translation efficiency but not the stability of mRNA.
• the deleted region was found to contain a 13-base sequence (base +123 to +135) well conserved in the mRNAs for all the cold-shock inducible cspA family, csp A, cspB, cspG, and cspl (see Fig. 12).
• This sequence designated the upstream box may form a distinct secondary structure in both the wild-type pMM67 and Class I constructs [pMM022 ( ⁇ 2-27) and pMM024 ( ⁇ 56-86)] (Fig. 14). Class I constructs showed a similar translation efficiency to the wild-type.
• the upstream box may function to punctuate the formation of a stable secondary structure immediately upstream of the SD sequence, allowing it highly accessible to ribosomes.
• the upstream-box sequence is complementary to the 16S rRNA sequence from base 1023 to 1035 (see Fig. 12), it is possible that the upstream-box sequence may be another c/s-element, which may enhance translation
• the synthesis of the heat-shock sigma factor, ⁇ 32 is regulated at the level of translation and the secondary structure of the rpoHmRNA plays a crucial role in this regulation (Nagi et al, 1991; Yuzawa et al, 1993).
• the secondary structure of the rpoHmKNA has been determined by chemical and enzymatic probing assays and the results are completely consistent with the predicted rpoH secondary structure proposed previously (Morita et al, 1999). It has also been shown that mutations in the rpoH mRNA, which are predicted to decrease the mRNA stability, increased rpoH expression and vice versa (Morita et al, 1999).
• Example 11 The Role of DB in the Cold-shock Induction of cspB, and the Effect of a
• Figure 15C shows ⁇ -galactosidase activity at various time points after temperature
• pB3 and pB17 are almost identical, while the ⁇ -galactosidase activity of pB 17 is 7 times
• mRNA stability plays a role in the cold-shock inducibility of cspA (Brandi et al., 1996; Goldenberg et al., 1997; Fang et al., 1997).
• DB the dramatic effect of DB on the lacZ expression cannot account for the differences of the mRNA stabilities at 15°C between the constructs with and without DB.
• Fig. 15E shows the half-life for pB3, pB13, pB13sd and pB17 to be 12, 22, 15 and 20 minutes, respectively.
• DBs of 12 (pJJG78DBl) or 15 (pJJG78DB2) bases that are complementary with the anti-DB of 16S rRNA to the site after the 5th codon of lacZ under the cspA regulatory system in pJJG78 (see Fig. 15 A) to examine if they enhance lacZ expression at 15°C.
• Mid-log phase cells (pcnB ) grown at 37°C were shifted to 15°C and ⁇ -galactosidase activity was measured at 1, 2 and 3 hr after the shift.
• 15B shows that at 1 hr at 15°C the ⁇ -galactosidase activity was 3 and 8 fold higher with pJJG78DBl and pJJG78DB2, respectively than with pJJG78.
• the ⁇ -galactosidase activity was increased 3.5 and 10.5 times with pJJG78DBl and pJJG78DB2, respectively than with pJJG78.
• lacZ mRNA half-life from ⁇ JJG78, pJJG78DBl and pJJG78DB2 was calculated to be 27, 23
• pJJG78 and pJJG78DB2 were replaced with the constitutive Ipp promoter and the lac
• promoter-operator fragment using a pINIII vector (Inouye, M. 1983), yielding pINZ and
• galactosidase sequence of pINZDBl (due to DB) does not affect the enzymatic activity.
• ⁇ -galactosidase produced from pINZDB2 is initiated at the second AUG codon as compared
• the second AUG codon is preceded by a potential but poor SD sequence
• galactosidase synthesis was measured by pulse-labeling cells for 5 min with [ 5 S]-methionine
• pINZDB 1 was continuously increasing at each time point while the rate of ⁇ -galactosidase
• mM IPTG may be due to a decrease in the concentration of free ribosomes as a result of the
• pINZDBl mRNA are 1.5, 1.4 and 1.3 times higher than those of the pINZ mRNA at 15, 30
• IPTG it increased from 18,500 to 64,400 units (3.5 fold) after 2.5 hr incubation.
• the background activity prior to IPTG induction was much lower, and it increased from 900 to 2,900 units (3 fold) at the 2.5 hr time point.
• the increment of the ⁇ -galactosidase activity of pINZDBl between 30 and 60 min is 35 times higher than that of pINZ, and therefore the efficiency of ⁇ -galactosidase production for pINZDBl is calculated to be 26 times higher than that for pINZ on the bases of the amount of mRNA. Therefore, the higher levels of ⁇ -galactosidase production from pINZDBl are due to a high efficiency of polysome formation.
• Fig. 20A shows that the ⁇ - galactosidase activity of pINZDBl significantly increases upon shifting the temperature from 30 to 42°C in the S2 U strain (CS239) (6.3 fold from 0 to 3.5 hr), while the activity in the wild type strain (CS240) slightly increased (1.1 fold from 0 to 3.5 hr). If the initial ratio of the activity of CS239 to that of CS240 at time 0 is taken as one, the ratio dramatically increased, reaching 5.8 at 3.5 hr after temperature shift (Fig. 20B).
• Escherichia coli negatively regulates its own gene expression. J. Bacteriol. 179:7081- 7088.
• Chloramphenicol induces the transcription of the major cold-shock gene of Escherichia coli, cspA. J. Bacteriol. 175:5824-5828.
• the Y-box factors a family of nucleic acid binding protein conserved from Escherichia coli to man. New Biol. 4:290-298.

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Biomedical Technology (AREA)
• General Health & Medical Sciences (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Medicinal Chemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Applications Claiming Priority (7)

Publications (1)

Family

ID=27378262

Family Applications (1)

Country Status (3)

Families Citing this family (1)

Family Cites Families (2)

• 1999
  • 1999-08-20 WO PCT/US1999/019030 patent/WO2000011148A2/en active IP Right Grant
  • 1999-08-20 AU AU54935/99A patent/AU5493599A/en not_active Abandoned
  • 1999-08-20 EP EP99941243A patent/EP1053310A1/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events