EP0983091A1 - Obesity protein formulations - Google Patents

Abstract

The present invention is a storage-stable, soluble formulation comprising an obesity protein analog and a preservative, said formulation having a pH higher than pH 8.0. Said storage-stable, soluble formulation is useful as a multi-use pharmaceutical product for treating obesity.

Description

OBESITY PROTEIN FORMULATIONS

Background of the Invention

1. Field of the Invention. The present invention is in the field of human medicine, particularly in the treatment of obesity and disorders associated with obesity. More specifically, the present invention relates to formulations of an obesity protein analog.

2. Background Information. Obesity, and especially upper body obesity, is a common and very serious public health problem in the United States and throughout the world, and is expected to worsen as the population ages. Currently, about 33 percent of Americans are overweight enough to be unhealthy, which is defined as weighing more than 26% greater than standard weight guidelines. For comparison, about 25% of Americans were overweight enough to be unhealthy in 1980, according to the United States National Center for Health Statistics. The proportion of obese adults among the well-fed populations of the world is expected to rise to more than 50% within 20 years.

Numerous studies indicate that lowering body weight dramatically reduces risk for chronic diseases, such as, diabetes, hypertension, hyperlipidemia, coronary heart disease, cancer, and muscularoskeletal diseases. Recent estimates for the medical cost of obesity are

$150,000,000,000 ($US) world- ide. The problem has become serious enough that the United States Surgeon General has begun an initiative to combat the ever- increasing adiposity rampant in American society. Obese patients may lose weight through deliberate modification of behavior, such as changing diet and increasing exercise. Unfortunately, an estimated 33 billion dollars ($US) are spent each year on such weight-loss measures that are largely futile, with failure rates reaching 95%. Failure may be due to genetic factors that cause increased appetite, a preference for high-fat foods, or a tendency for lipogenic metabolism. People inheriting such genetic traits are prone to becoming obese regardless of their efforts to combat the condition. Therefore, a pharmacological agent that can correct this adiposity handicap and allow the physician to successfully treat obese patients in spite of their genetic inheritance is needed. The ob I Ob mouse is a model of obesity and diabetes that is known to carry an autosomal recessive trait linked to a mutation in the sixth chromosome. Recently, Zhang and co-workers published the positional cloning of the mouse gene linked with this condition [Zhang, Y., et al . Nature 372:425-32 (1994)]. This report disclosed the murine and human protein expressed in adipose tissue. Likewise,

Murakami, T., et al., reported the cloning and expression of the rat obese gene [Biochemical and Biophysical Research Communications 209 (3) : 944-52 (1995)]. The protein, which is encoded by the oJ gene, has demonstrated an ability to effectively regulate adiposity in mice [Pelleymounter, et al . , Science 269:540-543 (1995)].

It is well-known that parenteral formulations containing insoluble protein cause problems relating to inconsistency in the dose-response, as well as unpredictability. The unpredictability is believed to be due to greater variability in the pharmacokinetics in suspension formulations. Insoluble formulations must first dissolve prior to adsorption. It is hypothesized that this step has significant variability in a subcutaneous depot. Aggregation makes the preparation of a soluble, pharmaceutically-acceptable parenteral formulation exceedingly difficult.

Unfortunately, native obesity proteins, that is, those having sequences naturally-occurring in mammals, tend to aggregate under conditions typically preferred for protein formulations. Certain analogs of native obesity proteins demonstrate activity, a reduced tendency to aggregate, and a significant improvement in physical stability in solution compared with native obesity proteins. Such analogs are disclosed in Basinski, M. B., et al . , European Patent Publication No. 725,078 (7 August 1996) and DiMarchi, R. D., et al . , European Patent Publication No. 725,079 (7 August 1996).

Despite increased physical stability when subjected to typical formulation conditions compared with native obesity proteins, analogs of native obesity proteins retain some tendency to aggregate in solution, a tendency that is aggravated by certain commonly-used, pharmaceutically-acceptable preservatives, such as, phenol, cresol, and alkylparabens . Because it is envisioned that a pharmaceutical product of obesity protein analog for treating obesity will be a multi-use product, preservatives will be required to inhibit microbial growth. Therefore, a solution to the aggregation problem is urgently needed in order to produce a multi-use obesity protein formulation that remains free of protein aggregation. The molecular interactions in a formulation between obesity protein analog, preservative, buffer, ionic strength, pH, temperature, and excipients, such as surfactants or sugars, are complex, and the role that each factor contributes to aggregation is highly unpredictable in view of the propensity for certain obesity protein analogs to aggregate and precipitate from the formulation.

As a general proposition, a slightly acidic pH is preferred for solution formulations of proteins. Among the various reasons for this preference is the concern about increasing oxidation, disulfide scrambling, and deamidation of the protein as pH increases above neutrality. For these reasons, a suggestion to formulate a protein at slightly alkaline pH, such as pH greater than 8.0, is commonly met with skepticism or concern about the chemical stability of the protein.

In view of this reluctance to formulate proteins above pH 8.0, and the unpredictability of protein formulation in general, it was most unexpected to discover that, under certain conditions, as disclosed herein, the aggregation of obesity protein analogs caused by preservatives is reduced when the pH of the formulation is greater than pH 8.0. The discovery that the physical stability of obesity protein analogs in the presence of preservatives is greatly enhanced above pH 8 is all the more unexpected in view of the calculated titration curve for certain obesity protein analogs. The calculated titration curve for two obesity protein analogs is given below in Table 1 as the net charge as a function of pH.

Table 1. Net charge on two obesity protein analogs, predicted by the Henderson-Hasselbach equation, as a function of pH.

The data in Table 1 predict relatively little change in the net charge of these obesity protein analogs in the pH range of 8.0 to 9.0 compared with lower and higher pH levels . In particular, the predicted net charge does not change abruptly at about pH 8.0, whereas, the physical stability of formulations of obesity protein analogs does change abruptly above about pH 8.0. Such a lack of correspondence between the net charge and aggregation of the obesity protein molecules in the presence of phenolic preservatives is most unexpected. The mechanism of such a striking increase in physical stability above pH 8.0 is unknown, but is not believed to be due to subtle changes in the conformation of the protein caused by the change in pH, such as occurs in serum albumin at acidic pH.

Thus, the present invention provides conditions that increase the physical stability of obesity protein analogs in the presence of preservatives, and makes possible a commercially-viable, multi-use pharmaceutical product comprising obesity protein analog to treat obesity. At pH higher than pH 8.0, the obesity protein analog remains soluble at much higher protein concentrations when formulated with certain preservatives, and there are less constraints on the other variables of the formulation, such as, ionic strength, temperature, etc., than at pH lower than pH 8.0.

Summary of the Invention This invention provides a soluble formulation comprising an obesity protein analog and a preservative, said formulation having pH greater than 8.0.

The invention further provides a process for preparing a soluble formulation, which comprises mixing an obesity protein analog and a preservative to produce a soluble formulation comprising said obesity protein analog and said preservative, said soluble formulation having pH greater than 8.0.

Additionally, the invention provides a method of treating obesity in a mammal in need thereof, which comprises administering to said mammal a soluble formulation comprising an obesity protein analog, said soluble formulation having a pH higher than pH 8.0. Detailed Description and Preferred Embodiments

For purposes of the present invention, as disclosed and herein, the following terms and abbreviations are defined as follows: Administration -- may be via any route known to be effective by the physician of ordinary skill. Parenteral administration is commonly understood in the medical literature as the injection of a dosage form into the body by a sterile syringe or some other mechanical device such as an infusion pump. For the purpose of this invention, peripheral parenteral routes of administration include, without limitation, intravenous, intramuscular, subcutaneous, and intraperitoneal routes of administration. Other routes known to the physician include occular, nasal, buccal, and pulmonary routes of administration.

Alkylparaben -- refers to a Ci to C alkyl paraben. Preferably, alkylparaben is methylparaben, ethylparaben, propylparaben, or butylparaben.

Base pair (bp) -- refers to DNA or RNA. The abbreviations A,C,G, and T correspond to the 5'- monophosphate forms of the nucleotides (deoxy) adenine, (deoxy) cytidine, (deoxy) guanine, and (deoxy) thymine, respectively, when they occur in DNA molecules. The abbreviations U,C,G, and T correspond to the 5'- monophosphate forms of the nucleosides uracil, cytidine, guanine, and thymine, respectively when they occur in RNA molecules. In double stranded DNA, base pair may refer to a partnership of A with T or C with G. In a DNA/RNA heteroduplex, base pair may refer to a partnership of T with U or C with G.

Cresol - refers to meta-cresol, ortho-cresol, para-cresol, chloro-cresol, or mixtures thereof.

Isotonicity agent -- isotonicity agent refers to an agent that is tolerated physiologically and imparts a suitable tonicity to the formulation to prevent the net flow of water across the cell membrane. Compounds, such as glycerin, are commonly used for such purposes at known concentrations. Other possible isotonicity agents include salts, e.g., NaCl, dextrose, mannitol, and lactose.

Obesity protein analog -- refers to a protein having a biological activity similar to that of human obesity protein, and also having an amino acid sequence essentially the same as that of the human obesity protein, except for having one or more modifications in the amino acid sequence. Modifications in the amino acid sequence may consist of additions of amino acids, deletions of amino acids, and replacement of an amino acid or amino acids with one or more amino acids . Obesity protein analog includes proteins having a leader sequence at the N-terminus the sequence. A leader sequence is one or more amino acids on the N-terminus to aid in production or purification of the protein. A preferred leader sequence is Met-Rl- wherein Rl is absent or any amino acid except Pro.

Pharmaceutically acceptable buffer -- The pH of the formulation may be buffered with a pharmaceutically acceptable buffer, such as TRIS or a basic amino acid, such as, lysine or arginine . Other pharmaceutically acceptable buffers for buffering at pH above 8.0 are known in the art. The selection and concentration of buffer is known in the art . pH -- has its usual and well-known meaning. Plasmid -- an extrachromosomal self-replicating genetic element .

Preservative -- a compound added to a pharmaceutical formulation to act as an anti-microbial agent. A parenteral formulation must meet guidelines for preservative effectiveness to be a commercially viable multi-use product. Among preservatives known in the art as being effective and acceptable in parenteral formulations are benzalkonium chloride, benzethonium, chlorohexidine, phenol, m-cresol, benzyl alcohol, methylparaben, chlorobutanol, o-cresol, p-cresol, chlorocresol, phenylmercurie nitrate, thimerosal and various mixtures thereof . Reading frame -- the nucleotide sequence from which translation occurs is "read" in triplets by the translational apparatus of tRNA, ribosomes and associated factors, each triplet corresponding to a particular amino acid. Because each triplet is distinct and of the same length, the coding sequence must be a multiple of three. A base pair insertion or deletion (termed a frameshift mutation) may result in two different proteins being coded for by the same DNA segment. To insure against this, the triplet codons corresponding to the desired poiypeptide must be aligned in multiples of three from the initiation codon, i.e., the correct "reading frame" must be maintained. In the creation of fusion proteins containing a chelating peptide, the reading frame of the DNA sequence encoding the structural protein must be maintained in the DNA sequence encoding the chelating peptide.

Recombinant DNA Cloning Vector -- any autonomously replicating agent including, but not limited to, plasmids and phages, comprising a DNA molecule to which one or more additional DNA segments can or have been added.

Recombinant DNA Expression Vector -- any recombinant DNA cloning vector in which a promoter has been incorporated.

Replicon -- A DNA sequence that controls and allows for autonomous replication of a plasmid or other vector .

Soluble -- refers to the relative absence of aggregated protein that is visually perceivable. The degree of aggregation of formulations of proteins may be inferred by measuring the turbidity of the formulation. The greater the turbidity of the formulation, the greater the extent of aggregation of the protein in the formulation. Turbidity is commonly determined by nephelometry, and measured in Nephalometric Turbidity Units (NTU) . Transcription -- the process whereby information contained in a nucleotide sequence of DNA is transferred to a complementary RNA sequence . Translation -- the process whereby the genetic information of messenger RNA is used to specify and direct the synthesis of a poiypeptide chain.

Treating -- as used herein, describes the management and care of a patient for the purpose of combating the disease, condition, or disorder and includes the administration of a formulation of the present invention to prevent the onset of the symptoms or complications, alleviating the symptoms or complications, or eliminating the disease, condition, or disorder. Treating as used herein includes the administration of the protein for cosmetic purposes. A cosmetic purpose seeks to control the weight of a mammal to improve bodily appearance.

Vector -- a replicon used for the transformation of cells in gene manipulation bearing polynucleotide sequences corresponding to appropriate protein molecules which, when combined with appropriate control sequences, confer specific properties on the host cell to be transformed. Plasmids, viruses, and bacteriophage are suitable vectors, since they are replicons in their own right. Artificial vectors are constructed by cutting and joining DNA molecules from different sources using restriction enzymes and ligases. Vectors include recombinant DNA cloning vectors and recombinant DNA expression vectors.

The nucleotide and amino acid abbreviations are accepted by the United States Patent and Trademark Office as set forth in 37 C.F.R. § 1.822 (b)(2) (1993). Unless otherwise indicated the amino acids are in the L configuration.

The unexpected effect of pH greater than 8.0 on formulation stability was demonstrated by preparing formulations with varying pH and various preservatives, and comparing their turbidity as measured by nephelometry . The formulations used to generate the data of Table 2 were prepared according to Example 1. For the most part, the concentration of obesity protein in this comparative study was 10 mg/mL. However, two sets of samples contained only 2 mg/mL of obesity protein, and these are clearly indicated in Table 2 (0.1% chlorocresol , and 0.5% phenol). The skilled pharmaceutical chemist will recognize that the turbidity expected at 10 mg/mL would be significantly higher than that measured at 2 mg/mL. Thus, it is expected that, in the presence of 0.5% phenol, samples having a protein concentration of 10 mg/mL would have significantly higher turbidity at pH 7.8 than at pH 8.5. Table 2 Effect of pH on the turbidity of a formulation comprising the protein of SEQ ID NO: 6 in the presence of various preservatives at 25°C. Besides the preservative noted, each formulation contained 10 mg/ml protein (except as noted) and either 5 mM phosphate buffer (pH 7.8) or 5 mM arginine buffer (pH 8.5) . Turbidity of the formulations was measured by nephelometry using a Hach Ratio Turbidimeter (Model 18900, or 2100N for values above 200) calibrated with Hach Formazin Turbidity Standard, 4000 NTU (Hach 2461-11, or equivalent) . Values are Nephelometric Turbidity Units (NTU) which are sample reading minus diluent blank reading .

*

Day 5 reading instead of Day 3 ** 2 mg/mL protein concentration

Formulations of the obesity protein analog of SEQ ID NO: 6 (10 mg/mL) containing m-cresol (0.3%) and TRIS buffer (5 mM) having pH ranging from 7.8 to 9.0 were prepared according to Example 2 herein. Three samples of each formulation were incubated for 14 days at each of three temperatures, 5, 25, and 37°C. Turbidity of the formulations was measured by nephelometry using a Hach Ratio Turbidimeter (Model 18900) calibrated with Hach Formazin Turbidity Standard, 4000 NTU (Hach 2461-11, or equivalent) . Results are presented in Table 3, below.

Table 3. Effect of pH and temperature on the turbidity of a formulation comprising the protein of SEQ ID NO: 6 in the presence of 0.3% m-cresol. Values are the average of the Nephelometric Turbidity Units (NTU) (sample reading minus diluent blank reading) for three samples stored under the conditions indicated.

The unexpected effect of pH greater than 8.0 on formulation stability in the presence of preservatives that cause instability was demonstrated for another obesity protein analog. The formulations used to generate the data of Table 4 were prepared according to Example 3.

Table 4. Effect of pH on the turbidity of a formulation comprising the protein of SEQ ID NO: 2 in the presence of various preservatives at 37°C. Besides the preservative noted, each formulation contained 15 mg/ml protein and either 10 mM phosphate buffer (pH 7.8) or 5 mM arginine buffer (pH 8.5). Turbidity of the formulations was measured by nephelometry using a Hach Ratio Turbidimeter (Model 18900, or 2100N for values above 200) calibrated with Hach Formazin Turbidity Standard, 4000 NTU (Hach 2461-11, or equivalent) . Values are Nephelometric Turbidity Units (NTU) which are sample reading minus diluent blank reading.

Parenteral formulations of the present invention can be prepared using conventional dissolution and mixing procedures. To prepare a suitable formulation, for example, a measured amount of obesity protein analog in water is combined with the desired preservative in water in quantities sufficient to provide the protein and preservative at the desired concentration. The pH of the formulation may be adjusted to greater than 8.0 either before or after combining the obesity protein analog and the preservative. The formulation is generally sterile filtered prior to administration. Variations of this process would be recognized by one of ordinary skill in the art. For example, the order the components are added, the order in which pH is adjusted, the surfactant used, if any, the temperature and ionic strength at which the formulation is prepared, may be optimized for the concentration and means of administration used.

The most effective preservatives, phenol and cresol, or mixtures thereof, cause protein aggregation when formulated with obesity protein analog. The concentration of preservative is that required to maintain preservative effectiveness. The relative amounts of preservative necessary to maintain preservative effectiveness varies with the preservative used. Generally, the amount of preservative necessary is known in the art [ allhauser, K. , Develop . Biol . Standard. 24:9-28 (S . Krager, Basel, 1974)]. The optimal concentration of the preservative depends on the preservative, its solubility, and the pH of the formulation. Other additives, such as a pharmaceutically acceptable solubilizers like Tween 20 (polyoxyethylene (20) sorbitan monolaurate) , Tween 40 (polyoxyethylene (20) sorbitan monopalmitate) , Tween 80 (polyoxyethylene (20) sorbitan monooleate) , Pluronic F68 (polyoxyethylene polyoxypropylene block copolymers) , and PEG (polyethylene glycol) may optionally be added to the formulation to reduce aggregation. These additives are particularly useful if a pump or plastic container is used to administer the formulation. A pharmaceutically acceptable surfactant may reduce protein aggregation. As noted above, the invention provides a soluble formulation comprising an obesity protein analog, said soluble formulation having a pH greater than pH 8.0. Preferably the pH is between about 8.0 and about 8.6, and more preferably between about 8.3 and about 8.6. Other preferred pH ranges for the formulations of the present invention are between about pH 8.2 and about pH 9.0, between about pH 8.2 and about pH 8.8, between about pH 8.2 and about pH 8.6, between about pH 8.3 and about pH 9.0, between about pH 8.3 and about pH 8.8, between about pH 8.4 and about pH 9.0, between about pH 8.4 and about pH 8.8, between about pH 8.4 and about pH 8.6, between about pH 8.5 and about pH 9.0, between about pH 8.5 and about pH 8.8, and between about pH 8.6 and about pH 9.0. At pH above 8.0, obesity protein analogs remain in solution in the presence of certain preservatives, making possible a multi-use parenteral formulation containing those preservatives that is relatively free of protein aggregation.

Preferably, the solubility of the obesity protein analogs in the present formulations is such that the turbidity of the formulation is lower than 50 NTU. More preferably, the turbidity is lower than 20 NTU. Most preferably, the turbidity is lower than 10 NTU.

Peripheral, parenteral administration is preferred. The formulations prepared in accordance with the present invention may be administered using a syringe, injector, pump, or any other device recognized in the art for parenteral administration. The amount of a formulation of the present invention that would be administered to treat obesity will depend on a number of factors, among which are included, without limitation, the patient's sex, weight and age, the underlying causes of obesity, the route of administration and bioavailability, the persistence of administered obesity protein analog in the body, the formulation, and the potency of the obesity protein analog. Where administration is intermittent, the amount per administration should also take into account the interval between doses, and the bioavailability of the obesity protein analog from the formulation. Administration of the formulation of the present invention could be continuous. It is within the skill of the ordinary physician to titrate the dose and rate or frequency of administration of the formulation of the present invention to achieve the desired clinical result. Administration of the formulations by occular, nasal, buccal, or pulmonary routes is also preferred. _Administration by the pulmonary route is particularly preferred. Glycerin is the preferred isotonicity agent. The concentration of the isotonicity agent is in the range known in the art for parenteral formulations, and for glycerin, is preferably about 16 mg/mL to about 25 mg/mL.

Preferred obesity protein analogs employed in the formulations of the present invention are those of the Formula (I) :

5 10 15

Val Pro lie Gin Lys Val Gin Asp Asp Thr Lys Thr Leu lie Lys Thr 20 25 30 lie Val Thr Arg lie Asn Asp lie Ser His Thr Xaa Ser Val Ser Ser

35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe lie Pro Gly Leu His Pro lie

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin lie

65 70 75 80 Leu Thr Ser Met Pro Ser Arg Asn Val lie Gin lie Ser Asn Asp Leu

85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys 100 105 110

His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Trp .Gin Leu Asp Leu Ser Pro

145 Gly Cys (SEQ ID NO:l) (I) wherein:

Xaa at position 28 is Gin or absent; and said protein having at least one of the following substitutions : Gin at position 4 is replaced with Glu;

Gin at position 7 is replaced with Glu;

Asn at position 22 is replaced with Gin or Asp;

Thr at position 27 is replaced with Ala;

Xaa at position 28 is replaced with Glu; Gin at position 34 is replaced with Glu; Met at position 54 is replaced with methionine sulfoxide, Leu, lie, Val, Ala, or Gly;

Gin at position 56 is replaced with Glu; Gin at position 62 is replaced with Glu;

Gin at position 63 is replaced with Glu; Met at position 68 is replaced with methionine sulfoxide, Leu, lie, Val, Ala, or Gly;

Asn at position 72 is replaced with Gin, Glu, or Asp;

Gin at position 75 is replaced with Glu; Ser at position 77 is replaced with Ala; Asn at position 78 is replaced with Gin or Asp; Asn at position 82 is replaced with Gin or Asp; His at position 97 is replaced with Gin, Asn, Ala,

Gly, Ser, or Pro;

Trp at position 100 is replaced with Ala, Glu, Asp, Asn, Met, lie, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu; Ala at position 101 is replaced with Ser, Asn,

Gly, His, Pro, Thr, or Val;

Ser at position 102 is replaced with Arg; Gly at position 103 is replaced with Ala; Glu at position 105 is replaced with Gin; Thr at position 106 is replaced with Lys or Ser;

Leu at position 107 is replaced with Pro; Asp at position 108 is replaced with Glu; Gly at position 111 is replaced with Asp; Gly at position 118 is replaced with Leu; Gin at position 130 is replaced with Glu;

Gin at position 134 is replaced with Glu; Met at position 136 is replaced with methionine sulfoxide, Leu, lie, Val, Ala, or Gly;

Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, lie, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu; or Gin at position 139 is replaced with Glu; or a pharmaceutically acceptable salt thereof .

A further group of preferred embodiments are formulations of proteins of Formula I, wherein: Gin at position 4 is replaced with Glu;

Gin at position 7 is replaced with Glu;

Asn at position 22 is replaced with Gin or Asp;

Thr at position 27 is replaced with Ala;

Gin at position 28 is replaced with Glu; Gin at position 34 is replaced with Glu;

Met at position 54 is replaced with methionine sulfoxide, Leu, or Ala;

Gin at position 56 is replaced with Glu;

Gin at position 62 is replaced with Glu; Gin at position 63 is replaced with Glu;

Met at position 68 is replaced with methionine sulfoxide, or Leu;

Asn at position 72 is replaced with Gin or Asp;

Gin at position 75 is replaced with Glu; Asn at position 78 is replaced with Gin or Asp;

Asn at position 82 is replaced with Gin or Asp;

Trp at position 100 is replaced with Ala or Asp;

Gin at position 130 is replaced with Glu;

Gin at position 134 is replaced with Glu; Met at position 136 is replaced with methionine sulfoxide, Leu, lie; or

Gin at position 139 is replaced with Glu.

Other preferred obesity protein analogs employed in the formulations of the present invention are those of Formula I, wherein:

Asn at position 22 is replaced with Gin or Asp;

Thr at position 27 is replaced with Ala;

Met at position 54 is replaced with methionine sulfoxide, Leu, or Ala; Met at position 68 is replaced with methionine sulfoxide, or Leu;

Asn at position 72 is replaced with Gin or Asp; W wOυ 9 ^y8a/^/3^j1u39^y0u PCT/US98/00816

- 18 -

Asn at position 78 is replaced with Gin or Asp;

Asn at position 82 is replaced with Gin or Asp; or

Met at position 136 is replaced with methionine sulfoxide, Leu, or lie. Additional preferred proteins employed in the formulations of the present invention are those of Formula I, wherein:

Asn at position 22 is replaced with Gin or Asp;

Thr at position 27 is replaced with Ala; Met at position 54 is replaced with Leu, or Ala;

Met at position 68 is replaced with Leu;

Asn at position 72 is replaced with Gin or Asp;

Asn at position 78 is replaced with Gin or Asp;

Asn at position 82 is replaced with Gin or Asp; or Met at position 136 is replaced with Leu, or lie.

Preferred species employed in the formulations of the present invention are those of SEQ ID NO: 2 and SEQ ID NO: 3:

5 10 15 Val Pro lie Gin Lys Val Gin Asp Asp Thr Lys Thr Leu lie Lys Thr

20 25 30 lie Val Thr Arg He Asn Asp He Ser His Thr Xaa Ser Val Ser Ser 35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asp Val He Gin He Ser Asn Asp Leu

85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Asp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO: 2)

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr 20 25 30

He Val Thr Arg He Asn Asp He Ser His Ala Gin Ser Val Ser Ser

35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO : 3 )

Other preferred proteins of the present formulations have specific substitutions to amino acid residues 97 to 111, and/or 138 of the proteins of SEQ ID NO:l. Accordingly, preferred embodiments are formulations comprising obesity protein analogs of the Formula I, wherein:

Xaa at position 28 is Gin or absent; and said protein having at least one substitution selected from the group consisting of :

His at position 97 is replaced with Gin, Asn, Ala, Gly, Ser, or Pro;

Trp at position 100 is replaced with Ala, Glu, Asp, Asn, Met, lie, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu;

Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr, or Val;

Ser at position 102 is replaced with Arg; Gly at position 103 is replaced with Ala;

Glu at position 105 is replaced with Gin;

Thr at position 106 is replaced with Lys or Ser;

Leu at position 107 is replaced with Pro; Asp at position 108 is replaced with Glu;

Gly at position 111 is replaced with Asp; or

Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu; or a pharmaceutically acceptable salt thereof .

Other preferred embodiments are formulations comprising obesity protein analogs of the Formula I, wherein Xaa at position 28 is Gin, and said protein has at least one substitution selected from the group consisting of:

His at position 97 is replaced with Gin, Asn, Ala, Gly, Ser, or Pro;

Trp at position 100 is replaced with Ala, Glu, Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu;

Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr, or Val;

Ser at position 102 is replaced with Arg;

Gly at position 103 is replaced with Ala; Glu at position 105 is replaced with Gin;

Thr at position 106 is replaced with Lys or Ser;

Leu at position 107 is replaced with Pro;

Asp at position 108 is replaced with Glu;

Gly at position 111 is replaced with Asp; or Trp at position 138 is replaced with Ala, Glu,

Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu; or a pharmaceutically acceptable salt thereof .

More preferred embodiments are formulations comprising obesity protein analogs of the Formula I, wherein:

Xaa at position 28 is Gin, and

His at position 97 is replaced with Gin, Asn, Ala, Gly, Ser or Pro; Trp at position 100 is replaced with Ala, Glu,

Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin or Leu; Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr or Val;

Glu at position 105 is replaced with Gin;

Thr at position 106 is replaced with Lys or Ser; Leu at position 107 is replaced with Pro;

Asp at position 108 is replaced with Glu;

Gly at position 111 is replaced with Asp; or

Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu.

Other preferred embodiments are formulations comprising obesity protein analogs of the Formula I, wherein:

Xaa at position 28 is Gin; and His at position 97 is replaced with Ser or Pro;

Trp at position 100 is replaced with Ala, Gly, Gin, Val, He, or Leu;

Ala at position 101 is replaced with Thr; or

Trp at position 138 is replaced with Ala, He, Gly, Gin, Val or Leu.

Additional preferred embodiments are formulations comprising obesity protein analogs of the Formula I, wherein:

Xaa at position 28 is Gin; and His at position 97 is replaced with Ser or Pro;

Trp at position 100 is replaced with Ala, Gin or Leu;

Ala at position 101 is replaced with Thr; or

Trp at position 138 is replaced with Gin. Another group of preferred proteins for the formulations of the present invention is described by Formula II:

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Xaa Asp He Ser His Thr Xaa Ser Val Ser Ser 35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60 Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Xaa Xaa He Gin He Ser Asn Asp Leu 85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140 Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO : 4 ) (II) wherein : Xaa at position 22 is Asn or Ser;

Xaa at position 28 is Gin or absent ;

Xaa at position 72 in Asn, Gin, Glu, or Asp;

Xaa at position 73 is Val or Met ; said protein having at least one of the following substitutions:

Trp at position 100 is replaced with Glu, Asp, His, Lys, or Arg;

Trp at position 138 is replaced with Glu, Asp, His, Lys, or Arg; or a pharmaceutically acceptable salt thereof.

Further preferred proteins for the formulations of the present invention include those of Formula II, wherein: Xaa at position 22 is Asn; Xaa at position 28 is Gin; Xaa at position 72 in Asn or Asp; and

Xaa at position 73 is Val.

Other preferred proteins are those of Formula II, wherein Trp at position 100 is replaced with Glu or Asp; or Trp at position 138 is replaced with Glu or Asp. Particularly preferred are proteins of Formula II wherein Xaa at position 72 is Asp. Additional preferred proteins are those of Formula II wherein Trp at position 100 is replaced with His, Lys, or Arg. Other preferred proteins of the Formula II for the present formulations are those wherein Trp at position 100 is replaced with Lys or Arg; or Trp at position 138 is replaced with Lys or Arg.

Another group of preferred embodiments consists of formulations comprising an obesity protein analog of the Formula (III) :

5 10 15 Xaa Xaa He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Xaa Asp He Ser His Thr Xaa Ser Val Ser Ser 35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Xaa Xaa He Gin He Ser Asn Asp Leu

85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Xaa Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Xaa Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO : 5 ) ( III) wherein :

Xaa at position 1 is Val or absent ; Xaa at position 2 is Pro or absent ;

Xaa at position 22 is Asn or Ser ;

Xaa at position 28 is Gin or absent ;

Xaa at position 72 is Asn, Gin, Glu or Asp ;

Xaa at position 73 is Val or Met ; Xaa at position 100 is Trp , Gin , Glu , Asp , Ser ,

Thr , Lys , His , or Arg ;

Xaa at position 138 is Trp , Gin , Glu , Asp , Ser , Thr , Lys , His , or Arg ; said protein having at least one of the following substitutions :

Xaa at position 1 is replaced with Glu, Asp, Ser, Thr, Lys, His, or Arg; Xaa at position 2 is replaced with Glu, Asp, Ser,

Thr, Lys, His, or Arg;

He at position 3 is replaced with Glu, Asp, Arg, Lys, or His;

Val at position 30 is replaced with Glu, Asp, Arg, Lys, or His;

Val at position 36 is replaced with Glu, Asp, Arg, Lys, or His;

Phe at position 41 is replaced with Glu, Asp, Arg, Lys, or His; He at position 42 is replaced with Glu, Asp, Arg,

Lys, or His;

Pro at position 43 is replaced with Glu, Asp, Arg, Lys, or His;

Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;

His at position 46 is replaced with Glu, Asp, Arg, or Lys;

Pro at position 47 is replaced with Glu, Asp, Arg, Lys, or His; He at position 48 is replaced with Glu, Asp, Arg,

Lys, or His;

Leu at position 49 is replaced with Glu, Asp, Arg, Lys, or His;

Thr at position 50 is replaced with Glu, Asp, Arg, Lys, or His;

He at position 74 is replaced with Gin, Glu, Asp, Arg, Lys, His, Thr or Ser;

Val at position 89 is replaced with Gin, Glu, Asp, Arg, Lys, His, Thr or Ser; Phe at position 92 is replaced with Gin, Glu, Asp,

Arg, Lys, His, Thr or Ser; Pro at position 99 is replaced with Gin, Glu, Asp, Arg, Lys, His, Thr or Ser; or

Leu at position 142 is replaced with Glu, Asp, Arg, Lys, or His; or a pharmaceutically acceptable salt thereof .

Preferred embodiments of the formulations of the present invention comprise an obesity protein of SEQ ID NO: 5, wherein:

Phe at position 92 is replaced with Asp, Glu, Lys, Arg, or His, or pharmaceutically acceptable salts thereof.

Preferred embodiments of the formulations of the present invention comprise an obesity protein of SEQ ID NO: 5, wherein:

Phe at position 92 is replaced with Asp or Glu, or pharmaceutically acceptable salts thereof.

Other preferred embodiments of the formulations of the present invention comprise an obesity protein of SEQ ID NO: 5, wherein:

Xaa at position 1 is Val or absent; Xaa at position 2 is Pro or absent;

Xaa at position 22 is Asn;

Xaa at position 28 is Gin or absent;

Xaa at position 72 is Asn;

Xaa at position 73 is Val; Xaa at position 100 is Trp, Glu, Asp, Ser, Thr,

Lys, His, or Arg;

Xaa at position 138 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg; said protein having at least one of the following substitutions:

Leu at position 45 is replaced with Glu, Asp, Arg, Lys, or His;

His at position 46 is replaced with Glu, Asp, Arg, or Lys; Pro at position 47 is replaced with Glu, Asp, Arg,

Lys, or His; He at position 48 is replaced with Glu, Asp, Arg, Lys, or His; or

Leu at position 142 is replaced with Glu, Asp, Arg, Lys, or His; or pharmaceutically acceptable salts thereof .

Other preferred proteins for use in the present invention are those of SEQ ID NO: 5, wherein:

Xaa at position 1 is Val;

Xaa at position 2 is Pro; Xaa at position 28 is Gin or absent;

Xaa at position 72 is Asn;

Xaa at position 100 is Trp, Glu, or Asp;

Xaa at position 138 is Trp, Glu or Asp; said protein having at least one of the following substitutions:

His at position 46 is replaced with Glu, Asp, Arg, or Lys;

He at position 48 is replaced with Glu, Asp, Arg, Lys, or His; or Phe at position 92 is replaced with Glu, Asp, Arg,

Lys, or His; or pharmaceutically acceptable salts thereof.

Other preferred proteins for use in the present invention are those of SEQ ID NO: 5, wherein: Xaa at position 1 is Val;

Xaa at position 2 is Pro;

Xaa at position 28 is Gin or absent;

Xaa at position 72 is Asn;

Xaa at position 100 is Trp, Glu, or Asp; Xaa at position 138 is Trp, Glu or Asp; said protein having at least one of the following substitutions :

His at position 46 is replaced with Glu, Asp, Arg, or Lys ; or He at position 48 is replaced with Glu, Asp, Arg,

Lys, or His; or pharmaceutically acceptable salts thereof . Still more preferred for use in the present formulations are proteins of SEQ ID NO: 5, wherein:

Xaa at position 1 is Val;

Xaa at position 2 is Pro; Xaa at position 28 is Gin or absent;

Xaa at position 72 is Asn;

Xaa at position 100 is Trp or Asp;

Xaa at position 138 is Trp; said protein having at least one of the following substitutions:

His at position 46 is replaced with Glu, Asp, Arg, or Lys;

He at position 48 is replaced with Asp, Arg, Lys, or His; or Phe at position 92 is replaced with Asp, Glu, Arg,

Lys, or His; or pharmaceutically acceptable salts thereof .

Still more preferred for use in the present formulations are proteins of SEQ ID NO: 5, wherein: Xaa at position 1 is Val;

Xaa at position 2 is Pro;

Xaa at position 28 is Gin or absent;

Xaa at position 72 is Asn;

Xaa at position 100 is Trp or Asp; Xaa at position 138 is Trp; said protein having at least one of the following substitutions :

His at position 46 is replaced with Glu, Asp, Arg, or Lys ; or He at position 48 is replaced with Asp, Arg, Lys, or His; or pharmaceutically acceptable salts thereof .

Other preferred proteins for use in the present formulations are those of Formula III, wherein: Xaa at position 1 is Val or absent;

Xaa at position 2 is Pro or absent;

Xaa at position 28 is Gin or absent; Xaa at position 72 is Asn, Glu or Asp;

Xaa at position 100 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg;

Xaa at position 138 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg; said protein having at least one of the following substitutions :

Xaa at position 1 is replaced with Glu, Asp, Ser, Thr, Lys, His, Arg, or absent; Xaa at position 2 is replaced with Glu, Asp, Ser,

Thr, Lys, His, Arg, or absent;

Val at position 89 is replaced with Glu, Asp, Arg, Lys, or His; or

Phe at position 92 is replaced with Glu, Asp, Arg, Lys, or His; or a pharmaceutically acceptable salt thereof .

Other preferred proteins for use in the present formulations are those of Formula III wherein:

Xaa at position 1 is Val or absent; Xaa at position 2 is Pro or absent;

Xaa at position 28 is Gin or absent;

Xaa at position 72 is Asn, Glu or Asp;

Xaa at position 100 is Glu, Asp, Lys, His, or Arg;

Xaa at position 138 is Trp, Glu, Asp, Ser, Thr, Lys, His, or Arg; said protein having at least one of the following substitutions :

Phe at position 92 is replaced with Glu, Asp, Arg, Lys, or His; Pro at position 99 is replaced with Glu, Asp, Arg,

Lys, or His; or a pharmaceutically acceptable salt thereof.

The most preferred embodiments are formulations comprising obesity protein analogs having a di-sulfide bond between Cys at position 96 and Cys at position 146.

Examples of the most preferred embodiments include formulations comprising obesity protein analogs of SEQ ID _{NO: 2}, or one of the proteins described by SEQ ID NO: 6-13, said obesity protein analogs having intramolecular disulfide bonds between Cys at position 96 and Cys at position ₁₄6, or pharmaceutically acceptable salts thereof.

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser

35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60 Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu 85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140 Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO: 6)

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser

35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60 Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu 85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Gin Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140 Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro 145 Gly Cys ( SEQ ID NO : 7 )

5 10 15 Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser 35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Gin Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO: 8)

5 10 15 Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser 35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Gin Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Gin Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO: 9) 5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30 He Val Thr Arg He Asn Asp He Ser His Ala Gin Ser Val Ser Ser

35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He 50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110 His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO: 10)

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30 He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser

35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He 50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 . 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110 His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Gin Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO: 11)

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr 20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser

35 40 45 Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He 65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 HO

Ser Leu Pro Gin Thr Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Gin Gin Leu Asp Leu Ser Pro 145

Gly Cys (SEQ ID NO: 12)

5 10 15

Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Gin Ser Val Ser Ser

35 40 45 Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He 65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95

Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

Ser Leu Pro Gin Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly

115 120 125 Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Gin Gin Leu Asp Leu Ser Pro 145

Gly Cys (SEQ ID NO: 13)

The concentration of obesity protein analog in the formulation is preferably about from about 0.5 mg/mL to about 100 mg/mL. More preferably, the concentration of obesity protein analog in the formulation is from about 0.5 mg/mL to about 50 mg/mL. Still more preferably, the concentration of obesity protein analog in the formulation is from about 1 mg/mL to about 25 mg/mL. Most preferably, the concentration of obesity protein analog in the formulation is from about 1 mg/mL to about 15 mg/mL. Other preferred ranges of concentration of obesity protein analog in the formulation are from about 0.5 mg/mL to about 20 mg/mL, from 0.5 mg/mL to about 5 mg/mL, and from about 2 mg/mL to about 20 mg/mL. The obesity protein analogs used in the formulations of the present invention are preferably bio- synthesized in a host cell transformed with recombinant DNA. The basic steps biosynthesis of a heterologous protein using the methods of recombinant technology include : a) construction of a synthetic or semi-synthetic (or isolation from natural sources) DNA encoding the protein, b) integrating the coding sequence into an expression vector in a manner suitable for the expression of the protein either alone or as a fusion protein, c) transforming an appropriate eukaryotic or prokaryotic host cell with the expression vector , and d) recovering and purifying the biosynthesized protein. a. Gene Construction

Synthetic genes, the in vitro or in vivo transcription and translation of which will result in the production of the protein, may be constructed by techniques well-known in the art. Owing to the natural degeneracy of the genetic code, the skilled artisan will recognize that a sizable yet definite number of DNA sequences may be constructed which encode the proteins . Methodologies of synthetic gene construction are well-known in the art [Brown, E. L., et al . Methods in Enzymology, Academic Press, New York, NY, 68:109-151 (1₉7₉)]. The DNA sequence corresponding to the synthetic protein gene may be generated using conventional DNA synthesizing apparatus such as the Applied Biosystems Model 380A or 38OB DNA synthesizers (Perkin Elmer, Applied Biosystems Division, Foster City, California) .

It may desirable in some applications to modify the coding sequence of the protein so as to incorporate a convenient protease sensitive cleavage site, e . g. , between the signal peptide and the structural protein, thereby facilitating the controlled excision of the signal peptide from the fusion protein construct.

The gene encoding the protein may also be created by using polymerase chain reaction (PCR) . The template can be a cDNA library (commercially available from CLONETECH or STRATAGENE) or mRNA isolated from human adipose tissue.

Such methodologies are well-known in the art. See, e . g. , Maniatis, T., et al . Molecular Cloning: A Laboratory Manual , 2^nd Ed., Cold Spring Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989) . b. Direct Expression or Fusion Protein

An obesity protein analog may be made either by direct expression, or as fusion protein comprising the protein, in which case expression may be followed by enzymatic or chemical cleavage to form the obesity protein analog. A variety of peptidases (e.g. trypsin) which cleave a poiypeptide at specific sites or digest the peptides from the amino or carboxy termini (e.g. diaminopeptidase) of the peptide chain are known. Furthermore, particular chemicals

(e.g. cyanogen bromide) will cleave a poiypeptide chain at specific sites. The skilled artisan will appreciate the modifications necessary to the amino acid sequence (and synthetic or semi-synthetic coding sequence if recombinant means are employed) to incorporate site-specific internal cleavage sites. See, e . g. , Carter, P., Chapter 13 in Protein Purification : From Molecular Mechanisms to Large- scale Processes, Ladisch, M., et al . (Eds.) American Chemical Soc . , Washington, D.C. (1990). c . Vector Construction

Construction of suitable vectors containing the desired coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to form the plasmids required.

To effect the translation of the desired protein, one inserts the engineered synthetic DNA sequence in any of a plethora of appropriate recombinant DNA expression vectors through the use of appropriate restriction endonucleases. A synthetic coding sequence is designed to possess restriction endonuclease cleavage sites at either end of the transcript to facilitate isolation from and integration into these expression, amplification, and expression plasmids. The isolated cDNA coding sequence may be readily modified by the use of synthetic linkers to facilitate the incorporation of this sequence into the desired cloning vectors by techniques well-known in the art. The particular endonucleases employed will be dictated by the restriction endonuclease cleavage pattern of the parent expression vector to be employed. Restriction sites are chosen so as to properly orient the coding sequence with control sequences to achieve proper in-frame reading and expression of the protein.

In general, plasmid vectors containing promoters and control sequences which are derived from species compatible with the host cell are used with these hosts. The vector ordinarily carries a replication site as well as marker sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species [Bolivar, F., et al., Gene 2:95-113 (1977)] . Plasmid pBR322 contains genes for ampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA technology. The desired coding sequence is inserted into an expression vector in the proper orientation to be transcribed from a promoter and ribosome binding site, both of which should be functional in the host cell in which the protein is to be expressed. An example of such an expression vector is a plasmid described in Belagaje, R. M., et al . , U.S. patent No. 5,304,473, issued, April 19, 1994, the teachings of which are herein incorporated by reference. The gene encoding A-C-B proinsulin described in U.S. Patent No. 5,304,473 can be removed from the plasmid pRB182 with restriction enzymes Ndel and BamHI . The genes encoding the protein of the present invention can be inserted into the plasmid backbone on a Ndel/BamHI restriction fragment cassette . d. Prokaryotic Expression

In general, prokaryotes are used for cloning of DNA sequences in constructing the vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No. 31446) is particularly useful. Other microbial strains which may be used include E. coli B and E. coli X1776 (ATCC No. 31537) . These examples are illustrative rather than limiting.

Prokaryotes also are used for expression. The aforementioned strains, as well as E. coli W3110 (prototrophic, ATCC No. 27325) , bacilli such as Bacillus subtilis, and other enterobacteriaceae such as Salmonella typhimurium or Serratia marcescans, and various pseudomonas species may be used. Promoters suitable for use with prokaryotic hosts include the β-lactamase (vector pGX2907 [ATCC 39344] contains the replicon and β-lactamase gene) and lactose promoter systems [Chang, A. C. Y., et al . , Nature, 275:617-624 (1978); and Goeddel, D. V., et al . , Nature 281:544-548 (1979)], alkaline phosphatase, the tryptophan (trp) promoter system (vector pATHl [ATCC 37695] is designed to facilitate expression of an open reading frame as a trpE fusion protein under control of the trp promoter) and hybrid promoters such as the tac promoter (isolatable from plasmid pDR540 ATCC-37282) . However, other functional bacterial promoters, whose nucleotide sequences are generally known, enable one of skill in the art to ligate them to DNA encoding the protein using linkers or adaptors to supply any required restriction sites. Promoters for use in bacterial systems also will contain a Shine-Dalgarno sequence operably linked to the DNA encoding protein. e. Eukaryotic Expression The protein may be recombinantly produced in eukaryotic expression systems. Preferred promoters controlling transcription in mammalian host cells may be obtained from various sources, for example, the genomes of viruses, such as: polyoma, Simian Virus 40 (SV40) , adenovirus, retroviruses , hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. β-actin promoter. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication [Fiers, W., et al., Nature, 273:113- 120 (1978)] . The entire SV40 genome may be obtained from plasmid pBRSV, ATCC 45019. The immediate early promoter of the human cytomegalovirus may be obtained from plasmid pCMBβ (ATCC 77177) . Of course, promoters from the host cell or related species also are useful herein. Transcription of a DΝA encoding the protein by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DΝA, usually about 10-300 bp, that act on a promoter to increase its transcription. Enhancers are relatively orientation and position independent having been found 5' [Laimins, L. A., et al . , Proc. Nat ' l Acad. Sci . (USA) 78:464-468 (1981)] and 3' [Lusky, M. , et al . , Mol . Cell . Bio. 3:1108-1122 (1983)] to the transcription unit, within an intron [Banerji, J., et al . , Cell 33:729-740 (1983)] as well as within the coding sequence itself [Osborne, T. F., et al . , Mol . Cell . Bio. 4:1293-1305 (1984)]. Many enhancer sequences are now known from mammalian genes (globin, RSV, _SV₄0, EMC, elastase, albumin, α-fetoprotein, and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 late enhancer, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers .

Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding protein. The 3' untranslated regions also include transcription termination sites. Expression vectors may contain a selection gene, also termed a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR, which may be derived from the Bglll/Hindlll restriction fragment of pJOD-10 [ATCC 68815] ) , thymidine kinase (herpes simplex virus thymidine kinase is contained on the BamHI fragment of vP-5 clone (ATCC 2028) or neomycin (G418) resistance genes, which are obtainable from pNN414 yeast artificial chromosome vector (ATCC 37682) . When such selectable markers are successfully transferred into a mammalian host cell, the transfected mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes . The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow without a supplemented media. Two examples are: CHO DHFR" cells (ATCC CRL-9096) and mouse LTKX cells [L-M(TK-) ATCC CCL-2.3] . These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine . Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements . Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in nonsupplemented media.

The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell . Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, [Southern P J. , et al., J. Molec. Appl . Genet . 1:327-341* (1982)], mycophenolic acid [Mulligan, R. C. et al . , Science 209:1422-1427 (1980)], or hygro ycin [Sugden, B. et al . , Mol Cell . Biol . 5:410-413 (1985)]. The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug, such as, G418, neomycin (geneticin) , xgpt (mycophenolic acid) , or hygromycin, respectively.

A preferred vector for eukaryotic expression is pRc/CMV. pRc/CMV is commercially available from Invitrogen Corporation, San Diego, CA. To confirm correct sequences in constructed plasmids, the ligation mixtures are used to transform E. coli K12 strain DH5a (ATCC 31446) and successful transformants are selected by antibiotic resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction and/or sequenced by the method of Messing, J., et al . , Nucleic Acids J.es. 9:309-321 (1981).

Host cells may be transformed with the expression vectors of this invention and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. The techniques of transforming cells with the aforementioned vectors are well-known in the art and may be found in such general references as Maniatis, T., et al. Molecular Cloning: A Laboratory Manual , 2^nd Ed., Cold Spring Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989) , or Current Protocols in Molecular Biology (1989) and supplements.

Preferred suitable host cells for expressing the vectors encoding the proteins in higher eukaryotes include: African green monkey kidney cell line transformed by SV40

(COS-7, ATCC CRL-1651) ; transformed human primary embryonal kidney cell line 293 [Graham, F. L. et al . , J. Gen Virol . 36:59-72 (1977); Harrison, T., et al . , Virology 11 . - 319 -329 (1977); Graham, F. L. et al . , Virology 86:10-21 (1978)]; baby hamster kidney cells [BHK-21 (C-13) , ATCC CCL-10;

MacPherson, I., et al, Virology 16.-147-151 (1962)]; Chinese hamster ovary cells [CHO-DHFR^" (ATCC CRL-9096)]; mouse Sertoli cells [TM4, ATCC CRL-1715; Mather, J. P., Biol . Reprod . 23:243-252 (1980)]; African green monkey kidney cells (VERO 76, ATCC CRL-1587) ; human cervical epitheloid carcinoma cells (HeLa, ATCC CCL-2) ; canine kidney cells (MDCK, ATCC CCL-34) ; buffalo rat liver cells (BRL 3A, ATCC CRL-1442) ; human diploid lung cells (WI-38, ATCC CCL-75) ; human hepatocellular carcinoma cells (Hep G2 , ATCC HB-8065) ; and mouse mammary tumor cells (MMT 060562, ATCC CCL51) . f . Yeast Expression

In addition to prokaryotic and mammalian host cells, eukaryotic microorganisms such as yeast may also be used as host cells. Saccharomyces cerevisiae, common baker's yeast, is the most commonly-used eukaryotic microorganism for expressing heterologous proteins, although a number of other strains are commonly available . For expression in Saccharomyces, the plasmid YRp7, for example, is commonly used [ATCC-40053, Stinchco b, D. T., et al . , Nature 282:39-43 (1979); Kingsman, A. J. , et al . , Gene

7:141-152 (1979); Tschumper, G. , et al., Gene 10:157-166 (1980)] . This plasmid already contains the trp gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan [e.g., ATCC 44076 or PEP4-1; Jones, E. W., Genetics 85:23-33 (1977)].

Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase, which is found on plasmid pAP12BD ATCC 53231 [Patel, A. C, et al . , U.S. Patent No. 4,935,350, issued June 19, 1990] or other glycolytic enzymes such as enolase, which is found on plasmid pACl (ATCC 39532) , glyceraldehyde-3-phosphate dehydrogenase, which is derived from plasmid pHcGAPCl (ATCC 57090, 57091), zymomonas mobilis [Ingram, L.O., et al . , U.S. Patent No. 5,000,000, issued March 19, 1991], hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6- phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase .

Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, which is contained on plasmid vector pCL28XhoLHBPV [ATCC 39475; Reddy, V. B., et al . , U.S. Patent No. 4,840,896, issued June 20, 1989], glyceraldehyde 3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization, such as, the GAL1 promoter, which may be found on plasmid pRY121 (ATCC 37658) . Suitable vectors and promoters for use in yeast expression are further described in Hitzeman, R. A., et al., European Patent Publication No. 73,657A1, published March 9, 1983. Yeast enhancers such as the UAS Gal from Saccharomyces cerevisiae, which is found in conjunction with the CYC1 promoter on plasmid YEpsec--hIlbeta (ATCC 67024) , also are advantageously used with yeast promoters . The preferred host cell line for biosynthesizing the proteins used in the present formulations is E. coli K12 RV308, but numerous other cell lines are available, such as, _but not limited to, E. coli K12 L201, L687, L693, L507, L640, L641, L695, L814 (E. coli B) .

Proteins that are expressed in high-level bacterial expression systems characteristically aggregate in granules or inclusion bodies which contain high levels of the overexpressed protein [Kreuger, J. K. , et al . , in Protein Folding, Gierasch, L. M. and King, J., eds . , American Association for the Advancement of Science Publication No. 89-18S, Washington, D.C., 136-142 (1990)]. Such protein aggregates must be dissolved to provide further purification and isolation of the desired protein product. [Kreuger, J. K. , et al . , supra . ] . A variety of techniques using strongly denaturing solutions such as guanidinium-HCl and/or weakly denaturing solutions such as urea are used to solubilize the proteins. Gradual removal of the denaturing agents (often by dialysis) in a solution allows the denatured protein to assume its native conformation. The particular conditions for denaturation and folding are determined by the particular protein expression system and/or the protein in question.

Preferably, the proteins are expressed with a leader sequence. One of ordinary skill in the art would recognize that numerous leader sequences are operable; however, the leader sequence is preferably Met-Rχ- , wherein Ri is any amino acid except Pro or is absent, so that the expressed proteins may be readily converted to an obesity protein analog not having a leader sequence with Cathepsin C, or other suitable aminopeptidases . Preferably, the DNA sequences are expressed with a dipeptide leader sequence encoding Met-Arg or Met-Tyr as described in U.S. Patent No. 5,126,249, herein incorporated by reference. This approach facilitates the efficient expression of proteins and enables rapid conversion to the active protein form with Cathepsin C or other dipeptidylaminopeptidases . The purification of proteins is by techniques known in the art, and includes reverse phase chromatography, affinity chromatography, and size exclusion. Preferably, Ri is Arg, Asp, or Tyr; and most preferably, the proteins are expressed with a Met-Arg leader sequence. Interestingly, the leader sequence does not significantly affect stability or activity of the protein. However, the leader sequence is preferably cleaved from the protein. Thus, the expressed proteins may be of the Formula: Met-Rχ- (obesity protein analog).

The following examples and preparations are provided merely to further illustrate the preparation of the formulations of the invention. The scope of the invention is not construed as merely consisting of the following examples .

Preparation 1 The plasmid containing the DNA sequence encoding the desired protein, is digested with Pmll and Bsu36I. The recognition sequences for these enzymes lie within the coding region for the protein at nucleotide positions 275 and 360 respectively. The cloning vector does not contain these recognition sequences. Consequently, only two fragments are seen following restriction enzyme digestion with Pmll and Bsu36I, one corresponding to the vector fragment, the other corresponding to the -85 base pair fragment liberated from within the protein coding sequence. This sequence can be replaced by any DNA sequence encoding the amino acid substitutions between positions 91 and 116 of the obesity protein. These DNA sequences are synthesized chemically as two oligonucieotides with complementary bases and ends that are compatible with the ends generated by digestion with Pmll and Bsu36I. The chemically synthesized oligonucieotides are mixed in equimolar amounts (1-10 picomoles/microliter) , heated to 95°C and allowed to anneal by slowly decreasing the temperature to 20-25°C. The annealed oligonucieotides are used in a standard ligation reaction. Ligation products are transformed and analyzed using standard techniques. Other substitutions are preferably carried out in a similar manner using appropriate restriction sites.

Preparation 2 A DNA sequence encoding SEQ ID NO: 6 with a Met-Arg leader sequence was obtained using the plasmid and procedures described in Preparation 1. The plasmid was digested with Pmll and Bsu36I. A synthetic DNA fragment of the sequence 5 " -SEQ ID NO : 14 : (SEQ ID NO: 14)

GTGCTGGCCTTCTCTAAAAGTTGCCACTTGCCAGCTGCCAGTGGCCTGGAGACATTGGAC AGTCTGGGGGGAGTCCTGGAAGCC

annealed with the sequence 5' -SEQ ID NO: 15:

(SEQ ID NO: 15)

TGAGGCTTCCAGGACTCCCCCCAGACTGTCCAATGTCTCCAGGCCACTGGCAGCTGGCAA GTGGCAACTTTTAGAGAAGGCCAGCAC

was inserted between the Pmll and the Bsu36I sites. Following ligation, transformation and plasmid isolation, the sequence of the synthetic fragment was verified by DNA sequence analysis.

Preparation 3 A DNA sequence encoding human obesity protein was assembled from chemically- synthesized, single-stranded oligonucieotides to generate a double- stranded DNA sequence. The oligonucieotides used to assemble this DNA sequence are as follows : (SEQ ID NO:16)

TATGAGGGTACCTATCCAAAAAGTACAAGATGACACCAAAACACTGATAAAGACAATAGT CACAAG

(SEQ ID NO: 17) GATAGATGATATCTCACACACACAGTCAGTCTCATCTAAACAGAAAGTCACAGGCTTGGA CTTCATACCTGG (SEQ ID NO: 18) GCTGCACCCCATACTGACATTGTCTAAAATGGACCAGACACTGGCAGTCTATCAACAGAT CTTAACAAGTATGCCTT

(SEQ ID NO: 19) CTAGAAGGCATACTTGTTAAGATCTGTTGATAGACTGC

(SEQ ID NO: 20) CAGTGTCTGGTCCATTTTAGACAATGTCAGTATGGGGTGCAGCCCAGGTATGAAGTCCAA GC

(SEQ ID NO: 21) CTGTGACTTTCTGTTTAGATGAGACTGACTGTGTGTGTGAGATATCATCTATCCTTGTGA CTATTGTCTTTATCAGTGTTTTG

(SEQ ID NO: 22) GTGTCATCTTGTACTTTTTGGATAGGTACCCTCA

(SEQ ID NO: 23) CTAGAAACGTGATACAAATATCTAACGACCTGGAGAACCTGCGGGATCTGCTGCACGTGC

TGGCCTTCTCTAAAAGTTGCCACTTGCCATGG

(SEQ ID NO: 24) GCCAGTGGCCTGGAGACATTGGACAGTCTGGGGGGAGTCCTGGAAGCCTCAGGCTATTCT ACAGAGGTGGTGGC

(SEQ ID NO:25) CCTGAGCAGGCTGCAGGGGTCTCTGCAAGACATGCTGTGGCAGCTGGACCTGAGCCCCGG GTGCTAATAG

(SEQ ID NO: 26) GATCCTATTAGCACCCGGGGCTCAGGTCCAGCTGCCACAGCATGTCTTGCAGAGACC

(SEQ ID NO:27) CCTGCAGCCTGCTCAGGGCCACCACCTCTGTAGAATAGCCTGAGGCTTCCAGGACTCCC (SEQ ID NO : 28 ) CCCAGACTGTCCAATGTCTCCAGGCCACTGGCCCATGGCAAGTGGCAACTTTTAGAGAAG

G

(SEQ ID NO : 29)

CCAGCACGTGCAGCAGATCCCGCAGGTTCTCCAGGTCGTTAGATATTTGTATCACGTTT

Oligonucieotides having SEQ ID NO: 16 through 22 were used to generate an approximately 220 base-pair segment which extends from the Ndel site to the Xbal site at position 220 within the coding sequence. The oligonucieotides having SEQ ID NO: 23 through 29 were used to generate an approximately 240 base-pair segment which extends from the Xbal site to the BamHI site. To assemble the 220 and 240 base-pair fragments, the respective oligonucieotides were mixed in equimolar amounts, usually at concentrations of about 1-2 picomoles per microliters. Prior to assembly, all but the oligonucieotides at the 5' -ends of the segment were phosphorylated in standard kinase buffer with T4 DNA kinase using the conditions specified by the supplier of the reagents. The mixtures were heated to 95°C and allowed to cool slowly to room temperature over a period of 1-2 hours to ensure proper annealing of the oligonucieotides . The oligonucieotides were then ligated to each other and into a cloning vector, PUC19 was used, but others are operable using T4 DNA ligase. The PUC19 buffers and conditions are those recommended by the supplier of the enzyme. The vector for the 220 base-pair fragment was digested with Ndel and Xbal, whereas the vector for the 240 base-pair fragment was digested with Xbal and BamHI prior to use. The ligation mixes were used to transform E. coli DH10B cells (commercially available from Gibco/BRL) and the transformed cells were plated on tryptone-yeast (TY) plates containing 100 μg/ml of ampicillin, X-gal and IPTG. Colonies which grow up overnight were grown in liquid TY medium with 100 μg/ml of ampicillin and were used for plasmid isolation and DNA sequence analysis . Plasmids with the correct sequence were kept for the assembly of the complete gene. This was accomplished by gel-purification of the 220 base-pair and the 240 base-pair fragments and ligation of these two fragments into PUC19 linearized with Ndel and BamHI. The ligation mix was transformed into E. coli DH10B cells and plated as described previously. Plasmid DNA was isolated from the resulting transformants and digested with Ndel and Bglll. The large vector fragment was gel-purified and ligated with a approximately 195 base-pair segment which was assembled as described previously from six chemically synthesized oligonucieotides as show below.

(SEQ ID NO:30) TAT GCG GGT ACC GAT CCA GAA AGT TCA GGA CGA CAC CAA AAC CCT GAT CAA AAC CAT CGT TAC

(SEQ ID NO: 31) GCG TAT CAA CGA CAT CTC CCA CAC CCA GTC CGT GAG CTC CAA ACA GAA GGT TAC CGG TCT GGA CTT CAT CCC GG

(SEQ ID NO: 32) GTC TGC ACC CGA TCC TGA CCC TGT CCA AAA TGG ACC AGA CCC TGG CTG TTT ACC AGC A

(SEQ ID NO: 33) ATA CGC GTA ACG ATG GTT TTG ATC AGG GTT TTG GTG TCG TCC TGA ACT TTC TGG ATC GGT ACC CGC A

(SEQ ID NO: 34)

TGC AGA CCC GGG ATG AAG TCC AGA CCG GTA ACC TTC TGT TTG GAG CTC ACG GAC TGG GTG TGG GAG ATG TCG TTG

(SEQ ID NO: 35) GAT CTG CTG GTA AAC AGC CAG GGT CTG GTC CAT TTT GGA CAG GGT CAG GAT CGG G The ligation was transformed into E. coli cells as described previously. The DNA from the resulting transformants was isolated and the sequence was verified by DNA sequence analysis . The plasmid with the correct sequence was digested with Ndel and BamHI and the approximately 450 base-pair insert was recloned into an expression vector.

Preparation 4 Protein of SEQ ID NO: 6 with a Met-Arg leader sequence was expressed in E. coli . Inclusion bodies were isolated in 8 M urea and 5 mM cysteine. The protein was purified by anion exchange chromatography in 8 M urea, and folded by dilution into 8 M urea (containing 5 mM cysteine) and exhaustive dialysis against phosphate-buffered saline (PBS) . Little to no aggregation of protein was seen in either of these procedures. Following final purification of the proteins by size-exclusion chromatography, the protein was concentrated to 3-3.5 mg/mL in PBS. Amino acid composition was confirmed. The Met-Arg leader sequence was cleaved by the addition of 6-10 milliunits of a diaminopeptidase which was isolated from Dicteolstelium discoidium per mg of protein [Atkinson, P. R. , et al . , U.S. Patent No. 5,565,330, issued October 15, 1996, incorporated herein expressly by reference] . The conversion reaction was allowed to proceed for 2-8 hours at room temperature. The progress of the reaction was monitored by high performance reversed phase chromatography. The reaction was terminated by adjusting the pH to 8 with NaOH. The des (Met-Arg) protein was further purified by cation exchange chromatography in 7-8 M urea, and then by size exclusion chromatography in PBS. Following final purification of the proteins by size exclusion chromatography the proteins were concentrated to 3-3.5 mg/mL in PBS. Example 1 Obesity Protein Analog Formulation

Lyophilized, obesity protein analog of SEQ ID NO: 6 (hereinafter Protein NO: 6) was first dissolved in arginine buffer (15.2 mM, pH 8.5) to form a Protein NO: 6 stock solution, having a concentration of Protein NO: 6 of 30.3 mg/mL. For each preservative, a stock solution containing preservative at 2 times the desired final preservative concentration was prepared by dissolving the preservative in water. To prepare formulations comprising the Protein NO: 6 at pH greater than 8.0, 5 volumes of the appropriate preservative stock and 3.3 volumes of the Protein NO: 6 stock solution were combined. Water was added to bring the combined volume to 10 volumes. The formulations were placed at 25°C. Each stock solution and water was sterile-filtered using a sterile 0.22 μm syringe filter into a sterile glass vial before combining to make the formulations. All glassware had been previously sterilized. Formulations at pH 7.8 were prepared for comparison in virtually the same way as described above, except that disodium phosphate (16.7 mM, pH 7.8 using phosphoric acid) was used to dissolve

Protein NO: 6, the stock solution concentration of Protein

NO: 6 was 33.3 mg/mL, and 3 volumes of Protein NO: 6 stock solution were used instead of 3.3 volumes .

Example 2

Obesity Protein Analog Formulation

Lyophilized, obesity protein analog of SEQ ID NO: 6 (Protein NO: 6) was dissolved in TRIS.HCl buffer (10.0 mM, pH 8.5) to form a Protein NO: 6 stock solution, having a concentration of Protein NO:6 of 20.0 mg/mL. A stock solution of m-cresol at a concentration of 1.0% (v/v) was prepared by dissolving the preservative in water. To prepare formulations comprising the Protein NO: 6, 3 volumes of the m-cresol stock solution and 5 volumes of the Protein NO: 6 stock solution were combined. The pH was adjusted to the pH at which the samples were to be stored by adding either 0.1 N HC1 or 0.1 N NaOH. Finally, water was added to bring the combined volume to 10 volumes. Each stock solution and water was sterile-filtered using a sterile 0.22μm syringe filter. The samples were stored at pH values between 7.8 and 9.0, in increments of 0.1 pH units.

Example 3 Obesity Protein Analog Formulation

Lyophilized, obesity protein analog of SEQ ID NO: 2 (Protein NO: 2) was dissolved in Arginine buffer (28.6 mM, pH 8.5) to form a Protein NO: 2 stock solution having a concentration of Protein NO: 2 of 85.7 mg/mL. The Protein NO: 2 stock solution was sterile-filtered using a 0.2 micron filter. Separate stock solutions of m-cresol, phenol, and chlorocresol at concentrations of 0.60%, 1.0%, and 0.38%, (w/v) , respectively, were prepared by dissolving the appropriate preservative in water. To prepare formulations comprising Protein NO: 2 and either m-cresol or phenol, 5 volumes of the appropriate preservative stock solution and 1.75 volumes of the Protein NO: 2 stock solution were combined and thoroughly mixed. To prepare formulations comprising Protein NO: 2 and chlorocresol, 2.63 volumes of the appropriate preservative stock solution and 1.75 volumes of the Protein NO: 2 stock solution were combined and thoroughly mixed. In each case, the pH was adjusted to about pH 8.5 by adding either 0.1 N HC1 or 0.1 N NaOH. The volume of each formulation was then brought to 10 volumes by adding water. Control formulations in phosphate buffer were prepared as described above, except that the Protein NO: 2 stock solution was prepared by dissolving lyophilized, obesity protein analog of SEQ ID NO: 2 (Protein NO: 2) with sodium phosphate buffer (62.5 mM, pH 7.8) to form a Protein NO: 2 stock solution having a concentration of Protein NO: 2 of 93.8 mg/mL. The pH of the formulation was adjusted, as needed, to pH 7.8 after mixing 1.6 parts of the Protein NO: 2 stock solution with 5 parts of the appropriate preservative stock solution. The principles, preferred embodiments and modes of operation of the present invention have been described in the foregoing specification. The invention which is intended to be protected herein, however, is not to be construed as limited to the particular forms disclosed, since they are to be regarded as illustrative rather than restrictive. Variations and changes may be made by those skilled in the art without departing from the spirit of the invention.

Claims

I claim:

I . A soluble formulation comprising an obesity protein analog and a preservative, said soluble formulation having pH greater than 8.0.

2. The soluble formulation of Claim 1, wherein the concentration of obesity protein analog is between 0.5 mg/mL and 100 mg/mL.

3. The soluble formulation of Claim 2, wherein the concentration of obesity protein analog is between 0.5 mg/mL and 20 mg/mL.

4. The soluble formulation of Claim 3, wherein the pH is greater than 8.0 and less than 9.0.

5. The soluble formulation of Claim 4, wherein the pH is greater than 8.6.

6. The soluble formulation of Claim 4, wherein the pH is less than 8.6.

7. The soluble formulation of Claim 6, wherein the pH is greater than 8.3.

8. The soluble formulation of Claim 1, which further comprises a pharmaceutically acceptable buffer.

9. The soluble formulation of Claim 8 , wherein the buffer is TRIS or L-arginine.

10. The soluble formulation of Claim 9, wherein the buffer is TRIS.

II. The soluble formulation of Claim 1, wherein the preservative is selected from the group consisting of phenol, cresol, alkylparaben, benzyl alcohol and mixtures thereof .

12. The soluble formulation of Claim 11, wherein the preservative is phenol, m-cresol, methylparaben, propylparaben, chlorocresol, benzyl alcohol, or mixtures thereof .

13. The soluble formulation of Claim 1, which further comprises an isotonicity agent.

14. The soluble formulation of Claim 1, wherein the obesity protein analog is a compound of Formula I:

5 10 15 Val Pro He Gin Lys Val Gin Asp Asp Thr Lys Thr Leu He Lys Thr

20 25 30

He Val Thr Arg He Asn Asp He Ser His Thr Xaa Ser Val Ser Ser 35 40 45

Lys Gin Lys Val Thr Gly Leu Asp Phe He Pro Gly Leu His Pro He

50 55 60

Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin He

65 70 75 80

Leu Thr Ser Met Pro Ser Arg Asn Val He Gin He Ser Asn Asp Leu

85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys

100 105 110

His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly 115 120 125

Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg

130 135 140

Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu Ser Pro

145

Gly Cys (SEQ ID NO:l) (I) wherein:

Xaa at position 28 is Gin or absent; said protein having at least one of the following substitutions :

Gin at position 4 is replaced with Glu;

Gin at position 7 is replaced with Glu;

Asn at position 22 is replaced with Gin or Asp; Thr at position 27 is replaced with Ala;

Xaa at position 28 is replaced with Glu;

Gin at position 34 is replaced with Glu; Met at position 54 is replaced with methionine sulfoxide, Leu, He, Val, Ala, or Gly;

Gin at position 56 is replaced with Glu;

Gin at position 62 is replaced with Glu; Gin at position 63 is replaced with Glu;

Met at position 68 is replaced with methionine sulfoxide, Leu, He, Val, Ala, or Gly;

Asn at position 72 is replaced with Gin, Glu, or Asp; Gin at position 75 is replaced with Glu; Ser at position 77 is replaced with Ala;

Asn at position 78 is replaced with Gin or Asp; Asn at position 82 is replaced with Gin or Asp; His at position 97 is replaced with Gin, Asn, Ala, Gly, Ser, or Pro; Trp at position 100 is replaced with Ala, Glu, Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu; Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr, or Val;

Ser at position 102 is replaced with Arg; Gly at position 103 is replaced with Ala; Glu at position 105 is replaced with Gin; Thr at position 106 is replaced with Lys or Ser; Leu at position 107 is replaced with Pro; Asp at position 108 is replaced with Glu; Gly at position 111 is replaced with Asp; Gly at position 118 is replaced with Leu; Gin at position 130 is replaced with Glu; Gin at position 134 is replaced with Glu; Met at position 136 is replaced with methionine sulfoxide, Leu, He, Val, Ala, or Gly;

Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, He, Phe, Tyr, Ser, Thr, Gly, Gin, Val or Leu; or

Gin at position 139 is replaced with Glu; or a pharmaceutically acceptable salt thereof .

15. The formulation of Claim 14, wherein the obesity protein analog is a compound of Formula I wherein Asn at position 72 is replaced with Asp and Trp at position 100 is replaced with Asp, or a pharmaceutically acceptable salt thereof .

16. The formulation of Claim 14, wherein the obesity protein analog is a compound of Formula I wherein Trp at position 100 is replaced with Ala, or a pharmaceutically acceptable salt thereof .

17. A process for preparing the soluble formulation of Claim 1, which comprises mixing an obesity protein analog and a preservative to produce a soluble formulation comprising said obesity protein analog and said preservative, said soluble formulation having pH greater than 8.0.

18. A method of treating obesity in a mammal in need thereof, which comprises administering to said mammal a soluble formulation of Claim 1.