EP0977850A1 - Recepteur de type edg-1 - Google Patents

Recepteur de type edg-1

Info

Publication number
EP0977850A1
EP0977850A1 EP98918400A EP98918400A EP0977850A1 EP 0977850 A1 EP0977850 A1 EP 0977850A1 EP 98918400 A EP98918400 A EP 98918400A EP 98918400 A EP98918400 A EP 98918400A EP 0977850 A1 EP0977850 A1 EP 0977850A1
Authority
EP
European Patent Office
Prior art keywords
nedg
sequence
leu
sequences
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98918400A
Other languages
German (de)
English (en)
Inventor
Janice Au-Young
Karl J. Guegler
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Incyte Corp
Original Assignee
Incyte Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Incyte Pharmaceuticals Inc filed Critical Incyte Pharmaceuticals Inc
Publication of EP0977850A1 publication Critical patent/EP0977850A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • This invention relates to nucleic acid and amino acid sequences of a new edg-1 -like receptor and to the use of these sequences in the diagnosis, prevention, and treatment of cancers and disorders associated with cellular growth and differentiation
  • Cellular early response genes are a class of genes whose transcription is activated within minutes of exposure of cells to stimuli. When quiescent cells are stimulated, the early-response genes are rapidly induced. These genes alter target gene expression by coupling short-term signals induced by extracellular stimuli to long-term changes in cellular phenotype. They encode proteins that induce phenotypic alterations by modulating the transcription rates of genes, and have been shown to have critical roles in the control of growth and differentiation (Lau. L. And Nathans. D. (1987) Proc. Natl. Acad. Sci. 84: 1 182-1186).
  • Extracellular stimuli which induce early response genes include growth factors, phorbol esters, okadaic acid, protein synthesis inhibitors, toxins, and abrupt changes in temperature, pH, and oxygen.
  • the stimulus activates cell surface receptors and membrane bound molecules which initiate signaling cascades that induce the transcription of early response genes.
  • These early response genes include the genes for cytokines; fos. myc,jun, the edg-1 receptor, and nuclear receptors, all of which have roles in cellular proliferation and differentiation.
  • the edg-1 receptor is an immediate-early response gene that has been characterized in rats and humans and is induced by stimuli that inmate cellular differentiation.
  • the edg- 1 gene product is a G-protem-coupled receptor classified as an orphan receptor because its' ligand is unknown. It shares features with other seven transmembrane proteins including seven hydrophobic domains which span the plasma membrane and form a bundle of antiparallel ⁇ helices. Stimulation of these receptors by agonists activates the receptor and allows it to interact with an intracellular G-protein complex.
  • the G protein complex activates a variety of second messenger molecules which regulate signaling pathways and modulate cellular responses (Lee. M. J. et al (1996) J. Biol. Chem. 271:11272-11279)
  • the human edg-1 receptor was first isolated by Hla. T. and Maciag. T. (1990. J. Biol.Chem. 265: 9308-9313) when they were screening phorbol 12-my ⁇ state 13-acetate (PMA) treated endothelial cells for induced early gene transcripts involved in cell differentiation. Endothelial cell differentiation is a key factor in the initiation of angiogenesis. This is a process by which new vascular networks are formed from pre-existing capillaries and is necessary for growth, tissue remodeling, and wound repair. Physiologically, it is essential for embryogenesis, tissue and organ development, ovulation, and corpus luteum formation.
  • PMA phorbol 12-my ⁇ state 13-acetate
  • PMA is a tumor promoter which alters the growth of endothelial cells in vitro and stimulates their differentiation into capillary-like tubules.
  • Many of the early endothelial cell genes induced by PMA treatment have a role in cell differentiation and, as such, determine the molecular events involved in the control of cellular growth and differentiation.
  • the present invention features a new edg-1 -like receptor hereinafter designated NEDG and characterized as having similarity to human edg-1.
  • the invention features a substantially purified new edg- 1 like receptor having the amino acid sequence shown in SEQ ID NO: 1.
  • polynucleotide that encode NEDG.
  • polynucleotide is the nucleotide sequence of SEQ ID NO:2.
  • the invention also relates to a polynucleotide sequence comprising the complement of SEQ ID NO:2 or variants thereof.
  • the invention features polynucleotide sequences which hybridize under stringent conditions to SEQ ID NO:2.
  • the invention additionally features nucleic acid sequences encoding fragments, portions or complement of the polynucleotides encoding NEDG, as well as expression vectors and host cells comprising said polynucleotides.
  • the invention also features an antibody to NEDG, and a pharmaceutical composition comprising substantially purified NEDG.
  • the invention features agonists and antagonists of NEDG.
  • the invention also features a method for treating a disorder associated with decreased NEDG by administering NEDG, and a method for treating a disorder associated with increased NEDG by administering an antagonist to NEDG.
  • Figures 1A, IB, 1C, ID, and IE show the amino acid sequence (SEQ ID NO: l) and nucleic acid sequence (SEQ ID NO: 2) of NEDG.
  • the alignment was produced using MacDNASIS PROTM software (Hitachi Software Engineering Co., Ltd., San Bruno, CA).
  • Figures 2A and 2B show the amino acid sequence alignments between NEDG (SEQ ED NO: 1) and human edg-1 (GI 181948, SEQ ED NO:3).
  • the alignment was produced using the multisequence alignment program of DNASTARTM software (DNASTAR Inc, Madison WI).
  • Figures 3A and 3B show the hydrophobicity plots (MacDNASIS PRO software) for NEDG and human edg-1, respectively; the positive X axis reflects amino acid position, and the negative Y axis, hydrophobicity.
  • Nucleic acid sequence refers to an oligonucleotide, nucleotide, or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or complement or antisense strand.
  • amino acid sequence refers to an o gopeptide, peptide, polypeptide, or protein sequence, and fragments or portions thereof, and to naturally occurring or synthetic molecules.
  • amino acid sequence is recited herein to refer to an amino acid sequence of a naturally occurring protein molecule
  • amino acid sequence and like terms, such as “polypeptide” or “protein” are not meant to limit the amino acid sequence to the complete, native ammo acid sequence associated with the recited protein molecule.
  • Peptide nucleic acid refers to a molecule which comprises an o gomer to which an amino acid residue, such as lysine, and an amino group have been added. These small molecules, also designated anti-gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, P.E. et al. (1993) Anticancer Drug Des.
  • NEDG refers to the ammo acid sequences of substantially purified NEDG obtained from any species, particularly mammalian, including bovine, ovine, porcine, mu ⁇ ne, equine, and preferably human, from any source whether natural, synthetic, semi-synthetic, or recombinant.
  • Consensus refers to a nucleic acid sequence which has been resequenced to resolve uncalled bases, or which has been extended using XL-PCRTM (Perkin Elmer, Norwalk. CT) in the 5' and/or the 3' direction and resequenced, or which has been assembled from the overlapping sequences of more than one Incyte clone using the GELVEEWTM Fragment Assembly system (GCG, Madison, WI), or which has been both extended and assembled.
  • XL-PCRTM Perkin Elmer, Norwalk. CT
  • a “variant" of NEDG refers to an amino acid sequence that is altered by one or more am o acids.
  • the variant may have "conservative" changes, wherein a substituted am o acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant may have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations may also include amino acid deletions or insertions, or both.
  • Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological or immunological activity may be found using computer programs well known in the art, for example, DNASTAR software
  • a “deletion”, as used herein, refers to a change in either amino acid or nucleotide sequence in which one or more amino acid or nucleotide residues, respectively, are absent.
  • An “insertion” or “addition”, as used herein, refers to a change in an amino acid or nucleotide sequence resulting in the addition of one or more amino acid or nucleotide residues, respectively, as compared to the naturally occurring molecule.
  • a “substitution”, as used herein, refers to the replacement of one or more amino acids or nucleotides by different amino acids or nucleotides, respectively.
  • biologically active refers to a protein having structural, regulatory, or biochemical functions of a naturally occurring molecule.
  • immunologically active refers to the capability of the natural, recombinant, or synthetic NEDG, or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies.
  • agonist refers to a molecule which, when bound to NEDG, causes a change in NEDG which modulates the activity of NEDG.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecules which bind to NEDG.
  • antagonist refer to a molecule which, when bound to NEDG, blocks or modulates the biological or immunological activity of NEDG.
  • Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecules which bind to NEDG.
  • modulate refers to a change or an alteration in the biological activity of NEDG. Modulation may be an increase or a decrease in protein activity, a change in binding characteristics, or any other change in the biological, functional or immunological properties of NEDG.
  • mimetic refers to a molecule, the structure of which is developed from knowledge of the structure of NEDG or portions thereof and, as such, is able to effect some or all of the actions of NEDG-like molecules.
  • nucleic acid derivative refers to the chemical modification of a nucleic acid encoding NEDG or the encoded NEDG. Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or amino group.
  • a nucleic acid derivative would encode a polypeptide which retains essential biological characteristics of the natural molecule.
  • substantially purified refers to nucleic or amino acid sequences that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which
  • PCR polymerase chain reaction
  • hybridization refers to any process by which a strand of nucleic acid binds with a complementary strand through base pairing.
  • hybridization complex refers to a complex formed between two nucleic acid sequences by virtue of the formation of hydrogen binds between complementary G and C bases and between complementary A and T bases; these hydrogen bonds may be further stabilized by base stacking interactions.
  • the two complementary nucleic acid sequences hydrogen bond in an antiparallel configuration.
  • a hybridization complex may be formed in solution (e.g., C 0 t or Rot analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g., membranes, filters, chips, pins or glass slides to which cells have been fixed for in situ hybridization).
  • complementarity refers to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, for the sequence "A-G-T” binds to the complementary sequence "T-C-A". Complementarity between two single-stranded molecules may be “partial”, in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between the single stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands.
  • a partially complementary sequence is one that at least partially inhibits an identical sequence from hybridizing to a target nucleic acid; it is referred to using the functional term "substantially homologous.”
  • the inhibition of hybridization of the completely complementary sequence to the target sequence may be examined using a hybridization assay (Southern or northern blot, solution hybridization and the like) under conditions of low stringency.
  • a substantially homologous sequence or probe will compete for and inhibit the binding (i.e., the hybridization) of a completely homologous sequence or probe to
  • SUBST1TUTE SHEET (RULE 26) the target sequence under conditions of low stringency This is not to say that conditions of low stringency are such that non-specific binding is permitted; low stringency conditions require that the binding of two sequences to one another be a specific (i.e., selective) interaction.
  • the absence of non-specific binding may be tested by the use of a second target sequence which lacks even a partial degree of complementarity (e g., less than about 30% identity), in the absence of non-specific binding, the probe will not hybridize to the second non-complementary target sequence
  • hybridization solution may be varied to generate conditions of either low or high stringency different from, but equivalent to, the above listed conditions
  • stringent conditions is the “stringency” which occurs within a range from about Tm-5°C (5°C below the melting temperature (Tm) of the probe) to about 20°C to 25°C below Tm
  • Tm melting temperature
  • the stringency of hybridization may be altered in order to identify or detect identical or related polynucleotide sequences.
  • antisense refers to nucleotide sequences which are complementary to a specific DNA or RNA sequence
  • antisense strand is used in reference to a nucleic acid strand that is complementary to the "sense" strand.
  • Antisense or complementary molecules may be produced by any method, including synthesis by gating the gene(s) of interest in a reverse orientation to a viral promoter which permits the synthesis of a complementary strand. Once introduced into a cell, this transcribed strand combines with natural sequences produced by the cell to form duplexes. These duplexes then block either the further transcription or translation.
  • mutant phenotypes may be generated
  • the designation "negative” is sometimes used in reference to the antisense or complement strand, and “positive” is sometimes used in reference to the sense strand.
  • portion refers to fragments of that protein The fragments may range in size from four ammo acid residues to the entire amino acid sequence minus one ammo acid.
  • SUBST1TUTE SHEET (RULE 26) "comprising at least a portion of the amino acid sequence of SEQ ID NO: 1" encompasses the full-length human NEDG and fragments thereof.
  • Transformation describes a process by which exogenous DNA enters and changes a recipient cell. It may occur under natural or artificial conditions using various methods well known in the art. Transformation may rely on any known method for the insertion of foreign nucleic acid sequences into a prokaryotic or eukaryotic host cell. The method is selected based on the host cell being transformed and may include, but is not limited to, viral infection, electroporation, lipofection, and particle bombardment.
  • Such "transformed” cells include stably transformed cells in which the inserted DNA is capable of replication either as an autonomously replicating plasmid or as part of the host chromosome. They also include cells which transiently express the inserted DNA or RNA for limited periods of time.
  • antigenic determinant refers to that portion of a molecule that makes contact with a particular antibody (i.e., an epitope).
  • a protein or fragment of a protein is used to immunize a host animal, numerous regions of the protein may induce the production of antibodies which bind specifically to a given region or three-dimensional structure on the protein; these regions or structures are referred to as antigenic determinants.
  • An antigenic determinant may compete with the intact antigen (i.e., the immunogen used to elicit the immune response) for binding to an antibody.
  • telomere binding in reference to the interaction of an antibody and a protein or peptide, mean that the interaction is dependent upon the presence of a particular structure (i.e., the antigenic determinant or epitope) on the protein; in other words, the antibody is recognizing and binding to a specific protein structure rather than to proteins in general. For example, if an antibody is specific for epitope "A”, the presence of a protein containing epitope A (or free, unlabeled A) in a reaction containing labeled "A” and the antibody will reduce the amount of labeled A bound to the antibody.
  • a biological sample suspected of containing nucleic acid encoding NEDG or fragments thereof may comprise a cell, chromosomes isolated from a cell (e.g., a spread of metaphase chromosomes), genomic DNA (in solution or bound to a solid support such as for Southern analysis), RNA (in solution or bound to a solid support such as for northern analysis), cDNA (in solution or bound to a solid support), an extract from cells or a tissue, and the like.
  • "Alterations" in the polynucleotide of SEQ ED NO:2, as used herein, comprise any alteration in the sequence of polynucleotides encoding NEDG including deletions, insertions, and point mutations that may be detected using hybridization assays.
  • alterations to the genomic DNA sequence which encodes NEDG e.g., by alterations in the pattern of restriction fragment length polymorphisms capable of hybridizing to SEQ ED NO:2
  • the inability of a selected fragment of SEQ ED NO:2 to hybridize to a sample of genomic DNA e.g., using allele-specific oligonucleotide probes
  • improper or unexpected hybridization such as hybridization to a locus other than the normal chromosomal locus for the polynucleotide sequence encoding NEDG (e.g., using fluorescent in situ hybridization [FISH] to metaphase chromosomes spreads).
  • FISH fluorescent in situ hybridization
  • the term "antibody” refers to intact molecules as well as fragments thereof, such as Fa, F(ab') 2 , and Fv, which are capable of binding the epitopic determinant.
  • Antibodies that bind NEDG polypeptides can be prepared using intact polypeptides or fragments containing small peptides of interest as the immunizing antigen.
  • the polypeptide or peptide used to immunize an animal can be derived from the transition of RNA or synthesized chemically, and can be conjugated to a carrier protein, if desired. Commonly used carriers that are chemically coupled to peptides include bovine serum albumin and thyroglobulin. The coupled peptide is then used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
  • humanized antibody refers to antibody molecules in which amino acids have been replaced in the non-antigen binding regions in order to more closely resemble a human antibody, while still retaining the original binding ability.
  • the invention is based on the discovery of a new edg-1 like protein, (NEDG), the polynucleotides encoding NEDG, and the use of these compositions for the diagnosis, prevention, or treatment of disorders associated with expression of NEDG, including cancer.
  • NEDG edg-1 like protein
  • Nucleic acids encoding the human NEDG of the present invention were first identified in Incyte Clone 144690 from the tumor cDNA library TLYMNOROl through a computer search for amino acid sequence alignments.
  • the complete nucleotide sequence, SEQ ID NO:2 was derived from extension of Incyte clone 144690 (TLYMNOROl).
  • the invention encompasses a polypeptide comprising the amino acid sequence of SEQ ID NO. l, as shown in Figures 1A, IB, 1C, ID and IE.
  • NEDG is 509 ammo acids in length and has chemical and structural homology with human edg-1 (SEQ ED NO 3).
  • NEDG shares 34% identity with human edg- 1
  • NEDG and human edg-1 contain an Asn glycosylation site at N 10 and have conserved cysteines at positions 58, 169, 186, 193, and 208
  • NEDG and human edg-1 have rather similar hydrophobicity plots Northern analysis shows the expression of this sequence in various libraries, a majority of which are associated with proliferating tissues, including cancers
  • the invention also encompasses NEDG variants
  • a preferred NEDG variant is one having at least 80%, and more preferably 90%, ammo acid sequence identity to the NEDG ammo acid sequence (SEQ ED NO 1)
  • a most preferred NEDG variant is one having at least 95% amino acid sequence identity to SEQ ED NO 1
  • the invention also encompasses polynucleotides which encode NEDG. Accordingly, any nucleic acid sequence which encodes the ammo acid sequence of NEDG can be used to generate recombinant molecules which express NEDG. In a particular embodiment, the invention encompasses the polynucleotide comprising the nucleic acid sequence of SEQ ED NO.2 as shown in Figures 1A, IB, 1C, ID and IE.
  • nucleotide sequences encoding NEDG may be produced.
  • the invention contemplates each and every possible variation of nucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleotide sequence of naturally occurring NEDG, and all such variations are to be considered as being specifically disclosed.
  • nucleotide sequences which encode NEDG and its variants are preferably capable of hybridizing to the nucleotide sequence of the naturally occurring NEDG under appropriately selected conditions of stringency, it may be advantageous to produce nucleotide sequences encoding NEDG or its derivatives possessing a substantially different codon usage Codons may be selected to increase the rate at which expression of the peptide occurs in a particular prokaryotic or eukaryotic host in accordance with the frequency with which particular
  • SUBST1TUTE SHEET (RULE 26) codons are utilized by the host.
  • Other reasons for substantially altering the nucleotide sequence encoding NEDG and its derivatives without altering the encoded amino acid sequences include the production of RNA transcripts having more desirable properties, such as a greater half-life, than transcripts produced from the naturally occurring sequence.
  • the invention also encompasses production of DNA sequences, or portions thereof, which encode NEDG and its derivatives, entirely by synthetic chemistry. After production, the synthetic sequence may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art at the time of the filing of this application Moreover, synthetic chemistry may be used to introduce mutations into a sequence encoding NEDG or any portion thereof
  • polynucleotide sequences that are capable of hybridizing to the claimed nucleotide sequences, and in particular, those shown in SEQ ED NO 2, under various conditions of stringency.
  • Hybridization conditions are based on the melting temperature (Tm) of the nucleic acid binding complex or probe, as taught in Wahl, G.M. and S.L. Berger (1987, Methods Enzymol. 152:399-407) and Kimmel, A.R. (1987; Methods Enzymol 152:507-511), and may be used at a defined stringency.
  • Altered nucleic acid sequences encoding NEDG which are encompassed by the invention include deletions, insertions, or substitutions of different nucleotides resulting in a polynucleotide that encodes the same or a functionally equivalent NEDG.
  • the encoded protein may also contain deletions, insertions, or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent NEDG. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophi city, and/or the amphipathic nature of the residues as long as the biological activity of NEDG is retained.
  • negatively charged ammo acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysme and arginine: and ammo acids with uncharged polar head groups having similar hydrophihcity values may include leucine, isoleucine, and vahne, glycine and alanine: asparagine and glutamine; se ⁇ ne and threonine; phenylalanine and tyrosine
  • alleles of the genes encoding NEDG are also included within the scope of the present invention.
  • an "allele” or “allehc sequence” is an alternative form of the gene which may result from at least one mutation in the nucleic acid sequence. Alleles may result in altered mRNAs or polypeptides whose structure or function may or may not be altered. Any given gene may have none, one, or many allehc forms. Common mutational changes which give rise to
  • SUBST1TUTE SHEET (RULE 26) alleles are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.
  • Methods for DNA sequencing which are well known and generally available in the art may be used to practice any embodiments of the invention.
  • the methods may employ such enzymes as the Klenow fragment of DNA polymerase I, Sequenase® (US Biochemical Corp, Cleveland, OH), Taq polymerase (Perkin Elmer), thermostable T7 polymerase (Amersham, Chicago, EL), or combinations of recombinant polymerases and proofreading exonucleases such as the ELONGASE Amplification System marketed by Gibco BRL (Gaithersburg, MD).
  • the process is automated with machines such as the Hamilton Micro Lab 2200
  • the nucleic acid sequences encoding NEDG may be extended utilizing a partial nucleotide sequence and employing various methods known in the art to detect upstream sequences such as promoters and regulatory elements.
  • one method which may be employed, "restriction-site" PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, G. (1993) PCR Methods Applic. 2:318-322).
  • genomic DNA is first amplified in the presence of primer to linker sequence and a primer specific to the known region.
  • the amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one.
  • Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
  • Inverse PCR may also be used to amplify or extend sequences using divergent primers based on a known region (Triglia, T. et al. (1988) Nucleic Acids Res. 16:8186).
  • the primers may be designed using OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Madison, MN), or another appropriate program, to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68°-72° C.
  • the method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
  • Another method which may be used is capture PCR which involves PCR amplification of
  • DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom, M. et al. (1991) PCR Methods Applic. 1: 1 11-119).
  • multiple restriction enzyme digestions and ligations may also be used to place an engineered double-stranded sequence into an unknown portion of the DNA molecule before performing PCR.
  • libraries that have been size-selected to include larger cDNAs.
  • random-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA.
  • Genomic libraries may be useful for extension of sequence into the 5' and 3' non-transcribed regulatory regions.
  • Capillary electrophoresis systems which are commercially available may be used to analyze the size or confirm the nucleotide sequence of sequencing or PCR products.
  • capillary sequencing may employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled devise camera.
  • Output/light intensity may be converted to electrical signal using appropriate software (e.g. GenotyperTM and Sequence NavigatorTM. Perkin Elmer) and the entire process from loading of samples to computer analysis and electronic data display may be computer controlled.
  • Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.
  • polynucleotide sequences or fragments thereof which encode NEDG, or fusion proteins or functional equivalents thereof may be used in recombinant DNA molecules to direct expression of NEDG in appropriate host cells. Due to the inherent degeneracy of the genetic code, other DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence may be produced and these sequences may be used to clone and express NEDG. As will be understood by those of skill in the art, it may be advantageous to produce
  • NEDG-encoding nucleotide sequences possessing non-naturally occurring codons For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • nucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter NEDG encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product.
  • DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides may be used to engineer the nucleotide sequences.
  • site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, or introduce mutations, and so forth.
  • natural, modified, or recombinant nucleic acid sequences encoding NEDG may be ligated to a heterologous sequence to encode a fusion protein.
  • a heterologous sequence to encode a fusion protein.
  • a fusion protein may also be engineered to contain a cleavage site located between the NEDG encoding sequence and the heterologous protein sequence, so that NEDG may be cleaved and purified away from the heterologous moiety.
  • sequences encoding NEDG may be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers, M.H. et al. (1980) Nucl. Acids Res. Symp. Ser. 215-223, Horn, T. et al. (1980) Nucl. Acids Res. Symp. Ser. 225-232).
  • the protein itself may be produced using chemical methods to synthesize the amino acid sequence of NEDG, or a portion thereof.
  • peptide synthesis can be performed using various solid-phase techniques (Roberge, J.Y. et al. (1995) Science 269:202-204) and automated synthesis may be achieved, for example, using the ABI 431 A Peptide Synthesizer (Perkin Elmer).
  • the newly synthesized peptide may be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, T. (1983) Proteins. Structures and Molecular Principles. WH Freeman and Co., New York, NY).
  • the composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra).
  • the amino acid sequence of NEDG, or any part thereof may be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide.
  • nucleotide sequences encoding NEDG or functional equivalents may be inserted into appropriate expression vector, i.e.. a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • appropriate expression vector i.e.. a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art may be used to construct expression vectors containing sequences encoding NEDG and appropriate transc ⁇ ptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in Sambrook, J. et al. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Press, Plainview, NY, and Ausubel, F.M. et al. ( 1989) Current Protocols in Molecular Biology. John Wiley & Sons, New York, NY.
  • a variety of expression vector/host systems may be utilized to contain and express sequences encoding NEDG. These include, but are not limited to. microorganisms such as bacteria transformed with recombinant bacte ⁇ ophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus. CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacte ⁇ ophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus. CaMV; tobacco
  • control elements are those non-translated regions of the vector— enhancers, promoters, 5' and 3' untranslated regions— which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the Bluesc ⁇ pt® phagemid (Stratagene, LaJolla, CA) or pSportlTM plasmid (Gibco BRL) and the like may be used.
  • inducible promoters such as the hybrid lacZ promoter of the Bluesc ⁇ pt® phagemid (Stratagene, LaJolla, CA) or pSportlTM plasmid (Gibco BRL) and the like may be used.
  • the baculovirus polyhed ⁇ n promoter may be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e g., viral promoters or leader sequences) may be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding NEDG, vectors based on SV40 or EBV may be used with an appropriate selectable marker.
  • SUBST1TUTE SHEET (RULE 26)
  • a number of expression vectors may be selected depending upon the use intended for NEDG.
  • vectors which direct high level expression of fusion proteins that are readily purified may be used.
  • Such vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as Bluescript® (Stratagene), in which the sequence encoding NEDG may be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ⁇ -galactosidase so that a hybrid protein is produced; pIN vectors (Van Heeke, G. and S.M.
  • pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • Proteins made in such systems may be designed to include heparin. thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
  • Saccharomvces cerevisiae a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH may be used.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH.
  • the expression of sequences encoding NEDG may be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV may be used alone or in combination with the omega leader sequence from TMV (Takamatsu, N. (1987) EMBO J. 3:17-31 1).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters may be used (Coruzzi, G. et al. (1984) EMBO J. 3: 1671-1680; Broglie, R. et al. (1984) Science 224:838-843; and Winter, J. et al. ( 1991) Results Probl. Cell Differ.
  • constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection.
  • pathogen-mediated transfection Such techniques are described in a number of generally available reviews (see, for example, Hobbs, S. or Murry, L.E. in McGraw Hill Yearbook of Science and Technology ( 1992) McGraw Hill, New York, NY; pp. 191-196.
  • An insect system may also be used to express NEDG.
  • AutQgrapha califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
  • the sequences encoding NEDG may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed
  • SUBST1TUTE SHEET (RULE 26) under control of the polyhed ⁇ n promoter. Successful insertion of NEDG will render the polyhed ⁇ n gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses may then be used to infect, for example, S_ frugiperda cells or T ⁇ choplusia larvae in which NEDG may be expressed (Engelhard, E.K. et al. (1994) Proc. Nat. Acad. Sci. 91.3224-3227).
  • a number of viral-based expression systems may be utilized.
  • sequences encoding NEDG may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing NEDG in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81 :3655-3659).
  • transcription enhancers such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.
  • RSV Rous sarcoma virus
  • Specific initiation signals may also be used to achieve more efficient translation of sequences encoding NEDG. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding NEDG, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transc ⁇ ptional or translational control signals may be needed. However, in cases where only coding sequence, or a portion thereof, is inserted, exogenous translational control signals including the ATG initiation codon should be provided.
  • initiation codon should be in the correct reading frame to ensure translation of the entire insert
  • Exogenous translational elements and initiation codons may be of various origins, both natural and synthetic
  • the efficiency of expression may be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used, such as those described in the literature (Scharf, D. et al ( 1994) Results Probl Cell Differ. 20: 125-162).
  • a host cell strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion.
  • modifications of the polypeptide include, but are not limited to. acetylation, carboxylation. glycosylation, phosphorylation, hpidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the protein may also be used to facilitate correct insertion, folding and/or function.
  • Different host cells such as CHO, HeLa, MDCK, HEK293, and WI38. which have specific cellular machinery and characteristic mechanisms for such post-translational
  • SUBST1TUTE SHEET (RULE 26) activities may be chosen to ensure the correct modification and processing of the foreign protein.
  • cell lines which stably express NEDG may be transformed using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media.
  • the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced sequences.
  • Resistant clones of stably transformed cells may be proliferated using tissue culture techniques appropriate to the cell type.
  • any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler, M. et al. (1977) Cell 11:223-32) and adenine phosphoribosyltransferase (Lowy, I. et al. (1980) Cell 22:817-23) genes which can be employed in tk " or aprt " cells, respectively. Also, antimetabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dhfr which confers resistance to methotrexate (Wigler, M. et al. (1980) Proc. Natl. Acad. Sci.
  • npt which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin, F. et al (1981) J. Mol. Biol. 150: 1-14) and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, supra). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman, S.C. and R.C. Mulligan (1988) Proc. Natl. Acad. Sci.
  • marker gene expression suggests that the gene of interest is also present, its presence and expression may need to be confirmed.
  • sequence encoding NEDG is inserted within a marker gene sequence
  • recombinant cells containing sequences encoding NEDG can be identified by the absence of marker gene function.
  • a marker gene can be placed in tandem with a sequence encoding NEDG under the control of a single promoter. Expression of the marker gene in response to induction or selection
  • SUBST1TUTE SHEET (RULE 26) usually indicates expression of the tandem gene as well
  • host cells which contain the nucleic acid sequence encoding NEDG and express NEDG may be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip based technologies for the detection and/or quantification of nucleic acid or protein.
  • polynucleotide sequences encoding NEDG can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or portions or fragments of polynucleotides encoding NEDG.
  • Nucleic acid amplification based assays involve the use of ohgonucleotides or ohgomers based on the sequences encoding NEDG to detect transformants containing DNA or RNA encoding NEDG.
  • ohgonucleotides or “ohgomers” refer to a nucleic acid sequence of at least about 10 nucleotides and as many as about 60 nucleotides, preferably about 15 to 30 nucleotides.
  • Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding NEDG include ohgolabehng, nick translation, end-labeling or PCR amplification using a labeled nucleotide.
  • sequences encoding NEDG, or any portions thereof may be cloned into a vector for the production of an mRNA probe
  • a vector for the production of an mRNA probe Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of an appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides These procedures may be conducted using a variety of commercially available kits (Pharmacia & Upjohn, (Kalamazoo, MI); Promega (Madison WI); and U.S. Biochemical Corp., Cleveland, OH).
  • reporter molecules or labels include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
  • Host cells transformed with nucleotide sequences encoding NEDG may be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the protein produced by a recombinant cell may be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode NEDG may be designed to contain signal sequences which direct secretion of NEDG through a prokaryotic or eukaryotic cell membrane.
  • Other recombinant constructions may be used to join sequences encoding NEDG to nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins.
  • Such purification facilitating domains include, but are not limited to. metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp,, Seattle, WA).
  • metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals
  • protein A domains that allow purification on immobilized immunoglobulin
  • the domain utilized in the FLAGS extension/affinity purification system Immunex Corp, Seattle, WA.
  • cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San Diego, CA) between the purification domain and NEDG may be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing NEDG and a nucleic acid encoding 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site.
  • the histidine residues facilitate purification on IMIAC (immobilized metal ion affinity chromatography as described in Porath. J. et al. (1992, Prot. Exp. Purif. 3:263-281) while the enterokinase cleavage site provides a means for purifying NEDG from the fusion protein.
  • IMIAC immobilized metal ion affinity chromatography as described in Porath. J. et al. (1992, Prot. Exp. Purif. 3:263-281
  • the enterokinase cleavage site provides a means for purifying NEDG from the fusion protein.
  • fragments of NEDG may be produced by direct peptide synthesis using solid-phase techniques Merrifield J. (1963) J. Am. Chem. Soc. 85:2149-2154). Protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Various fragments of NEDG may be chemically synthesized separately and combined using chemical methods to produce the full length molecule.
  • NEDG functions as an early response gene and has the structural characteristics of a G protein-coupled receptor NEDG may enable cells to respond to external stimuli, modify growth, and initiate differentiation
  • Northern analysis indicates that NEDG is associated with proliferating tissues, including cancers, and may play a role in modulating cell growth and differentiation.
  • NEDG or a fragment or derivative thereof may be added to cells to stimulate cell proliferation.
  • NEDG may be added to a cell or cells in vivo using delivery mechanisms such as hposomes, viral based vectors, or electroinjection for the pu ⁇ ose of promoting regeneration or differentiation of the cell or cells.
  • NEDG may be added to a cell, cell line, tissue or organ culture in vitro or ex vivo to stimulate cell proliferation for use in autologous or heterologous transplantation
  • the cell will have been selected for its ability to fight an infection or a cancer or to correct a genetic defect in a disease such as sickle cell anemia, ⁇ thalassemia.
  • NEDG or a fragment or derivative thereof may be administered to a subject to treat or prevent a disorder of abnormal cell growth and differentiation These disorders include, but are not limited to, Alzheimer's disease, aberrant co ⁇ us luteum formation, osteoarth ⁇ tis, osteoporosis, anovulation. Parkinson's disease and rheumatoid arthritis
  • NEDG or a fragment or derivative thereof may be administered to a subject to treat a disorder which results in damage to cells, such as myocardial infarction, arteriosclerosis, peripheral vascular disease, stroke, and various types of ischemia
  • a vector capable ol expressing NEDG, or a fragment or a derivative thereof may also be administered to a subject to treat or prevent the disorders of abnormal cell growth and differentiation listed above
  • agonists of NEDG may be administered to a subject to treat or prevent the disorders of abnormal cell growth and differentiation listed above
  • antagonists or inhibitors of NEDG may be administered to a subject to treat or prevent a disorder of excessive cell proliferation
  • a disorder of excessive cell proliferation includes that which occurs in cancer.
  • types of cancer include, but are not limited to, adenocarcmoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma and particularly cancers of the adrenal gland, bladder, bone, brain, breast, cervix, esophagus, gastrointestinal tract, heart, kidney, liver, lung, ovaries, pancreas, parathyroid,
  • SUBST1TUTE SHEET (RULE 26) pituitary gland, prostate, salivary gland, spleen, stomach, thymus, thyroid, testes, and uterus.
  • Other disorders include, but are not limited to, adult respiratory distress syndrome, allergies, ankylosing spondylitis, asthma, atherosclerosis, arteriosclerosis, bronchitis, dermatomyositis, diabetic retinopathy, hypereosinophilia, neurofibromatosis, polymyositis, and rheumatoid arthritis.
  • a vector expressing the complement or antisense of the polynucleotide encoding NEDG may be administered to a subject to treat or prevent the disorders listed above.
  • antibodies which are specific for NEDG may be used directly as an antagonist, or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissue which express NEDG.
  • any of the therapeutic proteins, antagonists, antibodies, agonists, antisense or complement sequences or vectors described above may be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy may be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents may act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • Antagonists or inhibitors of NEDG may be produced using methods which are generally known in the art.
  • purified NEDG may be used to produce antibodies or to screen libraries of pharmaceutical agents to identify those which specifically bind NEDG.
  • Antibodies to NEDG may be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies, (i.e., those which inhibit dimer formation) are especially preferred for therapeutic use.
  • various hosts including goats, rabbits, rats, mice, humans, and others, may be immunized by injection with NEDG or any fragment or oligopeptide thereof which has immunogenic properties. Depending on the host species, various adjuvants may be used to increase immunological response.
  • adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides. oil emulsions, keyhole limpet hemocyanin, and dinitrophenol.
  • BCG Bacilli Calmette-Guerin
  • Corynebacte ⁇ um parvum are especially preferable.
  • the peptides, fragments, or ohgopeptides used to induce antibodies to NEDG have an amino acid sequence consisting of at least five amino acids, and more preferably at least 10 amino acids. It is also preferable that they are identical to a portion of the amino acid sequence of the natural protein, and they may contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of NEDG amino acids may be fused with those of another protein such as keyhole limpet hemocyamn and antibody produced against the chimeric molecule.
  • Monoclonal antibodies to NEDG may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to. the hyb ⁇ doma technique, the human B-cell hyb ⁇ doma technique, and the EBV-hyb ⁇ doma technique (Kohler, G. et al. (1975) Nature 256:495-497; Kozbor. D. et al. (1985) J. Immunol. Methods 81:31-42; Cote. R.J. et al. (1983) Proc. Natl. Acad. Sci. 80:2026-2030; Cole, S.P. et al. (1984) Mol. Cell Biol. 62: 109-120).
  • chimeric antibodies the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity can be used (Morrison. S.L. et al. (1984) Proc. Natl. Acad. Sci. 81:6851-6855; Neuberger, M.S. et al. (1984) Nature 312:604-608; Takeda, S. et al. (1985) Nature 314:452-454).
  • techniques described for the production of single chain antibodies may be adapted, using methods known in the art, to produce NEDG-specific single chain antibodies.
  • Antibodies with related specificity, but of distinct ldiotypic composition may be generated by chain shuffling from random combinatorial lmmunoglobin libraries (Burton D.R. (1991) Proc. Natl. Acad. Sci. 88:11120-3).
  • Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening recombinant immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc. Natl. Acad. Sci. 86. 3833-3837; Winter, G. et al. (1991) Nature 349:293-299).
  • Antibody fragments which contain specific binding sites for NEDG may also be generated.
  • such fragments include, but are not limited to, the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
  • Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal
  • immunoassays may be used for screening to identify antibodies having the desired specificity.
  • Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art.
  • Such immunoassays typically involve the measurement of complex formation between NEDG and its specific antibody.
  • a two-site, monoclonal-based immunoassay utilizing monoclonal antibodies reactive to two non-interfering NEDG epitopes is preferred, but a competitive binding assay may also be employed (Maddox, supra).
  • the polynucleotides encoding NEDG, or any fragment thereof, or antisense or complement molecules may be used for therapeutic pu ⁇ oses.
  • antisense or complement to the polynucleotide encoding NEDG may be used in situations in which it would be desirable to block the transcription of the mRNA.
  • cells may be transformed with sequences complementary to polynucleotides encoding NEDG.
  • antisense or complement molecules may be used to modulate NEDG activity, or to achieve regulation of gene function.
  • sense or antisense or complement ohgomers or larger fragments can be designed from various locations along the coding or control regions of sequences encoding NEDG.
  • Expression vectors derived from retro viruses, adenovirus, he ⁇ es or vaccinia viruses, or from various bacterial plasmids may be used for delivery of nucleotide sequences to the targeted organ, tissue or cell population. Methods which are well known to those skilled in the art can be used to construct recombinant vectors which will express antisense molecules complementary to the polynucleotides of the gene encoding NEDG. These techniques are described both in Sambrook et al. (supra) and in Ausubel et al. (supra).
  • Genes encoding NEDG can be turned off by transforming a cell or tissue with expression vectors which express high levels of a polynucleotide or fragment thereof which encodes NEDG. Such constructs may be used to introduce untranslatable sense or antisense sequences into a cell. Even in the absence of integration into the DNA, such vectors may continue to transcribe RNA molecules until they are disabled by endogenous nuc leases. Transient expression may last for a month or more with a non-replicating vector and even longer if appropriate replication elements are part of the vector system.
  • modifications of gene expression can be obtained by designing antisense molecules, DNA, RNA, or PN A, to the control regions of the gene encoding NEDG, l e., the promoters, enhancers, and trons.
  • Ohgonucleotides derived from the transcription initiation site e.g., between positions -10 and +10 from the start site, are preferred.
  • inhibition can be achieved using "triple helix" base-pairing methodology
  • Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules. Recent therapeutic advances using triplex DNA have been described in the literature (Gee, J.E. et al. (1994) In Huber.
  • the antisense molecules may also be designed to block translation of mRNA by preventing the transcript from binding to ⁇ bosomes.
  • Ribozymes enzymatic RNA molecules, may also be used to catalyze the specific cleavage of RNA.
  • the mechanism of ⁇ bozyme action involves sequence-specific hybridization of the ⁇ bozyme molecule to complementary target RNA.
  • endonucleolytic cleavage examples include engineered hammerhead motif ⁇ bozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding NEDG
  • engineered hammerhead motif ⁇ bozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of sequences encoding NEDG
  • Specific nbozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ⁇ bozyme cleavage sites which include the following sequences GUA, GUU, and GUC.
  • RNA sequences of between 15 and 20 ⁇ bonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the oligonucleotide inoperable
  • the suitability of candidate targets may also be evaluated by testing accessibility to hybridization with complementary ohgonucleotides using ⁇ bonuclease protection assays
  • Antisense molecules and ribozymes of the invention may be prepared by any method known in the art for the synthesis of nucleic acid molecules. These include techniques for chemically synthesizing ohgonucleotides such as solid phase phosphoramidite chemical synthesis. Alternatively, RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding NEDG. Such DNA sequences may be inco ⁇ orated into a wide variety of vectors with suitable RNA polymerase promoters such as T7 or SP6. Alternatively, these cDNA constructs that synthesize antisense RNA constitutively or inducibly can be introduced into cell lines, cells, or tissues.
  • RNA molecules may be modified to increase intracellular stability and half-life Possible modifications include, but are not limited to, the addition of flanking sequences at the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule.
  • vectors may be introduced into stem cells taken from the patient and clonally propagated for autologous transplant back into that same patient. Delivery by transfection and by hposome injections may be achieved using methods which are well known in the art.
  • any of the therapeutic methods described above may be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans
  • compositions may consist of NEDG, antibodies to NEDG, mimetics, agonists, antagonists, or inhibitors of NEDG.
  • the compositions may be administered alone or in combination with at least one other agent, such as stabilizing compound, which may be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the compositions may be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions utilized in this invention may be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, lntra-arte ⁇ al, intramedullary, intrathecal, lntravent ⁇ cular, transdermal, subcutaneous, intraperitoneal, mtranasal, enteral, topical, subhngual, or rectal means
  • these pharmaceutical compositions may contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Further details on techniques for formulation and administration may be found in the latest edition of Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, PA).
  • compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for mgestion by the patient
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores
  • suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol. or sorbitol, starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arable and tragacanth: and proteins such as gelatin and collagen.
  • disintegrating or solubihzing agents may be added, such as the cross-linked polyvmyl pyrrohdone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores may be used in conjunction with suitable coatings, such as concentrated sugar solutions, which may also contain gum arable, talc, polyvinyipyrrohdone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e . dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks s solution. Ringer s solution, or physiologically buffered saline.
  • Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds may be prepared as appropriate oily injection suspensions.
  • Suitable hpophihc solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or
  • SUBST1TUTE SHEET (RULE 26) triglycerides, or liposomes.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art.
  • compositions of the present invention may be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition may be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • the preferred preparation may be a lyophilized powder which may contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
  • compositions suitable for use in the invention include compositions wherein the active ingredients are contained in an effective amount to achieve the intended pu ⁇ ose.
  • the determination of an effective dose is well within the capability of those skilled in the art.
  • the therapeutically effective dose can be estimated initially either in cell culture assays, e.g., of neoplastic cells, or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model may also be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • a therapeutically effective dose refers to that amount of active ingredient, for example NEDG or fragments thereof, antibodies of NEDG, agonists, antagonists or inhibitors of NEDG, which ameliorates the symptoms or condition.
  • Therapeutic efficacy and toxicity may be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., ED50 (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index, and it can be expressed as the ratio.
  • LD50/ED50 Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Factors which may be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug comb ⁇ nat ⁇ on(s), reaction sensitivities, and tolerance/response to therapy
  • Long-acting pharmaceutical compositions may be administered every 3 to 4 days, every week, or once every two weeks depending on half-life and clearance rate of the particular formulation. Normal dosage amounts may vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • antibodies which specifically bind NEDG may be used for the diagnosis of conditions or diseases characterized by expression of NEDG, or in assays to monitor patients being treated with NEDG, agonists, antagonists or inhibitors.
  • the antibodies useful for diagnostic pu ⁇ oses may be prepared m the same manner as those described above for therapeutics.
  • Diagnostic assays for NEDG include methods which utilize the antibody and a label to detect NEDG in human body fluids or extracts of cells or tissues.
  • the antibodies may be used with or without modification, and may be labeled by joining them, either covalently or non- covalently, with a reporter molecule.
  • a wide variety of reporter molecules which are known in the art may be used, several of which are described above.
  • ELIS A, RIA, and FACS for measuring NEDG are known in the art and provide a basis for diagnosing altered or abnormal levels of NEDG expression
  • Normal or standard values for NEDG expression are established by combining body fluids or cell extracts taken from normal mammalian subjects, preferably human, with antibody to NEDG under conditions suitable for complex formation The amount of standard complex formation may be quantified by various methods, but preferably by photometric, means. Quantities of NEDG expressed in subject, control and disease, samples from biopsied tissues are compared with the standard values. Deviation between standard and subject values establishes the parameters for diagnosing disease.
  • the polynucleotides encoding NEDG may be used for diagnostic pu ⁇ oses.
  • the polynucleotides which may be used include oligonucleotide sequences, antisense RNA and DNA molecules, and PNAs.
  • the polynucleotides may be used to detect and quantitate gene expression in biopsied tissues in which expression of NEDG may be correlated with disease.
  • the diagnostic assay may be used to distinguish between absence, presence, and excess expression of NEDG, and to monitor regulation of NEDG levels during therapeutic intervention.
  • hybridization with PCR probes which are capable of detecting polynucleotide sequences, including genomic sequences, encoding NEDG or closely related molecules, may be used to identify nucleic acid sequences which encode NEDG.
  • the specificity of the probe whether it is made from a highly specific region, e.g., 10 unique nucleotides in the 5' regulatory region, or a less specific region, e.g., especially in the 3' coding region, and the stringency of the hybridization or amplification (maximal, high, intermediate, or low) will determine whether the probe identifies only naturally occurring sequences encoding NEDG, alleles, or related sequences.
  • Probes may also be used for the detection of related sequences, and should preferably contain at least 50% of the nucleotides from any of the NEDG encoding sequences.
  • the hybridization probes of the subject invention may be DNA or RNA and derived from the nucleotide sequence of SEQ ID NO:2 or from genomic sequence including promoter, enhancer elements, and introns of the naturally occurring NEDG.
  • Means for producing specific hybridization probes for DNAs encoding NEDG include the cloning of nucleic acid sequences encoding NEDG or NEDG derivatives into vectors for the production of mRNA probes.
  • Such vectors are known in the art, commercially available, and may be used to synthesize RNA probes in vitro by means of the addition of the appropriate RNA polymerases and the appropriate labeled nucleotides
  • Hybridization probes may be labeled by a variety of reporter groups, for example, radionuclides such as 32P or 35S, or enzymatic labels, such as alkaline phosphatase coupled to the probe via avidin/biotin coupling systems, and the like.
  • Polynucleotide sequences encoding NEDG may be used for the diagnosis of disorders which are associated with expression of NEDG.
  • conditions or diseases include, but are not limited to, cancers such as adenocarcinoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, and teratocarcinoma and particularly cancers of the adrenal gland, bladder, bone, brain, breast, cervix, esophagus, gastrointestinal tract, heart, kidney, liver, lung, ovaries, pancreas, parathyroid, pituitary gland, prostate, salivary gland, spleen, stomach, thymus, thyroid, testes, and uterus: disorders of cell growth and proliferation such as adult respiratory distress syndrome, allergies, ankylosing spondylitis, anovulation, aberrant co ⁇ us luteum formation, asthma, atherosclerosis, arteriosclerosis, bronchitis, dermatomyositis.
  • NEDG diabetic retinopathy, hypereosinophilia. neurofibromatosis, polymyositis, rheumatoid arthritis, Alzheimer's disease, heart attacks, osteoarthritis, osteoporosis, Parkinson's disease, stroke, damage to cells such as heart muscle, and nerve cells caused by ischemia, free radicals, and toxins; rheumatoid arthritis, wound healing.
  • the polynucleotide sequences encoding NEDG may be used in Southern or northern analysis, dot blot, or other membrane-based technologies; in PCR technologies: or in dip stick, pin, ELISA or chip assays utilizing fluids or tissues from patient biopsies to detect altered NEDG expression.
  • nucleotide sequences encoding NEDG may be useful in assays that detect activation or induction of various cancers, particularly those mentioned above.
  • the nucleotide sequences encoding NEDG may be labeled by standard methods, and added to a fluid or tissue sample from a patient under conditions suitable for the formation of hybridization complexes. After a suitable incubation period, the sample is washed and the signal is quantitated and compared with a standard value.
  • nucleotide sequences have hybridized with nucleotide sequences in the sample, and the presence of altered levels of nucleotide sequences encoding NEDG in the sample indicates the presence of the associated disease.
  • assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials, or in monitoring the treatment of an individual patient.
  • a normal or standard profile for expression is established. This may be accomplished by combining body fluids or cell extracts taken from normal subjects, either animal or human, with a sequence, or a fragment thereof, which encodes NEDG, under conditions suitable for hybridization or amplification. Standard hybridization may be quantified by comparing the values obtained from normal subjects with those from an experiment where a known amount of a substantially purified polynucleotide is used. Standard values obtained from normal samples may be compared with values obtained from samples from patients who are symptomatic for disease. Deviation between standard and subject values is used to establish the presence of disease.
  • hybridization assays may be repeated on a regular basis to evaluate whether the level of expression in the patient begins to approximate that which is observed in the normal patient.
  • the results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to months.
  • the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms.
  • a more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer. Additional diagnostic uses for ohgonucleotides designed from the sequences encoding
  • NEDG may involve the use of PCR.
  • Such ohgomers may be chemically synthesized, generated enzymatically, or produced from a recombinant source.
  • Ohgomers will preferably consist of two nucleotide sequences, one with sense orientation (5'->3') and another with antisense (3' ⁇ -5'), employed under optimized conditions for identification of a specific gene or condition. The same two ohgomers. nested sets of ohgomers, or even a degenerate pool of ohgomers may be employed under less stringent conditions for detection and/or quantitation of closely related DNA or RNA sequences.
  • Methods which may also be used to quantitate the expression of NEDG include radiolabeling or biotinylating nucleotides. coamplification of a control nucleic acid, and standard curves onto which the experimental results are inte ⁇ olated (Melby, P.C. et al. (1993) J.
  • the nucleic acid sequences which encode NEDG may also be used to generate hybridization probes which are useful for mapping the naturally occurring genomic sequence.
  • the sequences may be mapped to a particular chromosome or to a specific region of the chromosome using well known techniques .
  • Such techniques include FISH, FACS, or artificial chromosome constructions, such as yeast artificial chromosomes, bacterial artificial chromosomes, bacterial PI constructions or single chromosome cDNA libraries as reviewed in Price, CM. (1993) Blood Rev. 7.127-134, and Trask, B.J. (1991) Trends Genet. 7- 149-154.
  • FISH (as described in Ve ⁇ na et al. (1988) Human Chromosomes: A Manual of Basic Techniques. Pergamon Press, New York, NY) may be correlated with other physical chromosome mapping techniques and genetic map data. Examples of genetic map data can be found in the 1994 Genome Issue of Science (265: 198 If)- Correlation between the location of the gene encoding NEDG on a physical chromosomal map and a specific disease , or predisposition to a specific disease, may help delimit the region of DNA associated with that genetic disease.
  • the nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, carrier, or affected individuals.
  • In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers may be used for extending genetic maps. Often the placement of a gene on the chromosome of another mammalian species, such as mouse, may reveal associated markers even if the number or arm of a particular human chromosome is not known. New sequences can be assigned to chromosomal arms, or parts thereof, by physical mapping. This provides valuable information to investigators searching for disease genes using positional cloning or other gene discovery techniques. Once the disease or syndrome has been crudely localized by genetic linkage to a particular genomic region, for example, AT to 1 lq22-23 (Gatti. R.A. et al.
  • any sequences mapping to that area may represent associated or regulatory genes for further investigation.
  • the nucleotide sequence of the subject invention may also be used to detect differences in the chromosomal location due to translocation, inversion, etc. among normal, carrier, or affected individuals.
  • NEDG in another embodiment, NEDG, its catalytic or lmmunogemc fragments or oligopeptides thereof, can be used for screening libraries of compounds in any of a variety of drug screening techniques.
  • the fragment employed in such screening may be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. The formation of binding complexes, between NEDG and the agent being tested, may be measured.
  • Another technique for drug screening which may be used provides for high throughput screening of compounds having suitable binding affinity to the protein of interest as described in published PCT application WO84/03564.
  • NEDG small test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.
  • the test compounds are reacted with NEDG, or fragments thereof, and washed.
  • Bound NEDG is then detected by methods well known in the art.
  • Purified NEDG can also be coated directly onto plates for use in the aforementioned drug screening techniques.
  • non-neutralizing antibodies can be used to capture the peptide and immobilize it on a solid support.
  • nucleotide sequences which encode NEDG may be used in any molecular biology techniques that have yet to be developed, provided the new techniques rely on properties of nucleotide sequences that are currently known, including, but not limited to, such properties as the triplet genetic code and specific base pair interactions.
  • TLYMNOROl cDNA Library Construction The TLYMNOROl cDNA library was constructed with RNA isolated from non-adherent peripheral blood mononuclear cells obtained from a 24-year-old Caucasian male. The cells were purified on Ficoll Hypaque. harvested, lysed in GuSCN, and spun through CsCl to obtain RNA for library construction. The RNA was primed with oligo dT and cDNA was synthesized from the mRNA. Double-stranded cDNA was blunted, ligated to EcoRI adaptors, digested with Xhol, size-selected, and cloned into the Xhol and EcoRI sites of the Lambda UniZAP vector (Stratagene).
  • the phagemid forms of individual cDNA clones were obtained by the in vivo excision process, in which the host bacterial strain was coinfected with both the lambda library phage and an f 1 helper phage. Proteins derived from both the library-containing phage and the helper phage nicked the lambda DNA, initiated new DNA synthesis from defined sequences on the lambda target DNA and created a smaller, single stranded circular phagemid DNA molecule that included all DNA sequences of the pBluescript® plasmid and the cDNA insert. The phagemid DNA was secreted from the cells and purified, then used to re-infect fresh host cells, where the double stranded phagemid DNA was produced.
  • Phagemid DNA was purified using the QIAwell-8 QIAwell PLUSTM, or QIAwell ULTRATM DNA Purification System (QIAGEN Inc. Chatsworth CA). The DNA was eluted from the purification resin already prepared for DNA sequencing and other analytical manipulations.
  • the cDNA inserts from random isolates of the library were sequenced in part by the method of Sanger F and AR Coulson (1975; J Mol Biol 94:44 If), using a Hamilton Micro Lab 2200 (Hamilton, Reno NV) in combination with four Peltier Thermal Cyclers (PTC200 from MJ Research, Watertown MA) and Applied Biosystems 377 or 373 DNA Sequencing Systems (Perkin Elmer), and the reading frame was determined.
  • nucleotide sequences of the Sequence Listing or amino acid sequences deduced from them were used as query sequences against databases such as GenBank, SwissProt. BLOCKS, and Pima L These databases which contain previously identified and annotated sequences were searched for regions of homology (similarity) using BLAST, which stands for Basic Local
  • BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying homologs which may be of prokaryotic (bacterial) or eukaryotic (animal, fungal or plant) origin. Other algorithms such as the one described in Smith RF and TF Smith (1992; Protein Engineering 5:35-51), inco ⁇ orated herein by reference, can be
  • SUBST1TUTE SHEET (RULE 26) used when dealing with primary sequence patterns and secondary structure gap penalties.
  • the sequences have lengths of at least 49 nucleotides, and no more than 12% uncalled bases (where N is recorded rather than A, C, G, or T).
  • threshold was set at 10 25 for nucleotides and 10 "14 for peptides.
  • Incyte nucleotide sequences were searched against the GenBank databases for primate (pri), rodent (rod), and mammalian sequences (mam), and deduced amino acid sequences from the same clones are searched against GenBank functional protein databases, mammalian (mamp), vertebrate (vrtp) and eukaryote (eukp). for homology.
  • Product score the calculation of which is shown below, was used to determine the electronic stringency. For an exact match, product score was set at 70 with a conservative lower limit set at approximately 40 (1-2% error due to uncalled bases).
  • Northern analysis is a laboratory technique used to detect the presence of a transcript of a gene and involves the hybridization of a labeled nucleotide sequence to a membrane on which RNAs from a particular cell type or tissue have been bound (Sambrook et al.. supra).
  • the product score takes into account both the degree of similarity between two sequences and the length of the sequence match. For example, with a product score of 40, the match will be exact within a 1-2% error; and at 70, the match will be exact. Homologous molecules are usually
  • SUBST1TUTE SHEET (RULE 26) identified by selecting those which show product scores between 15 and 40, although lower scores may identify related molecules.
  • Nucleic acid sequence of Incyte clone 144690 or SEQ ED NO:2 is used to design oligonucleotide primers for extending a partial nucleotide sequence to full length or for obtaining
  • Biosciences or another appropriate program, to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68° -72° C.
  • PCR is performed using the Peltier Thermal Cycler (PTC200; M.J. Research, Watertown, MA) and the following parameters:
  • Step 1 94° C for 1 nun (initial denaturation)
  • Step 2 65° C for 1 mm
  • Step 5 65° C for 1 mm
  • Step 7 Repeat step 4-6 for 15 additional cycles
  • Step 10 68° C for 7: 15 min
  • Step 1 Repeat step 8-10 for 12 cycles
  • a 5-10 ⁇ l aliquot of the reaction mixture is analyzed by electrophoresis on a low concentration (about 0.6-0.8%) agarose mini-gel to determine which reactions were successful in extending the sequence. Bands thought to contain the largest products are selected and removed from the gel. Further purification involves using a commercial gel extraction method such as QIAQuickTM (QIAGEN Inc., Chatsworth, CA). After recovery of the DNA, Klenow enzyme is used to trim single-stranded, nucleotide overhangs creating blunt ends which facilitate religation and cloning. After ethanol precipitation, the products are redissolved in 13 ⁇ l of ligation buffer, l ⁇ l
  • T4-DNA ligase (15 units) and l ⁇ l T4 polynucleotide kinase are added, and the mixture is incubated at room temperature for 2-3 hours or overnight at 16° C.
  • Competent E. coli cells (in 40 ⁇ l of appropriate media) are transformed with 3 ⁇ l of ligation mixture and cultured in 80 ⁇ l of SOC medium (Sambrook et al., supra). After incubation for one hour at 37° C, the whole transformation mixture is plated on Luria Bertani (LB)-agar (Sambrook et al., supra) containing 2x Carb.
  • PCR amplification For PCR amplification, 18 ⁇ l of concentrated PCR reaction mix (3.3x) containing 4 units of rTth DNA polymerase, a vector primer, and one or both of the gene specific primers used for the extension reaction are added to each well. Amplification is performed using the following conditions: Step 1 94° C for 60 sec
  • Step 2 94° C for 20 sec
  • Step 5 Repeat steps 2-4 for an additional 29 cycles Step 6 72° C for 180 sec
  • Hybridization probes derived from SEQ ED NO:2 are employed to screen cDNAs, genomic DNAs, or mRNAs. Although the labeling of ohgonucleotides, consisting of about 20 base-pairs, is specifically described, essentially the same procedure is used with larger cDNA fragments.
  • Ohgonucleotides are designed using state-of-the-art software such as OLIGO 4.06 (National Biosciences), labeled by combining 50 pmol of each oligomer and 250 ⁇ Ci of [ ⁇ - 32 P] adenosine triphosphate (Amersham) and T4 polynucleotide kinase (DuPont NEN ® , Boston, MA).
  • the labeled ohgonucleotides are substantially purified with Sephadex G-25 superfine resin column (Pharmacia & Upjohn).
  • a portion containing 10 7 counts per minute of each of the sense and antisense ohgonucleotides is used in a typical membrane based hybridization analysis of human genomic DNA digested with one of the following endonucleases (Ase I, Bgl El, Eco RI, Pst I, Xba 1, or Pvu H; DuPont NEN ® ).
  • Sequence complementary to the NEDG-encoding sequence, or any part thereof, is used to decrease or inhibit expression of naturally occurring NEDG.
  • ohgonucleotides comprising from about 15 to about 30 base-pairs is described, essentially the same procedure is used with smaller or larger sequence fragments.
  • Appropriate ohgonucleotides are designed using Oligo 4.06 software and the coding sequence of NEDG, SEQ ID NO: l.
  • a complementary oligonucleotide is designed from the most unique 5' sequence and used to prevent promoter binding to the coding sequence.
  • a complementary oligonucleotide is designed to prevent ribosomal binding to the ABBR-encoding transcript.
  • SUBST1TUTE SHEET (RULE 26) Expression of NEDG is accomplished by subcloning the cDNAs into appropriate vectors and transforming the vectors into host cells.
  • the cloning vector is used to express NEDG in E. coli. Upstream of the cloning site, this vector contains a promoter for ⁇ -galactosidase, followed by sequence containing the amino-terminal Met, and the subsequent seven residues of ⁇ -galactosidase. Immediately following these eight residues is a bacteriophage promoter useful for transcription and a linker containing a number of unique restriction sites.
  • Internal segments or cytopiasmic domains from an o ⁇ han G protein-coupled seven transmembrane receptor may be exchanged with the analogous domains of a known G protein- coupled seven transmembrane receptor and used to identify the G-proteins and downstream signaling pathways activated by the o ⁇ han receptor domains (Kobilka, B. K. et al (1988) Science 240: 1310-1316).
  • domains of the o ⁇ han receptor may be cloned as a portion of a fusion protein and used in binding assays to demonstrate interactions with specific G proteins. Studies have shown that the third intracellular loop of G protein-coupled seven transmembrane receptors are important for G protein interaction and signal transduction (Conklin.
  • the DNA fragment corresponding to the third intracellular loop of NEDG may be amplified by the polymerase chain reaction (PCR) and subcloned into a fusion vector such as pGEX (Pharmacia Biotech).
  • PCR polymerase chain reaction
  • pGEX Pharmacia Biotech
  • the construct is transformed into an appropriate bacterial host, induced, and the fusion protein is purified from the cell lysate by glutathione-Sepharose 4B (Pharmacia) affinity chromatography.
  • cell extracts containing G proteins are prepared by extraction with 50 mM Tris, pH 7.8, 1 mM EGTA, 5 mM MgCl, 20 m-M CHAPS, 20% glycerol, 10 ⁇ g of both aprotinin and leupeptin. and 20 ⁇ l of 50 mM phenylmethylsulfonyl fluoride.
  • the lysate is incubated on ice for 45 min with constant stirring, centrifuged at 23,000 g for 15 min at 4 °C, and the supernatant is collected.
  • 750 ⁇ g of cell extract is incubated with GST fusion protein beads for 2 h at 4 °C.
  • the GST beads are washed five times with phosphate-buffered saline. Bound G subunits are detected by [ 32 P]ADP-ribosylation with pertussis or cholera toxins.
  • the reactions are prepared by extraction with 50 mM Tris, pH 7.8, 1 m
  • SUBST1TUTE SHEET (RULE 26) are terminated by the addition of SDS sample buffer (4 6% (w/v) SDS, 10% (v/v) -mercaptoethanol, 20% (w/v) glycerol, 95.2 mM T ⁇ s-HCl, pH 6.8, 0.01% (w/v) bromphenol blue).
  • SDS sample buffer 4 6% (w/v) SDS, 10% (v/v) -mercaptoethanol, 20% (w/v) glycerol, 95.2 mM T ⁇ s-HCl, pH 6.8, 0.01% (w/v) bromphenol blue).
  • the [ 32 P]ADP-labeled proteins are separated on 10% SDS-PAGE gels, and antoradiographed.
  • NEDG that is substantially purified using PAGE electrophoresis (Sambrook. supra), or other purification techniques, is used to immunize rabbits and to produce antibodies using standard protocols.
  • the ammo acid sequence deduced from SEQ ED NO.2 is analyzed using DNASTAR software (DNASTAR Inc) to determine regions of high immunogenicity and a corresponding ohgopolypeptide is synthesized and used to raise antibodies by means known to those of skill in the art Selection of appropriate epitopes, such as those near the C-termmus or m hydrophihc regions, is described by Ausubel et al. (supra), and others.
  • the ohgopeptides are 15 residues in length, synthesized using an Applied Biosystems Peptide Synthesizer Model 431 A using fmoc-chemistry, and coupled to keyhole limpet hemocyanin (KLH, Sigma, St. Louis, MO) by reaction with N-maleimidobenzoyl-N- hydroxysuccinimide ester (MBS, Ausubel et al., supra). Rabbits are immunized with the ohgopeptide-KLH complex m complete Freund's adjuvant.
  • the resulting antisera are tested for antipeptide activity, for example, by binding the peptide to plastic, blocking with 1 % BS A, reacting with rabbit antisera, washing, and reacting with radioiodmated, goat anti-rabbit IgG XI Purification of Naturally Occurring NEDG Using Specific Antibodies
  • Naturally occurring or recombinant NEDG is substantially purified by lmmunoaffinity chromatography using antibodies specific for NEDG.
  • An lmmunoaffinity column is constructed by covalently coupling NEDG antibody to an activated chromatographic resin, such as CnBr-activated Sepharose (Pharmacia & Upjohn). After the coupling, the resin is blocked and washed according to the manufacturer's instructions.
  • SUBST1TUTE SHEET (RULE 26) washed under conditions that allow the preferential absorbance of NEDG (e.g., high ionic strength buffers in the presence of detergent).
  • the column is eluted under conditions that disrupt antibody/NEDG binding (eg, a buffer of pH 2-3 or a high concentration of a chaotrope, such as Urea or thiocyanate ion), and NEDG is collected.
  • a chaotrope such as Urea or thiocyanate ion
  • NEDG or biologically active fragments thereof are labeled with 125 I Bolton-Hunter reagent (Bolton et al. (1973) Biochem. J. 133:529).
  • Candidate molecules previously arrayed in the wells of a multi-well plate are incubated with the labeled NEDG, washed and any wells with labeled NEDG complex are assayed. Data obtained using different concentrations of NEDG are used to calculate values for the number, affinity, and association of NEDG with the candidate molecules.
  • AAGACCAGCC GCGTCTACGG CTTCATCGGC CTCTGCTGGC TGCTGGCCGC GCTGCTGGGG 540 ATGCTGCCTT TGCTGGGCTG GAACTGCCTG TGCGCCTTTG ACCGCTGCTC CAGCCTTCTG 600 CCCCTCTACT CCAAGCGCTA CATCCTCTTC TGCCTGGTGA TCTTCGCCGG CGTCCTGGCC 660 ACCATCATGG GCCTCTATGG GGCCATCTTC CGCCTGGTGC AGGCCAGCGG GCAGAAGGCC 720 CCACGCCCAG CGGCCCGCCG CAAGGCCCGC CGCCTGCTGA AGACGGTGCT GATGATCCTG 780 CTGGCCTTCC TGGTGTGCTG GGGCCCACTC TTCGGGGCTG CTGCTGGCCG ACGTCTTTGG 840 CTCCAACCTC TGGGCCCAGG AGTACCTGCG GGGCATGGAC TGGATCCTGGCCCTGGCCGT 900 CCTCAACTCG GCGGTCAACC C
  • CTGTGTGATT CTGGGGAAGT CCCGGCCCCT CTCTGGGCCT CAGTAGGGCT CCCAGGCTGC 1500

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pulmonology (AREA)
  • Immunology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Rheumatology (AREA)
  • Genetics & Genomics (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Cardiology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Urology & Nephrology (AREA)
  • Vascular Medicine (AREA)
  • Pain & Pain Management (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Neurology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne un nouveau récepteur de type edg-1 (NEDG) et des polynucléotides qui identifient et codent le NEDG. L'invention se rapporte également à des vecteurs d'expression, des cellules hôtes, des agonistes, des anticorps et des antagonistes. L'invention concerne enfin des procédés permettant de traiter des troubles associés à l'expression du NEDG.
EP98918400A 1997-04-24 1998-04-17 Recepteur de type edg-1 Withdrawn EP0977850A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US845566 1977-10-26
US08/845,566 US5912144A (en) 1997-04-24 1997-04-24 Edg-1-receptor homolog
PCT/US1998/007830 WO1998048016A1 (fr) 1997-04-24 1998-04-17 Recepteur de type edg-1

Publications (1)

Publication Number Publication Date
EP0977850A1 true EP0977850A1 (fr) 2000-02-09

Family

ID=25295530

Family Applications (1)

Application Number Title Priority Date Filing Date
EP98918400A Withdrawn EP0977850A1 (fr) 1997-04-24 1998-04-17 Recepteur de type edg-1

Country Status (6)

Country Link
US (1) US5912144A (fr)
EP (1) EP0977850A1 (fr)
JP (1) JP2002500633A (fr)
AU (1) AU7132898A (fr)
CA (1) CA2286865A1 (fr)
WO (1) WO1998048016A1 (fr)

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6060272A (en) * 1997-05-07 2000-05-09 Human Genome Sciences, Inc. Human G-protein coupled receptors
EP1042471B1 (fr) * 1997-12-30 2004-08-11 NPS Allelix Corp. Homologues de recepteurs edg-7 mammaliens
WO1999046277A1 (fr) 1998-03-09 1999-09-16 Smithkline Beecham Corporation POLYNUCLEOTIDES ET POLYPEPTIDES D'EDG-1c HUMAIN ET LEURS PROCEDES D'UTILISATION
EP1112365A2 (fr) * 1998-09-11 2001-07-04 Max-Delbrück-Centrum Für Molekulare Medizin Recepteur edg6 (gene de differentiation de cellules endotheliales) humain et murin couple a des proteines g et son utilisation
US20020198369A1 (en) * 1999-03-08 2002-12-26 Smith Kelli E. DNA encoding orphan SNORF12 receptor
US6812335B1 (en) 1999-03-23 2004-11-02 The Regents Of The University Of California Human polypeptide receptors for lysophospholipids and sphingolipids and nucleic acids encoding the same
JP2003506042A (ja) 1999-08-03 2003-02-18 ミレニアム ファーマシューティカルズ インク. セクレチン様ファミリーの新規gpcr様分子15571及びその使用
US20020142982A1 (en) * 1999-09-02 2002-10-03 Timothy Hla Method for regulating angiogenesis
WO2001027137A2 (fr) * 1999-10-12 2001-04-19 Smithkline Beecham Corporation Rattus norvegicus (edg3)
AU2002211477A1 (en) 2000-10-05 2002-04-15 Case Western Reserve University Suppressor of human breast cancer cell growth
WO2002051439A2 (fr) * 2000-12-22 2002-07-04 Medlyte, Inc. Compositions et procedes destines au traitement et a la prevention de troubles et de maladies cardio-vasculaires, et a l'identification d'agents therapeutiques correspondants
JP2005533852A (ja) * 2002-07-18 2005-11-10 セレテック エルエルシー Edg−1受容体に関連した症状の治療方法
US20040112375A1 (en) * 2002-11-20 2004-06-17 Boykin Joseph V. Predicting outcome of hyperbaric oxygen therapy treatment with nitric oxide bioavailability
JP4516430B2 (ja) 2002-12-20 2010-08-04 メルク・シャープ・エンド・ドーム・コーポレイション 1−(アミノ)インダン並びに(1,2−ジヒドロ−3−アミノ)−ベンゾフラン、ベンゾチオフェン及びインドール
US7794713B2 (en) 2004-04-07 2010-09-14 Lpath, Inc. Compositions and methods for the treatment and prevention of hyperproliferative diseases
US7862812B2 (en) 2006-05-31 2011-01-04 Lpath, Inc. Methods for decreasing immune response and treating immune conditions

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5585476A (en) * 1994-02-15 1996-12-17 Maclennan; Alexander J. Molecular cloning and expression of G-protein coupled receptors
WO1997000952A2 (fr) * 1995-06-20 1997-01-09 Incyte Pharmaceuticals, Inc. Homologue du recepteur de edg-2 de l'homme

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9848016A1 *

Also Published As

Publication number Publication date
CA2286865A1 (fr) 1998-10-29
AU7132898A (en) 1998-11-13
US5912144A (en) 1999-06-15
JP2002500633A (ja) 2002-01-08
WO1998048016A1 (fr) 1998-10-29

Similar Documents

Publication Publication Date Title
US5912144A (en) Edg-1-receptor homolog
EP0953049A2 (fr) Nouvelle metallothioneine humaine
EP1002070A1 (fr) Proteine humaine de transport de cassette de liaison de l'adenosine triphosphate (atp)
CA2283296A1 (fr) Proteine de liaison du recepteur du facteur de croissance
US6228616B1 (en) Human anion channel
WO1998040494A1 (fr) Nouvelle enzyme pour l'edition de l'arn
WO1998026067A1 (fr) Proteine liee a la differentiation specifique de l'adipocyte
EP0977845A1 (fr) Cotransporteur de phosphate humain dependant du sodium
US5955314A (en) Regulator of cell signaling
WO1998044114A1 (fr) Proteine de fixation du calcium similaire de la reticulocalbine
WO1998045440A1 (fr) Proteine humaine fixatrice d'acides gras
WO1998051782A2 (fr) 3-hydroxyisobutyryl-coenzyme a hydrolase humaine
US6485933B1 (en) B cell receptor associated proteins
WO1998036063A1 (fr) Nouvelle proteine humaine du genre h-rev 107
WO1998033817A1 (fr) Proteine membranaire humaine
WO1998024901A1 (fr) Variant du facteur de croissance du poumon
US20010010911A1 (en) Novel human pyrophosphatase
CA2283688A1 (fr) Serine/threonine proteine kinase
WO1998033921A1 (fr) Nouvelle proteine humaine de type cystatine
WO1998041635A1 (fr) Proteine associee a la tumorogenese humaine, htap
WO1998018938A1 (fr) Spermidine/spermine n1-acetyl transferase d'origine humaine
US20020177700A1 (en) New ras-like protein
WO1998044115A2 (fr) Regulateurs du processus de signalement de la proteine g
EP1003858A1 (fr) Nouvelle proteine regulatrice de croissance humaine
WO1998036077A1 (fr) Nouvelle proteine humaine de type parvuline

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19991104

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): BE DE ES FR GB IT NL

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20001101