EP0998558A1 - Wa545 compositions - Google Patents

Abstract

Purified WA545 proteins and processes for producing them are disclosed. DNA molecules encoding the WA545 proteins are also disclosed. The proteins, members of the TGF-β superfamily of growth factors, may be used to induce, enhance and/or inhibit the information, growth, proliferation, differentiation, maintenance of mesodermal tissue, including neural and muscle tissue. The proteins may also be useful for treatment of bone and cartilage and/or other connective tissue defects and in wound healing and related tissue repair.

Description

TITLE OF THE INVENTION

WA545 COMPOSITIONS The present invention relates to a novel family of purified proteins designated

WA545 and WA545-related proteins, DNA encoding them, and processes for obtaining them. These proteins may be used to induce bone and/or cartilage or other connective tissue formation, and in wound healing and tissue repair. These proteins may also be used for augmenting the activity of bone morphogenetic proteins. BACKGROUND OF THE INVENTION

The search for the molecule or molecules responsible for the bone, cartilage, and other connective tissue-inductive activity present in bone and other tissue extracts has led to the discovery of a novel set of molecules called the Bone Morphogenetic Proteins (BMPs). The structures of several proteins, designated BMP-1 through BMP- 16, have previously been elucidated. The unique inductive activities of these proteins, along with their presence in bone, suggests that they are important regulators of bone repair processes, and may be involved in the normal maintenance of bone tissue. There is a need to identify whether additional proteins exist which play a role in these processes. The present invention relates to the identification of such a protein, which the inventors have designated WA545.

SUMMARY OF THE INVENTION As used herein, the term "WA545-related protein" refers to the Xenopus WA545 protein, having the amino acid sequence specified in SEQUENCE ID NO:2, as well as homologues of this protein found in mammalian and other species; and other proteins which are closely related structurally and/or functionally to WA545.

Examples of "WA545-related proteins" include murine, bovine and human WA545 protein, as well as homologues in other species, particularly human.

As used herein, the term "WA545 activity" refers to one or more of the activities which are exhibited by the WA545 proteins of the present invention. In particular, "WA545 activity" includes the ability to induce, enhance and/or inhibit the formation, growth, proliferation, differentiation, maintenance of mesodermal tissue, including but not limited to neurons and/or related neural cells and tissues such as brain cells, Schwann cells, glial cells and astrocytes, as well as muscle cells and tissues. "WA545 activity" also includes the ability to induce molecular markers of mesodermal tissue, such as Xbra, gsc, brachyury, Pintallavis, Xnot and muscle-actin as well as the ability to induce the formation of neurons and/or related neural cells and tissues such as brain cells, Schwann cells, glial cells and astrocytes. "WA545 activity" may also include the ability to regulate the interaction ligands and their protein receptors. "WA545 activity" may further include the ability to regulate the formation, differentiation, proliferation and/or maintenance of other cells and/or tissue, for example connective tissue, organs and wound healing. In particular, "WA545 activity" may include the ability to enhance and/or inhibit angiogenesis, and formation and growth of capillaries, arteries and other blood vesssels, as well the formation, growth, proliferation, differentiation and/or maintenance of cardiac, spleen, liver, pancreas, stomach, kidney, lung and brain cells and tissue, osteoblasts and bone, chondrocytes and cartilage, tendon and epidermis. "WA545 activity" also includes the activities of WA545 protein in the described in the examples and specification herein. Xenopus WA545 The Xenopus WA545 DNA sequence (SEQ ID NO: 1) and amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence Listings. WA545 proteins are capable of inducing the formation of cartilage, muscle, nerve, epidermis or other connective tissue, or combinations thereof. WA545 proteins may be further characterized by the ability to demonstrate cartilage, bone, muscle, nerve, epidermis and/or other connective tissue formation activity in the assays described below.

Xenopus WA545 protein may be produced by culturing a cell transformed with a DNA sequence comprising nucleotide a DNA sequence encoding the mature WA545 polypeptide, comprising nucleotide #55, #775, or #811 to nucleotide #1113 or #1116 as shown in SEQ ID NO: 1, and recovering and purifying from the culture medium a protein characterized by the amino acid sequence comprising amino acids #-240, #1 or #13 to #113 or #114 as shown in SEQ ID NO:2 substantially free from other proteinaceous materials with which it is co-produced. For production in mammalian cells, the DNA sequence further comprises a DNA sequence encoding a suitable propeptide 5' to and linked in frame to the nucleotide sequence encoding the mature WA545 polypeptide. The propeptide may be the native WA545 propeptide, or may be a propeptide from another protein of the TGF-β superfamily. Human WA545

It is expected that other species, particularly human, have DNA sequences homologous to Xenopus WA545 protein. The invention, therefore, includes methods for obtaining the DNA sequences encoding human WA545, the DNA sequences obtained by those methods, and the human protein encoded by those DNA sequences. This method entails utilizing the Xenopus WA545 nucleotide sequence or portions thereof to design probes to screen libraries for the human gene or coding sequences or functional fragments thereof using standard techniques. Thus, the present invention includes DNA sequences from other species, particularly, human, which are homologous to Xenopus WA545 and can be obtained using the Xenopus WA545 sequence. A DNA sequence encoding the complete mature human WA545 protein and the corresponding amino acid sequence can be obtained using the procedures which are set forth herein. As described herein, these sequences are isolated using a portion of the Xenopus WA545 sequence as a probe. The human WA545 sequence of may also be used in order to design probes to obtain the complete human WA545 gene or coding sequences through standard techniques. The Xenopus WA545 and human WA545 sequences, or portions thereof, may also be used as probes, or to design probes, in order to obtain other related DNA sequences, such as homologues from other species. The WA545 proteins of the present invention, such as human

WA545, may be produced by culturing a cell transformed with the correlating DNA sequence, such as the WA545 DNA sequence, and recovering and purifying protein from the culture medium. The purified expressed protein is substantially free from other proteinaceous materials with which it is co-produced, as well as from other contaminants. The recovered purified protein is contemplated to exhibit cartilage, bone, muscle, nerve, epidermis and/or connective tissue formation activity. The proteins of the invention may be further characterized by the ability to demonstrate cartilage, bone, muscle, nerve, epidermis and/or other connective tissue formation activity in the assays described below. Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of a WA545 protein, such as Xenopus or human WA545 protein, in a pharmaceutically acceptable vehicle or carrier. These compositions of the invention may be used in the formation of bone, cartilage, muscle, nerve, epidermis and/or other connective tissue, including tendon, ligament and meniscus, as well as combinations of the above, for example regeneration of the tendon-to-bone attachment apparatus. The compositions of the present invention, such as compositions of human WA545, may also be used for wound healing and tissue repair. Compositions of the invention may further include at least one other therapeutically useful agent such as the BMP proteins BMP-1, BMP-2, BMP-3, BMP- 4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents

5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91/18098; and BMP-9, disclosed in PCT publication WO93/00432, BMP-10, disclosed in PCT application WO94/26893; BMP-11, disclosed in PCT application WO94/26892, or BMP- 12 or BMP- 13, disclosed in PCT application WO95/16035, or BMP-15, disclosed in PCT application WO96/36710 or

BMP-16, disclosed in co-pending patent application serial number 08/715/202, filed September 18, 1996.

Other compositions which may also be useful include Vgr-2, and any of the growth and differentiation factors [GDFs], including those described in PCT applications WO94/15965; WO94/15949; WO95/01801; WO95/01802;

WO94/21681 ; WO94/15966; and others. Also useful in the present invention may be BIP, disclosed in WO94/01557; and MP52, disclosed in PCT application WO93/16099. The disclosures of all of the above applications are hereby incorporated by reference for the disclosure contained therein. The compositions of the invention may comprise, in addition to a WA545 protein, other therapeutically useful agents including growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factor (TGF-α and TGF-β), wnt proteins, hedgehog proteins such as sonic, indian and desert hedgehog, activins, inhibins, and insulin-like growth factor (IGF). The compositions may also include an appropriate matrix, for instance, for supporting the composition and providing a surface for bone, cartilage, muscle, nerve, epidermis and/or other connective tissue growth. The matrix may provide slow release of the osteoinductive protein and/or the appropriate environment for presentation thereof.

The WA545 compositions may be employed in methods for treating a number of bone, cartilage, muscle, nerve, epidermis and/or other connective tissue defects, as well as periodontal disease and healing of various types of tissues and wounds. The tissue and wounds which may be treated include epidermis, nerve, including spinal chord, muscle, including cardiac, striated or smoothe muscle, and other tissues and wounds, and other organs such as liver, pancreas, spleen, brain, lung, cardiac, and kidney tissue. These methods, according to the invention, entail administering to a patient needing such bone, cartilage, muscle, nerve, epidermis and/or other connective tissue formation, wound healing or tissue repair, an effective amount of a WA545 protein. The WA545 compositions may also be used to treat or prevent such conditions as osteoarthritis, osteoporosis, and other abnormalities of bone, cartilage, muscle, nerve, epidermis or other connective tissue, organs such as liver, pancreas, spleen, lung, cardiac, and kidney and other tissues. These methods may also entail the administration of a protein of the invention in conjunction with at least one other BMP protein as described above. In addition, these methods may also include the administration of a WA545 protein with other growth factors including EGF, FGF, TGF- , TGF-β, wnt, hedgehog, activin, inhibin and IGF. Still a further aspect of the invention are DNA sequences coding for expression of a WA545 protein. Such sequences include the sequence of nucleotides in a 5' to 3' direction illustrated in SEQ ID NO: 1, as well as DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence SEQ ID NO: 1, and encode the protein of SEQ ID NO: 2. Further included in the present invention are DNA sequences which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 and encode a protein having the ability to induce the formation of cartilage, bone, muscle, nerve, epidermis and/or other connective tissue, or other organs such as liver, pancreas, brain, spleen, lung, cardiac, and kidney tissue. Preferred DNA sequences include those which hybridize under stringent conditions [see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389]. It is generally preferred that such DNA sequences encode a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature human WA545 amino acid sequence shown in SEQ ID NO:2. Finally, allelic or other variations of the sequences of SEQ ID NO: 1, whether such nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has WA545 activity, are also included in the present invention. The present invention also includes functional fragments of the DNA sequence of WA545 shown in SEQ ID NO: 1 which encode a polypeptide which retains the activity of WA545 protein. The determination whether a particular variant or fragment of a WA545 protein of the present invention will maintain WA545 activity, is routinely performed using the assays described in the examples and specification herein.

The DNA sequences of the present invention are useful, for example, as probes for the detection of mRNA encoding WA545 in a given cell population. The DNA sequences may also be useful for preparing vectors for gene therapy applications as described below.

A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence therefor. These vectors may be employed in a novel process for producing a WA545 protein of the invention in which a cell line transformed with a DNA sequence encoding a WA545 protein in operative association with an expression control sequence therefor, is cultured in a suitable culture medium and a WA545 protein is recovered and purified therefrom. This process may employ a number of known cells both prokaryotic and eukaryotic as host cells for expression of the polypeptide. The vectors may be used in gene therapy applications. In such use, the vectors may be transfected into the cells of a patient ex vivo, and the cells may be reintroduced into a patient. Alternatively, the vectors may be introduced into a patient in vivo through targeted transfection.

Still a further aspect of the invention are WA545 proteins or polypeptides. Such polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO: 2, variants of the amino acid sequence of SEQ ID NO: 2, including naturally occurring allelic variants, and other variants in which the protein retains the ability to induce the formation of cartilage, bone, muscle, nerve, epidermis and/or other connective tissue, or other organs such as liver, pancreas, brain, spleen, lung, cardiac, and kidney tissue, characteristic of WA545. Preferred polypeptides include a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature Xenopus WA545 amino acid sequence shown in SEQ ID NO:2. Finally, allelic or other variations of the sequences of SEQ ID NO: 2, whether such amino acid changes are induced by mutagenesis, chemical alteration, or by alteration of DNA sequence used to produce the polypeptide, where the peptide sequence still has WA545 activity, are also included in the present invention. The present invention also includes functional fragments of the amino acid sequence of WA545 shown in SEQ ID NO: 2 which retains the activity of WA545 protein.

The purified proteins of the present inventions may be used to generate antibodies, either monoclonal or polyclonal, to human WA545 and or other WA545- related proteins, using methods that are known in the art of antibody production.

Thus, the present invention also includes antibodies to human WA545 and/or other WA545 proteins. The antibodies may be useful for purification of WA545 and/or other WA545 proteins, or for inhibiting or preventing the effects of WA545 proteins. The WA545 protein and related proteins may be useful for identifying and isolating a receptor protein which binds to WA545, and for inducing the growth and/or differentiation of embryonic cells and/or stem cells. Thus, the present invention also includes WA545 receptors, methods of identifying receptors, and methods of treating cell populations, such as embryonic cells or stem cell populations, to enhance or enrich the growth and/or differentiation of the cells. The treated cell populations may be useful for implantation and for gene therapy applications.

Description of the Deposits

A clone encoding the full-length Xenopus WA545 protein was deposited with the American Type Culture Collection (ATCC) 12301 Parklawn Drive, Rockville, MD 20852, on May 9, 1997, and was accorded the ATCC designation 98428. This deposit fully satisfies the requirements of the Budapest Treaty. Description of the Sequences

SEQ ED NO:l is a nucleotide sequence encoding the entire mature Xenopus WA545 polypeptide.

SEQ ID NO:2 is the amino acid sequence containing the mature Xenopus

WA545 polypeptide. SEQ ID NO:3 is an oligonucleotide probe to Xenopus WA545 signal sequence.

SEQ ID NO:4 is an oligonucleotide probe to Xenopus WA545 signal sequence.

SEQ ID NO:5 is a consensus amino acid sequence derived from a highly conserved region of BMP/TGF-β/Vg-1 proteins

SEQ ID NO: 6 is an oligonucleotide designed on the basis of the above identified consensus amino acid sequence of SEQ ID NO:5

SEQ ID NO:7 is a consensus amino acid sequence derived from a highly conserved region of BMP/TGF-β/Vg-1 proteins.

SEQ ID NO: 8 is an oligonucleotide designed on the basis of the above identified consensus amino acid sequence of SEQ ID NO:7. SEQ ID NO:9 is an oligonucleotide probe to Xenopus WA545 mature peptide sequence.

SEQ ID NO: 10 is an oligonucleotide probe to Xenopus WA545 mature peptide sequence.

Brief Description of the Figures

Figure 1. Expression Pattern of WA545. WA545 is expressed in the marginal zone (mesoderm) and vegetal cells, and later becomes posteriorly restricted.

Whole mount in situ hybridization of Xenopus embryos with a digoxygenin- labelled indecence RNA probe for WA545, showing localization of WA545 RNA. Views from the vegetal pole or from the posterior (the vegetal pole eventually becomes the posterior), (a) WA545 is first expressed during cleavage, by mid-to-late blastula (stage 9). (b) Expression increases by early gastrula (stage 10+) in the entire marginal zone (mesoderm) as well as in vegetal cells. (c,d) This high level expression is maintained during gastrulation. (e) The expression level starts to decline during the late stages of gastrulation. By this stage, expression is still present in lateral and ventral tissue but is excluded from the dorsal-most region which will form the notochord. (f) By early neurula, expression has declined and is still limited to a region just next to the closing blastopore.

Figure 2. WA545 is expressed during gastrulation. Timing of WA545 RNA expression, using a reverse transcriptase-PCR (RT-

PCR) based assay. RNA was isolated from the stages indicated and processed for RT- PCT. PCR reactions were done at 21 cycles for all samples using primers specific to WA545 or ornithine decarboxylase (ODC), which was used as a loading control. WA545 expression could be detected at stage 9 (blastula) and remained at a high level until stage 13 (early neurula). St. 8, mid-blastula; st. 10.25, early gastrula; st. 11.5, mid-gastrula; st. 19, tailbud; st. 35, hatching. The reactions for three samples, unfertilized egg, st. 8 and st. 9 were also done at 30 cycles to detect small amounts of RNA. No signal could be detected in both egg and stage 8 samples even after 30 cycles. This indicates that WA545 does not have a maternal transcript and is not expressed until after mid-blastula transition, (stage 8.5).

Figure 3. WA545 induces a posterior secondary axis when misexpressed on ventral side of embryos.

Embryos were injected in one ventral blastomere in the marginal zone at the 4-cell stage with 50 or 100 pg WA545 in vitro transcribed RNA, or with globin RNA as a control. 80 pg lacL RNA was included as a lineage tracer to determine where the

WA545 RNA became localized. Embryos were incubated until hatching (stage 35) before fixation and X-gal staining. Arrowheads point to a secondary axis that is induced on the injected side, as indicated by the blue staining, of the embryos. A secondary head was never observed. This indicates that WA545 is capable of inducing posterior, but not anterior regions. The secondary axis contains both mesodermal and neural tissue. Figure 4. WA545 causes microcephaly when misexpressed on dorsal side of embryos.

Embryos were injected in one dorsal blastomere in the marginal zone at the 4- cell stage with 100 pg WA545 or globin RNA along with 80 pg lacZ RNA as lineage tracer. Embryos were incubated until tailbud stage (stage 22) before fixation and X- gal staining. Arrowheads indicate the chin primordium (cement gland), an extreme anterior structure. "Control" panel shows embryo injected with globin RNA. "WA545" panel shows embryos injected with WA545 RNA. In WA545 injected embryos, anterior structures are suppressed, as indicated by the smaller sizes of the cement glands. In later stages no eyes and no forebrain is present. This indicates that WA545 may convert anterior to more posterior tissue.

Figure 5. WA545 induces posterior mesodermal markers in an animal cap assay.

WA545 induces posterior mesoderm. Anterior mesoderm and neural gene expression is not activated by this gene. Embryos were injected in one blastomere in the animal pole at 2-cell stage with 400 pg WA545 or globin RNA. Animal caps were isolated as indicated and cultured until sibling embryos reached stage 14 (neurula) or 19 (tailbud) when various marker genes are maximally expressed. Total RNA was prepared from globin injected caps, WA545 injected caps and whole embryos. RT-PCR was used to assay for the expression of marker genes. Lanes 1, 2 and 3 are samples harvested at stage 14 samples. Xbra is a general mesodermal marker, gsc is a marker of anterior mesoderm, Pintallavis and Xnot are markers of posterior mesoderm. All genes were induced; however, gsc induction was very weak indicating that posterior mesoderm is predominantly induced (compare lanes 1 and 2). Xvent-1 and ode are loading controls. Lanes 4, 5 and 6 are samples harvested at stage

19. Muscle-specific actin is a lateral mesodermal marker and was strongly induced. HoxB9, a psoterior mesodermal marker was also induced. Krox20, a neural marker whose expression is in the hindbrain and N-CAM, a general neural marker, were not induced. Figure 6. WA545 induces muscle in animal caps.

At the histological level, muscle formation can be observed after WA545 ectopic expression. Embryos were injected in one blastomere in the animal pole at 2- cell stage with 400 pg WA545 or globin RNA. Animal caps were isolated as indicated and cultured until sibling embryos reached hatching stage (stage 35) and analysed histologically. (a) Globin-injected caps are vesicular, with only epidermal differentiation observed, (b) WA545 -injected caps show extensive tissue formation, (c) At higher magnification, WA545-injected caps show muscle blocks and possibly blood formation. Detailed Description of the Invention WA545

The Xenopus WA545 nucleotide sequence (SEQ ID NO: 1) and encoded amino acid sequence (SEQ ID NO: 2) are set forth in the Sequence Listing herein. The coding sequence of the mature Xenopus WA545 protein begins at nucleotide #55 and continues through nucleotide #1116. Purified Xenopus WA545 proteins of the present invention are produced by culturing a host cell transformed with a DNA sequence comprising the DNA coding sequence of SEQ ID NO: 1 from nucleotide #55 to #1116, or from nucleotide #775 to #1116, and recovering and purifying from the culture medium a protein which contains the amino acid sequence or a substantially homologous sequence as represented by amino acids #-240 to #114 or #1 to #114 of SEQ ID NO: 2.

Other species, in particular human, are expected to have DNA sequences homologous to Xenopus WA545. DNA sequences encoding human WA545 are isolated by various techniques known to those skilled in the art. The invention, therefore, includes methods for obtaining DNA sequences encoding human WA545. The methods utilize the Xenopus WA545 nucleotide sequences or portions in the design of probes to screen libraries for the human gene or coding sequences or fragments thereof using standard techniques.

Regions containing amino acid sequences which are highly conserved within the WA545 family of proteins are identified and consensus amino acid sequences of these highly conserved regions are be constructed based on the similarity of the corresponding regions of individual WA545 proteins. Oligonucleotide primers designed on the basis of the amino acid sequence of such conserved sequences allow the specific amplification of the human WA545 encoding sequences. Two such consensus amino acid sequences are set forth in the Sequence Listing. Once a recombinant bacteriophage containing DNA encoding a portion of a human WA545 is obtained, the human coding sequence can be used as a probe to identify a human cell line or tissue which synthesizes WA545 mRNA. Alternatively, the Xenopus coding sequence can be used as a probe to identify such human cell line or tissue. Alternatively, the Xenopus WA545 coding sequence is used to design oligonucleotide primers which will specifically amplify a portion of the WA545 encoding sequence located in the region located between the primers utilized to perform the specific amplification reaction. Utilizing Xenopus and human WA545 sequences one can specifically amplify corresponding human WA545 encoding sequences from mRNA, cDNA or genomic DNA templates. Once a positive source has been identified by one of the above described methods, mRNA is selected by oligo (dT) cellulose chromatography and cDN A is synthesized and cloned in Xgt 10 or other bacteriophage vectors known to those skilled in the art, for example, ZAP by established techniques.

It is also possible to perform the oligonucleotide primer directed amplification reaction, described above, directly on a pre-established human cDNA or genomic library which has been cloned into a bacteriophage vector. In such cases, a library which yields a specifically amplified DNA product encoding a portion of human

WA545 protein is screened directly, utilizing the fragment of amplified WA545 encoding DNA as a probe.

The human WA545 sequence of the present invention is obtained using the whole or fragments of the Xenopus WA545 DNA sequence, or a partial human WA545 sequence, as a probe. Thus, the human WA545 DNA sequence is expected to comprise a DNA sequence highly homologous to nucleotides #55 or #775 to #1116 of the Xenopus WA545 DNA sequence shown in SEQ ID NO: 1. The amino acid sequence of the human WA545 protein is expected to comprise an amino acids highly homologous to the sequence of amino acids #-240 or #1 to #114 of SEQ ED NO: 2. It is expected that WA545 protein, as expressed by mammalian cells such as

CHO cells, exists as a heterogeneous population of active species of WA545 protein with varying N-termini. It is expected that active species will comprise an amino acid sequence beginning with the cysteine residue at amino acid #13 of SEQ ID NO:2, or will comprise additional amino acid sequence further in the N-terminal direction. Thus, it is expected that DNA sequences encoding active WA545 proteins include those comprising nucleotides #775 or #811 to #1113 or #1116 of SEQ ID NO: 1, as well as those including additional nucleotides at the 5 '-terminal end. Accordingly, active species of WA545 are expected to include those comprising amino acids #1 or #13 to #113 or #114 of SEQ ID NO:2, as well as those including additional amino acids at the N-terminal end.

A host cell may be transformed with a coding sequence encoding a propeptide suitable for the secretion of proteins by the host cell linked in proper reading frame to the coding sequence for the mature WA545 protein. For example, see United States Patent 5,168,050, in which a DNA encoding a precursor portion of a mammalian protein other than BMP-2 is fused to the DNA encoding a mature BMP-2 protein. See also the specification of PCT application WO95/16035, in which the propeptide of BMP-2 is fused to the DNA encoding a mature BMP- 12 protein. Thus, the present invention includes chimeric DNA molecules comprising a DNA sequence encoding a propeptide or a regulatory sequence from a protein, such as a TGF-β protein, other than WA545, linked in correct reading frame to a DNA sequence encoding a WA545 protein. The term "chimeric" is used to signify that the propeptide originates from a different polypeptide than the WA545 protein. A host cell which naturally expresses native WA545 may be transfected with a highly expressed or regulable expression sequence so as to recombine in order to increase or alter WA545 expression. The N-terminus of one active species of WA545 is expected to be experimentally determined by expression in E. coli to be as follows: [MjSTHSSPPTP. Thus, it appears that the N-terminus of this species of WA545 is at amino acid #1 of SEQ ID NO: l, and a DNA sequence encoding said species of WA545 would comprise nucleotides #775 to #1116 of SEQ ID NO: 1. The apparent molecular weight of WA545 monomer is expected to be experimentally determined by SDS-PAGE to be approximately 10-15 kd, more particularly, about 13 kd, on a

Novex 16% tricine gel. The WA545 protein is expected to exist as a clear, colorless solution in 0.1% trifluoroacetic acid. The dimer is expected to have a molecular weight of approximately 20-30 kd.

It is expected that other WA545 proteins, as expressed by mammalian cells such as CHO cells, also exist as a heterogeneous population of active species of

WA545 protein with varying N-termini. For example, it is expected that active species of WA545 will comprise an amino acid sequence beginning with the cysteine residue at amino acid #13 of SEQ ID NO:2, or will comprise additional amino acid sequence further in the N-terminal direction. Thus, it is expected that DNA sequences encoding active WA545 proteins include those which comprise a nucleotide sequence comprising nucleotides #55, #775, #811 to #1113 or #1116 of SEQ ID NO: 1. Accordingly, active WA545 proteins include those comprising amino acids #-240, #1, or #13 to #113 or #114.

The WA545 proteins of the present invention, include polypeptides having a molecular weight of about 10-15 kd in monomeric form, said polypeptide comprising the amino acid sequence of SEQ ID NO:2 and having the ability to induce the formation of cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue in assays such as the Rosen-Modified Sampath-Reddi ectopic implant assay, or in the other assays described below. The WA545 proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present. WA545 proteins may be characterized by the ability to induce the formation of cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue, for example, in the assays described below. The WA545 proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 1, but into which modifications or deletions are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ ID NO: 2. These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with the polypeptide sequence of SEQ ID NO: 2 may possess biological properties in common therewith. Thus, these modifications and deletions of the native WA545 may be employed as biologically active substitutes for naturally-occurring WA545 polypeptides in therapeutic processes. It can be readily determined whether a given variant of WA545 maintains the biological activity of WA545 by subjecting both

WA545 and the variant of WA545 to the assays described in the examples and specification herein.

Other specific mutations of the sequences of\VA545 proteins described herein involve modifications of glycosylation sites. These modifications may involve O- linked or N-linked glycosylation sites. For instance, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosylation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagine-X-serine, where X is usually any amino acid.

A variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosylation recognition site (and/or amino acid deletion at the second position) results in non-glycosylation at the modified tripeptide sequence. Additionally, bacterial expression of WA545 protein will also result in production of a non-glycosylated protein, even if the glycosylation sites are left unmodified.

The present invention also encompasses the novel DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and coding for expression of WA545 proteins. These DNA sequences include those depicted in SEQ ID NO: 1 in a 5' to 3' direction and those sequences which hybridize thereto under stringent hybridization conditions [for example, 0.1X SSC, 0.1% SDS at 65 °C; see, T. Maniatis et al, Molecular Cloning (A Laboratorv Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389] and encode a protein having cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue inducing activity. As used herein, the term "stringent hybridization conditions" also refers to the use of initial low stringency hybridization conditions (such as 6X SSC, 0.5% SDS, at about 60° C, overnight which is followed by higher stringency wash condition (such as 2X SSC, 0.1% SDS, at about 20°C) or even higher wash stringency (such as 0.1X SSC, 0.1% SDS, at about 65 °C, for less than an hour. The DNA sequences of the present invention also include those which comprise the DNA sequence of SEQ ID NO: 1 and those which hybridize thereto under stringent hybridization conditions and encode a protein having cartilage, bone, tendon, ligament, nerve, epidermis and/or other connective tissue inducing activity.

Similarly, DNA sequences which code for WA545 proteins coded for by the sequences of SEQ ID NO: 1 or which encode the amino acid sequence of SEQ ID NO: 2, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein. Variations in the DNA sequences of SEQ ID NO: 1 which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the invention.

Another aspect of the present invention provides a novel method for producing WA545 proteins. The method of the present invention involves culturing a suitable cell line, which has been transformed with a DNA sequence encoding a WA545 protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the WA545 proteins recovered and purified from the culture medium. The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.

Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary cells (CHO). The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art. See, e.g., Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol.. 5(7): 1750-1759 (1985) or Howley et al, U.S. Patent 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey COS-1 cell line. The mammalian cell

CV-1 may also be suitable.

Bacterial cells may also be suitable hosts. For example, the various strains of E. coli (e.g., HBlOl, MC1061) are well-known as host cells in the field of biotechnology. Various strains of B. subtilis, Pseudomonas, other bacilli and the like may also be employed in this method. For expression of the protein in bacterial cells,

DNA encoding the propeptide of WA545 is generally not necessary.

Many strains of yeast cells known to those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention. Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic Engineering, 8:277-298

(Plenum Press 1986) and references cited therein.

Another aspect of the present invention provides vectors for use in the method of expression of these novel WA545 polypeptides. Preferably the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention. Additionally, the vectors contain appropriate expression control sequences permitting expression of the WA545 protein sequences. Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention. Additionally, the sequence of SEQ ID NO: 1 or other sequences encoding WA545 proteins could be manipulated to express a mature WA545 protein by deleting WA545 propeptide sequences and replacing them with sequences encoding the complete propeptides of other BMP proteins or members of the TGF-β superfamily. Thus, the present invention includes chimeric DNA molecules encoding a propeptide from a member of the TGF-β superfamily linked in correct reading frame to a DNA sequence encoding a WA545 polypeptide. The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing tissue specific or inducible replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in the art and may be selected depending upon the host cells. Thus, such specialized vectors constitute part of the present invention. A protein of the present invention, which induces cartilage, bone, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue formation in circumstances where such tissue is not normally formed, has application in the healing of bone fractures and cartilage or other connective tissue defects in humans and other animals. Such a preparation employing a WA545 protein may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery. A WA545 protein may be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells, and may also support the regeneration of the periodontal ligament and attachment apparatus, which connects bone and teeth. WA545 polypeptides of the invention may also be useful in the treatment of osteoporosis. A variety of osteogenic, cartilage-inducing and bone inducing factors have been described. See, e.g., European patent applications 148,155 and 169,016 for discussions thereof.

The proteins of the invention may also be used in wound healing and related tissue repair. The types of wounds include, but are not limited to burns, incisions and ulcers. (See, e.g. PCT Publication WO84/01106 for discussion of wound healing and related tissue repair). It is further contemplated that proteins of the invention may increase neuronal and glial cell survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival and repair. The proteins of the invention may further be useful for the treatment of conditions related to other types of tissue, such as nerve, including spinal chord, epidermis, muscle, including cardiac, striated and smoothe muscle, and other organs such as liver, pancreas, brain, spleen, lung, cardiac, and kidney tissue. The proteins of the present invention may also have value as a dietary or nutrient supplement. For this use, the proteins may be used in intact form, or may be predigested to provide a more readily absorbed supplement. The proteins of the invention may also have other useful properties characteristic of the TGF-β superfamily of proteins. Such properties include angiogenic, chemotactic and/or chemoattractant properties, and effects on cells including induction of collagen synthesis, fibrosis, differentiation responses, cell proliferative responses and responses involving cell adhesion, migration and extracellular matrices. These properties make the proteins of the invention potential agents for wound healing, reduction of fibrosis and reduction of scar tissue formation.

When dimerized as a homodimer or as a heterodimer with other BMPs, with other members of the TGF-β superfamily of proteins, or with inhibin- proteins or inhibin-β proteins, the WA545 heterodimer is expected to demonstrate effects on the production of follicle stimulating hormone (FSH), as described further herein. It is recognized that FSH stimulates the development of ova in mammalian ovaries (Ross et al., in Textbook of Endocrinology, ed. Williams, p. 355 (1981) and that excessive stimulation of the ovaries with FSH will lead to multiple ovulations. FSH is also important in testicular function. Thus, WA545 may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in mammals. WA545 may also be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary. See, for example, United States Patent 4,798,885. WA545 may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs. It is further contemplated that WA545 may be useful in modulating hematopoiesis by inducing the differentiation of erythroid cells [see, e.g., Broxmeyer et al, Proc. Natl. Acad. Sci. USA, 85:9052- 9056 (1988) or Eto et al, Biochem. Biophys. Res. Comm., _.142:1095-1103 (1987)], for suppressing the development of gonadal tumors [see, e.g., Matzuk et al., Nature, 360:313-319 (1992)] or for augmenting the activity of bone morphogenetic proteins [see, e.g., Ogawa et al., J. Biol. Chem., 267: 14233-14237 (1992)].

WA545 proteins may be further characterized by their ability to modulate the release of follicle stimulating hormone (FSH) in established in vitro bioassays using rat anterior pituitary cells as described [see, e.g., Vale et al, Endocrinology, 91:562-

572 (1972); Ling et al., Nature, 321:779-782 (1986) or Vale et al., Nature, 321:776- 779 (1986)]. It is contemplated that the WA545 protein of the invention, when composed as a heterodimer with inhibin β chains will exhibit stimulatory effects on the release of follicle stimulating hormone (FSH) from anterior pituitary cells as described [Ling et al., Nature, 321:779-782 (1986) or Vale et al., Nature, 321:776-

779 (1986)]. Additionally, it is contemplated that the WA545 protein of the invention, when composed as a heterodimer with the inhibin a chain, will inhibit the release of follicle stimulating hormone (FSH) from anterior pituitary cells as described [see, e.g., Vale et al, Endocrinology, £1:562-572 (1972). Therefore, depending on the particular composition, it is expected that the WA545 protein of the invention may have contrasting and opposite effects on the release of follicle stimulating hormone (FSH) from the anterior pituitary.

Activin A (the homodimeric composition of inhibin β_A) has been shown to have erythropoietic-stimulating activity [see e.g. Eto et al., Biochem. Biophys. Res. Comm., 142:1095-1103 (1987) and Murata et al., Proc. Natl. Acad. Sci. U.S.A.,

85:2434-2438 (1988) and Yu et al., Nature, 330:765-767 (1987)]. It is contemplated that the WA545 protein of the invention has a similar erythropoietic-stimulating activity. This activity of the WA545 protein may be further characterized by the ability of the WA545 protein to demonstrate erythropoietin activity in the biological assay performed using the human K-562 cell line as described by [Lozzio et al., Blood,

45:321-334 (1975) and U.S. Pat. No. 5,071,834].

A further aspect of the invention is a therapeutic method and composition for repairing fractures and other conditions related to cartilage, bone, tendon, ligament, muscle, nerve, epidermis and or other connective tissue defects or periodontal dis- eases. The invention further comprises therapeutic methods and compositions for wound healing and tissue repair. Such compositions comprise a therapeutically effective amount of at least one of the WA545 proteins of the invention in admixture with a pharmaceutically acceptable vehicle, carrier or matrix. It is further contemplated that compositions of the invention may increase neuronal survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival. Compositions of the invention may further include at least one other therapeutically useful agent, such as members of the TGF-β superfamily of proteins, which includes the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748; 5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication WO91/18098; BMP-9, disclosed in PCT publication WO93/00432; BMP-

10, disclosed in PCT application WO94/26893; BMP-11, disclosed in PCT application WO94/26892, BMP- 12 or BMP- 13, disclosed in PCT application WO 95/16035, BMP-15, disclosed in PCT application WO96/36710, and BMP-16, disclosed in co-pending patent application serial number 08/715/202, filed September 18, 1996. Other compositions which may also be useful include Vgr-2, and any of the

GDFs, including those described in PCT applications WO94/15965; WO94/15949; WO95/01801; WO95/01802; WO94/21681; WO94/15966; and others. Also useful in the present invention may be BIP, disclosed in WO94/01557; and MP52, disclosed in PCT application WO93/ 16099. The disclosures of the above applications are hereby incorporated by reference herein.

It is expected that WA545 proteins may exist in nature as homodimers or heterodimers. To promote the formation of dimers of WA545 with increased stability, one can genetically engineer the DNA sequence of SEQUENCE ID NO: 1 to provide one or more additional cysteine residues to increase potential dimer formation. The resulting DNA sequence would be capable of producing a "cysteine added variant" of

WA545 protein. Alternatively, one can produce "cysteine added variants" of WA545 proteins by altering the sequence of the protein at the amino acid level, for example, by altering the amino acid sequences of one or more amino acid residues to Cys. Production of "cysteine added variants" of proteins is described in United States Patent 5,166,322, the disclosure of which is hereby incorporated by reference.

It is expected that the proteins of the invention may act in concert with or perhaps synergistically with other related proteins and growth factors. Further therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one WA545 protein of the invention with a therapeutic amount of at least one other member of the TGF-β superfamily of proteins, such as the BMP proteins disclosed in the applications described above. Such combinations may comprise separate molecules of the BMP proteins or heteromolecules comprised of different BMP moieties. For example, a method and composition of the invention may comprise a disulfide linked dimer comprising a WA545 protein subunit and a subunit from one of the "BMP" proteins described above. Thus, the present invention includes a purified WA545 polypeptide which is a heterodimer wherein one subunit comprises an amino acid sequence of SEQ ID NO:2, and one subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group consisting of BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8, BMP-9, BMP-10, BMP-11, BMP-12 or BMP- 13, disclosed in PCT application WO 95/16035, or BMP- 15, disclosed in PCT application WO96/36710 or BMP- 16, disclosed in co- pending patent application serial number 08/715/202, filed September 18, 1996. A further embodiment may comprise a heterodimer of WA545 moieties, for example, of Xenopus WA545 and the human homologue of Xenopus WA545 protein. Further, WA545 may be combined with other agents beneficial to the treatment of the bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue defect, wound, or tissue in question. These agents include various growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-α and TGF-β), wnt proteins, hedgehog proteins, such as sonic, indian and desert hedgehog, activins, inhibins, and k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), leukemia inhibitory factor (LIF/HILDA/DIA), insulin-like growth factors (IGF-I and IGF-H). Portions of these agents may also be used in compositions of the present invention.

The preparation and formulation of such physiologically acceptable protein compositions, having due regard to pH, isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently valuable for veterinary applications due to the lack of species specificity in BMP proteins. Particularly domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment with the WA545 proteins of the present invention.

The therapeutic method includes administering the composition topically, systemically, or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage, tendon, ligament, muscle, nerve, epidermis or other connective tissue or other tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than the WA545 proteins which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the BMP composition in the methods of the invention.

Preferably for bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue formation, the composition includes a matrix capable of delivering WA545 or other BMP proteins to the site of bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue damage, providing a structure for the developing bone, cartilage, tendon, ligament, muscle, nerve, epidermis and/or other connective tissue and optimally capable of being resorbed into the body. The matrix may provide slow release of WA545 and/or other inductive protein, as well as proper presentation and appropriate environment for cellular infiltration. Such matrices may be formed of materials presently in use for other implanted medical applications.

The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the WA545 compositions will define the appropriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tricalcium phosphate, hydroxyapatite, polylactic acid and polyanhydrides. Other potential materials are biodegradable and biologically well defined, such as bone or dermal collagen. Further matrices are comprised of pure proteins or extracellular matrix components. Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.

The dosage regimen will be determined by the attending physician considering various factors which modify the action of the WA545 protein, e.g., amount of tissue weight desired to be formed, the site of tissue damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue, the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors. The dosage may vary with the type of matrix used in the reconstitution and the types of BMP proteins in the composition. The addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also affect the dosage. Progress can be monitored by periodic assessment of tissue growth and/or repair. The progress can be monitored, for example, x-rays, histomorphometric determinations and tetracycline labeling.

The following examples illustrate practice of the present invention in recovering and characterizing Xenopus WA545 protein and employing the DNA it to recover human WA545 proteins, obtaining the human proteins and expressing the proteins via recombinant techniques. The examples are not limiting, and the invention includes many variations as described herein, or will be apparent to those skilled in the art upon consideration of the detailed description of the invention and preferred embodiments thereof. The techniques and tools for such variations are known to those skilled in the art, and such variations constitute part of the present invention.

EXAMPLES Example 1. Isolation of Xenopus cDNA

The Xenopus WA545 full-length cDNA was isolated from a dT-primed cDNA library constructed in the plasmid vector CS2+. cDNA was made from Xenopus embryos (stage 11.5-12). The probe sequences used to isolate the clone were derived from an sEST, an EST used to allow secretion of invertase in the signal sequence trap, which is described in United States Patents 5,536,637, the disclosure of which is hereby incorpated herein. The sequences of the probes for WA545 were as follows: 5' - GAAAGTGATAGCCACAACTCTGCCATG - 3' (SEQ ID NO 3) and 5' - GATTTAGGTACAGGAGCTGGAGCAATG - 3' (SEQ ID NO 4).

Both probes were antisense sequence to the sEST. The DNA probes were radioactively labelled with ³²P and used to screen the Xenopus dT-primed cDNA library, under high stringency hybridization/washing conditions, to identify clones containing sequences of the WA545 gene. Approximately 61,000 library transformants were plated at a density of approximately 4350 transformants per plate on selective plates to screen for WA545. Nitrocellulose replicas of the transformed colonies were hybridized to the ³²P-labelled DNA probe in standard hybridization buffer (6X SSC, 0.5% SDS, 5X Denhardt's, lOmM EDTA pH8, lOOmg/ml Bakers Yeast ribonucleic acid) under high stringency conditions (65 °C for 2 hours). After 2 hours hybridization, the filters were removed from the hybridization solution and washed under high stringency conditions (2X SSC, 0.5% SDS 21°C for 5 minutes; followed by 2X SSC, 0.1% SDS 21°C for 15 minutes; followed by a 2nd 2X SSC, 0.1% SDS 21°C for 15 minutes; followed by 2X SSC, 0.1% SDS 65°C for 10 minutes). The filters were wrapped in Saran wrap and exposed to X-ray film for overnight to 3 days at room temperature. The autoradiographs were developed and positively hybridizing transformants of various signal intensities were identified. These positive clones were picked, grown for 5 hours in selective medium and plated at low density (approximately 100 colonies per plate). Nitrocellulose replicas of the colonies were hybridized to the ³²P-labelled probe in standard hybridization buffer (6X SSC, 0.5% SDS, 5X Denhardt's, lOmM

EDTA pH8, lOOmg/ml Bakers Yeast ribonucleic acid) under high stringency conditions (65°C for 2 hours). After 2 hours hybridization, the filters were removed from the hybridization solution and washed under high stringency conditions (e.g., 2X SSC, 0.5% SDS 21°C for 5 minutes; followed by 2X SSC, 0.1% SDS 21°C for 15 minutes; followed by a second wash at 2X SSC, 0.1% SDS 21°C for 15 minutes; followed by 2X SSC, 0.1% SDS 65°C for 10 minutes). The filters were wrapped in Saran wrap and exposed to X-ray film for overnight to 3 days at room temperature. The autoradiographs were developed and positively hybridizing transformants were identified. Bacterial stocks of purified hybridization positive clones were made and plasmid DNA was isolated. The sequence of the cDNA insert was determined. The cDNA insert contained the sequences of the DNA probe used in the hybridization.

Example 2. Isolation of WA545 Homologues

Using the DNA sequence reported herein for the newly isolated WA545 protein, DNA sequences encoding WA545 homologues and related proteins, such as the murine and human WA545 protein, may be isolated by various techniques known to those skilled in the art. As described below, oligonucleotide primers may be designed on the basis of amino acid sequences present in other BMP proteins, Vg-1 related proteins and other proteins of the TGF-β superfamily. Regions containing amino acid sequences which are highly conserved within the BMP family of proteins and within other members of the TGF-β superfamily of proteins can be identified and consensus amino acid sequences of these highly conserved regions can be constructed based on the similari ty of the corresponding regions of individual BMP/TGF-β/Vg-1 proteins. It is contemplated that the WA545 protein of the invention and other BMP/TGF-β/Vg-1 related proteins may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within a WA545 protein or other novel related proteins would correspond to the relative locations in the proteins from which they were derived. It is further contemplated that this positional information derived from the structure of other BMP/TGF-β/Vg-1 proteins and the oligonucleotide sequences which have been derived from consensus amino acid sequences could be utilized to specifically amplify DNA sequences encoding the corresponding amino acids of a WA545 protein or other BMP/TGF-β/Vg-1 related proteins.

An example of such a consensus amino acid sequence is indicated below. Consensus amino acid sequence:

Trp Xaa Xaa Trp lie Xaa Ala (SEQ ID NO: 5) wherein the first Xaa is Glu, Asn or Asp; the second Xaa is Asp, Glu or Asn; and the third Xaa is Val or lie. Where X Y indicates that either amino acid residue may appear at that position.

The following oligonucleotide is designed on the basis of the above identified consensus amino acid sequence (1): #1: GCGGATCCTGGVANGABTGGATHRTNGC (SEQ ID NO:6)

This oligonucleotide sequence is synthesized on an automated DNA synthesizer. The standard nucleotide symbols in the above identified oligonucleotide primer are as follows: A, adenosine; C, cytosine; G, guanine; T, thymine; N, adenosine or cytosine or guanine or thymine; R, adenosine or cytosine; Y, cytosine or thymine; H, adenosine or cytosine or thymine; V, adenosine or cytosine or guanine;

D, adenosine or guanine or thymine.

The first eight nucleotides of oligonucleotide #1 (underlined) contain the recognition sequence for the restriction endonuclease BamHl in order to facilitate the manipulation of a specifically amplified DNA sequence encoding the WA545 or WA545 -related proteins and are thus not derived from the consensus amino acid sequence (1) presented above.

A second consensus amino acid sequence is derived from another highly conserved region of BMP/TGF-β/Vg-1 proteins as described below:

Asn His Ala lie Xaa Gin Thr (SEQ ID NO:7) wherein Xaa is equal to Val or Leu.

The following oligonucleotide is designed on the basis of the above identified consensus amino acid sequence (2):

#2: GCTCTAGAGTYTGNAYNATNGCRTGRTT (SEQ ID NO:8) This oligonucleotide sequence is synthesized on an automated DNA synthesizer. The same nucleotide symbols are used as described above.

The first eight nucleotides of oligonucleotide #2 (underlined) contain the recognition sequence for the restriction endonuclease Xbal in order to facilitate the manipulation of a specifically amplified DNA sequence encoding the WA545 or

WA545-related proteins and are thus not derived from the consensus amino acid sequence (2) presented above.

It is contemplated that the WA545 or WA545-related proteins of the invention and other BMP/TGF-β/Vg-1 related proteins may contain amino acid sequences similar to the consensus amino acid sequences described above and that the location of those sequences within a WA545 or WA545-related protein or other novel related proteins would correspond to the relative locations in the proteins from which they were derived. It is further contemplated that this positional information derived from the structure of other BMP/TGF-β/Vg-1 proteins and the oligonucleotide sequences #1 and #2 which have been derived from consensus amino acid sequences (1) and (2), respectively, can be utilized to specifically amplify DNA sequences encoding the corresponding amino acids of a WA545 or WA545-related protein or other BMP/TGF-β/Vg-1 related proteins.

Based on the knowledge of the gene structures of BMP/TGF-β/Vg-1 proteins, it is further contemplated that Xenopus, human or murine genomic DNA can be used as a template to perform specific amplification reactions which would result in the identification of WA545 encoding sequences and WA545 proteins. Such specific amplification reactions of a human or murine genomic DNA template can be initiated with the use of oligonucleotide primers as described earlier. Oligonucleotides such as those set forth in SEQ ID NO:6 and SEQ ID NO:8 are utilized as primers to allow the specific amplification of a specific nucleotide sequence from Xenopus, human, murine or other genomic DNA. The amplification reaction is performed as follows: Genomic DNA is sheared by repeated passage through a 25 gauge needle, denatured at 100°C for 5 minutes and then chilled on ice before adding to a reaction mixture containing 200 μM each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP), 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl₂, 0.001% gelatin, 1.25 units Taq DNA polymerase, 50 pM of each oligonucleotide, such as those set forth in SEQ ID NO:6 and SEQ ID NO:8, to the consensus sequence, in a total reaction volume of 50 μl. This reaction mixture is subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 37°C, 2 minutes at 72°C for thirty cycles; followed by a 7 minute incubation at 72°C.

The DNA which is specifically amplified by this reaction is ethanol precipitated, digested with the restriction endonucleases BamHl and Xbal and subjected to agarose gel electrophoresis. A region of the gel, corresponding to the predicted size of the human or murine WA545 or WA545-related encoding DNA fragment, is excised and the specifically amplified DNA fragments contained therein are electroeluted and subcloned into a suitable vector, for example, the plasmid vector pGEM-3 between the Xbal and BamHl sites of the polylinker. DNA sequence analysis of the resulting human or murine WA545 or WA545-related subclones is conducted to determine whether the specifically amplified DNA sequence product contained therein encode a portion of the human or murine WA545 or WA545-related protein of the invention.

Oligonucleotide probes, preferably 30-50 nucleotides in length, can be designed on the basis of the human or murine WA545 or WA545-related specifically amplified DNA sequence described above. The oligonucleotide probes are radioactively labeled with ³²P and employed to screen a murine or human genomic library constructed in the vector λFIX II (Stratagene catalog #946309) or a comparable substitute. 500,000 recombinants of the human genomic library are plated at a density of approximately 10,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are made one set of nitrocellulose filters is hybridized to one oligonucleotide probe and a duplicate set of nitrocellulose filters is hybridized to a second oligonucleotide probe, both in a hybridization buffer consisting of 5X SSC, 1% SDS, 10% dextran sulfate, 2X Denhardt's, 100 μg/ml herring salmon sperm DNA) at 60°C overnight. The following day the radioactively labelled oligonucleotide containing hybridization solution is removed an the filters are washed with 5X SSC, 0.1% SDS at 60°C. Recombinants which hybridize to both oligonucleotide probes are identified and plaque purified. The plaque purified recombinant bacteriophage clones which hybridize to the Xenopus WA545 oligonucleotide probes and are analyzed to confirm that they encode a WA545 protein of the invention using sequence analysis and the assays described herein. Bacteriophage plate stocks are made and bacteriophage DNA is isolated from the murine or human genomic clone. The complete insert of the murine or human genomic recombinant is excised with restriction endonucleases, subcloned into a plasmid vector (pBluescript) and DNA sequence analysis is performed.

Based on the knowledge of other BMP proteins and other proteins within the TGF-β family, it is predicted that the Xenopus WA545 precursor polypeptide would be cleaved at the multibasic sequence Arg-Ala-Lys-Arg in agreement with a proposed consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the Xenopus WA545 precursor polypeptide is expected to generate a 114 amino acid mature peptide beginning with the amino acid Ser at position #1 of SEQ ID NO:2. The processing of Xenopus and mammalian WA545 and WA545-related proteins into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to the processing of the related protein TGF-β [Gentry et al., Molec & Cell. Biol.. 8:4162 (1988); Derynck et al. Nature, 316:701 (1985)]. It is contemplated therefore that the mature active species of mammalian

WA545 proteins will comprise a homodimer of two polypeptide subunits, each subunit comprising an amino acid sequence which correlates to a portion of the sequence of SEQ ID 2, such as amino acids #1 through #114. Further active species are contemplated comprising at least amino acids # 13 to #114 of SEQ ID NO:2, thereby including the first conserved cysteine residue. As with other members of the

TGF-β/BMP family of proteins, the carboxy-terminal portion of the murine WA545 protein exhibits greater sequence conservation than the more amino-terminal portion. The percent amino acid identity of the Xenopus WA545 protein in the cysteine-rich C-terminal domain (amino acids #24-#125) to the corresponding region of human BMP proteins and other proteins within the TGF-a family is as follows: BMP-2, 60%;

BMP-3, 43%; BMP-4, 57%; BMP-5, 57%; BMP-6, 59%; BMP-7, 57%; BMP-8, 55%;

BMP-9, 49%; BMP-10, 51%; BMP-l l, 41%; BMP-12, 51%; Vgl, 82%; GDF-l, 63%;

TGF-βl, 39%; TGF-β2, 40%; TGF-β3, 43%; inhibin β(B), 42%; inhibin β(A), 43%.

The Xenopus WA545 DNA sequence (SEQ ID NO:l), or a portion thereof, such as the portion of the Xenopus WA545 sequence corresponding to the mature peptide encoding region, can be used as probe to identify corresponding homologues or related proteins, such as the human or murine WA545 or WA545-related proteins. Nucleotides #775 through #1116 of SEQ ID NO: 1 can be specifically amplified with oligonucleotide primers designed on the basis of the Xenopus WA545 sequence (SEQ ID NO: l). The following oligonucleotide primer is designed on the basis of nucleotide #775 through #794 of the DNA sequence set forth in SEQ ID NO:l and synthesized on an automated DNA synthesizer:

AGTACTCATTCATCACCTCC (SEQ ED NO:9) The following oligonucleotide primer is designed on the basis of the reverse compliment of nucleotide #1116 through #1097 of the DNA sequence set forth in SEQ ED NO: 1 and synthesized on an automated DNA synthesizer. CTTGCAACCACACTCATCCA (SEQ ED NO: 10) The amplification reaction is performed as follows: 10 ng of a bacterial plasmid DNA containing the Xenopus W A545 full-length cDNA is added to a reaction mixture containing 200 μM each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl₂, 0.001% gelatin, 1.25 units Taq DNA polymerase, and 100 pM of each oligonucleotide primer. The reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 55°C, 1 minute at 72°C for thirty cycles. This amplification reaction would be expected to generate a DNA fragment of approximately 344 base pairs which encodes the entire mature peptide of the Xenopus WA545 protein of the invention. The resulting 344 bp DNA product is visualized following electrophoresis of the reaction products through a 2% agarose gel. The region of the gel containing the 344 base pair Xenopus WA545 DNA fragment is excised and the specifically amplified DNA fragments contained therein are extracted (by electroelution or by other methods known to those skilled in the art). The gel- extracted 344 base pair DNA amplification product was radioactively labelled with ³²P and employed to screen a human genomic library constructed in the vector eDASH II (Stratagene catalog #945203). The same probe can be used to screen a murine genomic library constructed in the vector eFEX π (Stratagene catalog #946309). Murine or Human WA545 or WA545-related genes

One million recombinants of the human or murine genomic library are plated at a density of approximately 20,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bacteriophage plaques are hybridized, under reduced stringency conditions, to the ³²P-labelled specifically amplified 344 bp probe in standard hybridization buffer (SHB = 5X SSC, 0.1% SDS, 5X Denhardt's, 100 μg/ml salmon sperm DNA) at 60°C overnight. The following day the radioactively labelled oligonucleotide containing hybridization solution is removed an the filters are washed, under reduced stringency conditions, with 2X SSC, 0.1% SDS at 60°C. Multiple positively hybridizing recombinants can be identified and plaque purified.

These plaque purified recombinant bacteriophage are used to prepare bacteriophage plate stocks from which recombinant bacteriophage DNA can be isolated and purified. The resulting recombinant bacteriophage DNA, isolated from either murine or human genomic clones which were originally identified by hybridization to the Xenopus WA545 probe are analyzed for the presence of either human or murine WA545 or

WA545-related sequences by DNA sequence characterization.

The Xenopus WA545 DNA sequence (SEQ ID NO: 1), or a portion thereof, can be used as a probe to identify a human cell line or tissue which synthesizes WA545 mRNA. Briefly described, RNA is extracted from a selected cell or tissue source and either electrophoresed on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formaldehyde and spotted on nitrocellulose directly. The nitrocellulose is then hybridized to a probe derived from the coding sequence of Xenopus WA545 DNA.

Alternatively, the Xenopus WA545 sequence is used to design oligonucleotide primers which will specifically amplify a portion of the human or murine WA545 or

WA545-related encoding sequence located in the region between the human or murine primers utilized to perform the specific amplification reaction. It is contemplated that these Xenopus WA545 derived primers would allow one to specifically amplify corresponding human WA545 or other mammalian WA545 encoding sequences from mRNA, cDNA or genomic DNA templates. Once a positive source has been identified by one of the above described methods, mRNA is selected by oligo (dT) cellulose chromatography and cDNA is synthesized and cloned in λgtlO or other λ bacteriophage vectors known to those skilled in the art, for example, λZAP by established techniques (Toole et al., supra). It is also possible to perform the oligonucleotide primer directed amplification reaction, described above, directly on a pre-established human cDNA or genomic library which has been cloned into a λ bacteriophage vector. In such cases, a library which yields a specifically amplified DNA product encoding a portion of the human WA545 protein could be screened directly, utilizing the fragment of amplified human WA545 protein encoding DNA as a probe. Oligonucleotide primers designed on the basis of the DNA sequence of the

Xenopus WA545 genomic clone are predicted to allow the specific amplification of human WA545 encoding DNA sequences from pre-established human cDNA libraries which are commercially available (i.e., Stratagene, La Jolla, CA or Clonetech Laboratories, Inc., Palo Alto, CA). The oligonucleotide primers are designed on the basis of the DNA sequence set forth in SEQ ID NO: l and synthesized on an automated DNA synthesizer.

Approximately 1 x 10⁸ pfu (plaque forming units) of λbacteriophage libraries containing human cDNA inserts corresponding to the primers are denatured at 95°C for five minutes prior to addition to a reaction mixture containing 200 μM each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl pH

8.3, 50 mM KC1, 1.5 mM MgCl₂, 0.001% gelatin, 1.25 units Taq DNA polymerase, 100 pM oligonucleotide primers. The reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 50°C, 1 minute at 72°C for thirty-nine cycles followed by 10 minutes at 72°C. The resulting DNA product which is specifically amplified by this reaction is visualized following electrophoresis of the reaction products through a 2% agarose gel. Once a positive cDNA source has been identified in this manner, the corresponding cDNA library from which a WA545 specific sequence was amplified could be screened directly with the other WA545 specific probes in order to identify and isolate cDNA clones encoding the full-length WA545 protein of the invention.

Additional methods known to those skilled in the art may be used to isolate other full-length cDNAs encoding human WA545 proteins, or full length cDNA clones encoding WA545 proteins of the invention from species other than humans, particularly other mammalian species. Alternatively, oligonucleotides are utilized as primers to allow the specific amplification of human or murine WA545 specific nucleotide sequences from Xenopus WA545 encoding plasmids. The amplification reaction is performed as follows: Approximately 25 ng of Xenopus WA545 DNA is added to a reaction mixture containing 200 μM each deoxynucleotide triphosphates (dATP, dGTP, dCTP and dTTP) 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl₂, 0.001% gelatin, 1.25 units Taq DNA polymerase, 100 pM each of oligonucleotide primers to the

Xenopus WA545 DNA sense and complementary orientations. The reaction mixture is then subjected to thermal cycling in the following manner: 1 minute at 94°C, 1 minute at 53°C, 1 minute at 72°C for thirty cycles.

The DNA which is specifically amplified by this reaction would be expected to generate a WA545 encoding product. The resulting DNA product is visualized following electrophoresis of the reaction products through a 2% agarose gel. The region of the gel containing the WA545 DNA fragment is excised and the specifically amplified DNA fragments contained therein are extracted (by electroelution or by other methods known to those skilled in the art). The gel-extracted DNA amplification product is radioactively labelled with ³²P and employed to screen a human genomic library constructed in the vector λ DASH II (Stratagene catalog #945203).

Additional methods known to those skilled in the art can also be used to isolate human and other species homologues of WA545 and related proteins using the DNA and amino acid sequences of the present invention.

Example 3. W-20 Bioassays

A. Description of W-20 cells

Use of the W-20 bone marrow stromal cells as an indicator cell line is based upon the conversion of these cells to osteoblast-like cells after treatment with a BMP protein [Thies et al, Journal of Bone and Mineral Research, 5:305 (1990); and Thies et al, Endocrinology, 130:1318 (1992)]. Specifically, W-20 cells are a clonal bone marrow stromal cell line derived from adult mice by researchers in the laboratory of Dr. D. Nathan, Children's Hospital, Boston, MA. Treatment of W-20 cells with certain BMP proteins results in (1) increased alkaline phosphatase production, (2) induction of PTH stimulated cAMP, and (3) induction of osteocalcin synthesis by the cells. While (1) and (2) represent characteristics associated with the osteoblast phenotype, the ability to synthesize osteocalcin is a phenotypic property only displayed by mature osteoblasts. Furthermore, to date we have observed conversion of W-20 stromal cells to osteoblast-like cells only upon treatment with BMPs. In this manner, the in vitro activities displayed by BMP treated W-20 cells correlate with the in vivo bone forming activity known for BMPs.

Below two in vitro assays useful in comparison of BMP activities of novel osteoinductive molecules, such as WA545, are described. B. W-20 Alkaline Phosphatase Assay Protocol W-20 cells are plated into 96 well tissue culture plates at a density of 10,000 cells per well in 200 μl of media (DME with 10% heat inactivated fetal calf serum, 2 mM glutamine and 100 Units/ml penicillin + 100 μg/ml streptomycin. The cells are allowed to attach overnight in a 95% air, 5% CO₂ incubator at 37 °C.

The 200 μl of media is removed from each well with a multichannel pipettor and replaced with an equal volume of test sample delivered in DME with 10% heat inactivated fetal calf serum, 2 mM glutamine and 1% penicillin-streptomycin. Test substances are assayed in triplicate.

The test samples and standards are allowed a 24 hour incubation period with the W-20 indicator cells. After the 24 hours, plates are removed from the 37 °C incubator and the test media are removed from the cells.

The W-20 cell layers are washed 3 times with 200 μl per well of calcium/magnesium free phosphate buffered saline and these washes are discarded. 50 μl of glass distilled water is added to each well and the assay plates are then placed on a dry ice/ethanol bath for quick freezing. Once frozen, the assay plates are removed from the dry ice/ethanol bath and thawed at 37 °C. This step is repeated 2 more times for a total of 3 freeze-thaw procedures. Once complete, the membrane bound alkaline phosphatase is available for measurement.

50 μl of assay mix (50 mM glycine, 0.05% Triton X-100, 4 mM MgCl₂, 5 mM p-nitrophenol phosphate, pH = 10.3) is added to each assay well and the assay plates are then incubated for 30 minutes at 37 °C in a shaking waterbath at 60 oscillations per minute.

At the end of the 30 minute incubation, the reaction is stopped by adding 100 μl of 0.2 N NaOH to each well and placing the assay plates on ice.

The spectrophotometric absorbance for each well is read at a wavelength of 405 nanometers. These values are then compared to known standards to give an estimate of the alkaline phosphatase activity in each sample. For example, using known amounts of p-nitrophenol phosphate, absorbance values are generated. This is shown in Table I.

Table I

Absorbance Values for Known Standards of P-Nitrophenol Phosphate

P-nitrophenol phosphate umoles Mean absorbance (405 nm)

0.000 0

0.006 0.261 +/- .024

0.012 0.521 +/- .031

0.018 0.797 +/- .063

0.024 1.074 +/- .061

0.030 1.305 +/- .083

Absorbance values for known amounts of BMPs can be determined and converted to μmoles of p-nitrophenol phosphate cleaved per unit time as shown in Table II.

Table II

Alkaline Phosphatase Values for W-20 Cells

Treating with BMP-2

BMP-2 concentration Absorbance Reading umoles substrate ng/ml 405 nmeters per hour

0 0.645 0.024

1.56 0.696 0.026

3.12 0.765 0.029

6.25 0.923 0.036

12.50 1.121 0.044

25.0 1.457 0.058

50.0 1.662 0.067

100.0 1.977 0.080 These values are then used to compare the activities of known amounts of

WA545 to BMP-2.

C. Osteocalcin RIA Protocol

W-20 cells are plated at 10⁶ cells per well in 24 well multiwell tissue culture dishes in 2 mis of DME containing 10% heat inactivated fetal calf serum, 2 mM glutamine. The cells are allowed to attach overnight in an atmosphere of 95% air 5%

CO₂ at 37°C.

The next day the medium is changed to DME containing 10% fetal calf serum, 2 mM glutamine and the test substance in a total volume of 2 ml. Each test substance is administered to triplicate wells. The test substances are incubated with the W-20 cells for a total of 96 hours with replacement at 48 hours by the same test medias.

At the end of 96 hours, 50 μl of the test media is removed from each well and assayed for osteocalcin production using a radioimmunoassay for mouse osteocalcin.

The details of the assay are described in the kit manufactured by Biomedical

Technologies Inc., 378 Page Street, Stoughton, MA 02072. Reagents for the assay are found as product numbers BT-431 (mouse osteocalcin standard), BT-432 (Goat anti-mouse Osteocalcin), BT-431R (iodinated mouse osteocalcin), BT-415 (normal goat serum) and BT-414 (donkey anti goat IgG). The RIA for osteocalcin synthesized by W-20 cells in response to BMP treatment is carried out as described in the protocol provided by the manufacturer. The values obtained for the test samples are compared to values for known standards of mouse osteocalcin and to the amount of osteocalcin produced by W-20 cells in response to challenge with known amounts of BMP-2. The values for BMP-2 induced osteocalcin synthesis by W-20 cells is shown in Table HI.

Table III

Osteocalcin Synthesis by W-20 Cells

BMP-2 Concentration ng/ml Osteocalcin Synthesis ng/well

0 0.8

2 0.9

4 0.8

8 2.2

16 2.7

31 3.2

62 5.1

125 6.5

250 8.2

500 9.4

1000 10.0

Example 4. Rosen Modified Sampath-Reddi Assay

A modified version of the rat bone formation assay described in Sampath and Reddi, Proc. Natl. Acad. Sci. USA. 80:6591-6595 (1983) is used to evaluate bone and/or cartilage and/or other connective tissue activity of BMP proteins. This modified assay is herein called the Rosen-modified Sampath-Reddi assay. The ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialyzing (if the composition is a solution) or diafiltering (if the composition is a suspension) the fraction to be assayed against water. The solution or suspension is then equilibrated to 0.1% TFA. The resulting solution is added to 20 mg of rat matrix. A mock rat matrix sample not treated with the protein serves as a control. This material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules. The capsules are implanted subcutaneously in the abdominal thoracic area of 21-49 day old male E >ng Evans rats. The implants are removed after 7-14 days. Half of each implant is used for alkaline phosphatase analysis [see, Reddi et al, Proc. Natl. Acad. ScL, 69: 1601 (1972)].

The other half of each implant is fixed and processed for histological analysis. 1 μm glycolmethacrylate sections are stained with Von Kossa and acid fuschin to score the amount of induced bone and cartilage and other connective tissue formation present in each implant. The terms +1 through +5 represent the area of each histological section of an implant occupied by new bone and/or cartilage cells and matrix. A score of +5 indicates that greater than 50% of the implant is new bone and/or cartilage produced as a direct result of protein in the implant. A score of +4, +3, +2, and +1 would indicate that greater than 40%, 30%, 20% and 10% respectively of the implant contains new cartilage and/or bone.

Alternatively, the implants are inspected for the appearance of tissue resembling embryonic tendon, which is easily recognized by the presence of dense bundles of fibroblasts oriented in the same plane and packed tightly together. [Tendon/ligament-like tissue is described, for example, in Ham and Cormack, Histology (JB Lippincott Co. (1979), pp. 367-369, the disclosure of which is hereby incorporated by reference]. These findings may be reproduced in additional assays in which tendon/ligament-like tissues are observed in the WA545 protein containing implants.

The WA545 proteins of this invention may be assessed for activity on this assay.

Example 5. Expression of WA545

In order to produce murine, human or other mammalian WA545 proteins, the DNA encoding it is transferred into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. The preferred expression system for biologically active recombinant human WA545 is contemplated to be stably transformed mammalian cells.

One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 1 , or other DNA sequences encoding WA545 proteins or other modified sequences and known vectors, such as pCD [Okayama et al., Mol. Cell Biol., 2: 161-170 (1982)], pJL3, pJL4 [Gough et al., EMBO J.. 4:645-

653 (1985)] and pMT2 CXM.

The mammalian expression vector pMT2 CXM is a derivative of p91023(b) (Wong et al., Science 228:810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline resistance gene and further contains a Xhol site for insertion of cDNA clones. The functional elements of pMT2 CXM have been described (Kaufman, R.J., 1985, Proc. Natl. Acad. Sci. USA 82:689- 693) and include the adenovirus VA genes, the SV40 origin of replication including the 72 bp enhancer, the adenovirus major late promoter including a 5' splice site and the majority of the adenovirus tripartite leader sequence present on adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences needed for propagation in R coli.

Plasmid pMT2 CXM is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD (USA) under accession number ATCC 67122. EcoRI digestion excises the cDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout in mutagenesis [Morinaga, et al., Biotechnology 84: 636 (1984). This removes bases 1075 to 1145 relative to the Hind EH site near the SV40 origin of replication and enhancer sequences of pMT2. In addition, it inserts the following sequence:

5' PO-CATGGGCAGCTCGAG-3' at nucleotide 1145. This sequence contains the recognition site for the restriction endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains recognition sites for the restriction endonucleases PstI, Eco RI, Sail and Xhol.

Plasmid pMT2 CXM and pMT23 DNA may be prepared by conventional methods. pEMC2βl derived from pMT21 may also be suitable in practice of the invention. pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear form which can be ligated and used to transform R Coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT21 is derived from pMT2 through the following two modifications. First, 76 bp of the 5' untranslated region of the DHFR cDNA including a stretch of 19 G residues from G/C tailing for cDNA cloning is deleted. In this process, a Xhol site is inserted to obtain the following sequence immediately upstream from DHFR: 5' -

CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3'

PstI Eco RI Xhol

Second, a unique Clal site is introduced by digestion with EcoRV and Xbal, treatment with Klenow fragment of DNA polymerase I, and ligation to a Clal linker (CATCGATG). This deletes a 250 bp segment from the adenovirus associated RNA (VAI) region but does not interfere with VAI RNA gene expression or function. pMT21 is digested with EcoRI and Xhol, and used to derive the vector pEMC2B 1. A portion of the EMCV leader is obtained from pMT2-ECAT 1 [S .K. Jung, et al, J. Virol 63: 1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a 2752 bp fragment. This fragment is digested with TaqI yielding an Eco RI-TaqI fragment of 508 bp which is purified by electrophoresis on low melting agarose gel. A 68 bp adapter and its complementary strand are synthesized with a 5' TaqI protruding end and a 3' Xhol protruding end which has the following sequence:

5'-CGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTT TaqI GAAAAACACGATTGC-3'

Xhol

This sequence matches the EMC virus leader sequence from nucleotide 763 to 827.

It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a Xhol site. A three way ligation of the pMT21 Eco Rl-Xhol fragment, the EMC virus EcoRI-TaqI fragment, and the 68 bp oligonucleotide adapter Taql-

Xhol adapter resulting in the vector pEMC2βl.

This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I gene, DHFR and β-lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells. The construction of vectors may involve modification of the WA545 DNA sequences. For instance, WA545 cDNA can be modified by removing the non-coding nucleotides on the 5' and 3' ends of the coding region. The deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of WA545 proteins. Additionally, the sequence of SEQ ID NO: 1 or other sequences encoding WA545 proteins can be manipulated to express a mature WA545 protein by deleting WA545 encoding propeptide sequences and replacing them with sequences encoding the complete propeptides of other BMP proteins.

One skilled in the art can manipulate the sequences of SEQ ID NO: 1 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (e.g. ligated to other known linkers or modified by deleting non-coding sequences therefrom or altering nucleotides therein by other known techniques). The modified WA545 coding sequence could then be inserted into a known bacterial vector using procedures such as described in T. Taniguchi et al., Proc. Natl Acad. Sci. USA, 77:5230-5233 (1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a WA545 protein expressed thereby. For a strategy for producing extracellular expression of WA545 proteins in bacterial cells, see, e.g. European patent application EPA 177,343.

Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures described in published European patent application 155,476] for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells. [See, e.g., procedures described in published PCT application WO86/00639 and European patent application EPA 123,289].

A method for producing high levels of a WA545 protein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous WA545 gene. The heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J. Mol. Biol., 159:601-629 (1982). This approach can be employed with a number of different cell types. For example, a plasmid containing a DNA sequence for a WA545 protein of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell. Biol.. 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO cells, DUKX-Bπ, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol., 5: 1750 (1983). Transformants are cloned, and biologically active WA545 expression is monitored by the Rosen-modified

Sampath-Reddi rat bone formation assay described above in Example 4. WA545 protein expression should increase with increasing levels of MTX resistance. WA545 polypeptides are characterized using standard techniques known in the art such as pulse labeling with [35S] methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related WA545 proteins. Example 6 Biological Activity of Expressed WA545

To measure the biological activity of the expressed WA545 proteins obtained in Example 5 above, the proteins are recovered from the cell culture and purified by isolating the WA545 proteins from other proteinaceous materials with which they are co-produced as well as from other contaminants. The purified protein may be assayed in accordance with the rat bone formation assay described in Example 4.

Purification is carried out using standard techniques known to those skilled in the art. Protein analysis is conducted using standard techniques such as SDS-PAGE acrylamide [Laemmli, Nature 227:680 (1970)] stained with silver [Oakley, et al. Anal. Biochem. 105:361 (1980)] and by immunoblot [Towbin, et al. Proc. Natl. Acad. Sci. USA 76:4350 (1979)1

Example 7. Northern Analysis of WA545

Using Northern analysis, WA545 proteins can be tested for their effects on various cell lines. Suitable cell lines include cell lines derived from El 3 mouse limb buds. After 10 days of treatment with WA545 protein, the cell phenotype is examined histologically for indications of tissue differentiation. In addition, Northern analysis of mRNA from WA545 protein treated cells can be performed for various markers including one or more of the following markers for bone, cartilage and/or tendon/ligament, as described in Table TV:

Table IV

Marker Bone Cartilage Tendon/Li gament

Osteocalcin - -

Alkaline Phosphatase + - -

Proteoglycan Core Protein +/-' + +²

Collagen Type I + + +

Collagen Type II +/-' + +²

Decorin + + +

Elastin +/-³ ? +

1 - Marker seen early, marker not seen as mature bone tissue forms

2- Marker depends upon site of tendon; strongest at bone interface

3- Marker seen at low levels

Example 8. Embryonic Stem Cell Assay

In order to assay the further effects of the WA545 proteins of the present invention, it is possible to assay the growth and differentiation effects in vitro on a number of available embryonic stem cell lines. One such cell line is ES-E14TG2, which is available from the American Type Culture Collection in Rockville, Md. In order to conduct the assay, cells may be propagated in the presence of 100 units of LEF to keep them in an undifferentiated state. Assays are setup by first removing the LEF and aggregating the cells in suspension, in what is known as embryoid bodies. After 3 days the embryoid bodies are plated on gelatin coated plates (12 well plates for PCR analysis, 24 well plates for immunocytochemistry) and treated with the proteins to be assayed. Cells are supplied with nutrients and treated with the protein factor every 2-3 days. Cells may be adapted so that assays may be conducted in media supplemented with 15% Fetal Bovine Serum (FBS) or with CDM defined media containing much lower amounts of FBS.

At the end of the treatment period (ranging from 7-21 days) RNA is harvested from the cells and analyzed by quantitative multiplex PCR for the following markers:

Brachyury, a mesodermal marker, AP-2, an ectodermal marker, and HNF-3 an endodermal marker. Through immunocytochemistry, it is also possible to detect the differentiation of neuronal cells (glia and neurons), muscle cells (cardiomyocytes, skeletal and smooth muscle), and various other phenotype markers such as proteoglycan core protein (cartilage), and cytokeratins (epidermis). Since these cells have a tendency to differentiate autonomously when LEF is removed, the results are always quantitated by comparison to an untreated control.

Example 9. In Situ Hybridization of WA545 with Embryos of Xenopus laevis Albino embryos were collected at various stages for fixation, permeabilized with proteinase K and pre-hybridized. They were then hybridized overnight with digoxygenin-labeled riboprobes. Embryos were washed, treated with RNase A and Tl to remove background and blocked with Boehringer Mannheim Blocking Reagent. Embryos were incubated with alkaline phosphatase-conjugated anti-digoxygenin antibody for four hours at room temperature, washed extensively before chromogenic reaction with alkaline phosphatase substrate. Embryos were then re-fixed and de- stained to remove background for photography. Results: Expression profile.

Results from in situ hybridization (Figure 1) and developmental RT-PCR (Figure 2) show that WA545 has no maternal transcript and is first expressed at late blastula in the entire marginal zone and in some of the vegetal cells. The expression level increases at the onset of gastrulation. This high level expression is maintained during gastrulation and starts to decline during late stages of gastrulation. By late gastrula, WA545 expression is still present in lateral and ventral mesoderm but is excluded from the dorsal-most region which will form the notochord. The early expression of this gene in the entire marginal zone and later posterior restriction correlates well with the conclusion that WA545 is involved in induction of mesoderm with posterior characteristics and modification of neural tissue formation.

Example 10. Whole embryo assay of WA545 Frog embryos were microinjected with 50pg or lOOpg in vitro synthesized, capped RNA at 2-cell or 4-cell stages. Beta-galactosidase RNA was included as lineage tracer to determine the extent of diffusion of the injected RNA. The product of the b-gal RNA was visualized histochemically, by X-gal staining. The target area of these micro-injections were dorsal marginal zone or ventral marginal zone of one of the 2 or 4 cells. Embryos were left to develop until desired stages before harvested for fixation, X-gal staining and photography. Results: WA545 gain-of-function phenotype in whole embryos.

Ventral microinjection of early embryos results in the formation of a secondary axis at later stages (Figure 3). This secondary axis does not contain a head, implying that WA545 is an inducer of posterior mesoderm. Dorsal micro-injection of early embryos results in a loss of anterior structures (Figure 4) including cement gland (chin), hatching gland, eyes, and forebrain. This observation indicates that WA545 may convert anterior to more posterior tissue.

Example 11. Animal cap assay

Embryos were micro-injected with 50 to 400pg capped RNA in animal pole of one cell at 2-cell stage. Globin RNA was used as a control. Embryos were left to develop until stage 8. Cells at the animal pole of embryos were microdissected

(animal caps) and cultured until sibling intact, uninjected embryos reach stages 14 or 19. 15 animal caps microinjected with the same RNA (experimental or globin) were pooled for total RNA preparation. 5 intact embryos were used for preparation of whole embryo control RNA. These RNA samples were reverse transcribed using random hexamer as primers for cDNA. These DNA samples were subjected to PCR using gene-specific primer pairs at the presence of ³²P-dCTP to assay for the presence of corresponding mRNAs in the original RNA samples. The primer pairs used and cycle number for each pair were optimized previously. The products of these PCR reactions were subsequently resolved on polyacrylamide gels. Results: Animal cap gain-of-function assay.

Examination of a panel of molecular markers indicates that most mesodermal markers are induced in animal cap assays (Figure 5). These markers include brachyury, Pintallavis, Xnot and muscle-actin. Histologically, large blocks of muscle are formed. Of the neural markers examined, Krox20 is not induced while HoxB9 is. Krox20 is normally expressed in rhombomeres 3 and 5 and HoxB9 is expressed in the posterior spinal cord. These results indicate that WA545 induces posterior mesoderm while anterior mesoderm (goosecoid) and neural (NCAM) genes are not activated. This again lends support to the idea that WA545 is an inducer of mesoderm of posterior characteristics, and may modify neural fates from brain to spinal cord.

Example 12. Summary of Results for WA545

WA545 is expressed from late blastula throughout the mesoderm and endoderm. It is later expressed in posterior mesoderm. It is able to efficiently induce posterior and lateral mesoderm, including muscle. Thus, WA545 may be involved in formation of posterior regions and may be useful for ectopic activation of muscle and spinal cord development.

The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these descriptions.

Those modifications and variations are part of the present invention, and believed to be encompassed within the claims appended hereto. The disclosure of all of the publications and patent applications which are cited in this specification are hereby incorporated by reference for the disclosure contained therein.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: RACIE, LISA A.

LaVALLIE, EDWARD R. SIVE, HAZEL SUN, BENJAMIN

(ii) TITLE OF INVENTION: WA545 COMPOSITIONS

(iii) NUMBER OF SEQUENCES: 10

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Genetics Institute, Inc.

(B) STREET: 87 CambridgePark Drive

(C) CITY: Cambridge

(D) STATE: Massachusetts

(E) COUNTRY: USA

(F) ZIP: 02140

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentin Release #1.0, Version #1.30

(vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: US TBD

(B) FILING DATE: 10-JUL-1997

(C) CLASSIFICATION:

(viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: LAZAR, STEVEN R.

(B) REGISTRATION NUMBER: 32,618

(C) REFERENCE/DOCKET NUMBER: GI 5292

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (617) 498-8260

(B) TELEFAX: (617) 876-5851

(2) INFORMATION FOR SEQ ID NO : 1 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1554 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 55..1119

(ix) FEATURE:

(A) NAME/KEY: sig_peptide

(B) LOCATION: 55..774

(ix) FEATURE: (A) NAME/KEY: mat_peptide

(B) LOCATION: 775..1119

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 1 :

GAATTCCCAT AGCAACAAAC AGTACCCATA GCAACAAACA GTAGAGAAGT CAAC ATG 57

Met -240

GCA GAG TTG TGG CTA TCA CTT TCT TGC ATG TTC TCC TTG CTT CTA CTG 105 Ala Glu Leu Trp Leu Ser Leu Ser Cys Met Phe Ser Leu Leu Leu Leu -235 -230 -225

ACA AAT TCA TCT CCA CTT ACC TTC CAG GAA AGA ATG CTC CTT AAA GCC 153 Thr Asn Ser Ser Pro Leu Thr Phe Gin Glu Arg Met Leu Leu Lys Ala -220 -215 -210

TTG GGG CTG AAC ACC AGA CCA AAC CCC ATT GCT CCA GCT CCT GTA CCT 201 Leu Gly Leu Asn Thr Arg Pro Asn Pro lie Ala Pro Ala Pro Val Pro -205 -200 -195

AAA TCT TTA AGA GAC ATT TTT GAG AAG GGG ATA AAC CAG GAC AAT CCC 249 Lys Ser Leu Arg Asp lie Phe Glu Lys Gly lie Asn Gin Asp Asn Pro -190 -185 -180

TGC ATG ATG GAA GGT TTC GGA GTA CCT GGA AAT ATT GTC CGC TCA TAT 297 Cys Met Met Glu Gly Phe Gly Val Pro Gly Asn lie Val Arg Ser Tyr -175 -170 -165 -160

CGA GAT CAA GGA ACC ATA GCA GCC ATA GAG GAG CCA CAA GGA TCT CTG 345 Arg Asp Gin Gly Thr lie Ala Ala lie Glu Glu Pro Gin Gly Ser Leu -155 -150 -145

TGC TTA AAG AAA TTT CTC TTT TTT GAC CTA TCA GCA GTG GAG AAC AAG 393 Cys Leu Lys Lys Phe Leu Phe Phe Asp Leu Ser Ala Val Glu Asn Lys -140 -135 -130

GAG CAA TTG ACC CTA GGC CAA CTG GAA ATT AAG TTC AAG CAC AAC ACA 441 Glu Gin Leu Thr Leu Gly Gin Leu Glu lie Lys Phe Lys His Asn Thr -125 -120 -115

TAT TAT GGA CAA CAG TTC CAT CTC CGC CTC TAC CGC ACC CTT CAG CTA 489 Tyr Tyr Gly Gin Gin Phe His Leu Arg Leu Tyr Arg Thr Leu Gin Leu -110 -105 -100

TCT CTA AAA GGG ATG AGA GAC AGC AAG ATG AAC AGG AAG CTC CTG GTG 537 Ser Leu Lys Gly Met Arg Asp Ser Lys Met Asn Arg Lys Leu Leu Val -95 -90 -85 -80

ACT CAG TCT TTC CGT CTC CTT CAC AAG TCC CTC TAT TTC AAC TTG ACC 585 Thr Gin Ser Phe Arg Leu Leu His Lys Ser Leu Tyr Phe Asn Leu Thr -75 -70 -65

AAG GTG GCA GAG GAC TGG AAA AAC CCT GAG AAG AAT ATG GGT CTG ATA 633 Lys Val Ala Glu Asp Trp Lys Asn Pro Glu Lys Asn Met Gly Leu lie -60 -55 -50

CTG GAA ATA TAT GCA AGC AGT GAA CTT GCA GGA GGC AAT CGA TCA TTT 681 Leu Glu lie Tyr Ala Ser Ser Glu Leu Ala Gly Gly Asn Arg Ser Phe -45 -40 -35

GTA GTA TGT GAA CCA ATA CAG TCT TTC ATT TAC ACT TCT CTG CTC ACT 729 Val Val Cys Glu Pro lie Gin Ser Phe lie Tyr Thr Ser Leu Leu Thr -30 -25 -20

GTG TCC CTA GAC CCA TCC AAT TGC AAA ACT CAA CGA GCC AAG AGG AGT 777 Val Ser Leu Asp Pro Ser Asn Cys Lys Thr Gin Arg Ala Lys Arg Ser -15 -10 -5 1

ACT CAT TCA TCA CCT CCA ACC CCA AGC AAT ATC TGC AAG AAA AGG AGA 825 Thr His Ser Ser Pro Pro Thr Pro Ser Asn lie Cys Lys Lys Arg Arg 5 10 15

TTG TAC ATT GAC TTC AAG GAT GTT GGA TGG CAG AAC TGG GTC ATT GCA 873 Leu Tyr lie Asp Phe Lys Asp Val Gly Trp Gin Asn Trp Val lie Ala 20 25 30

CCC CGT GGT TAC ATG GCA AAC TAC TGC CAT GGA GAG TGC CCC TAT CCA 921 Pro Arg Gly Tyr Met Ala Asn Tyr Cys His Gly Glu Cys Pro Tyr Pro 35 40 45

CTG ACG GAA ATG CTA AGG GGC ACA AAT CAT GCT GTT TTA CAG ACT CTG 969 Leu Thr Glu Met Leu Arg Gly Thr Asn His Ala Val Leu Gin Thr Leu 50 55 60 65

GTG CAT TCT GTA GAA CCA GAA AAC ACC CCA TTG CCT TGC TGT GCC CCC 1017 Val His Ser Val Glu Pro Glu Asn Thr Pro Leu Pro Cys Cys Ala Pro 70 75 80

ACT AAG CTG TCT CCT ATC TCC ATG CTA TAT TAT GAC AAC AAT GAC AAT 1065 Thr Lys Leu Ser Pro lie Ser Met Leu Tyr Tyr Asp Asn Asn Asp Asn 85 90 95

GTG GTA CTG AGG CAC TAT GAA GAT ATG GTA GTG GAT GAG TGT GGT TGC 1113 Val Val Leu Arg His Tyr Glu Asp Met Val Val Asp Glu Cys Gly Cys 100 105 110

AAG TGA GTTTGCTTTG GAGATTGTTC TCATTCCCTT ATCTAAGCCT TAAACTTATC 1169 Lys * 115

CTCTAAAGGG ACTGCTGCCA ACCTAGTTAT GAAGCCTCGC GCCTCGTGCG ACAGTGACTT 1229

TAACCATCTT ACATAACATT AATTGATAAG ACTATATTTA TTTTGGGGTG TACTTGCCCT 1289

TTAGGTGGTT TGGCAAATGC CATGCGTGGC TCTTAACAGA GCTGCTGGAT GAAACACATT 1349

TTTAAAAAAG TATATTGTTG TCAATAAATG TTTTTATCTT TATATATTGG GCATAGAGCT 1409

AGGTTGGTGC CTGAAAATTG CCTAGCACTT GCAAGTACAG CTGATTGTTG GAAATAAATG 1469

TGATTTAACC CAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA 1529

AAAAAAAAAA AAAAAAAAAC TCGAG 1554

(2) INFORMATION FOR SEQ ID NO : 2 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 355 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 2 :

Met Ala Glu Leu Trp Leu Ser Leu Ser Cys Met Phe Ser Leu Leu Leu -240 -235 -230 -225

Leu Thr Asn Ser Ser Pro Leu Thr Phe Gin Glu Arg Met Leu Leu Lys -220 -215 -210

Ala Leu Gly Leu Asn Thr Arg Pro Asn Pro lie Ala Pro Ala Pro Val -205 -200 -195

Pro Lys Ser Leu Arg Asp lie Phe Glu Lys Gly lie Asn Gin Asp Asn -190 -185 -180

Pro Cys Met Met Glu Gly Phe Gly Val Pro Gly Asn He Val Arg Ser -175 -170 -165

Tyr Arg Asp Gin Gly Thr He Ala Ala He Glu Glu Pro Gin Gly Ser -160 -155 -150 -145

Leu Cys Leu Lys Lys Phe Leu Phe Phe Asp Leu Ser Ala Val Glu Asn -140 -135 -130

Lys Glu Gin Leu Thr Leu Gly Gin Leu Glu He Lys Phe Lys His Asn -125 -120 -115

Thr Tyr Tyr Gly Gin Gin Phe His Leu Arg Leu Tyr Arg Thr Leu Gin -110 -105 -100

Leu Ser Leu Lys Gly Met Arg Asp Ser Lys Met Asn Arg Lys Leu Leu -95 -90 -85

Val Thr Gin Ser Phe Arg Leu Leu His Lys Ser Leu Tyr Phe Asn Leu -80 -75 -70 -65

Thr Lys Val Ala Glu Asp Trp Lys Asn Pro Glu Lys Asn Met Gly Leu -60 -55 -50

He Leu Glu He Tyr Ala Ser Ser Glu Leu Ala Gly Gly Asn Arg Ser -45 -40 -35

Phe Val Val Cys Glu Pro He Gin Ser Phe He Tyr Thr Ser Leu Leu -30 -25 -20

Thr Val Ser Leu Asp Pro Ser Asn Cys Lys Thr Gin Arg Ala Lys Arg -15 -10 -5

Ser Thr His Ser Ser Pro Pro Thr Pro Ser Asn He Cys Lys Lys Arg 1 5 10 15

Arg Leu Tyr He Asp Phe Lys Asp Val Gly Trp Gin Asn Trp Val He 20 25 30

Ala Pro Arg Gly Tyr Met Ala Asn Tyr Cys His Gly Glu Cys Pro Tyr 35 40 45

Pro Leu Thr Glu Met Leu Arg Gly Thr Asn His Ala Val Leu Gin Thr 50 55 60

Leu Val His Ser Val Glu Pro Glu Asn Thr Pro Leu Pro Cys Cys Ala 65 70 75 80

Pro Thr Lys Leu Ser Pro He Ser Met Leu Tyr Tyr Asp Asn Asn Asp 85 90 95

Asn Val Val Leu Arg His Tyr Glu Asp Met Val Val Asp Glu Cys Gly 100 105 110

Cys Lys *

115

(2) INFORMATION FOR SEQ ID NO : 3 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 3 : GAAAGTGATA GCCACAACTC TGCCATG 27

(2) INFORMATION FOR SEQ ID NO : 4 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 27 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 4 : GATTTAGGTA CAGGAGCTGG AGCAATG 27

(2) INFORMATION FOR SEQ ID NO : 5 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 5 :

Trp Xaa Xaa Trp He Xaa Ala 1 5

(2) INFORMATION FOR SEQ ID NO : 6 :

(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 6 : GCGGATCCTG GVANGABTGG ATHRTNGC ( 2 ) INFORMATION FOR SEQ ID NO : 7 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 7 :

Asn His Ala He Xaa Gin Thr 1 5

( 2 ) INFORMATION FOR SEQ ID NO : 8 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 28 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO : 8 : GCTCTAGAGT YTGNAYNATN GCRTGRTT (2) INFORMATION FOR SEQ ID NO : 9 :

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 9 : AGTACTCATT CATCACCTCC 20

(2) INFORMATION FOR SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: CTTGCAACCA CACTCATCCA 20

INDICATIONS RELATING TO A DEPOSITED MICROORGANISM

(PCT Rule I3bis)

A. The indications made below relate to the microorganism referred to in the description on page 8 , lines 5-23

B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet | |

Name of depositary institution

American Type Culture Collection

Address of depositary institution (including postal code and country)

10801 University Boulevard Manas sas , Virginia 201 10-2209 United States of America

Date of deposit Accession Number 09 May 1997 98428, 98429, 98430, 98431, and 98432

C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet Q

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)

E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)

The indications listed belowwill be submitted to the Internationa] Bureau later (specify the general nature of the indications e.g., "Accession Number of Deposit")

Claims

What is claimed is:

1. An isolated DNA sequence encoding a WA545-related protein comprising a DNA sequence selected from the group consisting of:

(a) nucleotides #55, #775 or #811 to nucleotide #1113 or #1116 as shown in SEQ ID NO: 1;

(b) sequences which hybridize to (a) under stringent hybridization conditions and encode a protein which exhibits WA545 activity.

2. An isolated DNA sequence encoding WA545 protein comprising a DNA sequence selected from the group consisting of:

(a) nucleotides encoding amino acids #-240, #1 or #13 to #113 or #114 as shown in SEQ ID NO: 2;

(b) sequences which hybridize to (a) under stringent hybridization conditions and encode a protein which exhibits WA545 activity.

3. A vector comprising a DNA molecule of claim 1 in operative association with an expression control sequence therefor.

4. A vector comprising a DNA molecule of claim 2 in operative association with an expression control sequence therefor.

5. A host cell transformed with the vector of claim 3.

6. A host cell transformed with the vector of claim 4.

7. An isolated DNA molecule having a sequence encoding a protein which is characterized by the ability to induce the formation of mesodermal or related tissue, said DNA molecule comprising a DNA sequence selected from the group consisting of:

(a) nucleotide #55, #775 or #811 to nucleotide #1116 as shown in SEQ ID NO: l; and

(b) naturally occurring allelic sequences and equivalent degenerative codon sequences of (a).

8. A vector comprising a DNA molecule of claim 7 in operative association with an expression control sequence therefor.

9. A host cell transformed with the vector of claim 8.

57

10. An isolated DNA molecule encoding WA545 protein, said DNA molecule comprising nucleotides encoding an amino acid sequence comprising amino acids #- 240, #1 or #13 to #114 as shown in SEQ ID NO:2.

11. An isolated DNA molecule according to claim 10, further comprising a nucleotide sequence encoding a suitable propeptide 5' to and linked in frame to the DNA coding sequence.

12. A vector comprising a DNA molecule of claim 11 in operative association with an expression control sequence therefor.

13. A host cell transformed with the vector of claim 12.

14. A method for producing purified WA545 protein said method comprising the steps of:

(a) culturing a host cell transformed with a DNA sequence according to claim

1, comprising a nucleotide sequence encoding WA545 protein; and

(b) recovering and purifying said WA545 protein from the culture medium.

15. A method for producing purified WA545 protein said method comprising the steps of:

(a) culturing a host cell transformed with a DNA sequence according to claim

2, comprising a nucleotide sequence encoding WA545 protein; and

(b) recovering and purifying said WA545 protein from the culture medium.

16. A method for producing purified WA545 protein said method comprising the steps of:

(a) culturing a host cell transformed with a DNA sequence according to claim 7, comprising a nucleotide sequence encoding WA545 protein; and

(b) recovering and purifying said WA545 protein from the culture medium.

17. A purified WA545 polypeptide comprising an amino acid sequence consisting essentially of amino acids encoded by the DNA sequence of SEQ ID NO: 1, wherein said WA545 polypeptide exhibits WA545 activity.

18. A WA545 polypeptide of claim 17 wherein the amino acid sequence comprises a functional fragment of the amino acid sequence of SEQ ID NO:2, wherein said WA545 polypeptide exhibits WA545 activity.

58

19. A purified WA545 polypeptide of claim 17 wherein said polypeptide is a dimer wherein each subunit comprises an amino acid sequence consisting essentially of the amino acid sequence from amino acid #1 to #114 of SEQ ID NO:2.

20. A purified WA545 polypeptide of claim 17, wherein said polypeptide is a dimer wherein one subunit comprises an amino acid sequence from amino acid #1 to #114 of SEQ ID NO:2, and one subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group consisting BMP-2, BMP-3, BMP-4, BMP-5, BMP-6, BMP-7, BMP-8, BMP-9. BMP- 10, BMP-11, BMP-12, BMP-13, BMP- 15 and BMP- 16.

21. A purified WA545 protein produced by the steps of

(a) culturing a cell transformed with a DNA comprising the nucleotide sequence from nucleotide #775 to nucleotide #1116 as shown in SEQ ID NO: 1 ; and

(b) recovering and purifying from said culture medium a protein comprising the amino acid sequence from amino acid #1 to #114 as shown in SEQ ID NO:2.

22. A composition comprising a therapeutic amount of at least one WA545 protein according to claim 17.

23. A composition of claim 22 further comprising a matrix for supporting said composition and providing a surface for induction of tissue growth.

24. The composition of claim 23 wherein said matrix comprises a material selected from the group consisting of hydroxyapatite, hyaluronic acid, collagen, polylactic acid and tricalcium phosphate.

25. A method for inducing tissue formation in a patient in need of same comprising administering to said patient an effective amount of the composition of claim 22.

26. A chimeric DNA molecule comprising a DNA sequence encoding a propeptide from a member of the TGF-╬▓ superfamily of proteins linked in correct reading frame to a DNA sequence encoding a WA545 polypeptide.

27. A purified WA545 protein comprising the amino acid sequence from amino acid #1 to #114 of SEQ ID NO:2.

59

28. A purified WA545 protein having a molecular weight of about 10-15 kd in monomeric form, said protein comprising the amino acid sequence of SEQ ID NO:2 and having the ability to induce the formation of mesodermal tissue.

29. Antibodies to a purified WA545 protein according to claim 17.

60