CA2243518A1 - Obesity protein formulations - Google Patents

Abstract

The present invention discloses a soluble parenteral formulation, comprising obesity protein analog and a preservative selected from the group consisting of alkylparaben, chlorobutanol, or a mixture thereof.

Description

CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 obesity Protein Formulations This application claims the benefit of U.S.
Provisional Application No. 60~010,257, filed January 19, 1996.
The present invention is in the field of human medicine, particularly in the treatment of obesity and disorders associated with obesity. More specifically, the present invention relates to formulations of an obesity protein analog.
Obesity, and especially upper body obesity, is a common and very serious public health problem in the United States and throughout the world. According to recent statistics, more than 25% of the United States population and 27% of the Canadian population are overweight. Kuczmarski, Amer. J. of Clin. Nutr. 55: 495S - 502S (1992); Reeder et.
al., Can. Med. Ass. J., 23: 226-233 ~1992). Upper body obesity is the strongest risk factor known for type II
diabetes mellitus, and is a strong risk factor for cardiovascular disease and cancer as well. Recent estimates for the medical cost of obesity are $150,000,000,000 world wide. The problem has become serious enough that the surgeon general has begun an initiative to combat the ever increasing adiposity rampant in American society.
Much of this obesity induced pathology can be attributed to the strong association with dyslipidemia, hypertension, and insulin resistance. Many studies have demonstrated that reduction in obesity by diet and exercise reduces these risk factors dramatically. Unfortunately, these treatments are largely unsuccessful with a failure rate reaching 95%. This failure may be due to the fact that the condition is strongly associated with genetically inherited factors that contribute to increased appetite, preference for highly caloric foods, reduced physical activity, and increased lipogenic metabolism. This indicates that people inheriting these genetic traits are prone to becoming obese regardless of their efforts to combat the condition.

CA 02243~18 1998-07-l~
WO97/26011 P~T~S97/OOS68 There~ore, a pharmacological agent that can correct this adiposity handicap and allow the physician to success~ully treat obese patients in spite o~ their genetic inheritance is needed.
The ob/ob mouse is a model o~ obesity and diabetes that is known to carry an autosomal recessive trait linked to a mutation in the sixth chromosome. Recently, Yiying Zhang and co-workers published the positional cloning of the mouse gene linked with this condition. Yiying Zhang et al. Nature 372: ~25-32 (1994). This report disclosed the murine and human protein expressed in adipose tissue. ~ikewise, Murakami et al., in Biochemical and Bio~hvsical Research Communications 209(3):944-52 (1995) report the cloning and expression of the rat obese gene. The protein, which is encoded by the ob gene, has demonstrated an ability to effectively regulate adiposity in mice. Pelleymounter et al., Science 269: 540-543 (1995).
A parenteral formulation containing insoluble protein causes problems relating to inconsistency in the dose-response as well as unpredictability. The unpredictability is believed to be due to greater variability in the pharamacokinetics in suspension ~ormulations. The insoluble ~ormulations must ~irst dissolve prior to adsorption. It is hypothesized that this step has signi~icant variability in a subcutaneous depot.
Furthermore, non native association and aggregation under physiological conditions can lead to precipitation of the protein at the site o~ injection, which could lead to irritation or other immune response. For these reasons, a ~ormulation o~ human obesity protein that developed insoluble protein particles would be unacceptable to patients seeking its bene~its and to regulatory agencies.
Un~ortunately, the naturally occurring obesity proteins demonstrate a propensity to aggregate making the preparation o~ a soluble, pharmaceutically acceptable parenteral ~ormulation exceedinyly dif~icult. The molecular interactions amongst the preservative, buf~er, ionic CA 02243~l8 l998-07-l~

WO97/26011 PCT~S97/~0568 strength, pH, temperature, and any additional excipients such as a surfactant, or sugar are highly unpredictable in view of the propensity for the obesity protein to aggregate and precipitate from the formulation.
obesity protein analogs have been developed and have demonstrated pharmacological activity. Some of these analogs demonstrate significant improvement in physical properties and stability. Analogs included in the present invention are disclosed in Basinski et al., in WO 96/23515 and WO 96/23517.
The present invention provides conditions under which solubility of an obesity protein analog is enhanced.
Thus, permitting a longer shelf life, ease of manufacture, and more convenient patient delivery. Most unexpectedly, the physical stability of the formulation is greatly enhanced in the presence of methylparaben, ethylparaben, propylparaben, butylparaben, chlorobutanol or a mixture thereof. That is, when ~ormulated under the conditions described herein, the obesity protein analog r~m~i n~ soluble at much higher concentrations and at a pH range acceptable for a soluble, multi-use parenteral formulation. Accordingly, the present invention provides a soluble, parenteral formulations of an obesity protein analog.
This invention provides a soluble parenteral formulation, comprising an obesity protein analog and a preservative selected from the group consisting of alkylparaben, chlorobutanol, or a mixture thereof.
The invention further provides a process for preparing a soluble parenteral formulation, which comprises mixing an obesity protein analog and a preservative selected from the group consisting of alkylparaben, chlorobutanol, or ~ a mixture thereof.
Additionally, the invention provides a method of treating obesity in a mammal in need thereof, which comprises administering to said m~mm~l a soluble parenteral formulation of the present invention.

CA 02243~18 1998-07-1~
WO~7/26011 PCT~S97/00568 For purposes o~ the present invention, as disclosed and claimed herein, the ~ollowing terms and abbre~iations are de~ined as ~ollows:
Alkylparaben -- re~ers to a Cl to C4 alkyl paraben.
Pre~erably, alkylparaben is methylparaben, ethylparaben, propylparaben, or butylparaben.
Base pair (bp) -- re~ers to DNA or RNA. The abbreviations A,C,G, and T correspond to the 5'-monophosphate ~orms o~ the nucleotides (deoxy)adenine, (deoxy)cytidine, (deoxy)guanine, and (deoxy)thymine, respectively, when they occur in DMA molecules. The abbreviations U,C,G, and T
correspond to the 5~-monophosphate ~orms o~ the nucleosides uracil, cytidine, guanine, and thymine, respectively when they occur in RNA molecules In double stranded DNA, base pair may re~er to a partnership o~ A with U or C with G. In a DNA/RNA heteroduplex, base pair may re~er to a partnership of T with U or C with G.
Obesity protein analog -- re~ers to a protein o~
the Formula (I):
205 l0 15 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Xaa Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu 3~~ 85 90 95 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 4~ Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/OOS68 , Gly cys (SEQ ID NO:l) (I) wherein: Xaa at position 28 is Gln or absent; said protein ha~ing at least one of the following substitutions:
Gln at position 4 is replaced with Glu;
Gln at position 7 is replaced with Glu;
Asn at position 22 is replaced with Gln or Asp;
Thr at position 27 is replaced with Ala Xaa at position 28 is replaced with Glui Gln at position 34 is replaced with Glu;
Met at position 54 is replaced with methionine sulfoxide, Leu, Ile, Val, Ala, or Gly;
Gln at position 56 is replaced with Glu;
Gln at position 62 is replaced with Glu Gln at position 63 is replaced with Glui Met at position 68 is replaced with methionine sulfoxide, Leu, Ile, Val, Ala, or Gly;
Asn at position 72 is replaced with Gln, Glu, or Asp;
Gln at position 75 is replaced with Glu;
Ser at position 77 is replaced with Alai Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp;
His at position 97 is replaced with Gln, Asn, Ala, Gly, Ser, or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr, or Val;
Ser at position 102 is replaced with Arg;

Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Proi Asp at position 108 is replaced with Glui Gly at position 111 is replaced with Asp;
Gly at position 118 is replaced with Leui Gln at position 130 is replaced with Glu;

CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 Gln at position 134 is replaced with Glu;
Met at position 136 is replaced with methionine sulfoxide, Leu, Ile, Val, Ala, or Gly;
Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu; or Gln at position 139 is replaced with Glu;
or a pharmaceutically acceptable salt thereof. Obesity protein analog includes those proteins having a leader sequence. A leader sequence is one or more amino acids on the N-terminus to aid in production or purification of the protein. A preferred leader sequence is Met-Rl- wherein Rl is absent or any amino acid except Pro.
Plasmid -- an extrachromosomal sel~-replicating genetic element.
Reading frame -- the nucleotide sequence from which translation occurs "read" in triplets by the translational apparatus of tRNA, ribosomes and associated factors, each triplet corresponding to a particular amino acid. Because each triplet is distinct and of the same length, the coding sequence must be a multiple of three. A base pair insertion or deletion (termed a frameshift mutation) may result in two different proteins being coded for by the same DMA segment.
To insure against this, the triplet codons corresponding to the desired polypeptide must be aligned in multiples of three from the initiation codon, i.e. the correct ~'reading ~rame~
must be maintained. In the creation of fusion proteins containing a chelating peptide, the reading frame of the DNA
sequence encoding the structural protein must be maintained in the DNA sequence encoding the chelating peptide.
Recombinant DNA Cloning Vector -- any autonomously replicating agent including, but not limited to, plasmids and phages, comprising a DNA molecule to which one or more additional DNA segments can or have been added.
Recombinant DNA Expression Vector -- any recombinant DNA cloning vector in which a promoter has been incorporated.

CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568 .

Replicon -- A DNA sequence that controls and allows for autonomous replication of a plasmid or other vector Transcription -- the process whereby information contained in a nucleotide sequence of DNA is transferred to a ~ 5 complementary RNA se~uence.
Translation -- the process whereby the genetic information of messenger RNA is used to specify and direct the synthesis of a polypeptide chain.
Vector -- a replicon used for the transformation of cells in gene manipulation bearing polynucleotide se~uences corresponding to appropriate protein molecules which, when combined with appropriate control sequences, confer specific properties on the host cell to be transformed. Plasmids, viruses, and bacteriophage are suitable vectors, since they are replicons in their own right. Artificial vectors are constructed by cutting and joining DNA molecules from different sources using restriction enzymes and ligases.
Vectors include Recombinant DNA cloning vectors and Recombinant DNA expression vectors.
Treating -- as used herein, describes the management and care of a patient for the purpose of combating the disease, condition, or disorder and includes the administration of a protein of present invention to prevent the onset of the symptoms or complications, alleviating the symptoms or complications, or eliminating the disease, condition, or disorder. Treating as used herein includes the administration of the protein for cosmetic purposes. A
cosmetic purpose seeks to control the weight of a mammal to improve bodily appearance.
Isotonicity agent -- isotonicity agent refers to an agent that is physiologically tolerated and embarks a suitable tonicity to the formulation to prevent the net flow of water across the cell membrane. Compounds, such as glycerin, are commonly used for such purposes at known concentrations. Other possible isotonicity agents include salts, e.g., NaC1, dextrose, mannitol, and lactose.

CA 02243~l8 l998-07-l~
WO9~/26011 PCT~S97/00568 .

Physiologically tolerated bu~er -- a physiologically tolerated bu~fer is known in the art. A
physiologically tolerated bu~fer is pre~erably a phosphate bu~fer, like sodium phosphate. Other physiologically tolerated buffers include TRIS, sodium acetate, or sodium citrate. The selection and concentration of bu~er is known in the art.
The nucleotide and amino acid abbreviations are accepted by the United States Patent and Trademark O~ice as set ~orth in 37 C.F.R. 1.822 (b)(2) (1993). Unless otherwise indicated the amino acids are in the L
con~iguration.
As noted above, the invention provides a soluble parenteral ~ormulation, comprising an obesity protein analog and a preservative selected from the group consisting of an alkylparaben or chlorobutanol. In the presence of these preservatives, the obesity protein analog remains in solution making a soluble, parenteral ~ormulation possible.
A parenteral formulation must meet guidelines ~or ~0 preservative e~e~tiveness to be a commercially viable product. Preservatives known in the art as being acceptable in parenteral formulations include: phenol, m-cresol, benzyl alcohol, methylparaben, chlorobutanol, p-cresol, phenylmercuric nitrate, thimerosal and various mixtures thereo~. See, e.g., WALLHAUSER, K.--H., DEvELoP. BIOL. STANDARD.
24, pp. 9-28 (Basel, S. Krager, 1~74).
Most unexpectedly, a select number of prese~vatives have been identi~ied that provide good formulation stability These select preservatives are an alkylparaben or chlorobutanol. Most preferrably, the preservative is methylparaben, propylparaben, or butylparaben. Most unexpectedly, the obesity protein analog does not aggregate in the presence of these preservatives at the conditions necessary to formulate, and particularly conditions at 37~C.
The concentration o~ obesity protein analog in the ~ormulation is about l.0 mg/mL to about l00 mg/mL; preferably about 5.0 mg/mL to about 50.0 mg/mL; most pre~erably, about CA 02243~18 1998-07-1~
WO97/26011 PCT~S97/0~68 _ g _ l0.0 mg/mL. The concentration of preservative required is the concentration necessary to maintain preservative effectiveness. The relative amounts of preservative necessary to maintain preservative e~fectiveness varies with the preservative used. Generally, the amount necessary can be found in WALLHAusER, K.- H ., DEVELOP . BIoL. STANDARD . 2 4, pp .
9-28 (Basel, S. Krager, 1974), herein incorporated by reference. The optimal concentration of the preservative depends on the preservative, its solubility, and the pH of the formulation.
Also included as optional embodiments are agents known to be synergistic with the preservative to provide enhanced antimicrobial effect. Such agents are recognized in the art and include for example ethylene diaminetetraacetic acid (EDTA), 1, 2-di(2-aminoethoxy)ethane-N,N,N',N'=tetraacetaic acid (EGTA), citrate, and caprylic acid. The concentration of these agents varies with the desired preservation effect. A preferred agent is EDTA, particularly in conjunction with an alkylparaben at a concentration of about 0.025% to 0.4%. Notably, in preparations including EDTA or EGTA, the bu~fer concentration is reduced to m;n;m; ze ionic strength.
The present formulations may optionally contain a physiologically tolerated solvent such as glycerol, propylene 25 glycol, phenoxy ethanol, phenyl ethyl alcohol. Such solvents are generally added to enhance the solubility of the protein in the preservation effectiveness of the formulation.
An isotonicity agent, preferably glycerin, may be addltionally added t~ the ~r~ulation. The concentration o~
the isotonicity agent is in the range known in the art for parenteral formulations, preferably about l to 20 mg/mL, mcre - preferably about 8 to 16 mg/mL, and still more preferably about 16 mg/mL. The pH of the formulation may also be buffered with a physiologically tolerated buffer, preferably 35 a phosphate buffer, like sodium phosphate (at about 5mM to about 15 mM). Other acceptable physiologically tolerated buffers include TRIS, sodium acetate, or sodium citrate. The CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568 selection and concentration of buffer is known in the art;
however, the formulations of the present invention are preferably prepared with the m; ni m~lly acceptable concentration of buffer.
other additives, such as a pharmaceutically acceptable solubilizers like Tween 20 ~polyoxyethylene (20) sorbitan monolaurate), Tween 40 (polyoxyethylene (20) sorbitan monopalmitate), Tween 80 (polyoxyethylene (20) sorbitan monooleate), Pluronic F68 (polyoxyethylene polyoxypropylene block copolymers), BRIJ 35 (polyoxyethylene (23) lauryl ether), and PEG (polyethylene glycol) may optionally be added to the formulation to reduce aggregation.
These additives are particularly useful i~ a pump or plastic container is used to administer the formulation. The presence of pharmaceutically acceptable surfactant mitigates the propensity for the protein to aggregate.
The parenteral formulations of the present invention can be prepared using conventional dissolution and mixing procedures. To prepare a suitable formulation, for example, a measured amount of obesity protein analog in water is combined with the desired preservative in water in ~uantities sufficient to provide the protein and preservative at the desired concentration. The formulation is generally sterile filtered prior to administration. Variations of this process would be recognized by one of ordinary skill in the art. For example, the order the components are added, the surfactant used, the temperature and pH at which the formulation is prepared may be opt'imized for the concentration and means of administration used.
The unexpected preservative effect on formulation stability was demonstrated by preparing formulations comprising methylparaben, propylparaben, butylparaben, chlorobutanol, cresol, phenol, benzyl alcohol, or a mixture thereof and comparing the amount of protein r~m~ining in solution after 3 days at 4~C and 37~C. The data in Table 1 demonstrate that the stability and solubility of the protein is enhanced in the presence of an alkylparaben or CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 .

chlorobutanol. The ~ormulations used to generate the data of Table 1 were prepared in a manner analogous to Examples 1 and 2.
Table 1. Recovery of the protein of SEQ ID NO:6 as a function of preservative and conditions. Values are the calculated least square means and standard errors determined ~rom ~itting the raw data to a ~actorial model o~ the second degree containing the effects of preservative, acid excursion, bu~er, conditions, and all two-factor interactions (R2 = 0 945 (Prob > F) = 2.88e~38, total observations = 125).
Percent of protein in solution is calculated using a theoretical target of 1.6 mg protein/mL.
Protein in Solution (% of theoretical) PreservativePreservative3 days ~ 3 days @
Concentration (%) 4~C 7~C
methylparaben 0.17 = '.02 ~.6 =
propylparaben 0.16 - .02 . = . ,. = _.
butylparaben0. 1 . = .
chlorobutenol 0.5 ~r, = t 8 . ~ = _ .
methylparaben + 0.18 i 0.02 . = .~ 70. = .
propylparaben 0.017 + 0.002 benzyl alcohol 1.0 81.4 + 3.6 28.9 i 3.6 methylparaben + 0.16 i 0.02 81.6 i 3.6 11.9 + 3.6 propylparaben +0.02 i 0.002 benzyl -~lcohol 0.~
m-creso 0. 5~.~ = .0 ~ .6 = -.
p-creso_ 0. 7~
phenol 0. 6-. = _.~ '.2 = ~.' The stabilizing e~fect by the alkylparabens is most unexpected in view of the structural similarities to other preservatives. The data clearly show that the alkylparabens and chlorobutanol are superior at 37~C, which is the temperature re~uired ~or in-use physical stability testing.
Preferably, the pH of the present ~ormulations is about pH 7.0 to about 8.0 and, most preferably 7.6 to 8Ø
The ~ormulations are pre~erably prepared under basic conditions by mixing the obesity protein analog and preservative at a pH greater than pH 7Ø Pre~erably, the pH
25 is about 7.6 to 8.0, and most preferably about pH 7.8.
Ideally, a preservative and water solution is mixed at pH 7.6 to 8Ø Added to this solution is obesity protein analog in CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 .

water. The pH is adjusted, as necessary, to about pH 7.6 to 8Ø The solution is then held until the components are dissolved, approximately 20 to 40 ~inutes, preferably about 30 minutes. The base used to adjust the pH o~ the formulation may be one or more pharmaceutically acceptable bases such as sodium hydroxide or potassium hydroxide. The preferred base is sodium hydroxide.
The formulations prepared in accordance with the present invention may be used in a syringe, in~ector, pumps or any other device recognized in the art ~or parenteral administration.
Pre~erred obesity protein analo~s employed in the formulations of the present invention are those of Formula I, wherein:
Gln at position 4 is repLaced with Glu;
Gln at position 7 is replaced with Glu;
Asn at position 22 i5 replaced with Gln or Asp;
Thr at position 27 is replaced with Ala;
Gln at position 28 is replaced with Glu;
Gln at position 34 is replaced with Glu;
Met at position 54 is replaced with methionine sulfoxide, Leu, or Ala;
Gln at position 56 is replaced with Glu;
Gln at position 62 is replaced with Glu;
Gln at position 63 is replaced with Glu;
Met at position 68 is replaced with methionine sulfoxide, or Leu;
Asn at position 72 is replaced with Gln or Asp;
Gln at position 75 is replaced with Glu;
3D Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp;
Gln at position 130 is replaced with Glu;
Gln at position 134 is replaced with Glu;
Met at position 136 is replaced with methionine sulfoxide, Leu, Ile; or Gln at position 139 is replaced with Glu.

CA 02243~18 1998-07-1~
WO9-7/26011 PCT~S97/00568 other pre~erred obesity protein analogs employed in the ~ormulations of the present invention are those of - Formula I, wherein:
Asn at position 22 is replaced with Gln or Asp;
Thr at position 27 is replaced with Ala;
Met at position 54 is replaced with methionine sulfoxide, Leu, or Ala;
Met at position 68 is replaced with methionine sul~oxide, or Leu;
Asn at position 72 is replaced with Gln or Asp;
Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp; or Met at position 136 is replaced with methionine sulfoxide, Leu, or Ile.
Still yet additional preferred proteins employed in the ~ormulations o~ the present inventin are those o~ Eormula I, wherein:
Asn at position 22 is replaced with Gln or Asp;
Thr at position 27 is replaced with Ala;
Met at position 54 is replaced with Leu, or Ala;
Met at position 68 is replaced with Leu;
Asn at position 72 is replaced with Gln or Asp;
Asn at position 78 is replaced with Gln or Asp;
Asn at position 82 is replaced with Gln or Asp; or Met at position 136 is replaced with Leu, or Ile.

Pre~erred species employed in the ~ormulations o~
the present invention are those o~ SEQ ID NO:2 and SEQ ID
NO:3:
5 lO 15 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asp Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile so 55 60 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile CA 02243~18 1998-07-1~
WO~-7/26011 PCT~S97/00568 .

Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser ~rg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO: 2) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg I le Asn Asp Ile Ser His Ala Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile 3 0 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO:3) Most signi:Eicantly, other pre~erred proteins o~ the present ~ormulations are speci~ic substitutions to amino acid residues 97 to lll, and/or 138 O~ the proteins o:E SEQ ID
NO:l. These substitutions result in additional stability and are superior therapeutic agents. These speci~ic proteins are CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/OOS68 more readily formulated and are more pharmaceutically elegant, which results in superior delivery o~ therapeutic doses. Accordingly, pre~erred embodiments are formulations comprising obesity protein analogs o~ the Formula II:

Val Pro Ile Gln Ly~ Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Xaa Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile 15 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 3 0 Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro 1~5 Gly Cys (SEQ ID NO:4) (II) wherein:
Xaa at position 28 is Gln or absent;
said protein having at least one substitution selected ~rom the group consisting o~:
His at position 97 is replaced with Gln, Asn, Ala, Gly, Ser, or Pro;
Trp at position lOO is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position lO1 is replaced with Ser, Asn, Gly, His, Pro, Thr, or Val;
Ser at position 102 iS replaced with Arg;
Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;

CA 022435l8 l998-07-l5 WO57/26011 PCT~S97/00~68 Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
or a pharmaceutically acceptable salt thereo~.
Other pre~erred embodiments are ~ormulations comprising obesity protein analogs of the Formula III:

0 Val Pro Ile Gln Ly~ Val Gln Asp Asp Thr Lys Thr Leu Ile Ly~ Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu ~is Pro Ile 50 55 6~
Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn ~eu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu A~p Ser Leu Gly Gly Val L~u Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Me~ Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO:5) (III) said protein having at least one substitution selected ~rom the group consisting o~:
His at position 97 is replaced with Gln, Asn, Ala, Gly, Ser, or Pro;
Trp at position 100 is replaced with Ala, &lu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr, or Val;
Ser at position 10~ is replaced with Arg;

CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 Gly at position 103 is replaced with Ala;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu;
or a pharmaceutically acceptable salt thereo~.
More preferred embodiments are ~ormulations comprising obesity protein analogs o~ the Formula III, wherein:
His at position 97 is replaced with Gln, Asn, Ala, Gly, Ser or Pro;
Trp at position 100 is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln or Leu;
Ala at position 101 is replaced with Ser, Asn, Gly, His, Pro, Thr or Val;
Glu at position 105 is replaced with Gln;
Thr at position 106 is replaced with Lys or Ser;
Leu at position 107 is replaced with Pro;
Asp at position 108 is replaced with Glu;
Gly at position 111 is replaced with Asp; or Trp at position 138 is replaced with Ala, Glu, Asp, Asn, Met, Ile, Phe, Tyr, Ser, Thr, Gly, Gln, Val or Leu.
other pre~erred embodiments are ~ormulations comprising obesity protein analogs o~ the Formula III, wherein:
His at position 97 is replaced with Ser or Pro;
Trp at position 100 is replaced with Ala, Gly, Gln, Val, Ile, or Leu;
Ala at position 101 is replaced with Thr; or Trp at position 138 is replaced with Ala, Ile, Gly, Gln, Val or Leu.

CA 02243~18 1998-07-1~
WO~7/26011 PCT~S97/00568 Additional pre~erred embodiments are ~ormulations comprising obesity protein analo~s of the Formula III, wherein:
His at position 97 is re~laced with Ser or Pro;
Trp at position lOO is replaced with Ala, Gln or Leu;
Ala at position lOl is replaced with Thr; or Trp at position 138 is replaced with Gln.
Most pre~erred embodiments are ~ormulations comprising obesity protein analogs havin~ a di-sul~ide bon~
l~ between Cys at position 96 and Cys at positio~ 146. Examples o~ most preferred embodimenets include formulations comprising obesity protein analogs o~ SEQ ID NO:6-13, said obesity protein analogs having intramolecular di-sul~ide bonds between Cys at position 96 and Cys at position 146, or pharmaceutically acceptable salts thereo~:

Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser Xis Thr Gln Ser Val Ser Ser ~0 45 Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys 3 5 His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO: 6 ) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr CA 02243~l8 l998-07-l~

WO g'7t26011 PCT/US97/00568 Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu 15 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys 100 105 . 110 His Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID MO: 7) 3 0 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu 45 Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID MO: 8) CA 02243~l8 l998-07-l~
WO 9~/26011 PCT/US97/OOS68 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser lQ Lys Gln Lys Val Thr Gly Leu A5p Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys lQO 105 110 His Leu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO: 9) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Ala Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu 5Q Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys lQO 105 110 His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg CA 02243~l8 l998-07-l~

WO g7/26011 PCT/US97/00568 .

Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys ( SEQ ID NO: 10 ) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser ~Iis Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile 20 Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro 3 5 Gly Cys ( SEQ ID ~O

CA 02243~l8 l998-07-l~
WO g7126011 PCT/US97/00568 Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr 5 Ile Val Thr Arg Ile Asn A5p Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp lleu Leu His Val Leu Ala Phe Ser Lys Ser Cys 2 0 Ser Leu Pro Gln Thr Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO: 12 ) Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile ~0 Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile 4~ Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys lQ0 lQ5 - llO
Ser heu Pro Gln Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg 130 13~ 140 Leu Gln Gly Ser Leu Gln Asp Met Leu Gln Gln Leu Asp Leu Ser Pro CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568 Gly Cys (SEQ ID NO:13) The obesity protein analogs of the present invention can be prepared by any of a variety o~ recognized peptide synthesis techniques including classical (solution) methods, solid phase methods, semi synthetic methods, and more recent recombinant DNA methods. Recombinant methods are preferred if a high yield is desired. The basic steps in the recombinant production of protein include:
a) construction of a synthetic or semi-synthetic (or isolation from natural sources) DMA
encoding the obesity protein analog, b) integrating the coding sequence into an expression vector in a manner suitable for the expression of the protein either alone or as a fusion protein, c) transforming an appropriate eukaryotic or prokaryotic host cell with the expression vector, and d) recovering and purifying the recombinantly produced protein.
Synthetic genes, the n vitro or ln v vo transcription and translation of which will result in the production of the protein may be constructed by techniques well known in the art. Owing to the natural degeneracy of the genetic code, the skilled artisan will recognize that a sizable yet definite number of DNA sequences may be constructed which encode the desired proteins. In the preferred practice of the invention, synthesis is achieved by recombinant DNA technology.
Methodology of synthetic gene construction is well known in the art. For example, see Brown, et al. (1979) Methods in Enzymology, Academic Press, N.Y., Vol. 63, pgs.
lD9-151. The DNA sequence corresponding to the synthetic claimed protein gene may be generated using conventional DNA
synthesizing apparatus such as the Applied Biosystems Model CA 02243~18 1998-07-1~
WO97/26011 PCT~S97/00568 380A or 380B DNA synthesizers (commercially available ~rom Applied Biosystems, Inc., 850 Llncoln Center Drive, Foster City, CA 94~04). It may be desirable in some applications to modify the coding sequence of the obesity protein analog so as to incorporate a convenient protease sensitive cleavage site, e.g., between the signal peptide and the structural protein ~acilitatina the controlled excision of the signal peptide ~rom the ~usion protein construct.
The gene encoding the obesity protein analog may also be created by using polymerase chain reaction (PCR).
The template can be a cDNA library (commercially available from CLONETECH or STRATAGENE) or mRNA isolated ~rom the desired arrival adipose tissue. Such methodologies are well known in the art Maniatis, e~ al. Molecular Clonina: A
L~horatorv Manual, Cold Sprina Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989).
The constructed or isolated DNA sequences are use~ul for expressing the obesity protein analog either by direct expression or as fusion protein. When the sequences ~=0 are used in a fusion yene, the resulting product will re~uire en~ymatic or chemical cleavage. A variety of peptidases which cleave a polypeptide at specific sites or digest the peptides ~rom the amino or carboxy termini ~e.g.
diaminopeptidase~ of the peptide chain are known.
Furthermore, particular chemicals (e.g. cyanogen bromide~
will cleave a polypeptide chain at speci~ic sites. The skilled artisan will appreciate the modi~ications necessary to the amino acid sequence (and synthetic or semi-synthetic coding sequence i~ recombinant means are employed~ to incorporate site-specific internal cleavage sites. ~ U.S.
Patent No. 5,126,249; Carter P., Site Speci~ic Proteolysis o~ Fusion Proteins, Ch. 13 in Protein Purification: From ~Qlecular Mechanisms to rarae Scale Processes, American Chemical Soc., Washington, D.C. (l990~.
Construction o~ suitable vectors cont~;n;ng the desired coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA ~ragments are cleaved, -CA 02243~18 1998-07-1~
WO9~J26~11 PCT~S97/00568 tailored, and religated in the form desired to form the plasmids required.
To effect the translation of the desired protein, one inserts the engineered synthetic DNA sequence in any of a b 5 plethora of appropriate recombinant DNA expression vectors through the use of appropriate restriction endonucleases. A
synthetic coding sequence may be designed to possess restriction endonuclease cleavage sites at either end of the transcript to facilitate isolation from and integration into lO these expression and amplification and expression plasmids.
The isolated CDNA coding sequence may be readily modified by the use of synthetic linkers to facilitate the incorporation of this sequence into the desired cloning vectors by techniques well known in the art. The particular 15 endonucleases employed will be dictated by the restriction endonuclease cleavage pattern of the parent expression vector to be employed. The restriction sites are chosen so as to properly orient the coding sequence with control sequences to achieve proper in-frame reading and expression o~ the 20 protein.
In general, plasmid vectors containing promoters and control sequences which are derived ~rom species compatible with the host cell are used with the~e hosts The vector ordinarily carries a replication origin as well as 25 marker sequences which are capable of providing phenotypic selection in transformed cells. For example, E. coli is typically transformed using pBR322, a plasmid derived from an E. coli species ~Bolivar, et al., Gene 2: 95 (1977)).
Plasmid pBR322 contains genes for ampicillin and tetracycline 30 resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid must also contain or be modified to contain promoters and other control elements commonly used in recombinant DNA
technology.
The desired coding sequence is inserted into an expression vector in the proper orientation to be transcribed ~rom a promoter and ribosome binding site, both of which CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568 .

should ~e functional in the host cell in which the protein is to be expressed. An example of such an expression vector is a plasmid described in Belagaje et al., U.S. patent Mo.

5,304,493, the teachings of which are herein incorporated by reference. The gene encoding A-C-B proinsulin described in U.S. patent No. 5,304,493 can be removed from the plasmid - pRB182 with restriction enzymes ~I and ~mHI. The isolated DNA sequences can be inserted into the plasmid backbone on a NdeI/BamHI restriction fragment cassette.
In general, procaryotes are used for cloning of DNA
se~uences in constructing the vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No.
31446) is particularly useful. Other microbial strains which may be used include E. coli B and E. Goli X1776 (ATCC No.
1~ 31537). These examples are illustrative rather than limiting.
Procaryotes also are used for expression. The aforementioned strains, as well as E~ coli W3110 ~prototrophic, ATCC No. 27325), bacilli such as Bacillus subtilis, and other enterobacteriaceae such as S~lmonella t~himurium or Serratia marcescans, and various pseudomonas species may be used. Promoters suitable for use with prokaryotic hosts include the ~-lactamase (vector pGX2907 ~ATCC 39344] contains the replicon and ~-lactamase gene) and lactose promoter systems (Chang et al., Nature, 275:615 25 (1978); and Goeddel et ~1., Matl~re 281:544 (1979)), alkaline phosphatase, the tryptophan (trp) promoter system (vector pATHl rATCC 37695] is designed to facilitate expression of an open reading frame as a trpE fusion protein under control o~
the trp promoter) and hybrid promoters such as the tac 30 promoter (isolatable from plasmid pDR540 ATCC-37282).
However, other ~unctional bacterial promoters, whose nucleotide ~equences are generally known, enable one o~ skill in the art to ligate them to DNA encoding the protein using linkers or adaptors to supply any required restriction sites.
Promoters for use in bacterial systems also will contain a Shine-Dal~arno sequence operably linked to the DNA encoding protein.

CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 .

The DNA molecules may also be recombinantly produced in eukaryotic expression systems. Preferred promoters controlling transcription in m~mm~l ian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. ~-actin promoter. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication. Fiers, e~ al., Nature, 273:113 (1978). The entire SV40 genome may be obtained from plasmid psRsv, ATCC ~5019. The immediate early promoter of the human cytomegalovirus may be obtained from plasmid pCMBb (ATCC
77177). Of course, promoters from the host cell or related species also are useful herein.
Transcription of the D~A by higher eucaryotes is increased by inserting an enhancer sequence into the vector.
Enhancers are cis-acting elements of DNA, usually about 10-300 bp, that act on a promoter to increase its transcription.Enhancers are relatively oriented and positioned independently and have been found 5' (T-~; mi n~, L. et al., 7~:993 (1981)) and 3' (Lusky, M. L., et al., Mol Cell ~Q~ 3:1108 (1983)) to the transcription unit, within an intron (Banerji, J. L. et al., Cell 33:729 (1983)) as well as within the coding sequence itself (Osborne, T. F., et al., Mol. Cell Bio. 4:1293 (1984)). Many enhancer sequences are now known from mammalian genes (globin, RSV, SV40, EMC, elastase, albumin, alpha-fetoprotein and insulin).
Typically, however~ one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 late enhancer, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells from other multicellular organisms) will also contain CA 02243~l8 l998-07-l~
WO9~/26011 PCT~S97/00S68 sequences necessary for the termination o~ transcription which may a~fect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion o~ the mRNA encoding protein. The 3~ untranslated regions also include transcription termination sites.
Expression vectors may contain a selection gene, also termed a selectable marker. Examples o~ suitable selectable markers for mammalian cells are dihydrofolate reductase (DHER, which may be derived from the ~lII/HindIII
restriction ~ragment of pJOD-10 [ATCC 68815]), thymidine kinase (herpes simplex virus thymidine kinase is contained on the ~mHI ~ragment o~ vP-5 clone [ATCC 2028]) or neomycin (G418) resistance genes (obtainable from pNN414 yeast artificial chromosome vector [ATCC 37682~). When such selectable markers are success~ully transferred into a m~mm~l ian host cell, the transfected m~mm~l ian host cell can survive if placed under selective pressure. There are two widely used distinct categories o~ selective regimes. The first category is based on a cell~s metabolism and the use o~
2~ a mutant cell line which lacks the ability to grow without a supplemented media. Two examples are: CHO DHFR- cells ~ATCC
CRL-9~96) and mouse LTK- cells (L-M(TK-) ATCC CCL-2.3).
These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternati~e to supplementing the media ls to introduce an intact DXFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not trans~ormed with the DHFR or TK gene will not be capable of survival in nonsupplemented media.
The second ~ategory is dominant selection which refers to a selecticn scheme used in any cell type and does not require the use o~ a mutant cell line. These schemes typically use a drug to arrest growth o~ a host cell. Those cells which have a novel gene would express a protein CA 02243~l8 l998-07-l~

W0~7126011 PCT~S97/00568 conveying drug resistance and would survive the selection.
Examples of such ~oml n~nt selection use the drugs neomycin, Southern P. and Berg, P., J. Molec. A~l. Genet. 1: 327 ~1982), mycophenolic acid, Mulligan, R. C. and serg, P.
Sci~nce 20~:1422 (1980), or hygromycin, Sugden, B. et al., Mol Cell. Biol. 5:410-413 (1985). The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively.
A preferred vector for eucaryotic expression is pRc/CMV. pRc/CMV is commercially available from Invitrogen Corporation, 3985 Sorrento Valley Blvd., San Diego, CA
92121. To confirm correct se~uences in plasmids constructed, the ligation mixtures are used to transform ~. coli K12 strain DHlOB (ATCC 31446) and successful transformants selected by antibiotic resistance where appropriate.
Plasmids ~rom the transformants are prepared, analyzed by restriction and/or se~uence by the method of Messing, et al., ~l]cleic Acids Res. 9:309 (1981).
Host cells may be transformed with the expression vectors of this invention and cultured in conventional nutrient media modified as is appropriate for inducing promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan. The techni~ues of transforming cells with the aforementioned vectors are well known in the art and may be found in such general references as Maniatis, et al., Molecular Clonin~: A Laboratorv Manual, Cold Spring Harbor ress, Cold Spring Harbor Laboratory, Cold Spring Harbor, ~ew York (lg8g), or Current Protocols in Molecular Bioloov ~1989~ and supplements.
Preferred suitable host cells for expressing the vectors encoding the claimed proteins in higher eucaryotes include: African green monkey kidney line cell line CA 02243~l8 l998-07-l~
WO9i~26011 PCT~S97/00568 transformed by SV40 (COS-7, ~TCC CRL-1651); transformed human primary embryonal kidney cell line 293,(Graham, F. L. et al., J. Gen Virol. 36:59-72 (1977), V~roloov 77:319-329, Viroloov 86:10-21); ba~y hamster kidney cells (BHK-21(C-13), ATCC CCL-10, ViroloqY 16:147 (1962)3; Chinese hamster ovary cells CHO-DHFR- (ATCC CRL-9096), mouse Sertoli cells (TM4, ATCC CRL-1715, Biol. Re~rod. 23:243-250 (1980)); African green monkey kidney cells (VERO 76, ATCC CRL-1587); human cervical epitheloid carcinoma cells (HeLa, ATCC CCL-2); canine kidney cells ~MDCK, ATCC CCL-34); buffalo rat liver cells (BRL 3A, ATCC CRL-1442); human diploid lung cells (WI-38, ATCC CCL-75); human hepatocellular carcinoma cells (Hep G2, ATCC Hs-8065);and mouse m~mm~ry tumor cells (MMT 060562, ATCC CCL51).
In addition to prokaryotes, unicellular eukaryotes such as yeast cultures may also be used. Saccharomvces cerevisiae, or common baker~s yeast is the most commonly used eukaryotic microorganism, although a number of other strains are commonly available. For expression in Saccharomyces, the plasmid YRp7, for example, (ATCC-40053, Stinchcomb, et al., Nature 282:39 (1979); Kingsman ~ al., Gene 7:141 (1979);
Tschemper et ~l-, Gene 10:157 (1980)) is commonly used. This plasmid already contains the trp gene which provides a selection marker for a mutant strain o~ yeast lacking the ahility to grow in tryptophan, for example ATCC no. 44076 or PEP4-1 (Jones, Genetics 85:12 (1977)).
suitable promoting se~uences ~or use with yeast hosts include the promoters for 3-phosphoglycerate kinase (found on plasmid pAP12BD ATCC 53231 and described in U.S.
Patent ~o. 4,935,350, June 19, 19903 or other glycolytic enzymes such as enolase (found on plasmid pACl ATCC 39532), glyceraldehyde-3-phosphate dehydrogenase (derived from plasmid pHcGAPCl ATCC 57090, 57Q91), zymomonas mobilis (United States Patent No. 5,000,000 issued March 19, 1991), hexokinase, pyruvate decarboxylase, phospho~ructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase~ and glucokinase.
-CA 02243~l8 l998-07-l~
WO97/26011 PCT~S97/00568 other yeast promoters, which contain inducible promoters having the additional advantage o~ transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein (contained on plasmid vector pCL28XhoLHsPV
ATCC 39475, United States Patent No. 4,840,896), glyceraldehyde 3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose (GA~l ~ound on plasmid pRY121 ATCC 37658) utilization. Suitable vectors and promoters for use in yeast expression are ~urther described in R. Hitzeman et al., European Patent Publication No.
73,657A. Yeast enhancers such as the UAS Gal from ~accharomvces cerevisiae (found in conjunction with the CYCl promoter on plasmid YEpsec--hIlbeta ATCC 67024), also are advantageously used with yeast promoters.
Pre~aration 1 The plasmid cont~;ning the DNA sequence encoding the desired protein, is digested with PmlI and Bsu36I. The recognition sequences ~or'these enzymes lie within the coding region ~or the protein at nucleotide positions 275 and 360 respectively. The cloning vector does not contain these recognition sequences. Conse~uently, only two ~ragments are seen ~ollowing restriction enzyme digestion with PmlI and ssu36I, one corresponding to the vector ~ragment, the other corresponding to the ~85 base pair ~ragment liberated ~rom within the protein coding sequence. This sequence can be replaced by any DNA sequence encoding the amino acid substitutions between positions 91 and 116 o~ the present invention. These DNA sequences are synthesized chemically as two oligonucleotides with complementary bases and ends that are compatible with the ends generated by digestion with PmlI
and Bsu36I. The chemically synthesized oligonucleotides are mixed in equimolar amounts (1-10 picomoles/microliter), heated to 95 degrees and allow to anneal by slowly decreasing the temperature to 20-25 degrees. The annealed CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/OOS68 oligonucleotides are used in a standard ligation reaction.
Ligation products are transformed and analyzed as described in Example 1. Other substitutions are pre~erably carried out in a similar manner using appropriate restriction cites.

Pre~aration 2 A DNA sequence encoding SEQ ID No:6 with a Met Arg leader sequence was obtained using the plasmid and procedures described in preparation 1. The plasmid was digested with PmlI and Bsu36I. A synthetic DMA fragment of the sequence 5"-SEQ ID NO:14:
(SEQ ID NO:14) GT~CTGGCCTTCTCTAAAAGTTGCCACTTGCCAGCTGCCAGTGGCCTGGAGACATTGGACA
GTCTGGGCGGAGTCCTGGAAGCC

~5 annealed with the sequence 5'-SEQ ID NO:15:

(SEQ ID NO:15) TGAGGCTTCCAGGACTCCCCCCAGACTGTCCAATGTCTCCAGGCCACTG~CAGCTGGCAAG
TGGCAACTTTTAGAGAAGGCCAGCAC
was inserted between the PmlI and the Bsu36I sites.
Following ligation, transformation and plasmid isolation, the sequence of the synthetic fragment was veri~ied by DNA
sequence analysis.
The techniques of trans~orming cells with the a~orementioned vectors are well known in the art and may be found in such general references as Maniatis, et al. (1988) Molecular Clonina: A Laboratorv ~anual, Cold Spring Harbor Press, Cold Spring Harbor Laboratory, Cold Spring Harbor, New 30 York or Current Protocols in Molecular Biolo3v (1989) and supplements. The techniques involved in the transformation of ~. coli cells used in the preLerred practice of the invention as exemplified herein are well known in the art.
The precise conditions under which the transformed E. coli cells are cultured is dependent on the nature o~ the ~ coli CA 02243~l8 l998-07-l~
WO97126011 PCT~S97/00568 host cell line and the expression or cloning vectors employed. For example, vectors which incorporate thermoinducible promoter-operator regions, such as the c1857 thermoinducible lambda-phage promoter-operator region, require a temperature shift ~rom about 30 to about 40 degrees C. in the culture conditions so as to induce protein synthesis.
In the preferred embodiment of the invention E.
coli K12 RV308 cells are employed as host cells but numerous other cell lines are available such as, but not limited to, . coli K12 L201, L687, L693, L507, L640, L641, L695, L814 (E. coli B). The transformed host cells are then plated on appropriate media under the selective pressure of the antibiotic corresponding to the resistance gene present on the expression plasmid. The cultures are then incubated for a time and temperature appropriate to the host cell line employed.
Proteins that are expressed in high-level bacterial expression systems characteristically aggregate in granules ~0 or inclusion bodies which contain high levels o~ the overexpressed protein. Kreuger et al., in Protein Foldina, Gierasch and King, eds., pgs 136-142 (1990), American Association for the Advancement o~ Science Publication No.
89-18S, Washington, D.C. Such protein aggregates must be dissolved to provide further puri~ication and isolation of the desired protein product. Id. A variety o~ techniques using strongly denaturing solutions such as guanidinium-H~l andJor weakly denaturing solutions such as urea are used to solubilize the proteins. Gradual removal of the denaturing agents ~often by dialysis) in a solution allows the denatured protein to assume its native con~ormation. The particular ~ conditions ~or denaturation and ~olding are determined by the particular protein expression system and/or the protein in question.
Pre~aration 3 The protein o~ SEQ ID NO:6 with a Met Arg leader sequence was expressed in E.col; granules were isolated in 8M

CA 022435l8 l998-07-l5 WO57f26011 PCT~S97/00568 .

urea and 5mM cysteine. The protein was purified ~y anion exchange chromatography in 8M urea, and ~olded by dilution into 8M urea (containing 5 mM cysteine) and exhaustive dialysis against PBS. Following final purification of the proteins by size exclusion chromatography the proteins were concentrated to 3-3.5 mg/mL in PBS.
Pre~aration 4 A DMA sequence encoding the protein of SEQ ID NO:2 was assembled from chemically synthesized single stranded oligonucleotides to generate a double stranded DNA sequence.
The oligonucleotides used to assemble this DNA se~uence are as follows:

(SEQ ID NO:16) TATGAGGGTACCTATCCAAAAAGTACAAGATGACACCAAAACACTGATAAAGACAATAGTC
ACAAG

(SEQ ID NO:17) GATAGATGATATCTCACACACACAGTCAGTCTCATCTAAACAGAAAGTCACAGGCTTGGAC
TTCATACCTGG

(SEQ ID NO:18) GCTGCACCCCATACTGACATTGTCTAAAATGGACCAGACACTGGCAGTCTATCAACAGATCTTAAC
AAGTATGCCTT
(SEQ ID NO:l9) CTAGAAGGCATACTTGTTAAGATCTGTTGATAGACTGC

(SEQ ID NO:20) CAGTGTCTGGTCCATTTTAGACAATGTCAGTATGGGGTGCAGCCCAGGTATGAAGTCCAAG
C

(SEQ ID NO:21) CTGTGACTTTCTGTTTAGATGAGACTGACTGTGTGTGTGAGATATCATCTATCCTTGTGAC
TATTGTCTTTATCAGTGTTTTG

CA 02243~l8 l998-07-l~

WOg7/26011 PCT~S97/00568 .

~SEQ ID NO:22) GTGTCATCTTGTA~L~ GGATAGGTACCCTCA

(SEQ ID NO:23) T5 CTAGA~ACGTGATACAAATATCTAACGACCTGGAGAACCTGCGGGATCTGCTGCACGTGCT
GGCCTTCTCTAAAAGTTGCCACTTGCCATGG

(SEQ ID NO:24) GCCAGTGGCCTGGAGACATTGGACAGTCTGGGGGGAGTCCTGGAAGCCTCAGGCTATTCTACA

~SEQ ID NO:25) CCTGAGCAGGCTGCAGGGGTCTCTGCAAGACATGCTGTGGCAGCTGGACCTGAGCCCCGGG
TGCTAATAG
(SEQ ID NO:26) GATCCTATTAGCACCCGGGGCTCAGGTCCAGCTGCCACAGCATGTCTTGCAGAGACC

(SEQ ID NO:27) (SEQ ID No:28) CCCAGACTGTCCAATGTCTCCAGGCCACTGGCCCATGGCAAGTGGCAACTTTTAGAGAAGG

(SEQ ID NO:29) CCAGCACGTGCAGCAGATCCCGCAGGTTCTCCAGGTCGTTAGATATTTGTATCACGTTT

Oligonucleotides 16 - 22 were used to generate an approximately 220 base-pair segment which extends from the NdeI site to the XbaI site at position 220 within the coding sequence. The oligonucleotides 23 - 29 were used to generate - an approximately 240 base-pair segment which extends ~rom the XbaI site to the BamHI site.
To assemble the 220 and 240 base-pair fragments, the respective oligonucleotides were mixed in equimolar amounts/ usually at concentrations of about 1-2 picomoles per microliters. Prior to assembly, all but the oligonucleotides CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568 at the 5" -ends of the segment were phosphorylated in standard kinase buf~er with T4 DNA kinase using the conditions specified by the supplier of the reagents. The mixtures were heated to 95~C and allowed to cool slowly to room temperature over a period of 1-2 hours to ensure proper annealing of the oligonucleotides. The oligonucleotides were then ligated to each other and into a cloning vector, PUCl9 was used~ but others are operable using T4 DNA ligase. The PUCl9 bu~fers and conditions are those recommended by the supplier of the enzyme. The vector ~or the 220 base-pair fragment was digested with NdeI and XbaI, whereas the vector for the 240 base-pair fragment was digested with XbaI and BamHI prior to use. The ligation mixes were used to transform ~. coli DHlQB cells (commercially available ~rom GibcofBRL) and the transformed cells were plated on tryptone-yeast (TY) plates containing 100 ~g/ml of ampicillin, X-gal and IPTG. Colonies which grow up overnight were grown in li~uid TY medium with 100 ~g/ml of ampicillin and were used for plasmid isolation and DNA seguence analysis. Plasmids ~0 with ~he correct sequence were kept for the assembly of the complete gene. This was accomplished by gel-purification of the 22~ base-pair and the 240 base-pair fragments and ligation of these two fragments into PUClg linearized with NdeI and BamHI. The ligation mix was trans~ormed into E.
2~ ~Qli DHlOB cells and plated as described previously. Plasmid DNA was isolated from the resulting transformants and digested with NdeI and BglII. The large vector fragment was gel-puri~ied and ligated with a approximately 195 base-pair segment which was assembled as described previously from six chemically synthesized oligonucleotides as show below.

(SE~ ID MO:30) TAT GCG GGT ACC GAT CCA GAA AGT TCA GGA CGA CAC CAA AAC CCT
GAT CAA AAC CAT CGT TAC

CA 02243~18 1998-07-1~
WO97126011 PCT~S97/OOS68 (SEQ ID NO:31) GCG TAT CAA C~A CAT CTC CCA CAC CCA GTC CGT GAG CTC CAA ACA
GAA GGT TAC CGG TCT GGA CTT CAT CCC GG

(SEQ ID NO:32) GTC TGC ACC CGA TCC TGA CCC TGT CCA AAA TGG ACC AGA CCC TGG
CTG TTT ACC A~C A

(SEQ ID NO:33) l0 ATA CGC ~TA ACG ATG GTT TTG ATC AGG GTT TTG GTG TCG TCC TGA
ACT TTC TGG ATC GGT ACC CGC A

(SEQ ID NO:34) TGC AGA CCC GGG ATG AAG TCC AGA CCG GTA ACC TTC TGT TTG GAG
l5 CTC ACG GAC TGG GTG TGG GAG ATG TCG TTG

(SEQ ID NO:35) GAT CTG CTG GTA AAC AGC CAG GGT CTG GTC CAT TTT GGA CAG GGT
CAG GAT CGG G
20 The ligation was transformed into ~. coli cells as described previously.
The DNA from the resulting transformants was isolated and the sequence was verified by DNA sequence analysis. The plasmid with the correct se~uence was digested 25 with NdeI and Bam~I and the approximately 450 base-pair insert was recloned into an expression vector.
The protein was expressed in E.coli, isolated and was folded either by dilution into PBS or by dilution into 8M
urea ~hoth cont~;ning 5 ~mM cysteine) and ~haustive dialysis 30 against PBS. Following final purification of the proteins by size exclusion chromatography the proteins were co~centrated t to 3-3.5 mgJmL in PBS. Amino acid composition was confirmed.
Pre~aration 5 The protein of SEQ ID NO:6 with a Met Arg leader se~uence was expressed in E.col;, isolated and folded as described previously. The Met Arg leader se~uence was CA 02243~18 1998-07-1~
WO9~/2~011 PCT~S97/00568 cleaved by the addition o~ 6-l0 milliunits dDAP per mg of prctein. The conversion reaction was allowed to proceed for 2-8 hours at room temperature. The progress of the reaction was monitored by high performance reversed phase chromatography. The reaction was terminated by adjusting the pH to 8 with NaOH. The des(Met-Arg) protein was ~urther purified by cation exchange chromatography in 7-8M urea and size exclusion chromatography in PBS. Following ~inal puri~ication o~ the proteins by size exclusion chromatography the proteins were concentrated to 3-3.~ mg/mL in PBS.
Preferably, the DNA sequences are expressed with a dipeptide leader sequence encoding Met-Ar~ or Met-Tyr as described in U.S. Patent No. 5,126,249, herein incorporated by re~erence. This approach ~acilitates the e~icient expression o~ proteins and enables rapid conversion to the active protein form with Cathepsin C or other dipeptidylpeptidases. The purification o~ proteins is by techniques known in the art and includes reverse phase chromatography, af~inity chromatography, and size exclusion.
2~ The ~ollowing examples and preparations are provided merely to ~urther illustrate the preparation of the ~ormulations o~ the invention. The scope of the invention is not construed as merely consistin~ of the ~ollowing examples.
Example l Obesitv Protein Analoq Formulation To generate a solution of a protein o~ SEQ ID No:6 ~hereinafter, Protein No:6) the lyophilized solid material was first dissolved in water to generate a stock solution (stock l~. The concentration o~ Protein NO:6 in stock l was 3~ verified by W/Vis spectrophometry using the known extinction coef~icient ~or Protein NO:6 at the maximum spectral absorbance (279nm or 280nm), measuring the maximum spectral absorbance ~279nm or 280nm), and utilizing the dilution ~actor. A stock preservative solution containing methylparaben, for example, was prepared by dissolving the solid in water (stock 2). A solution o~ Protein NO:6 at l.6 -CA 02243~l8 l998-07-l~
WO97126011 PCT~S97/00568 mg/mL was prepared by addition of an aliquot of stock 1 to a container which held an aliquot of stock 2 along with the required quantity of water, at an alkaline pH (7.8+0.3);
adjusted i~ necessary with HCl or NaOH. After an appropriate incubation period at room temperature ~30 minutes), the solution pH was examined and adjusted if necessary with trace ~L quantities of HCl or NaOH, to yield Protein NO:6 solution at 1.6 mg/mL with 0.17 % methylparaben pH 7.8+0.1. The solution was then hand-filtered using a glass syringe with an attached 0.22~m syringe filter into a glass vial.
Example 2 Obesit~ Protein Analoa Formulation To generate a solution of a protein of SEQ ID NO:6 (hereinafter Protein NO:6), the lyophilized solid material was first dissolved in water to generate a stock solution (stock 1). The concentration of Protein NO:6 in stock 1 was veri~ied by UV/Vis Spectrophometry using the known extinction coefficie~t ~or Protein NO:6 at the maximum spectral absorbance (279nm or 280nm), measuring the maximum spectral absorbance (279nm or 280nm), and utilizing the dilution factor. A stock preservative solution containing chlorobutanol, for example, was prepared by dissolving the solid in water (stock 2). A solution of Protein NO:6 at 1~6 mg/mL was prepared by addition of an aliquot of stock 1 to a container which held an aliquot of stock 2 along with the required quantity of water, at an alkaline pH (7.8+0.3~;
adjusted if necessary with HCl or ~aOH. After an appropriate incubation period at room temperature (30 minutes), the solution pH was examined and adjusted if necessary with trace ~L quantities of HCl or NaOH, to yield an Protein No:6 solution at 1.6 mg~mL with 0.50% chlorobutanol pH 7.8+0.1.
The solution was then hand-filtered using a glass syringe with an attached 0.22~m syringe filter into a glass vial.

CA 02243~l8 l998-07-l~
WO9~/26011 PCT~S97/00S68 Example 3 Obesitv Protein Analoa Formulation To generate a solution of a protein o~ SEQ ID NO:6 (hereinafter Protein Mo:6), the solid bulk material, lyophilized from a neutral water solution, was redissolved in water to generate a stock solution (stock 1) The concentration of Protein NO:6 in stock 1 was verified by W /Vis Spectrophometry by multiplying the maximum spectral absorbance (279nm or 280nm) by the dilution factor divided by the known extinction coefficient for Protein NO:6. A stock preservative solution containing methylparaben was prepared by dissolving the solid in water (stock 2). A stock of an isotonicity agent, such as glycerin, was ~repared by dissolving the neat liquid in water (stock 3). A stock o~ a physiologically-tolerated bu~fer, such as sodium phosphate was prepared by dissolving the solid in water (stock 4). A
solution of Protein NO:6 at 1.6 mg/mL was prepared by addition of an aliquot of stock 1 to a container which held an aliquot o~ stock 2 along with an aliquot of stock 3 along with the required quantity of water, adjusted i~ necessary with HCl or NaOH to an alkaline pH (7.8i0.3). A~ter an appropriate incubation period at room temperature (30 minutes) an aliquot of stock 4 was added. The solution pH
was then readjusted if necessary with trace ~L quantities of HCl or NaOH, to yield Protein No:6 solution,.for example, at 1.6 mg/mL with 0.17~ methylparaben, 16 mg/mL glycerin, and 14mM sodium phosphate at pH 7.8+0.1. The solution was then hand-filtered using a glass syringe with an attached 0.22~m syringe filter into a glass vial.
3~0 Example 4 obesitv Protein Analoa Formulation To generate a solution of Human Obesity Analog Protein (Protein NO:6), the solid bulk material, lyophilized from a neutral water solution, was redissolved in water to 3~ generate a stock solution (stock 1). The concentration of CA 02243~l8 l998-07-l~
WOg7/26011 PCT~S97/00568 ~ 41 -Protein N~:6 in stock 1 was verified by W /Vis Spectrophometry by multiplying the maximum spectral absorbance (279nm or 280nm) by the dilution factor divided by the known extinction coe~ficient for Protein MO:6. A stock preservative solution containing chlorobutanol, for example, was prepared by dissolving the solid in water (stock 2). A
stock of an isotonicity agent, such as glycerin, was prepared by dissolving the neat li~uid in water (stock 3). A stock of a physiologically-tolerated buffer, such as sodium phosphate was prepared by dissolving the solid in water (stock 4). A
solution of Protein No:6 at 1.6 mg/mL was prepared by addition of an aliquot of stock 1 to a container which held an aliquot of stock 2 along with an aliquot of stock 3 along with the required quantity of water, adjusted if necessary with HCl or NaOH to an alkaline pH (7.8~0.3). After an appropriate incubation period at room temperature (30 minutes) an aliquot of stock 4 was added. The solution pH
was then readjusted if necessary with trace ~L quantities of HCl or NaOH, to yield Protein NO:6 solution, for example, at 1.6 mg/mL with 0.5% chlorobutanol, 16 mg/mL glycerin, and 14mM sodium phosphate at pH 7.8+0.1. The solution was then hand-filtered using a glass syringe with an attached 0.22~m syringe filter into a glass vial.

The principles, preferred embodiments and modes of operation of the present invention have been described in the foregoing specification. The invention which is intended to be protected herein, however, is not to be construed as limited to the particular forms disclosed, since they are to be regarded as illustrative rather than restrictive.
Variations and changes may be made by those skilled in the art without departing from the spirit of the invention.

Claims (10)

We claim:

1. A soluble parenteral formulation, comprising an obesity protein analog and a preservative selected from the group consisting of alkylparaben, chlorobutanol, or a mixture thereof.

2. A formulation of Claim 1, wherein the preservative is methylparaben, ethylparaben, propylparaben, or butylparaben.

3. A formulation of Claim 2, wherein the concentration of obesity protein analog is about 1.0 mg/mL to about 10 mg/mL.

4. A formulation of Claim 3, which further comprises an isotonicity agent.

5. A formulation of Claim 4, which further comprises a physiologically acceptable buffer.

6. A formulation of Claim 5, wherein the preservative is methylparaben, and the isotonicity agent is glycerin.

7. A formulation of any one of Claims 1 through 6, wherein the obesity protein analog is the obesity protein analog having the sequence:
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asp Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ilc Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO :2 ), or a pharmaceutically acceptable salt thereof, or wherein the obesity protein analog is the obesity protein analog having the sequence:
Val Pro Ile Gln Lys Val Gln Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gln Ser Val Ser Ser Lys Gln Lys Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp Gln Thr Leu Ala Val Tyr Gln Gln Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gln Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys Ser Cys His Leu Pro Ala Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gln Gly Ser Leu Gln Asp Met Leu Trp Gln Leu Asp Leu Ser Pro Gly Cys (SEQ ID NO: 6), or a pharmaceutically acceptable salt thereof, said obesity protein analog having a disulfide bond between Cys at position 96 and Cys at position 146.

8. A process for preparing a soluble parenteral formulation of any one of Claims 1 through 7, which comprises mixing an obesity protein analog and a preservative selected from the group consisting of alkylparaben, chlorobutanol, or a mixture thereof.

9. A method of treating obesity in a mammal in need thereof, which comprises administering to said mammal a soluble parenteral formulation of any one of Claims 1 through 7.

10. A formulation as claimed in any one of Claims 1 through 7 for use in the treatment of obesity.