EP0968289A1 - Icam-6 materials and methods - Google Patents

Abstract

The present invention provides polynucleotides encoding ICAM-6, expression constructs encoding the polynucleotides, host cells transformed or transfected with the expression constructs, methods to produce ICAM-6 polypetides, ICAM-6 polypeptides, antibodies immunospecific for the polypeptides, and anti-idiotype antibodies which recognize the anti-ICAM-6 antibodies.

Description

ICAM-6 MATERIALS AND METHODS

This application is a continuation-in-part of U.S. Patent Application Serial No: 08/955,661 , filed October 22, 1997, which is pending.

FIELD OF THE INVENTION The present invention relates generally to cellular adhesion molecules and more particularly to the cloning and expression of DNA encoding a heretofore unknown polypeptide designated "ICAM-6" which possesses structural relatedness to the intercellular adhesion molecules ICAM-1, ICAM-2, ICAM-R, (Landsteiner-Weiner) LW-ICAM-4, and ICAM-5.

BACKGROUND OF THE INVENTION

Research spanning the last decade has significantly elucidated the molecular events attending cell-cell interactions in the body, especially those events involved in the movement and activation of cells in the immune system, and more recently, those involved in development and normal physiological function of cells in the nervous system. See generally, Springer, Nature, 346: 425-434 (1990) regarding cells of the immune system, and Yoshihara, et al. Neurosci.Res. 70:83-105 (1991) and Sonderegger and Rathjen, J. Cell Biol. i ?: 1387-1394 (1992) regarding cells of the nervous system. Cell surface proteins, and especially the so-called Cellular Adhesion Molecules ("CAMs") have correspondingly been the subject of pharmaceutical research and development having as its goal intervention in the processes of leukocyte extravasation to sites of inflammation and leukocyte movement to distinct target tissues, as well as neuronal differentiation and formation of complex neuronal circuitry. The isolation and characterization of cellular adhesion molecules, the cloning and expression of DNA sequences encoding such molecules, and the development of therapeutic and diagnostic agents relevant to inflammatory processes and development and function of the nervous system have also been the subject of numerous U.S. and foreign applications for Letters Patent. See Edwards, Current Opinion in Therapeutic Patents, 1(11): 1617-1630 (1991) and particularly the published "patent literature references" cited therein.

Of fundamental interest to the background of the present invention are the prior identification and characterization of certain mediators of cell adhesion events, the "leukointegrins," LFA-1, MAC-1 and pl50,95 (referred to in WHO nomenclature as CD18/CDl la, CD18/CDl lb, and CD18/CDl lc, respectively) which form a subfamily of heterodimeric "integrin" cell surface proteins present on B lymphocytes, T lymphocytes, monocytes and granulocytes. See, e.g., Table 1 of Springer, supra, at page 429. Also of interest are other single chain adhesion molecules (CAMs) that have been implicated in leukocyte activation, adhesion, motility and the like, which are events attendant to the inflammatory process. For example, it is presently believed that prior to the leukocyte extravasation which characterizes inflammatory processes, activation of integrins constitutively expressed on leukocytes occurs and is followed by a tight ligand/receptor interaction between the integrins (e.g., LFA-1) and one or both of two distinct intercellular adhesion molecules (ICAMs) designated ICAM-1 and ICAM-2 which are expressed on blood vessel endothelial cell surfaces and on leukocytes.

Like the other CAMs characterized to date, [e.g., vascular adhesion molecule (VCAM-1) as described in PCT WO 90/13300 published November 15, 1990; and platelet endothelial cell adhesion molecule (PECAM- 1) as described in Newman et al , Science, 247: 1219-1222 (1990) and PCT WO 91/10683 published July 25, 1991], ICAM-1 and ICAM-2 are structurally homologous to other members of the immunoglobulin gene superfamily in that the extracellular portion of each is comprised of a series of domains sharing a similar structure. A "typical" immunoglobulin-like domain contains a loop structure usually anchored by a disulfide bond between two cysteines at the extremity of each loop. ICAM-1 and ICAM-R each include five immunoglobu- lin-like domains; ICAM-2 and LW-ICAM-4, which differ from ICAM-1 in terms of cell distribution, include two such domains; ICAM-5 includes nine; PEC AM- 1 includes six; NCAM includes six or seven, depending on splice variations, and so on. Moreover, CAMs typically include a hydrophobic "transmembrane" region believed to participate in orientation of the molecule at the cell surface and a carboxy terminal "cytoplasmic" region. Graphic models of the operative disposition of CAMs generally show the molecule anchored in the cell membrane at the transmembrane region with the cytoplasmic "tail" extending into the cell cytoplasm and one or more immunoglobulin-like loops extending outward from the cell surface.

A number of neuronal cells express surface receptors with extracellular Ig-like domains, structurally similarity to the ICAMs. See for example, Yoshihara, et al, supra, and Mizuno, et al , J. Biol. Chem. 272: 1156-1163 (1997). In addition to Ig-like domains, many adhesion molecules of the nervous system also contain tandemly repeated fibronectin-like sequences in the extracellular domain.

A variety of therapeutic uses has been projected for intercellular adhesion molecules, including uses premised on the ability of ICAM-1 to bind human rhinovirus. European Patent Application 468 257 A published January 29, 1992, for example, addresses the development of multimeric configurations and forms of ICAM-1 (including full length and truncated molecular forms) proposed to have enhanced ligand/receptor binding activity, especially in binding to viruses, lymphocyte associated antigens and pathogens such as Plasmodium falciparum .

In a like manner, a variety of uses has been projected for proteins immunologically related to intercellular adhesion molecules. WO91/16928, published November 14, 1991 , for example, addresses humanized chimeric anti-ICAM-1 antibodies and their use in treatment of specific and non-specific inflammation, viral infection and asthma. Anti- ICAM-1 antibodies and fragments thereof are described as useful in treatment of endotoxic shock in WO92/04034, published March 19, 1992. Inhibition of ICAM-1 dependent inflammatory responses with anti-ICAM-1 anti-idiotypic antibodies and antibody fragments is addressed in WO92/06119, published April 16, 1992.

Despite the fundamental insights into cell adhesion phenomena which have been gained by the identification and characterization of intercellular adhesion proteins such as ICAM-1 and lymphocyte interactive integrins such as LFA-1 , the picture is far from complete. It is generally believed that numerous other proteins are involved in inflammatory processes and in targeted lymphocyte movement throughout the body. For example, U.S. Patent Application Serial Nos. 07/827,689, 07/889,724, 07/894,061 and 08/009,266 and corresponding published PCT AppUcation WO 93/14776 (published August 5, 1993) disclose the cloning and expression of an ICAM- Related protein, ICAM-R, which has been shown to be expressed on human lymphocytes, monocytes and granulocytes. The disclosures of these applications are specifically incorporated by reference herein. As another example, a blood group glycoprotein, designated herein as LW-ICAM-4 has been described [Bailly, et al, Proc. Natl. Acad. Sci. (USA) 7:53065-5310 (1994); Bailly, et al, Eur. J. Immunol. 25:3316-3320 (1995)]. LW-ICAM-4 was suggested to mediate red blood cell binding to CDlla/CD18 and CD1 lb/CD 18 and was shown to be structurally similar to ICAM-2 in that the surface protein includes two extracellular domains. As still another example, an ICAM-like surface molecule has been identified which has a tissue specific expression unlike that of any known ICAM molecule. Mori, et al , [Proc. Natl. Acad.Sci. (USA) 84:3921-3925 (1987)] reported identification of a telencephalon-specific antigen in rabbit brain, specifically immunoreactive with monoclonal antibody 271A6. This surface antigen was named telencephalin or ICAM-5. Yoshihara, et al. , in Neuron i2:543-553 (1994) reported the cDNA and amino acid sequences for rabbit telencephalin which suggested that the 130 kD telencephalon is an integral membrane protein with nine extracellular immunoglobulin (Ig)-like domains. The distal eight of these domains showed homology to other ICAM Ig-like domains. Cloning of the human homolog to rabbit ICAM-5 was described by Mizuno, et al, supra.

There thus continues to be a need in the art for the discovery of additional proteins participating in human cell-cell interactions and especially a need for information serving to specifically identify and characterize such proteins in terms of their amino acid sequence. Moreover, to the extent that such molecules form the basis for the development of therapeutic and diagnostic agents, it is essential that the DNA encoding them be elucidated. Such seminal information would inter alia, provide for the large scale production of the proteins, allow for the identification of cells naturally producing them, and permit the preparation of antibody substances or other novel binding proteins specifically reactive therewith and/or inhibitory of ligand/receptor binding reactions in which they are involved.

SUMMARY OF THE INVENTION In brief, the present invention provides polypeptides and underlying polynucleotides for the cellular adhesion molecule family designated ICAM-6. The invention includes both naturally occurring and non-naturally occurring ICAM-6 polynucleotides and polypeptide products thereof. Naturally occurring ICAM-6 polypeptides include distinct genes and polypeptides species within the family (i.e. , allelic variants and species homologs). Within each ICAM-6 species, the invention further provides splice variants encoded by the same polynucleotide but which arise from distinct mRNA transcripts. Non- naturally occurring ICAM-6 polypeptides include variants of the naturally occurring polypeptides such as analogs (t^*. e. , wherein one or more amino acids are added, substituted, or deleted) and those ICAM-6 polypeptides which include covalent modifications (i.e. , fusion proteins, glycosylation variants, Met 'lCAM-όs, Met^-Lys^-ICAM-όs, Gly 'lCAM-όs and the like). In a preferred embodiment, the invention provides a polynucleotide comprising the sequence set forth in SEQ ID NO: 1. The invention also embraces polynucleotides encoding the amino acid sequence set out in SEQ ID NO: 2. A presently preferred polypeptide of the invention comprises the amino acid sequence set out in SEQ ID NO: 2. A plasmid encoding the preferred polynucleotide of the invention was deposited with the American Type Culture Collection, 12301 Rockville MD, 20852 on October 16, 1997 and assigned Accession No: 98557.

The present invention provides novel purified and isolated polynucleotides (e.g., DNA sequences and RNA transcripts, both sense and complementary antisense strands, including splice variants thereof) encoding the ICAM-6. DNA sequences of the invention include genomic and cDNA sequences as well as wholly or partially chemically synthesized DNA sequences. "Synthesized," as used herein and is understood in the art, refers to purely chemical, as opposed to enzymatic, methods for producing polynucleotides. "Wholly" synthesized DNA sequences are therefore produced entirely by chemical means, and "partially" synthesized DNAs embrace those wherein only portions of the resulting DNA were produced by chemical means. The invention further embraces species, preferably mammalian, homologs of the preferred ICAM-6 DNA. The invention also embraces DNA sequences encoding ICAM-6 species which hybridize under stringent conditions to the non-coding strands, or complements, of the polynucleotides in SEQ ID NO: 1. DNA sequences encoding ICAM-6 polypeptides which would hybridize thereto but for the redundancy of the genetic code are contemplated by the invention. Exemplary stringent hybridization conditions are as follows: hybridization in 50% formamide, 5X SSC, 42°C overnight and washing in 0.5X SSC and 0.1 % SDS at 50° C. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausebel, et al. (Eds.), Protocols in Molecular Biology. John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook, et al. , (Eds.), Molecular Cloning: A Laboratory Manual. Cold Spring Harbor

Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51.

Autonomously replicating recombinant expression constructions such as plasmid and viral DNA vectors incorporating ICAM-6 polynucleotide sequences are also provided. Expression constructs wherein ICAM-6-encoding polynucleotides are operatively linked to an endogenous or exogenous expression control DNA sequence and a transcription terminator are also provided.

According to another aspect of the invention, host cells are provided, including prokaryotic and eukaryotic cells, either stably or transiently transformed with DNA sequences of the invention in a manner which permits expression of ICAM-6 polypeptides of the invention. Host cells of the invention are a valuable source of immunogen for development of antibodies specifically immunoreactive with ICAM-6. Host cells of the invention are also conspicuously useful in methods for large scale production of ICAM-6 polypeptides wherein the cells are grown in a suitable culture medium and the desired polypeptides are isolated from the cells or from the medium in which the cells are grown by, for example, immunoaffinity purification.

Knowledge of ICAM-6 DNA sequences allows for modification of cells to permit, or increase, expression of endogenous ICAM-6. Cells can be modified (e.g. , by homologous recombination) to provide increased ICAM-6 expression by replacing, in whole or in part, the naturally occurring ICAM-6 promoter with all or part of a heterologous promoter so that the cells express ICAM-6 at higher levels. The heterologous promoter is inserted in such a manner that it is operatively-linked to ICAM-6 encoding sequences. See, for example, PCT International Publication No. WO 94/12650, PCT International Publication No. WO 92/20808, and PCT International Publication No. 91/09955. The invention also contemplates that, in addition to heterologous promoter DNA, amplifiable marker DNA (e.g. , ada, dhfr, and the multifunctional CAD gene which encodes carbamyl phosphate synthase, aspartate transcarbamylase, and dihydroorotase) and/or intron DNA may be inserted along with the heterologous promoter DNA. If linked to the ICAM-6 coding sequence, amplification of the marker DNA by standard selection methods results in co-amplification of the ICAM-6 coding sequences in the cells.

The DNA sequence information provided by the present invention also makes possible the development through, e.g. homologous recombination or "knock-out" strategies [Capecchi, Science 244: 1288-1292 (1989)], of animals that fail to express functional ICAM-6 or that express a variant of ICAM-6. Such animals are useful as models for studying the in vivo activities of ICAM-6 and modulators of ICAM-6.

The invention also provides purified and isolated ICAM-6 polypeptides. A presently preferred ICAM-6 polypeptide is set out in SEQ ID NO: 2. ICAM-6 peptides of the invention may be isolated from natural cell sources or may be chemically synthesized, but are preferably produced by recombinant procedures involving host cells of the invention. Use of mammalian host cells is expected to provide for such post-translational modifications (e.g. , glycosylation, truncation, lipidation, and phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. ICAM-6 polypeptides of the invention may be full length polypeptides, biologically active fragments, or variants thereof which retain specific ICAM-6 biological activity. Variants may comprise ICAM-6 polypeptide analogs wherein one or more of the specified ( . e. , naturally encoded) amino acids is deleted or replaced or wherein one or more non-specified amino acids are added: (1) without loss of one or more of the biological activities or immunological characteristics specific for ICAM-6; or (2) with specific disablement of a particular biological activity of ICAM-6. Variant polypeptides of the invention include mature, i.e. , ICAM-6 polypeptides wherein leader or signal sequences are removed, ICAM-6 polypeptides having additional amino terminal residues. ICAM-6 polypeptides having an additional methionine residue at position -1 (Met^_1-ICAM-6) are contemplated, as are ICAM-6 polypeptides having additional methionine and lysine residues at positions -2 and -1 (Mef²-Lys^"1-ICAM-6). Variants of these types are particularly useful for recombinant protein production in bacterial cell types.

The invention also embraces ICAM-6 variants having additional amino acid residues which result from use of specific expression systems. For example, use of commercially available vectors that express a desired polypeptide such as a glutathione-S-transferase (GST) fusion product provide the desired polypeptide having an additional glycine residue at position -1 as a result of cleavage of the GST component from the desired polypeptide. Variants which result from expression in other vector systems are also contemplated. The invention also embraces ICAM-6 fragments comprising one or more extracellular domains of the polypeptide. Particularly preferred truncated forms of ICAM-6 include those soluble forms of the protein which are involved in specific ligand binding to effect cell adhesion. Truncated forms of ICAM-6 which comprise one or more extracellular domains are generated with respect to knowledge of the defined and distinct domains of the extracellular portion of the protein; the various domains are characteristically indicated by the presence of conserved cysteine residues and generally conserved and/ or similar neighboring amino acid residues. The invention further includes ICAM-6 fragments which are covalently attached to amino acids sequences not normally associated with ICAM-6. The resulting "chimeric" or "fusion" proteins are particularly useful for modulating ICAM-6 biological activity as well as for improving antigenic properties of ICAM-6 amino acid sequences. "Amino acid sequences not normally associated with ICAM-6" may be derived from any source and can be selected based on particular properties attachment of the amino acids may effect on ICAM-6.

The invention further embraces ICAM-6 polypeptides modified to include one or more water soluble polymer attachments. Particularly preferred are ICAM-6 polypeptides covalently modified with polyethylene glycol (PEG) subunits. Water soluble polymers may be bonded at specific positions, for example at the amino terminus of the ICAM-6 polypeptides, or randomly attached to one or more side chains of the polypeptide.

Also comprehended by the present invention are antibodies (e.g. , monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) or fragments thereof and other binding proteins specific for ICAM-6 polypeptides. Specific binding proteins can be developed using isolated or recombinant ICAM-6 products, ICAM-6 variants, or cells expressing such products. Binding proteins are useful for purifying ICAM-6 polypeptides and detection or quantification of ICAM-6 polypeptides in fluid and tissue samples using known immunological procedures. Binding proteins are also manifestly useful in modulating (i.e. , blocking, inhibiting or stimulating) biological activities of ICAM-6, especially those activities involved in signal transduction. Anti-idiotypic antibodies specific for anti-ICAM-6 antibodies are also contemplated.

The scientific value of the information contributed through the disclosures of DNA and amino acid sequences of the present invention is manifest. As one series of examples, knowledge of the sequence of a cDNA for ICAM-6 makes possible through use of Southern hybridization or polymerase chain reaction (PCR) the identification of genomic DNA sequences encoding ICAM-6 and ICAM-6 expression control regulatory sequences such as promoters, operators, enhancers, repressors, and the like. DNA/DNA hybridization procedures carried out with DNA sequences of the invention under moderately to highly stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of ICAM-6; allelic variants are known in the art to include structurally related proteins sharing one or more of the biochemical and/or immunological properties specific to ICAM-6. Similarly, species genes encoding proteins homologous to ICAM-6 can also be identified by Southern and/or PCR analysis. As an alternative, complementation studies can be useful for identifying other ICAM-6 proteins, and DNAs encoding the proteins.

Polynucleotides of the invention are also useful in hybridization assays to detect the capacity of cells to express ICAM-6. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in a ICAM-6 locus that underlies a disease state or states.

Also made available by the invention are antisense polynucleotides which recognize and hybridize to polynucleotides encoding ICAM-6. Full length and fragment antisense polynucleotides are provided. Antisense polynucleotides are particularly relevant to regulating expression of ICAM-6 by those cells expressing ICAM-6 mRNA.

The DNA and amino acid sequence information provided by the present invention also makes possible the systematic analysis of the structure and function of ICAM-6. DNA and amino acid sequence information for ICAM-6 also permits identification of molecules with which ICAM-6 will interact. Agents that modulate (i.e. , increase, decrease, or block) ICAM-6 binding activity may be identified by incubating a putative modulator with ICAM-6 and determining the effect of the putative modulator on ICAM-6 binding activity. The selectivity of a compound that modulates the biological activity of the ICAM-6 can be evaluated by comparing its effect on ICAM-6 to its effect on other ICAM-6 binding proteins. Cell based methods, such as di- hybrid assays and split hybrid assays, as well as in vitro methods, including assays wherein a polypeptide or its binding partner are immobilized, and solution assays are contemplated by the invention.

Selective modulators may include, for example, antibodies and other proteins or peptides which specifically bind to the ICAM-6 or ICAM-6 nucleic acid, oligonucleotides which specifically bind to the ICAM-6 or ICAM- 6 nucleic acid, and other non-peptide compounds (e.g. , isolated or synthetic organic molecules) which specifically react with ICAM-6 or ICAM-6-encoding nucleic acid. Modulators also include compounds as described above but which interact with a specific binding partner of ICAM-6. Mutant forms of ICAM-6 which affect the enzymatic activity or cellular localization of the wild-type ICAM-6 are also contemplated by the invention. Presently preferred targets for the development of selective modulators include, for example: (1) cytoplasmic or transmembrane regions of ICAM-6 which contact other proteins and/or localize the ICAM-6 within a specific membrane region of a cell and (2) extracellular regions of the ICAM-6 which bind specific binding partners. Modulators of ICAM-6 activity may be therapeutically useful in treatment of diseases and physiological conditions in which ICAM-6 activity is involved. DETAILED DESCRIPTION OF THE INVENTION

The present invention is illustrated by the following examples which relate to the isolation of polynucleotides encoding ICAM-6 polypeptides as well as expression and characterization of the encoded polypeptides. Example 1 describes a search of an EST database in an attempt to identify novel ICAM cDNA sequences. Example 2 relates to screening a mouse library to identify a full length ICAM-6 cDNA. Example 3 addresses Northern tissue analysis of mouse ICAM-6 expression. Example 4 relates to use of RACE PCR to identify a 5 " sequence encoding mouse ICAM-6. Example 5 describes construction of expression plasmids encoding soluble forms of mouse ICAM-6. Example 6 relates to isolation of a full length mouse ICAM-6 cDNA. Example 7 describes construction of additional mouse ICAM-6 expression constructs. Example 8 addresses production of ICAM-6 antibodies. Example 9 describes functional analysis of mouse ICAM-6. Example 10 describes in situ hybridization analysis of mouse ICAM-6. Example 11 relates to identification of a partial human ICAM-6 cDNA. Example 12 provides Northern analysis of human ICAM-6 expression in tissues and cells. Example 13 describes isolation of a more complete human ICAM-6 cDNA. Example 14 addresses use of RACE PCR to identify a correctly spliced 5 ' cDNA for human ICAM-6. Example 15 describes cloning ICAM-6 domains 4 and 5 from sterile male patients. Example 16 relates to expression of a soluble human ICAM-6 polypeptide. Example 17 describes Western analysis and ICAM-6 antibody production.

Example 1 Search of EST Database for Novel ICAMs

A BLASTN search of the National Center for Biotechnology

Information (NCBI) expressed sequence tags (EST) database was carried out in order to identify cDNA fragments that could potentially be useful in the identification of novel cell adhesion molecules (CAMs). The database contains DNA sequences representing one or both ends of cDNAs collected from a variety of tissue sources. To identify ESTs for submission to the database, a single sequencing run is performed on one or both ends of the cDNA and the quality, in terms of sequence accuracy, of the DNA varies tremendously. At the time the searches described herein were performed, the EST database contained more than 860,000 cDNA sequences from a variety of organisms.

The search for novel CAMs included three steps. First, the BLASTN program available through NBCI was used to identify ESTs with homology to cDNA sequences encoding known CAMs. The program compares a query nucleotide sequence against all nucleotide sequences in the database. In the present search, cDNAs encoding human ICAM-1 [Staunton, et al. , Cell 52:925 (1988)], ICAM-2 [Staunton, et al , Nature 339:61 (1989)], ICAM-R [Vazeux, et al , Nature 360:485 (1992)], LW-ICAM-4 [Bailly et al , Proc. Nat 'I. Acad. Sci. (USA) 91:5306 (1994)], ICAM-5 [Mizuno et al , J.Biol. Chem. 272: 1156 (1997)], VCAM-1 [Osborn, et al , Cell, 59: 1203 (1989)], and MadCAM [Leung, et al , Immunogenetics 46: 111 (1997)], murine ICAM-1 [Ballantyne, et al , Nucl. Acids. Res. 17:5853 (1989)], ICAM-2 [Xu, et al. , J. Immunology 149:2650 (1992)], ICAM-5 [Yoshihara, et al. , Neuron 12:541 (1994)], VCAM-1 [Araki, et al , Gene 126:261 (1993)], and MadCAM [Briskin, et al , Nature 363:461 (1993)], and part of mouse ICAM-4 (EST W46066) were submitted and thirteen BLASTN searches were performed. From the results, EST sequences determined to correspond to one of the thirteen known CAMs were identified.

A second TBLASTN search was carried out using as query sequences the amino acid sequences for the known human and mouse CAM genes discussed above. In this search, polynucleotides in the EST sequence library are translated in six reading frames and each resultant amino acid sequence is compared to the query sequences. ESTs identified in this search which corresponded to ESTs found in the first search were discarded. Thirdly, the sequences identified in the TBLASTN search that did not correspond to a known CAM were examined further. The majority of the remaining sequences did not contain the conserved cysteine residues and extracellular domain structures typically found in cell adhesion molecules, and these sequences were also discarded. However, one 250 nucleotide EST derived from mouse testis and designated AA065978 (SEQ ID NO: 46) was identified as encoding polypeptide sequences homologous to mouse ICAM-1, ICAM-3, and ICAM-5 amino acid sequences. The AA065978 sequence was most closely related to mouse ICAM-5; alignment of the sequence for AA065978 with the corresponding mouse ICAM-5 region showed 47% identity overall. The EST was ordered from Genome Systems (St. Louis, MO) which maintains and makes available deposits of ESTs identified and sequenced by I.M.A.G.E., Lawrence Livermore Laboratory, Livermore, CA.

Bacteria transformed with plasmid DNA encoding EST AA065978 were plated on LB-agarose containing carbenicillin and grown overnight at 37°C. One colony was picked and grown in liquid LB-carbenicillin media. Plasmid DNA was recovered from 18 ml of the bacterial culture using a Wizard Mini- Prep kit (Promega, Madison WI). The EST insert was sequenced using vector primers T7.1 (SEQ ID NO: 3) and T3.1 (SEQ ID NO: 4) and primers I6MO24 (SEQ ID NO: 5) and I6MO20 (SEQ ID NO: 6) which were designed based on the database sequence of AA065978.

T7.1 SEQ ID NO: 3

GTAATACGACTCACTATAGGGC

T3.1 SEQ ID NO: 4 AATTAACCCTCACTAAAGGG

I6MO20 SEQ ID NO: 6

TTGCCTGCATCCCAGAGG

I6MO24 SEQ ID NO: 5

CAAGCCAAGGTTTCAGGAATCCCGCTGC After the first sequence analysis, additional primers I6MO30 (SEQ ID NO: 7), I6MO31 (SEQ ID NO: 8), I6MO32 (SEQ ID NO: 9), I6MO33 (SEQ ID NO: 10), and I6MO34 (SEQ ID NO: 11) were designed to determine the remainder of the EST sequence.

I6MO30 TCTTTGCTGGAGTGTGAC SEQ ID NO: 7

I6MO31 GTCACACTCCAGCAAAGA SEQ ID NO: 8

I6MO32 CAAAGCAAGGGCGAGGAG SEQ ID NO: 9

I6MO33 CTCCTCGCCCTTGCTTTG SEQ ID NO: 10

I6MO34 TCTAGGTGGGACTCTGTG SEQ ID NO: 11

The DNA sequence of AA065978 was determined for both strands using DNA oligonucleotide primers set out above and a Perkin Elmer Applied Biosystems Division 373A DNA Sequencer according to the manufacturer's suggested protocol. The amount of PCR product used as template was calculated based on the size of the PCR product and was sequenced using ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase, FS (Perkin Elmer, Foster City, CA) and asymmetric PCR. The reaction product was purified on a AGCT spin column (Advanced Genetic Technologies Corp., Gaithersburg, MD) and dried. Loading buffer was added to each purified sample and the mixture heated at 90°C for two minutes. The solution was transferred to ice until being loaded onto a 4 % polyacrylamide gel. Data was automatically collected once the Data Collection program was initiated and was automatically analyzed and read by the Sequence Analysis program. All editing was performed manually, the resulting sequences were aligned, and the consensus sequence was determined. Sequence analysis indicated that AA065978 was 1.6 kb in length and included a correctly processed transcript with splicing between domains 4 and 5 followed by a transmembrane region and a cytoplasmic tail. Protein homology between the deduced amino acid sequence for AA065978 and other known mouse ICAMs is set out below in Table 1. Table 1

Protein Homology Between Amino Acid Sequence of AA065978 and Known Mouse ICAMs

Because of the sequence similarity of the amino acid sequence of AA065978 to other known ICAMs, the EST was designated ICAM-6.

Example 2

Screening of a Mouse Testis Library for a Full Length Mouse ICAM-6 cDNA

Because the mouse EST AA065978 was identified in the database as being derived from mouse testis cDNA, a mouse testis library was screened in an attempt to isolate a full length cDNA encoding ICAM-6.

Approximately 1 x 10⁶ plaque forming units (pfu) from a mouse testis library (Stratagene, La Jolla, CA) were screened with a mouse ICAM-6 domain 5 probe labeled with ³²P-dCTP by PCR. The probe was generated with two rounds of PCR. In the first, the AA065978 plasmid was used as a template to amplify DNA encoding domain 5 in a PCR reaction using primers I6MO24

(SEQ ID NO: 5) and I6MO26 (SEQ ID NO: 12) primers.

I6MO26 AGTAGCTCCCCGTGTGGTTCTGGGTGGC SEQ ID NO: 12

The PCR was carried out in a DNA thermal cycler 480 (Perkin Elmer, Foster City, CA); each reaction contained 250 mM KC1, 100 mM Tris, pH 8.3, (Perkin-Elmer PCR buffer), 2 mM MgCl₂, 2 mM dNTPs, 100 μg/ml primers, with 0.125 μl Taq polymerase (Perkin-Elmer, Roche Molecular. Branchburg, N. J.) and 2 μl of AA065978 plasmid DNA per 25 μl reaction. A four minute denaturation step was performed at 94° C, followed by thirty cycles of denaturation 94°C for one minute, annealing at 50°C for thirty seconds, and extension at 72 °C for one minute. One single band was found to migrate on an agarose gel at the expected size. This 209 bp band was gel purified, diluted 1 :20 and used as template in a second PCR amplification.

In the second round of PCR, the ICAM-6 domain 5 DNA was labeled by carrying out seven identical 25 μl PCR reaction in which the 2 mM dCTP in the nucleotide mix was replaced with 20 Ci of dCTP ³²P (New England Nuclear, Boston, MA.) and 0.02 mM of unlabeled dCTP. PCR conditions were otherwise as in the first round of amplification. PCR polypeptides from the seven reactions were pooled and the probe purified from unincorporated nucleotides on a Sephadex G50 spin column (5 Prime, 3 Prime, Inc. Boulder, CO). Library phage were transferred to nylon membranes by standard methods and the filters were hybridized at 42 °C overnight in 50% formamide, 5X SSC, 5X Denhardt's solution and 0.5 % SDS with 1 x 10⁶ cpm/ml of labeled domain 5 probe. The next day the filters were washed three times in 2X SSC and 0.1 % SDS at room temperature for 15 minutes and once in 0.5X SSC and 0.1 % SDS at 50 °C for ten minutes. Filters were then exposed to film.

Eighteen positive clones were identified which were purified and sequenced. While three clones were found to be unspliced, fifteen were found to be correctly spliced and to include both transmembrane and cytoplasmic regions. The longest clone, designated MT-3, was found to be 2.3 kb long and encoded a region having four of the five extracellular domains characteristic of ICAM polypeptides and also included a poly(A)⁺ tail. Sequencing indicated that the 5 ' sequences were missing from the clone.

The sequence of MT-3 is set out in SEQ ID NO: 42. Example 3 Tissue Expression of Clone MT-3

In order to determine in which tissues ICAM-6 was expressed, a mouse multiple tissue northern blot (MTN) (Clontech, Palo Alto, CA) was screened with a ³²P-labeled ICAM-6 probe. The probe was a gel purified 1.4 kb PstllSacl DNA fragment from MT-3 that extended from the middle of domain 2 through the cytoplasmic tail of ICAM-6. The probe was labeled by random-priming using ³²P-dCTP and ³²P-TTP with a Random-priming Kit (Boehringer-Mannheim, Indianapolis, IN). Hybridization was carried out according to the manufacturer's suggested protocol.

Results identified a 3 kb transcript in testis, while RNA from normal heart, brain, spleen, lung, skeletal muscle, and kidney did not hybridize.

Example 4 RACE PCR to Determine 5 ' Terminus of Mouse IC AM-6

In order to determine the 5 ' sequence for mouse ICAM-6,

RACE PCR was carried out on a mouse testis Marathon-ready™ cDNA library

(Clontech, Palo Alto, CA). The cDNA had been prepared from a mouse testis

RNA sample and ligated to marathon cDNA adaptors; the marathon adaptors permit PCR using complementary primers AP-1 (SEQ ID NO: 13) and AP-2

(SEQ ID NO: 14).

AP-1 CCATCCTAATACGACTCACTATAGGGC SEQ ID NO: 13 AP-2 ACTCACTATAGGGCTCGAGCGGC SEQ ID NO: 14

In order to amplify a PCR fragment including the ICAM-6 leader, domain 1 , domain 2, and domain 3, two primers, I6MO40 (SEQ ID NO: 15) and I6MO39 (SEQ ID NO: 16) were designed based on the previously determined sequence for MT-3. I6MO40 GCTCACAATCTCTGCCTTCCCAACCTCC SEQ ID NO: 15 I6MO39 GACAGTGGCGGTGACCTCGGCTCTTTGG SEQ ID NO: 16

Primer I6MO40 corresponded to MT-3 domain 3 sequences and I6MO39 corresponded to sequences in MT-3 domain 2. The four primers were used in two rounds of PCR. In the first round, a 25 μl reaction was carried out with IX Klen Tag buffer, 2 mM dNTPs, 0.2 μM AP-1, 2 μg/ml I6M040, 0.5 μl Klen Taq polymerase solution, and 2.5 μl mouse testis cDNA library using an Advantage cDNA PCR kit

(Clontech) according to the manufacturer's suggested protocol. A "touchdown"

® PCR reaction was performed using a Gene Amp PCR system 9700 (Perkin

Elmer); the reaction was carried out with a one minute denaturation step, followed by five cycles of denaturation at 94 °C for five seconds and annealing/extension at 72 °C for two minutes, five cycles of denaturation at

94 °C for five seconds and annealing/extension at 70 °C for two minutes, and twenty-five cycles of denaturation at 94° C for five seconds and annealing/extension at 68 °C for two minutes.

Because these conditions did not yield an amplification product that could be detected on an agarose gel, PCR was repeated using primers AP-1 and I6MO40 but with annealing/extension temperatures that were 2°C lower for each cycle. Under these conditions, an amplification product of approximately 900 bp was detected on an agarose gel.

The amplification products from both PCRs were separately diluted 1:50 in water and used as template DNA for another PCR.

Amplification was carried out using either primers pairs AP-1 and I6MO40 or AP-2 and I6MO39. Reactions were performed in 50 μl volumes with the same makeup as described above and at the lowest temperatures (70° C, 68 °C, and

66 °C) as described above.

The resulting PCR products were analyzed using agarose gel electrophoresis which showed a DNA smear in addition to two bands that migrated at the expected size; a band of approximately 900 bp was detected from the reaction using primer pair AP-1 and I6MO40 and a band of about 700 bp was detected from the reaction using primer pair AP-2 and I6MO39. The 900 bp fragment was consistent with the size of a DNA expected to encode the leader and more than two domains from an ICAM.

The smaller 700 bp fragment was consistent with the size of a DNA predicted from use of the I6MO39 primer based on the location of complementary sequences in MT-3 compared to complementary sequences for primer I6MO40. The fragment was directly sequenced by PCR using primers AP-2 and I6MO37 (SEQ ID NO: 17) to permit deduction of a full length mouse ICAM-6 cDNA. The 900 bp amplification product was ligated into vector pCR2.1 using a TA cloning kit (Invitrogen, San Diego, CA) according to manufacturer's suggested protocol. Bacteria were transformed and plated. Plasmid DNA was recovered from selected colonies and screened by PCR using primer I6MO36 (SEQ ID NO: 18), corresponding to domain 2 sequences, and T7.1.

I6MO37 AGGAGTGAAGGCACCCAG SEQ ID NO: 17

I6MO36 CAGAGCCTCACCCTTACC SEQ ID NO: 18

One clone, designated "ICAM-6 mouse 5 'RACE clone #6," with the insert in the correct orientation to produce an antisense riboprobe (described below) were selected and the insert sequences again determined.

Sequence analysis indicated that clone #6 included 5 ' untranslated DNA and DNA encoding the leader sequence, domain 1 , domain

2, and a portion of domain 3. The complete 5 ' RACE sequence was combined with the MT-3

DNA to generate a complete cDNA encoding mouse ICAM-6. In order to confirm that the deduced amino acid sequence for mouse ICAM-6 was distinct from other known ICAMs, sequence comparison was carried out with the amino acid sequences for known mouse ICAMs. Comparison indicated that mouse ICAM-6 is a novel ICAM molecule having five extracellular immunoglobulin domains and having sequence homology to other mouse ICAM polypeptides. The amino acid comparison results are set out in Table 2.

Table 2

Amino Acid Sequence Comparison of Mouse ICAM-6 with Known ICAMs

Mouse Mouse Human

ICAM-6 ICAM-1 ICAM-2 ICA -5 ICAW-l ICAM-2 ICAM-R LW- 1CAM-5 ICAM-4

Domain 1 39 % 37% 38% 34 % 44% 33 % 29 % 36%

Domain 2 39% 42% 52% 44% 49 % 46% 26% 51 %

Domain 3 ₂₈% / 34% 35 % / 32% / 40%

Domain 4 29% / 30% 34% / 34% / ₃4%

1 Domain 5 34% / 36% 34% / 25% / 3-6% __j

Example 5

Construction of Soluble Mouse ICAM-6/IgGl Expression Plasmids

Protein Expression and Purification

A. ICAM-6 Dl-5 IgGl in Plasmid pDCl

In order to analyze the function of mouse ICAM-6, an expression construct was generated using plasmid pDCl. This construct encoded the extracellular domains 1 through 5 (D1-D5) of ICAM-6 as a chimeric polypeptide in association with the hinge CH2-CH3 domain sequences from IgGl . In the expression construct, the 3 ' end of the ICAM-6 coding region, corresponding to domain 3 through 5 sequences from MT-3, was generated by PCR using the primer pair I6MO43 (SEQ ID NO: 34) and I6MO44 (SEQ ID NO: 19).

I6MO43 ATGCCCTCGAGCAGGCCTTGGAC SEQ ID NO: 34 I6MO44 TCACGGCAGCTCAGCCACCAAGC SEQ ID NO: 19 To facihtate Ugation of the 3 ' ICAM-6 PCR-generated fragment to sequences encoding the IgGl fragment, an Xhol site was incorporated in the I6MO43 primer (underlined above). A 903 bp fragment encoding the human IgGl hinge CH2-CH3 [Burto, et al , Immunol. 22: 161-206 (1985)] was isolated from ICAM-1/IgGl/pDCl by digestion with Sail and Xbal; the 5 ' Sail overhanging end was compatible with the 3 ' Xhol overhanging end in the above PRC amplification product.

In producing the 3 ' end (encoding domains 3 through 5) of the ICAM-6 component of the fusion DNA, two 50 μl PCR reactions were carried out with MT-3 DNA as a template, I6MO43 and I6MO44 primers, "high fidelity" Pfu DNA polymerase (Stratagene, LaJolla, CA) with the corresponding dNTP and buffer according to manufacturers protocol. The PCR reactions were performed in Gene Amp^R PCR system 9700 (Perkin Elmer) as described above.

Samples were held at 94 °C for five minutes, followed by thirty cycles of: 94°C for 30 seconds; 55°C for 30 seconds; and 72°C for 30 seconds in a Gene Amp^R PCR system 9700 (Perkin Elmer). The PCR product of approximately 930 bp was gel purified using QIAquick Gel Extraction Kit (QIAGEN, Chatsworth, GA), digested with BgU and Xhol, and gel purified using the QIAquick kit.

The DNA fragment encoding the 5' end of ICAM-6 polypeptide was derived from HindmiBglΩ. digestion of the "5' RACE mouse ICAM-6 clone #6" clone described in the previous example.

The Hin miBgUI fragment encoding the 5 ' end of the ICAM-6 sequences, the BgWXhol fragment encoding the 3 ' end of the ICAM-6 sequences, and the SaRIXbal fragment encoding the IgGl hinged-CH2-CH3 were ligated together and inserted into pDCl previously digested with Hinάm and Xbal. The resulting plasmid was transformed into XL2 Blue Competent Cells

(Stratagene, LaJolla, CA) and transformants were screened by PCR using primers IC6MO36 (SEQ ID NO: 18) and IC6M043 (SEQ ID NO: 34). Clones found to be positive by PCR were verified by sequencing. Sequence analysis of the cDNA encoding the ICAM-6 region of the fusion protein indicated that one nucleotide encoding the amino acid at position 180 in the protein sequence was different from that in the MT3 clone; in the MT3 clone, the amino acid at position 180 was leucine, whereas the cDNA generated by RACE to provide the "5 ' RACE mouse ICAM-6 clone #6" encoded phenylalanine at position 180. The mutation, which may be a polymorphism or, alternatively may have arisen from the amplification process, was located between domains 2 and 3, outside of the immunoglobulin-like domains bounded by cysteine residues, and was thought to be inconsequential to the binding function of the extracellular domain.

B. Expression and Purification

COS cells were transfected with 20 μg of the above pDCl construct encoding ICAM-6/Ig using the DEAE-dextran method. Briefly, 20 ml of serum-free Dulbecco's Modified Eagle Medium (DMEM) containing 0.3 mg/ml of DEAE-dextran (Pharmacia, Uppsala, Sweden) and 0.1 mM chloroquine (Sigma, St. Louis, MO) was added to 50-80% confluent COS cells in 15 cm plates. After 2 hours of incubation at 37 °C and 5 % CO₂, the cells were incubated for 1 minute in DMEM containing 10% dimethyl sulfoxide (DMSO) and incubated overnight in DMEM supplemented with 10% FBS, 1 mM sodium pyruvate, 100 u/ml penicillin, 100 μg/ml streptomycin, and 2 mM L-glutamine. The following day the media was replaced with fresh media but with only 5% FBS. Supernatant was collected every two to five days, filtered through

0.2 μm filter and stored at 4°C until purification. ICAM-6/Ig protein concentration in the supernatant showed no significant decline for at least 3 weeks post-transfection.

ICAM-6/Ig protein was recovered from the COS supernatant using a

HiTrap Protein A column (Pharmacia). The column was initially equilibrated with at least 100 ml of calcium-free, magnesium-free phosphate buffered saline (CMF-PBS). Column loading was conducted using a Biorad Econo System. COS supernatant was loaded on the column at a rate of 1 to 2 ml/minute. After loading the supernatant, the column was washed with at least 100 ml of CMF-PBS. Protein was eluted using 100 mM citric acid, pH 3.0, directly into neutralizing buffer containing 1 M Tris, pH 9.0. The eluted protein was dialyzed against CMF-PBS for at least 24 hours with at least three changes of buffer using a Slide-a-Lyzer cassette (Pierce, Rockford, IL).

Dialyzed protein was concentrated, when necessary, using a BIOMAX 30 K centrifugal filter (Millipore, Bedford, MA) and protein concentrations were determined by capture EIISA as follows. Immulon 4 plates (Dynatech) were coated with 3 μg/ml of goat anti-human immunoglobulin (Jackson ImmunoResearch, West Grove, PA.) diluted in 0.1 M Na-carbonate/bicarbonate buffer, pH 9.6, for 1.5 to 2.5 hours at 37°C. Plates were washed three times with CMF-PBS containing 0.05 % Tween. Protein samples (diluted in DMEM with 5 % FBS) were added and incubated at 37 °C for 30 minutes. Plates were washed three times. Captured protein was detected with horse radish peroxidase (HRP) conjugated goat anti-human immunoglobulin (Jackson ImmunoResearch) diluted 1 :2000 in DMEM with 5 % FBS and incubated on plates for 30 minutes at 37° C. Plates were washed three times, developed with o-phenylenediamine (OPD) (Sigma) and read on a Dynatech MR5000 plate reader. Protein concentrations were estimated by comparison to an ICAM-1/Ig control. Protein purity was assessed by Coomassie staining of an SDS-PAGE gel containing 2 μg of purified protein. All ICAM-6/Ig preparations were found to be 50% to 90% pure with only bovine immunoglobulin as an obvious contaminant.

C. ICAM-6 Dl-5/IgGl in Plasmid pDEF-1

In an attempt to increase expression levels, an ICAM-6/Ig construct was made in vector pDEF14 for expression in CHO cells. The pDEF14 vector includes the Chinese hamster EF-lα promoter which has previously been shown to permit high levels of expression in CHO cells. The ICAM-6/Ig sequence was removed from the pDC-1 construct by digestion with Hindm and Xbal. The fragment was gel purified and ligated with the 738 bp NotllHindlD. fragment and the 19,723 bp NotllXbal fragment from pDEF14. D. Expression and Purification

The pDEF14/ICAM-6/Ig plasmid was transformed into XL-2 Blue competent cells (Stratagene) and colonies were screened by PCR. The resulting clone pDEF-14/ICAM-6/Ig was used to stably transfect CHO cells. Briefly, cells were recovered from a 50% confluent CHO culture using 0.05% trypsin/0.53 mM EDTA and quenched with DMEM/F12 media containing 10% FBS, 1 mM sodium pyruvate, 100 u/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, 0.1 mM sodium hypoxanthine, and 1.5 mM thymidine (HT plus DMEM/F12). Recovered cells were washed with CMF-PBS. Approximately 20 x 10⁶ cells were transfected with 50 μg of DNA, previously ethanol precipitated and resuspended in 800 μl HBS buffer containing 20 mM HEPES-NaOH, pH 7, 137 mM NaCl, 5 mM KC1, 0.7 mM Na₂HPO₄ and 6 mM dextrose, using a Biorad GenePulser electroporator with capacitance set at 960 μF and voltage at 290V. Following electroporation, cells were allowed to recover at room temperature for ten minutes. Cells were washed with 10 ml of HT plus DMEM/F12, pelleted by centrifugation and resuspended in order to seed two 10 cm plates containing HT plus DMEM/F12. Two days after transfection, the transfectants were harvested with trypsin/EDTA and used to seed 15 cm plates at 1:8, 1: 16, 1:32, and 1:64 dilutions in DMEM/F12 media containing 10% FBS, 1 mM sodium pyruvate, 100 u/ml penicillin, 100 μg/ml streptomycin, and 2 mM L-glutamine. Two weeks later, approximately 300 colonies had formed. Colonies were recovered using trypsin/EDTA as above, and used to seed well plates at a calculated single cell/well. Eighteen days later, 120 single colony wells were screened by ELISA as above with the COS produced protein. Eighteen of these clones were expanded and rescreened three days later by EliSA. Four clones were chosen for further expansion which producing an estimated 3.7 μg of ICAM-6/Ig/ml of supernatant in three days.

Example 6 Isolation of a Full Length Mouse ICAM-6 cDNA

In attempting to isolate a full length mouse ICAM-6 cDNA, a second screening was carried out on 2 x 10⁶ pfu from a commercial mouse testis library (Stratagene) using the MT3 clone described in Example 2. Hybridization conditions were as described above except that the library was hybridized with an ICAM-6 domain 2 probe. The probe was generated with PCR using primers I6MO36 (SEQ ID NO: 18) and I6MO37 designed based on domain 2 sequences from the MT-3 sequence.

I6MO36 CAGAGCGTGACCCTTACC SEQ ID NO: 18

I6MO37 AGGAGTGAAGGCACCCAG SEQ ID NO: 17

The probe was labeled using two rounds of PCR and hybridization was carried out as described in Example 2.

Eleven clones were identified and only one, designated MT2-36, appeared to encode full length ICAM-6. The clone contained two inserts, a 0.8 kb insert that encoded a phosphatase and a 2.8 kb insert encoding mouse ICAM-6. The 2.8 kb mouse ICAM-6 insert was analyzed. Sequence analysis indicated that the MT2-36 sequence was identical to the ICAM-6 sequence deduced from the MT-3 sequence and the RACE amplification product discussed in Example 4. The nucleotide sequence of the MT2-36 clone (ICAM-6) is set out in SEQ ID NO: 1 and the amino acid sequence deduced therefrom is set out in SEQ ID NO: 2 A plasmid MT2.36 encoding MT2-36 was deposited under the terms of the Budapest Treaty in a bacterial host with the American Type Culture Collection, 12301 Rockville MD, 20852 on October 16, 1997 and assigned Accession No: 98557.

Example 7

Construction of Additional ICAM-6 Expression Plasmids

In an attempt to improve the expression of soluble mouse ICAM-6 and to eliminate the Phe¹⁸⁰ mutation found in the previous ICAM-6/IgGl chimera (Example

5), an expression construct was generated encoding ICAM-6 domains 1-5 /IgGl in the pCI-neo vector (Promega, Madison, WI). A second expression construct was also generated that contained a glutamate (Glu)-to-alanine (Ala) mutation at position 38.

This Glu³⁸ is part of a conserved motif in the domain 1 (Ile-Glu-Thr-Phe) of ICAM-6 that has been shown in ICAM-1 and ICAM-3 to be essential for binding LFA-1. Therefore, by analogy with the other ICAMs, this change in amino acid sequence was expected to eliminate a putative LFA-1 binding site in domain 1.

A. ICAM-6 Domains 1-5/IgGl in pCI-neo for Functional Analysis To make this construct, the ICAM-6 leader region through domain 3 was amplified by PCR using the MT2-36 clone as a template. Two primers were designed; I6MO55 (SEQ ID NO: 28) was complementary to the 5' end of mouse ICAM-6 and I6MO56 (SEQ ID NO: 29) was based on sequences in domain 3.

I6MO55 GCGATGCTAGCAAGCTTCACAGCTCATCACCATGGCAATG- CTTCTGTTGGGTGTCTGGACACTGCTGGCC SEQ ID NO: 28

I6MO56 GGACCCAGAGACACAAGGCAAGTCAGTTCC SEQ ID NO: 29

The I6MO55 primer contained a short Kozak sequence (in italics) previously shown to induce high levels of ICAM expression in other constructs, and two cloning site (Nhel and Hindm, underlined). The PCR reaction was carried out using the MT2-36 DNA as a template, primers I6MO55 and I6MO56, and "proof-reading" Pwo DNA polymerase (Boehringer Mannheim, Indianapolis, IN) according to manufacturer's protocol. Samples were held at 95 °C for one minute and then run through 30 cycles of 94 °C for 15 seconds, 50 °C for 30 seconds, and 72 °C for 45 seconds in a Gene

® Amp PCR system 9700 (Perkin Elmer). The PCR product (approximately 880 bp) migrated on gel electrophoresis at the expected size. The fragment was gel purified, digested with Nhel and BgM, and again gel purified (Wizard PCR purification kit,

Promega, Madison, WI).

Construction of the mouse ICAM-6 domain 1-5/IgG chimera was carried out in two steps. First, the ICAM-6 NhellBglll fragment (encoding the leader to domain 3) was ligated to a ICAM-6 BgMlXhol fragment (encoding domains 3 to 5) described in Example 5, and inserted into the vector pCI-neo that had been previously cleaved with Nhel and Xhol. The resultant plasmid was transformed into XL1 Blue Ultracompetent cells (Stratagene, La Jolla, CA) and colonies were examined for the presence of a plasmid with the correct insert by PCR using T3.1 (SEQ ID NO: 4) and T7.1 (SEQ ID NO: 3) primers. In the second step, the resultant plasmid from step one was digested with

Xliol and Xbal, and gel purified. The 903 bp SaWXbal human IgGl hinge CH2-CH3 fragment described in Example 5 was ligated to the ICAM-6 and vector sequences. The resulting plasmid was transformed into E. coli XL1 Blue cells as described above and the bacteria were screened by PCR for the presence of a plasmid with the correct size of insert. Clones were analyzed by sequencing to verify the presence of a correct insert and the absence of the Phe¹⁸⁰ mutation.

B. ICAM-6 Domains 1-5/IgGl in pCI-neo with

Glutamate/ Alanine Mutation For Functional Analysis

For this construct, Glu³⁸ was replaced with an alanine in order to eliminate the putative LFA-1 binding site. Three primers were designed to create the mutation. The first primer, I6MO57 (SEQ ID NO: 30) was a sense primer in which the glutamate codon GAG was replaced by an alanine codon GCG (underlined). The second primer, I6MO58 (SEQ ID NO: 31) was an anti-sense primer in which the antisense glutamate codon CTC was replaced by an antisense alanine codon CGC (underlined). The third primer, I6MO59 (SEQ ID NO: 36) was identical to the 5' end of I6MO55 but smaller.

I6MO57 CCTGGGCCCAGTGGAATCG-CGACCTTCTAA SEQ ID NO: 30

I6MO58 TAAGAAGGTC-3-CGATTCCACTGGGCCCAGG SEQ ID NO: 31

I6MO59 GCGATGCTAGCAAGCTTCACAGCTCATCACC SEQ ID NO: 36

The mutation was created using two rounds of PCR. In the first round, two fragments were created containing the alanine mutation; one 217 bp 5' fragment was created with primers I6MO55 and I6MO58 and one 728 bp 3' fragment created with primers I6MO57 and I6MO56. The first round of PCR was performed using MT2-36 DNA as a template and Pwo DNA polymerase as described above. Both fragments generated in the PCR reactions were gel purified and then diluted 1/50 to be used as templates in a second round of PCR. In order to generate a single DNA fragment containing the ICAM-6 leader to domain 3 region and the Glu³⁸/ Ala³⁸ mutation, a second round of PCR was performed. Primers I6MO59 and I6MO56 were employed and the template was a mixture of the 217 bp and 728 bp fragments generated in the first round of PCR. The two DNA fragments overlapped by 30 bp and therefore annealed to each other during the annealing step of the PCR reaction. Extension of the single stranded regions yielded a 915 bp fragment that contained a region from the ICAM-6 leader to domain 3 and included the Ala³⁸ mutation. The PCR reaction was carried out with Pwo DNA polymerase as described above.

The resulting 915 bp ICAM-6 fragment was digested with Nhel and BgB and gel purified. The fragment was combined with the BgMlXhol ICAM-6 fragment (domain 3 to 5) described above and ligated into the vector pCI-neo previously digested with Nhel and Xhol to yield the pCI-neo ICAM-6 (leader-domain 5, Ala³⁸) plasmid.

Finally, a SaWXbal IgGl-Fc fragment was inserted into the plasmid as described above. The resulting plasmid encoded a ICAM-6 Ala³⁸/IgG chimera which was verified by sequencing.

C. FLAG -tag and HIS-tag ICAM-6 Domains 1-3 in pBAR8a

The presence of the human IgGl in the mouse ICAM-6/IgGl chimera was believed to make it difficult to use the expressed polypeptide as an immunogen for raising polyclonal antibodies for immunohistochemistry. Therefore, an expression construct was prepared that would allow the production of soluble mouse ICAM-6 without the IgGl antigen. To produce a soluble ICAM-6 molecule, the first three domains of mouse ICAM-6 were inserted into a bacterial expression vector pBAR8a. Proteins expressed using this vector are transcribed under control of an inducible arabinose

® promoter. The pBAR8a plasmid encodes a FLAG tag sequence (SEQ ID NO: 35) and a HIS tag sequence (SEQ IS NO: 32) in the cloning site which allow the detection and

® purification of the fusion protein with anti-FLAG antibodies and a nickel purification column, respectively.

FLAG tag TATAAGGATGACGATGACAAG SEQ ID NO: 35

HIS tag CATCACCATCACCATCAC SEQ ID NO: 32

The first three domains of mouse ICAM-6 were chosen for two reasons. First, antibodies were desired that were immunoreactive with the N-terminal portion of the ICAM-6 molecule that could block ICAM-6 function and also detect the molecule on tissue sections. Secondly, based on experience with other ICAM proteins, it was thought to be likely that expression of the first three domains would yield a soluble protein in E. coli.

The first three domains of the mouse ICAM-6 were inserted into ® pBAR8a in frame with the FLAG and HIS tag sequences. DNA encoding the ICAM-

6 domain 1 to domain 3 fragment was first generated by PCR. One primer, I6MO52

(SEQ ID NO: 33), was designed to be complementary to the 5' end of domain 1 and including a Kpnl (underlined) site to allow positioning of domain 1 in frame with the ® FLAG and HIS tag sequences. Another primer was designed to be complementary to the 3' end of the domain 3, 16M054 (SEQ ID NO: 37), and to contain a Spel site

(underlined) to allow cloning in pBAR8a and a stop codon (in italics) to stop the translation of the ICAM-6 fusion protein.

I6MO52 CGAGGAGCTGTTTCAGiiTACCTGTCC SEQ ID NO: 33

I6M054 CGTTCA- -AQTTTTCTGCTCrC GGGACC SEQ ID NO: 37 PCR amplification was carried out using the mouse ICAM-6 clone MT2-36 as a template, the I6MO52 and I6MO54 as primers, and "proof-reading" Pwo DNA Polymerase (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's protocol. The reaction was denatured for four minutes at 94° C, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 52°C for 30 seconds, and

® extension at 72 °C for one minute in a Gene Amp PCR system 9700 (Perkin Elmer).

A 800 bp PCR fragment that migrated at the expected size was gel purified (Wizard

PCR Purification System, Promega), digested with Kpnl and Spel, gel purified again, ligated to gel purified pBAR8a previously digested with Kpnl and Spel. The resulting plasmid was transformed into DH5α competent cells (Gibco BRL, Gaithersburg, MD) according to the manufacturer's protocol, and plated on tetracycline agarose plates.

® The presence of a correct FLAG -HIS tag/ICAM-6 insert was verified by sequencing.

In order to produce the ICAM-6 fusion protein, the ICAM-6/pBAR8a plasmid was transformed into an E. coli strain which was deficient in arabinose catabohsm. In a small scale experiment, a transformed colony was grown at 30° C and arabinose added to a final concentration of 0.5% in order to induce protein expression.

Samples were taken at one hour and two hours post-induction, pelleted by centrifugation, and resuspended in cold CMF-PBS. The presence of expressed protein was checked on a 12 % SDS-page gel (Novex, SanDiego, CA). A protein migrating at about 38 kD was detected which corresponded

® to the expected molecular weight of an ICAM-6 domain 1-3/FLAG -HIS tag fusion protein. The ICAM-6 fusion protein is purified using a nickel purification column (Ni-

NTA Silica, QIAGEN, Chatsworth, GA) according to standard protocol.

D. ICAM-6 Domains 1 to 5 in pCI-neo Another soluble ICAM-6 construct was generated by fusing the 5

® extracellular domains of ICAM-6 to a carboxy terminal FLAG tag for expression in mammalian cells to generate polyclonal antibodies, either in rabbit or chicken, where it would be undesirable to have reactivity to IgGl . ® The FLAG tag was incorporated onto the 3' end of ICAM-6 by PCR using the primers I6MO44 (SEQ ID NO: 19) and I6MO45 (SEQ ID NO: 39).

I6MO44 TCACGGCAGCTCAGCCACCAAGC SEQ ID NO: 19

I6MO45 AATTTCTCGAGTCACTTGTCATCGTCGTC- CTTGTAGTCCTCAGGCAGGCCTTGGAC SEQ ID NO: 39

The primers were used in two 50 μl PCR reactions with MT-3 DNA as a template. Samples were held at 94 °C for five minutes and then run through 30 cycles of 94 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 30 seconds. The PCR product (about 850 bp) was gel purified, digested with Xhol and BgM, and again gel purified (QIAquick Gel Extraction Kit, QIAGEN, Chatsworth, GA). The 5 ' end of the ICAM- 6 was isolated by digesting the "5' RACE ICAM-6 clone #6" described in Example 4 with Spel and BgM and gel purifying the 720 bp DNA fragment. The DNA fragments containing the 5'- and 3 '-ends of the ICAM-6 were ligated into pCI-neo previously digested with Nhel and Xhol. The ligation mix was transformed into XL2 Blue competent cells and transformants were screened by PCR. ICAM-6 sequences of the plasmid were confirmed by sequencing as described above. Three clones with the correct sequence were transfected into COS cells as previously described for the

ICAM-6/Ig construct.

Expression of the desired protein was undetectable by Western blotting ® using M2 anti-FLAG monoclonal antibody (Eastman Kodak Company, New Haven,

CT).

Example 8 Preparation of Anti-Mouse ICAM-6 Antibodies

Anti-mouse ICAM-6 monoclonal antibodies can be generated by different approaches. A. Mouse Intrasplenic Injection

Two mice were pre-bled and immunized on day 0 by intrasplenic injection with 5 μg of ICAM-6/IgGl chimeric protein in PBS. Immunization was carried out by a previously reported method [Spitz, Meth. Exnzymol. 121:33-41 (1986)]. On day 11 , the mice were bled and serum assayed by EHISA for reactivity to immobilized antigen. Briefly, Immulon 4 plates (Dynatech, Cambridge, MA) were coated with goat anti-human antibody that had been preadsorbed to bovine and mouse serum proteins (Jackson Immunoresearch). Plates were washed and COS supernatant containing ICAM-6 IgGl was added. As a negative control, ICAM-1/IgGl fusion protein, diluted to 2 μg/ml in RPMI with 10% FBS, was similarly immobilized. After the plates were incubated and washed, pre-immune or immune mouse sera were added. A goat anti-mouse IgGl(fc) horseradish peroxidase-(HRP) conjugated antibody (Jackson) was used to detect any mouse anti-ICAM-6 antibody.

Results indicated that the mouse immune sera showed no reactivity to either immobilized ICAM-6 or ICAM-1 fusion protein as compared to pre-immune sera, so no further immunization by this procedure was pursued.

B. Hamster Intrasplenic Injection

One Armenian hamster (Cytogen Research and Development, West Roxbury, MA) was pre-bled and immunized on day 0 by intrasplenic injection as described above with 5 μg of the ICAM-6/IgGl chimeric protein in PBS. A test bleed at day 11 was assayed by EIISA, also as described above except that immobilized ICAM-3/IgGl was used as a negative control and a goat anti- Armenian hamster IgG HRP-conjugated antibody was used to detect serum reactivity.

Results showed weak reactivity of the serum with immobilized ICAM-6 as compared to ICAM-3.

On day 14, the hamster was again injected intrasplenically with the same antigen described above. Because the hamster died during anesthesia, the spleen was immediately removed and cultured as a single cell suspension in the presence of the ICAM-6/IgGl antigen as described in a previously reported technique [Boss, Meth. Enzymol. 121:27-33 (1986)]. After four days, the splenocytes were harvested and fused with NS-1 cells using standard procedures. After eleven days, hybridoma culture supernatants were screened by ELISA against immobilized ICAM-6/IgGl or ICAM- 3/IgGl as described above.

Results showed no specific reactivity with ICAM-6.

C. Hamster Immunization with

ICAM-6 Dl-5/IgGl in Freund's Adjuvant

Two Armenian hamsters (Cytogen Research and Development, West Roxbury, MA) were pre-bled on day 0 and immunized with 50 μg of ICAM-6/IgGl fusion protein in complete Freund's adjuvant, total volume 200 μl. On day 15, the hamsters were boosted with 50 μg of the same antigen in incomplete Freund's adjuvant

(TFA). On day 25, the animals were bled and antibody titer was determined by ELISA.

Immulon 4 plates (Dynatech, Cambridge, MA) were coated with goat anti-human antibody that had been pre-adsorbed to bovine and mouse serum proteins (Jackson Immunoresearch, West Grove, PA). ICAM-6/IgGl fusion protein was captured from supernatant of COS transfected cells (described in Example 5). ICAM- 1/IgGl fusion protein was diluted to 2 μg/ml in RPIvfl with 10% FBS and captured in separate wells as a negative control. Pre-immune and immune sera from the hamsters were diluted and added to separate wells after ICAM-6/IgGl capture. A goat anti- hamster horseradish peroxidase (HRP) conjugated antibody was used to detect the hamster antibody.

Immune sera from both hamsters showed reactivity over the preimmune sera at the highest dilution tested (1:1,600) in both the ICAM-6/IgGl and ICAM- 1/IgGl wells. In order to determine specificity of serum antibody binding, another ELISA was performed wherein ICAM-1/IgGl was added to the diluted hamster serum, thereby absorbing the reactivity to the IgGl portion of both fusion proteins. Specific reactivity to captured ICAM-6/IgGl was not detected. In an attempt to improve the antigenic response in the hamsters, boosters are administered periodically over a four week period using ICAM-6/IgGl in IFA. When specific reactivity is detected, the hamsters are boosted one final time by intraperitoneal injection with ICAM-6/IgGl in phosphate buffered saline (PBS) and the spleen is sterilely removed four days later. The splenocytes are fused to NS-1 myeloma cells (A.T.C.C , Rockville, MD) at a ratio of 2:1 according to standard methods. Culture supernatants are screen by ELISA as described above using captured ICAM-6/IgGl and ICAM-1/IgGl .

D. Rabbit Immunization to Produce Polyclonal Antisera Soluble ICAM-6 expressed as a chimeric protein including domains 1

® to 3 and FLAG /HIS tag sequences is used as an immunogen to produce polyclonal antisera useful for immunohistochemical staining.

New Zealand white rabbits are each injected sub-cutaneously with 50 to ® 150 mg of the ICAM-6/FLAG -HIS fusion protein in complete Freund's adjuvant. Subsequent injections with a similar amount of immunogen but in incomplete Freund's adjuvant are administered at three to four week intervals. Rabbits are bled seven to fourteen days after a third and each subsequent injection and serum assayed by ELISA for specific reactivity to ICAM-6/IgG fusion protein. When specific reactivity is detected, Western analysis and immunocytochemistry are carried out using standard techniques.

Example 9 Functional Analysis of Mouse ICAM-6

In order to determine the biological relevance of ICAM-6, adhesion assays were performed using immobilized mouse ICAM-6/IgGl fusion protein (Example 5) and cells that express integrins which bind to known ICAMs. A. Analysis of ICAM-6/LFA-1 (CDl la/CD18) Binding

A first adhesion assay was carried out using immobilized ICAM-6/IgGl and a mouse T-cell line, PLP, known to express CDlla/CD18 and no other CD18 integrins. Two other cell lines, the human B lymphoblastoid cell line JY-8 and the human promyelomonocytic cell HL-60, were also used in the assay. As a negative control, the mouse pre-B myeloma cell line, NS-1, which does not express CD18 integrins, was also assayed.

Adhesion assays were performed in 96-well Easy Wash plates (Coming) using a modification of a previously reported procedure [Morla et al. , Nature 367: 193- 196 (1994)]. Each well was coated with 50 μl of 5 μg/ml mouse ICAM-6/Ig fusion protein or 5 μg/ml human ICAM-1/Ig protein, both from stock solutions in 50 mM bicarbonate buffer (pH 9.6). Control wells to quantitate binding 100% of input cells were coated with anti-CD18 monoclonal antibodies, anti-CD18 antibodies M17 or 22F12C for human cells, or anti CDlla antibodyM17 and anti-CD3 antibody 145-2C11 for mouse cells. Control wells to determine the background binding were coated with bovine serum albumin (BSA). After addition of either mouse ICAM-6 or mouse ICAM-1 fusion protein, wells were blocked with 1 % BSA in PBS for one hour at room temperature. Wells were rinsed and 200 μl of adhesion buffer containing 5 mM KC1 , 150 mM NaCl, 1 mM MgCl₂, 1 mM CaCl₂, 20 mM HEPES, 10 mM D-glucose, and 5 % FBS was added either with or without phorbol 12-myristate 13-acetate (PMA) (20 ng/ml). In order to determine the specificity of binding, a monoclonal antibody immunoreactive with CD18, antibody 2E6, or with human CDlla, antibody TS1/22, (ATCC), was added to the adhesion buffer. Cells (100 μl of 5 x lOVml) were then added to each well and plates were incubated at 37°C, in 5% CO₂ for 30 minutes. Adherent cells were fixed with the addition of 50 μl of glutaraldehyde solution, washed and stained with 0.5% crystal violet (Sigma) solution. After washing and the addition of 70% ethanol, adherent cells were quantitated by determining absorbance at 570 nm using a SPECTRAmax™ 250 microplate Spectrophotometer system (Molecular Devices). Percent adherent cells was determined using the formula: A₅-,₀ (binding to ICAM-1 or ICAM-6) - A₅₇₀ (binding to BSA) A₅₇₀ (binding to positive control antibody) X 100

Results indicated that the PLP cells preferentially bound to immobilized ICAM-6/IgGl compared to a negative control NS-1 cell line. PLP binding was dependent on the concentration of immobilized ICAM-6/IgGl and was blocked in the presence of anti-CD 18 antibodies. In addition, PLP binding increased in the presence of PMA which is known to activate CD1 la/CD18 integrin. Binding of the PLP cells was not detected in wells coated with human ICAM-1/IgGl. The JY-8 cells and the HL-60 cells also bound immobilized ICAM-6/IgGl and the binding was blocked in the presence of the anti-human CDl la antibody. These results indicated that mouse ICAM-6 is capable of binding both mouse and human CDlla/CD18.

B. Analysis of ICAM-6/Mac-l (CDllb/CD18) and ICAM-6/pl50/95 .CDllc/CD^ Binding

In order to assess mouse ICAM-6 binding to CDllb/CD18 and CDl lc/CD18, the mouse monocyte cell line, RAW 264.7 which expresses both integrins, and the human HL-60 cell line, which expresses CDllb/CD18, were utilized in an adhesion assay as described above. Specificity of binding was determined using an anti-mouse CDllb antibody (Ml/70), an anti-mouse CDllc antibody (N418), an anti-mouse CD 18 antibody (2E6), an anti-human CDl lb antibody (44AACB), or an anti-human CD18 antibody (22F12C). In addition, specificity of antibody blocking was determined using a non-blocking mouse CD18 antibody (M18).

Results indicated that the RAW 264.7 cells bound immobilized ICAM-6 and that the binding was inhibited in the presence of both anti-mouse CDllb, anti- mouse CDllc, and anti-mouse CD 18 monoclonal antibodies. Binding was unaffected by the non-blocking anti-CD18 antibody, however. HL-60 also bound to the ICAM- 6/IgGl coated wells and the binding was blocked with the anti-human CDllb antibody. These results demonstrated that mouse ICAM-6 binds both mouse and human CDl lb/CD18 and to mouse CDl lc/CD18. C. Analysis of ICAM-6/A1pha-d Binding

Adhesion of α_d to ICAM-6 was tested with Chinese hamster ovary (CHO) cells stably transfected with cDNA encoding rat α_d and human CD18. The α_d/huCD18 CHO cells were tested for adhesion to either immobilized mouse ICAM- 6/IgGl, human ICAM-1/IgGl, or human VCAM-1/IgGl fusion protein as described above. Specificity of binding for α_d was determined using an anti-rat _d monoclonal antibody (205C) and an anti-human CD18 monoclonal (22F12C). A non-binding antibody was used as a negative control for the binding of human VCAM-l/IgGl to _d. Preliminary results indicated that mouse ICAM-6 binds rat _d/CD18 integrin.

Example 10 In situ Hybridization of Mouse ICAM-6 Transcription

In order to identify cells in which ICAM-6 is expressed, in situ hybridization was performed with mouse ICAM-6 riboprobes on mouse testis tissue sections. ICAM-6 domain 1 and 2 anti-sense riboprobes were used to detect ICAM-6 mRNA in mouse testis tissue sections. ICAM-6 sense probes that could not hybridize to ICAM-6 mRNA were used as a negative control.

The probes were labeled by RNA transcription with α-³⁵S UTP according to manufacturer's protocol (Stratagene). Frozen tissue sections were deposited on coated slides (Superfrost Plus VWR, Seattle, WA), fixed in paraformaldehyde, denatured, dehydrated through a series of ethanol washes, and dried. The tissue sections were hybridized overnight at 50° C in 50% formamide, 0.3

M NaCl, 20 mM Tris pH 7.5, 5 mM EDTA, IX Denhardt's Solution, 10% dextran sulfate, 0.5 mg/ml yeast RNA, 100 mM dithiothreitol (DTT), and 5 x 10⁵ cpm of probe per tissue section. The slides were washed in 4X SSC containing 10 mM DTT at room temperature for one hour, washes in 50% formamide IX SSC containing 10 mM DTT at 60°C for 40 minutes, washed once in 2X SSC, and washed once in 0.1X

SSC, the last two washes at room temperature for 30 minutes with gentle stirring. The tissue sections were dehydrated, air dried, coated with photographic emulsion (Kodak NTB2 Nuclear Emulsion, International Biotechnologies, Hartford, CT), and exposed. After development, tissue sections were counterstained with hematoxylin-eosin and silver grains visualized by darkfield microscopy. A strong hybridization signal was detected on primary spermatocytes within the tubules of mouse testis after a four day exposure with the mouse ICAM-6 antisense probe. In sharp contrast, the testis tissue section hybridized with the control ICAM-6 sense riboprobe did not show any hybridization.

Example 11 Identification of a Partial Human Genomic ICAM-6 DNA

The mouse AA065987 sequence was used as the query sequence in a second BLASTN search in order to determine that the sequence was not identical to any

Genbank sequences. From the Genbank database, a human genomic sequence of approximately 66.5 kb designated J03071 was identified that contained regions having approximately 70% nucleotide homology to the corresponding sequence in AA065987 and approximately 61 % homology at the amino acid level. In addition to the sequences homologous to AA065987, J03071 includes the complete protein coding region for human growth hormone (GH1 and GH2) and chorionic somatotropin polypeptide hormones 1 , 2, and 5. The chromosomal location of J03071 (17q22-24) was determined to be in the vicinity of genes encoding PECAM (17q23) and ICAM-2 (17q23-17q25).

Within the genomic J03071 DNA sequence, five regions were identified that encoded protein sequences with homology to known ICAMs. The five regions of DNA appeared to represent one partial and four complete exons. By examination of the protein sequences encoded by the five regions and by analogy to the intron/exon splicing pattern of ICAM- 1, the five protein coding regions were designated exons 2 through 6. The first region, exon 2, (nucleotides 66,422 to 66,495) with homology to a portion of domain 1 in ICAMs. The sequence extended to the end of the J03071 DNA and therefore most likely represented only a portion of exon 2. When the region designated domain 2 (encoded by exon 3, nucleotide 64,225 or 66,226 to nucleotide 64,544) was translated, a frameshift was required to maintain the open reading frame and homology to other ICAMs. Exon 4, encoding domain 3 from nucleotides 63,697 to either 63,975 or 63,976, encoded a complete open reading frame and showed homology to known ICAMs. Two stop codons were found in domain 4, encoded by exon 5 (nucleotides 62,895 to 63,163), and one stop codon was found in domain 5, encoded by exon 6 (nucleotides 61,329 to 61,569). In all domains, however, the amino acid sequences included conserved cysteines residues along with amino acid sequences around the cysteine that are characteristic of ICAMs. When the amino acid sequences of the various domains encoded by J03071 were compared to the known ICAMs, the percent identity calculated was typical for a comparison of any two given ICAM sequences; the results of the comparison analysis are set out in Table 3. Because of the "typical" amino acid identity and protein structure, the polypeptide encoded by J03071 was designated ICAM-6. While the frameshift in domain 3 and the stop codon(s) in domains 4 and 5 may reflect sequencing errors, it is also possible that the putative ICAM-6 coding region of J03071 may be a pseudogene and not encode a functional polypeptide.

The portion of J03071 that included the five regions of homology to known ICAMs was used in a BLASTN search of the EST database. Two ESTs, H79158 and H54052, were identified. The two ESTs were identified as having been isolated from a fetal liver and spleen library and included exons and adjacent intron nucleotides indicating that they were unspliced cDNAs.

Table 3 Human ICAM-6 Protein Homology to Other Human ICAMs

Using the mouse ICAM-6 sequences, an additional region of homology was seen in the J03071 genomic sequences. This region encodes an animo acid sequence with 48 % homology to the transmembrane region and cytoplasmic tail of the mouse ICAM-6 and thus probably represented the corresponding human sequence. The sequences encoding this putative transmembrane/cytoplasmic tail are contiguous which is consistent with what is seen for other ICAM genes when they are found within the same exon. The transmembrane/cytoplasmic region in J03017 corresponds to nucleotides 60,912 to 61,135.

Example 12 Tissue and Cell Expression of Human ICAM-6

Two approaches were utilized to identify an appropriate cell or tissue source from which to attempt to isolate a full length human ICAM-6 clone. In a first analysis, cDNA samples from several cell lines and from several cDNA libraries were screened by PCR using primers corresponding to domains 1 and 3 of human ICAM-6.

In a second approach, domain 3 of ICAM-6 was cloned by PCR and used as a probe for Northern blot analysis of human RNA samples. A. Test PCR Analysis and Cloning of ICAM-6 Domain 3

In order to be able to carry out the two approaches described above, PCR conditions needed to be determined under which domain 3 from ICAM-6 would be amplified as a means to detect the presence of ICAM-6 cDNA and to clone the ICAM-6 domain for use as a Northern analysis probe. Primers 1601 , 1602, 1603, and 1606 were designed based on sequences located in domain 3 as determined from the J03071 sequence. Primers 1603 and 1606 were also designed to created EcoRI and Xhol restriction sites, respectively, (underlined in sequences set out below) to facilitate the subsequent cloning process.

1601 CTTTTGGAGGCTGGGATG SEQ ID NO: 38

1602 CATTGCACCCAGAGATGC SEQ ID NO: 20

1603 ATA⁽3 Δ1I-CCTTTTGGAGGCTGGGATG SEQ ID NO: 21 1606 TAACT-CQAQCATTGCACCCAGAGATGC SEQ ID NO: 22

PCR amplification was first performed using genomic DNA purified from peripheral blood lymphocytes as a template. PCR reactions were performed with the same buffers as described in Example 2. In order to optimize production of the amplification product, reaction conditions were varied with respect to MgCl₂ concentration (1.5 mM,

2 mM) and temperature of annealing (50° C, 55 ^CC, 60 °C); the various reactions were carried out simultaneously on three DNA thermal cycler 480 (Perkin Elmer, Foster City, CA). Thermal conditions for all reactions included first a four minute denaturation step at 94°C, followed by three cycles of denaturation at 94 °C for one minute, annealing at either 50°C, 55°C or 60°C for 30 seconds, and extension at 72°C for one minute. Resulting amplification products were analyzed using agarose gel electrophoresis and under all tested PCR conditions, fragments migrating at the expected size, a 210 bp fragment using primer pair I6O3/I6O6 and a smaller fragment using primer pair I6O1/I6O2, were detected.

The products from all reactions were pooled and precipitated with 30 μg of carrier yeast RNA in 0.3 M sodium acetate and two volumes of ethanol. The amplification products and BSE SK+ vector (Stratagene) were digested with EcoΕI and Xhol, both the fragment and the linearized vector gel purified (QIAGEN kit), the two DNAs ligated together, and the resulting plasmid transformed into XL1 Blue Ultracompetent cells (Stratagene, La Jolla, CA) according to the manufacturer's suggested protocol.

Single colonies were selected and screened by PCR for the presence of the ICAM-6 domain 3 by two series of PCR amplification using the bacterial DNA as templates. In one series of PCR, the presence of a correct 330 bp insert was checked using the T3.1 and T7.1 primers. In a second PCR reaction, the presence of ICAM-6 domain 3 in the same bacteria was checked by combining ICAM-6 and vector primers as follows. Using T3.1 and primer I6O8, a 259 bp PCR product was expected and using primer T7.1 and I6O7, a 215 bp amplification product was expected.

1607 GCGAGGTGGCTAGGGTGTTTCCAGC SEQ ID NO: 23

1608 CCTGATCACCAGCCTCCATGGTCCG SEQ ID NO: 24

All PCR reactions were carried out as described above with 1.5 mM MgCl₂ at an annealing temperature of 50° C. One colony was selected which had the correct insert as determined by PCR. Plasmid DNA from the clone was extracted using a Wizard Mini prep purification kit (Promega) and the domain 3 sequence was verified.

Results indicated that the sequence encoded a complete open reading frame and was identical to the genomic sequence of human ICAM-6 domain 3 in J03071.

B. PCR Analysis

PCR was used to screen several cDNA libraries to determine if any contained human ICAM-6 cDNAs. Screening was focused mostly on hematopoietic and endothelial cells because ICAMs are characteristically expressed in these cell types.

In addition, screening samples encompassed cDNAs prepared from unstimulated human umbilical vascular endothelial cells (HUNECs) in addition to cDΝA from HUVECs stimulated with EL-1 and/or IL-4, cDΝA from the promyelocytic cell line HL-60, and cDΝA from lung, appendix, and colon. PCR was also carried out on several human cDΝA hbraries which included cDΝA libraries prepared from HUNECs, Jurkat cells (human T cell line), peripheral blood mononuclear cells (PBMC), synovium, and Hela cells (epithelial cervical tumor cell line). The PCR reactions were carried out as described above with 2 mM MgCl₂ and at 60 °C annealing temperature. Primers I6O1 (SEQ ID NO: 38) and I6O2 (SEQ ID NO: 20) were used in the PCR.

On agarose gel electrophoresis, a 210 bp ICAM-6 domain 3 DNA band was detected from the HUVEC cDNAs, the HUVEC library, and also from the PBMC library. Additional PCR reactions were performed with these cDNA samples using other combinations of ICAM-6-derived primers to determine if the libraries contained DNA encoding domain 1 of ICAM-6 and to determine if the clones were properly spliced. Primer I6O11 (SEQ ID NO: 25), specific for domain 1 and either I6O2 (SEQ ID NO: 20) or I6O8 (SEQ ID NO: 24), specific for DNA encoding domain 3, were used in the PCR.

I6O11 GCAGTGCTTCTTCTCTTGTGCAGGG SEQ ID NO: 25

No amplification products of the expected size were found in the PCR reactions, indicating that either (i) DNA encoding the ICAM-6 domain 1 was not in hbraries, (ii) the clones were unspliced, or (iii) the cDNA samples were contaminated with genomic DNA that gave rise to the domain 3 signals detected in the first reactions.

B. Northern analysis

Northern analysis was carried out on RNA isolated from HUVECs, cell lines including A549, HeLa, HL60, Jurkat, Ramos, and U937, and tissue types including spleen, thymus, peripheral blood leukocytes, testis, prostate, ovary, colon and small intestines. The hybridization probe comprised the sequence corresponding to ICAM-6 domain 3 cloned as described above.

The human ICAM-6 domain 3 plasmid was linearized with EcoKI and gel purified using a Qiagen kit, and anti-sense ICAM-3 RNA probe was labeled by in vitro transcription using ³²P labeled UTP according to manufacturer's protocol (RNA transcription kit, Stratagene). Membranes were hybridized overnight at 65° C in 50% formamide, 5X SSC, 50 mM Tris-HCl, pH 7.6, 0.1 % sodium pyrophosphate, 0.2% polyvinylpyrrolidone, 0.2% ficoll, 5 mM EDTA, 2% SDS, and 150 mg/ml denatured salmon sperm. Membranes were washed at 65 °C, twice in 2X SSC containing 0.1 % SDS and twice in 0. IX SSC with 0.1 % SDS for 15 minutes each wash.

Results indicated high levels of expression of a 3 kb RNA in testis and prostate. In PBL, a 1 kb fragment was identified; in colon and small intestines, a 7.5 kb transcript was positive; and in HUVECs and the various cell lines, high level hybridization was detected with a 4.4 kb RNA, consistent in size with 28S ribosomal RNA. It is unclear if the probe cross reacted with rRNA or there exists a specific 4.4 kb transcript in these cell types.

Example 13 Isolation of a Human ICAM-6 cDNA

Having demonstrated that HUVEC and PBMC cDNA libraries include DNA corresponding to ICAM-6 domain 3, the ICAM-6 domain 3 PCR probe was used to screen cDNA libraries from the two cell types in an attempt to isolate a full length

ICAM-6 cDNA. In addition, because the Northern blot analysis demonstrated expression in testis, a human testis library (Stratagene) was also screened. The libraries were screened with a human ICAM-6 domain 3 probe labeled by PCR as described in Example 2. The unlabeled template was generated by PCR using the

ICAM-6 domain 3 plasmid as a template and primers I6O1 (SEQ ID NO: 38) and I6O2

(SEQ ID NO: 20). The PCR product was gel purified, diluted, and used as a template to generate a 210 bp ICAM-6 domain 3 probe. Hybridization conditions were as described in Example 2. Results from the testis library provided thirteen positive clones, eight of which were sequenced to reveal four sphced (clones 13A, 20C, 5A, and 13B) and four unspliced ICAM-6 clones. Among the four sphced clones, two, 20C and 13A, were found to include leader and domain 1 sequences. In the PBMC library, only one unspliced clone was identified. In the HUVEC library, no clones were identified.

Having determined a more complete sequence for the human ICAM-6 sequence, the coding region for human ICAM-6 that encoded the leader and part of domain 1 was utilized as a query sequence in a BLASTN search which revealed four EST sequences that appeared to represent three human ICAM-6 clones. Two ESTs, AA421394 (SEQ ID NO: 49) and AA421290 (SEQ ID NO: 50), corresponded to the 5 ' and 3 ' ends of another clone, 731071 that had been isolated from a human testis library and encoded the ICAM-6 leader and domains 1 to 3. Two ESTs from a human fetal liver-spleen library previously referred to in Example 11, H79158 (SEQ ID NO: 47) and H54052 (SEQ ID NO: 48), were also identified and appeared to encode an unspliced domain 4.

The eight clones from the testis library were sequenced and the results combined to correct the database sequence for EST J03071. The corrected sequence indicated that the leader and domains 1, 2, and 3 encoded complete open reading frames, but the sequence for domain 4 still included a stop codon. With a more complete polynucleotide sequence for ICAM-6, a second comparison to the sequences for other known ICAMs was carried out including comparison of ICAM-6 domains 4 and 5 despite the presence of the stop codon in domain 4. The results are set out in Table 4 below. Table 4 Human ICAM-6 Protein Homology With Other Human ICAMs

In order to further analyze ICAM-6 DNA encoding the leader and domains 1 to 3, the sequence of the 731071 clone from the EST database was used in combination with the sequences of two of the human testes clones 13 A and 20C. The three clones were found to encode the same leader and the same domain 2 and 3 amino acid sequence with both domains encoded by an open reading frame. It was therefore concluded that the frameshift identified in domain 2 of the J03071 clone from Genbank arose from a sequencing error. In all three of the clones, 13A, 20C, and 731071, however, domain 1 was incomplete; clone 20 encoded only the 5 ' portion of domain 1 and clones 13A and 731071 encoded only the 3 " portion. In all three clones, splicing of domain 1 sequences was abnormal as indicated by the presence of a partial domain and either frameshifts or stop codons at the splice junctions. None of the three clones was therefore fully processed, nor did they encode transmembrane or cytoplasmic amino acid sequences. In each clone, sequences encoding domain 3 were followed by the corresponding intron.

Of the four sphced human testis clones, 13A, 5A, and 13B encoded amino acids for domain 4. Each of the clones contained the first of the two stop codons previously identified in the J03071 genomic sequences. Because none of the three clones included the second stop codon found in J03071, it was concluded that the second stop codon resulted from a sequencing error. The corrected sequence for human ICAM-6, but still including a stop codon in the coding region of domain 4, indicated that the leader, and domains 1, 2, and 3 encode complete open reading frames. These observations led to the conclusion that splicing of human ICAM-6 in testis is abnormal, an occurrence which has been previously reported for other genes expressed in testis [Sorrentino, et al, Proc. Natl. Acad. Sci. (USA) S5:2191-2195 (1988)]. This conclusion does not rule out the possibility that a correctly sphced and functional human ICAM-6 is expressed in other human tissues. The identification of the stop codon encoding in DNA for domain 4 may also be otherwise explained in that; (i) alternative splicing may take place wherein sequences encoding domain 4 are removed thereby permitting expression of a functional polypeptide having fewer extracellular domains than the mouse ICAM-6 protein; (ii) the identified human ICAM-6 gene may be polymorphic within the population and may therefore be mutated in some individuals and not others; or (iii) the J03071 clone may represent a pseudogene which does not express a functional ICAM-6 polypeptide. In the event of J03071 being a pseudogene, it is possible that a functional ICAM-6 (or other unique ICAM) may be located in the same chromosomal location (Example 11).

Example 14 RACE PCR Identify a Spliced 5' Human ICAM-6 cDNA In order to isolate the 5 ' end of the human ICAM-6 cDNA, RACE PCR was carried out using a human testis Marathon-ready™ cDNA (Clontech). The cDNA was prepared from testes pooled from four Caucasians ranging in age from 22 to 31. The pooled source was different from that used to prepare the testis cDNA library (Stratagene) previously described. The human testis cDNA was ligated to Marathon adaptors that contained sites for AP-1 and AP-2 primers (SEQ ID NOs: 13 and 14) described in Example 4. PCR was carried out using the AP-1 and 1608 (SEQ ID NO: 24) primer pair, the 1608 primer specific for DNA encoding domain 3. Two rounds of PCR were carried out as described in Example 4. In both PCRs, the reaction mixture was denatured for one minute, followed by five cycles of denaturation at 94 °C for five seconds and annealing/extension at 72 °C for two minutes, an additional five cycles of denaturation at 94 °C for five seconds and annealing/extension at 70 °C for two minutes, and finally 25 cycles of denaturation at 94 °C for five seconds and annealing/extension at 68 ^CC for two minutes. The expected size of a correctly sphced fragment encoding the ICAM-6 leader through domain 3 was about 0.8 to 1 kb.

Agarose gel electrophoresis showed a DNA smear with a band that migrated at approximately 0.7 to 0.8 kb in length. In view of this results, three steps were undertaken in an attempt to obtain an amplification product of the expected size. First, the PCR product was digested with Sαcl and Nøtl. This procedure was based on the known presence of a Sαcl site in the ICAM-6 domain 3 and a NotI site in the 5 ' untranslated region and the cDΝA adaptor. The expected size of the SacllNotl fragment was approximately 0.8 kb.

Second, the PCR products were size selected for a range of 0.8 to 1 kb using gel electrophoresis. Fragments in this range were purified from the gel and hgated into vector BSU SK+ (Stratagene) previously digested with NotI and Sαcl. The resulting plasmids were transformed into Ultracompetent XL-blue MRF ' cells according to manufacturer's suggested protocol.

Third, hybridization was carried out using ³²P-labeled oligonucleotide probes to identify ICAM-6 cDΝAs that contained all of domain 1. Ohgonucleotides 16047 (SEQ ID NO: 26) and 16048 (SEQ ID NO: 27) were designed to be complementary to both extremities of DNA encoding domain 1.

16047 GTCCCGGAACAGTCGTTTGAGGTTT- CTATTTGGCCAAGTC SEQ ID NO: 26

16048 GATCACTTGCTCTGGTGGCTGATAC- ACAGTGACGCCAAGG SEQ ID NO: 27

Primer 16047 corresponded to the 5 ' end of domain 1 while 16048 corresponded to the junction between domains 1 and 2. The ohgonucleotides were end-labeled with ³²P- γATP using T4 polynucleotide kinase (New England Biolabs, Beverly MA) and purified using Centrispin 10 columns (Princeton Separations, Adelphia, NJ).

Bacteria that had been transformed with the size selected PCR products were plated on filters laid over carbemcillin agarose plates and incubated overnight at 37° C. The colonies were transferred onto two additional sets of filters. One set of replicas was hybridized with the 16047 probe while the other was hybridized with the 16048 probe. Both filters were hybridized in 5X SSC, 50 mM sodium phosphate, 5X Denhardt's solution, and 0.1 % SDS at 65 °C, washed at room temperature for 15 minutes in 2X SSC with 0.1 % SDS, and then washed in the same solution at 65 °C for five minutes.

Twenty colonies were picked that hybridized to both probes. Sequence analysis showed that the twenty colonies did contain human ICAM-6 inserts. Some of the clones included the Sαcl site and extended into domain 2 or domain 1. Five clones included the Sαcl site of domain 3 and extended to the Nøtl site in the 5 ' untranslated region. These five clones thereby permitted determination of the splice junction between the leader and domain 1 of ICAM-6. The full length human ICAM-6 sequence, was deduced by combining sequence information from human RACE clone Bib (encoding the leader sequence through domain 3), the clones found in the human testis library (encoding domains 2 to 4), and the genomic clone (encoding domain 5). The human ICAM-6 sequence, including the region encoding the stop codon in domain 4, is set out in SEQ ID NO: 40. The deduced amino acid sequence up to the stop codon for the polynucleotide is set out in SEQ ID NO: 41. Comparison of the amino acid sequence of the human ICAM-6 extracellular domains with the corresponding region of other mouse and human ICAMs is shown in Table 5. Table 5 Amino Acid sequence comparison of HUMAN ICAM-6 with known mouse and human ICAMs

Human Human Mouse Mouse

ICAM-6 ICAM-1 ICAM-2 ICAM-R LW-ICAM-4 ICAM-5 ICAM-6 ICAM-1 ICAM-2 ICAM-5

Domain 1 34% 42% 39% 34% 35 % 79% 37% 41 % 37%

Domain 2 34% 45% 35% 25% 42% 72% 35 % 40% 43 %

Domain 3 30% — 29% — 34% 69% 22% — 28%

Domain 4 38% — 34% — 37% 75% 31 % — 31 %

Domain 5 29% — 22% — 35% 69% 25% — 35%

Example 15 Cloning of ICAM-6 Domains 4 and 5 from Sterile Patients

In view of the observed expression of ICAM-6 mRNA in testis, a possible relationship between ICAM-6 and fertility was examined. One hypothesis to explain why the ICAM-6 gene includes stop codons in domains 4 and 5 is that the presence of one or two copies of functional ICAM-6 in the human chromosome may render a male carrier unfertile. It is possible that expression of ICAM-6 leads to either an abnormahty in spermatogenesis and/or spermatozoid function, or to destruction of spermatozoids or spermatocytes. In order to explore this hypothesis, domain-4 and domain-5 of ICAM-6 were cloned from genomic DNA obtained from selected patients and the polynucleotide structure examined to determine if these domain contained stop codons or full open reading frames.

DNA was obtained from blood samples from twenty male patients with primary testicular failure and five control blood samples using DNAzolRBD reagent (Molecular Research Center, Inc, Cincinnati, OH) according to the manufacturer's suggested protocol. PCR was performed to amplify a genomic fragment spanning either domain 4 or 5 of human ICAM-6 using two pairs of primers which were designed based on the human ICAM-6 sequence. The first pair of primers, I6O70 (SEQ ID NO: 51 ) and I6O73 (SEQ ID NO: 52 ), and the second pair of primers, I6O75 (SEQ ID NO: 53) and I6O77 (SEQ ID NO: 54 ), corresponded to the 5' and 3' ends of ICAM-6 domain 4 and domain 5, respectively.

I6O70 CTTCCCTCCACCAATCCTGGAGC SEQ ID NO: 51

I6O73 GGATATGGAGCTGGATCACAGTGG SEQ ID NO: 52

I6O75 TGGCTGGAAGGGATGGAACACACG SEQ ID NO: 53

I6O77 TGACAGAGCCCAGCTGGTTAGTGG SEQ ID NO: 54

Fifty μl PCR reactions were carried out with lx KlenTaq buffer, 2 mM dNTPs, 100 μg/ml of either domain-4 primer pair I6O70 and I6O73 or domain-5 primer pair I6O75 and I6O77, 1 μl KlenTaq polymerase solution, and 6 to 12 ng of genomic DNA using an Advantage cDNA PCR kit (Clontech, Palo Alto, CA) according to the manufacturer's suggested protocol. A "touchdown" PCR reaction was performed using a Gene AmpR PCR system 9700 (Perkin Elmer). The reaction was carried out with an initial thirty second denaturation step followed by five cycles of denaturation at 94 °C for five seconds and annealing/extension at 72 °C for thirty seconds, five cycles of denaturation at 94 °C for five seconds and annealing/extension at 70 °C for thirty seconds, and twenty-five cycles of denaturation at 94 °C for five seconds and annealing/extension at 68 °C for thirty seconds. The resulting PCR products were separated using agarose gel electrophoresis and two bands were detected that migrated at the expected sizes. A band of approximately 260 bp was detected from the reaction using domain 4 primer pair I6O70 and I6O73 and a band of about 170 bp was detected using the domain 5 primer pair I6O75 and I6O77. The fragments were purified using a PCR product purification kit (Promega, Madison, WI) according to the manufacturer's suggested protocol and sequenced directly using the corresponding pair of primers. Controls included genomic DNA from gorilla or macaque nemestrina.

Sequence analysis of ICAM-6 PCR products indicated that either one or two stop codons were present in domain 4 of all patient and control samples. One of the stop codons was located at the same nucleotide position as in the clone described in Example 13, and the second stop codon was at a constant location in all samples where it was observed. Sequence analysis of ICAM-6 domain 5 showed either a stop codon or an ambiguous sequence at the same nucleotide position as previously observed. The sequence ambiguity may have resulted from a sequencing artifact or the presence of two alleles of ICAM-6 in a given patient, one with and the other without the second stop codon.

Because the ICAM-6 gene is highly conserved between species, blood from macaque and gorilla was used as controls. The genomic DNA was extracted as described before and used in PCR under the same conditions as described above for the human samples. Sequence analysis demonstrated that ICAM-6 domains 4 and 5 of macaque were 95 % and 97 % identical to their human homologs but encoded complete open reading frames. ICAM-6 including domain 4 and 5 is therefore likely to be functional in macaques. In gorilla, ICAM-6 domains 4 and 5 were found to be highly homologous to the human molecule (domain 4, 91 % and domain 5, 94 %), and while a stop codon was detected in the gorilla domain 4 as in the human sequence, domain 5 encoded a complete open reading frame.

These results suggest that the presence of stop codons prevent correct expression of a human ICAM-6 polypeptide having five extracellular immunoglobulin domains. This observation, however, does not rule out the possibihty that there are alternative forms of biologically active ICAM-6 having fewer than five domain extracellular domains. For example, ICAM-6 could exist in a soluble form and the stop codon in domain 4 would indicate the 3 ^' end of a protein lacking a transmembrane region and a cytoplasmic tail. Alternatively, domain 4 could be spliced out and a four domain protein could be expressed as a surface molecule in those patients who are heterozygous for genomic DNA having the stop codon in domain 5. As still another possibihty, a two domain form of ICAM-6 may exist that is membrane bound and includes only domains 1 and 2.

Example 16 Expression of Soluble Human ICAM-6

In an effort to examine the function of human ICAM-6, an expression construct was generated to express extracellular domains 1 and 2 (D1-D2) of human ICAM-6 as a chimeric polypeptide in association with the hinge-CH2-CH3 domain sequences from IgG4. Construction of the expression plasmid was carried out as described below.

The ICAM-6 coding region for the leader sequence through domain 2 was amplified by PCR using the primer pair I6O78 (SEQ ID NO: 55) and I6O79 (SEQ ID NO: 56)

I6O78 CCCAAGCTX4CCGCC4CCATGAAAACGCTTCTGTTT SEQ ID NO: 55 I6O79 CCGCTCGAGAAAGATCCGGACTATTCTGATGGG SEQ ID NO:56

To facilitate cloning of the amplification product, a Hindm site was included in the 5 '

I6O78 primer and a Xhol site was included in the 3 ' I6O79 primer (underlined above).

In addition, a consensus sequence for initiation of translation was created in primer

I6O78 to ensure high levels of expression of the soluble molecule (in italics above).

In preparation of a template for the PCR reaction, the human RACE clone Bib plasmid described in Example 14 was digested with NotI and Sαcl and a

DΝA fragment encoding the leader sequence through domain 3 of ICAM-6 purified using the QIAquick( Gel Extraction Kit (QIAGEΝ, Valencia, CA). PCR was carried out with the purified NotllSacl fragment as a template, primers I6O78 and I6O79,

"high fidelity" Pfu DΝA polymerase (Stratagene, La Jolla, CA) and deoxynucleotides and buffer according to the manufacturer's suggested protocol. Samples were initially denatured at 94 °C for five minutes, and then run through thirty cycles of denaturation at 94°C for thirty seconds, annealing at 50°C for thirty seconds, and extension at 72°C

® for thirty seconds in a GeneAmp PCR System 9700 (Perkin Elmer). A PCR product of approximately 670 bp was gel purified using QIAquick™ Gel Extraction Kit

(QIAGEΝ), digested with HimKH and Xhol, and gel purified using the QIAquick™ Gel

Extraction Kit. The HindlElXhol DΝA fragment encoding domains 1 and 2 of the

ICAM-6 was hgated into the vector pDEF2S/IgG4 previously digested with the same two enzymes. The pDEF2S/IgG4 plasmid was constructed as described below.

The approximately 1 kb XhollXbal IgG4 fragment fused to ICAM-6 sequences contained cDΝA sequence encoding the human gamma 4 heavy chain hinge,

CH2, and CH3 regions together with 328 bp of 3 ' flanking sequence derived from a genomic clone of the human gamma 4 gene. The cDΝA encoding the heavy chain sequence was obtained from a commercially available spleen cDΝA library and synthetic oligonucleotide probes derived from known human gamma 4 sequences

[Ellison, et al, DNA 1: 1 (1981)] using standard cloning techniques. Similarly, genomic sequences containing the 3 ' flanking sequences were obtained from a commerciaUy available genomic hbrary using the human gamma 4 probes and the same cloning techniques. Fusion of the cDNA sequences to the flanking sequence was carried out using PCR with appropriate primers that introduce compatible restriction sites, followed by restriction digestion and ligation by procedures well known and routinely practiced in the art. The resulting plasmid, ICAM-6(Dl-D2)/Ig/pDEF2S, was transformed into XL2 Blue Competent Cells (Stratagene, La Jolla, CA) and transformants were screened by PCR using the I6O78 (SEQ ID NO: 55 ) and I6O79 (SEQ ID NO: 56) primers. Positive clones as detected by PCR were verified by sequencing.

Expression of the protein was carried out in DG44 CHO cells transfected with the ICAM-6 (Dl-D2)/Ig/pDEF2S. DG44 CHO cells are deficient in dihydrofolate reductase (DHFR) and require hypoxanthine and thymidine in the culture media to grow. Because a marker DHFR gene is present in the pDEF2S vector, DG44 CHO cells transformed with ICAM-6 (Dl-D2)/Ig/pDEF2S grow in selective culture media. Cells were transfected by electroporation as described below.

Approximately 2 x 10⁷ cells were mixed with 50 μg of ICAM-6 (Dl-D2)/Ig/pDEF2S suspended in 800 μl HBS buffer (20 mM HEPES-NaOH, pH 7.0, 137 mM NaCl, 5 mM KC1, 0.7 mM Na₂HPO₄, 6 mM dextrose) and electroporation carried out using a BioRad GenePulser electroporator with capacitance set at 960 μF and voltage at 290V. Following electroporation, cells were allowed to recover at room temperature for ten minutes and washed with 10 ml of media containing 10% FBS, 1 mM MEM sodium pyruvate, 100 u/ml penicillin, 100 μg/ml streptomycin, 2 mM L-glutamine, 0.1 mM sodium hypoxanthine, and 1.6 mM thymidine (HT plus DMEM/F12). Cells were collected by centrifugation, resuspended in media, and seeded in two 10 cm plates containing HT plus DMEM/F12. Two days after electroporation, transfected cells were transferred into selective media (DMEM/F12 without hypoxanthine or thymidine) and approximately twelve days after transfection, surviving colonies were harvested and pooled. Half of the cellular pool was stored in liquid nitrogen and the other half was cultured for protein purification. For protein purification, ICAM-6 (Dl-D2)/Ig protein was recovered from CHO supernatant using a Prosep Protein A column (BioProcessing LTD). The column was initially equilibrated with at least 100 ml of buffer containing 1 M glycine plus 0.15 M NaCl, pH 8.6, using a BioRad Econo System. Supernatant was loaded on the column at a rate of 1 ml/minute and the column was washed with at least 100 ml of the same buffer as above. Protein was eluted using 100 mM citric acid, pH 3.0, and collected directly into neutralizing 1 M Tris, pH 9.0. The eluted protein was placed in 10,000 MW cutoff SnakeSkin dialysis tubing (Pierce, Rockford, IL) and dialyzed against calcium free-, magnesium free- phosphate buffered saline (CMF-PBS) for at least 24 hours with three changes of buffer using. Dialyzed protein was concentrated using a Centriprep-30 centrifugal filter (Amicon, Beverly, MA) and protein concentration was determined by BCA Protein Assay (Pierce). Protein purity was assessed by Coomassie staining of an SDS-PAGE gel containing 2 μg of purified protein.

All ICAM-6 (Dl-D2)/Ig preparations were 50-90% pure with only bovine Ig as an obvious contaminant. The purified protein is used to study the function of human ICAM-6 and generate monoclonal antibodies.

Example 17 Western Analysis

Generation of Mouse ICAM 6 Polyclonal Antibodies

A soluble mouse ICAM-6 protein consisting of domains 1 through 3 fused to a FLAG/HIS tag was produced as described in Examples 7 and 8 and used as an immunogen to inject New Zealand White rabbit. Briefly, two New Zealand White rabbit were pre-bled to obtain pre-immune serum and then injected sub-cutaneously on day 0 with approximately 100 μg of the ICAM-6/ FLAG-EHS tag protein in complete Freund's adjuvant (CFA). Animals were immunized thereafter an additional four times at three to four weeks intervals with the same amount of protein in incomplete Freund's adjuvant. Sera were tested for specific reactivity by immunocytochemistry (described below) on rodent testis tissue sections seven to fourteen days after injections. Polyclonal antibodies from the sera were purified on a protein A column using well- known procedures routinely practiced in the art. A strong specific ICAM-6 staining was detected on mouse testis after the fourth antigen injection.

Immunohistochemistry

Normal mouse testis were snap frozen in Isopentane cooled in liquid nitrogen and stored at -70°C. Sections were layered onto Superfrost microslides (Erie Scientific Corporation, West Chester, PA) and stored at -20°C. Prior to use, slides were dried and fixed in cold acetone for two minutes. Endogenous peroxidase activity was suppressed when shdes were incubated for fifteen minutes at room temperature in TBS including 0.04 % H₂O₂, and 0.1 % NaN₃. Shdes were blocked for 30 minutes at room temperature in TBS including 2 % bovine serum albumin (BSA) (Sigma, St. Louis, MO), 30% normal rat serum, and 5 % normal goat serum. Endogenous biotin sites were blocked by treating the shdes with an avidin/biotin blocking kit (Vector laboratories, Burlingame, CA) according to the manufacturer's suggested protocol.

Primary antibodies (diluted to 10 μg/ml) against mouse ICAM-6 and or control antibodies were apphed to each tissue section for one hour at room temperature. Unbound antibody was removed by immersing the shdes three times in TBS for five minutes each wash. Biotinylated goat anti-rabbit immunoglobulin (Vector Laboratories) was apphed to each section for 30 minutes at room temperature. After a washing step, sections were incubated with goat anti-biotin immunoglobulin conjugated with horseradish peroxidase (HRP) (Vector Laboratories) for 30 minutes at room temperature. After washing , 3 '3 diaminobenzidine-tetrahydrochloride (DAB) substrate was applied to each section until the desired color was obtained using the DAB peroxidase substrate kit (Vector laboratories). The reaction was stopped in water, enhanced with 1 % osmic acid, and immediately washed for five to ten minutes. Tissue sections were counterstained with hematoxylin (Sigma), rinsed in water, and mounted with coverslips using Aquamount (Lerner Laboratories, Pittsburgh). Staining with the ICAM-6 antibodies revealed high level expression on primary spermatocytes. The controls slides with pre-immune serum and without primary antibody were consistently negative.

Western blot

In order to determine the size of ICAM-6 protein produced in vivo, polyclonal antisera was tested on mouse testis lysates by Western blotting as follow. Snap frozen mouse testis tissue was ground into powder in liquid nitrogen, mixed with a solution of 150 mM Tris, pH 6.8, bromophenol blue, 2.5 % beta-mercaptoethanol, 4% SDS, and 20%glycerol, boiled for five minutes, sheared through a 21 gauge needle, and pelleted by centrifugation. The supernatant was separated using 12% SDS-PAGE and the protein content of the supernatant estimated by running several dilutions on SDS-PAGE and staining with Coomassie blue. Approximately 20 μg of mouse testis protein was separated on SDS-PAGE and electroblotted onto Immobilon-P membranes (Millipore, Bedford, MA). Blots were incubated overnight at 4° C in 3% bovine serum albumin diluted in Tris buffered saline containing 0.2% Tween-20 (TBS-Tween). After washing, the membranes were incubated with 2 μg/ml mouse ICAM-6 polyclonal rabbit antisera or with the control pre-immune sera in TBS-Tween for one hour at room temperature. Membranes were then washed and incubated with goat anti-rabbit HRP-conjugated tight chain specific secondary antibody (Accurate, Westbury, NY) at room temperature for one hour. After washing, an enhanced cheiniluminescence (ECL) Western blotting detection kit (Pierce) was used according to the manufacturer's suggested protocol and bands were visualized on Kodak X-OMAT-AR film. Between each incubation step the membranes were washed three times for five minutes in TBS-Tween.

Two bands were consistently detected by ICAM-6 antisera while controls were consistently negative. A wide band was detected that migrated between 60 kDa and 100 kDa and another band was observed which migrated at approximately 200 to 250 kDa. The expected size of the mature 527 amino acid mouse ICAM-6 protein was approximately 58 kDa, which suggested that the expressed protein was glycosylated. Sequence analysis indicated the presence of six potential N-linked glycosylation sites characterized by the consensus sequence Asp-Xaa-(Ser/Thr) and at least three potential O-linked glycosylation sites were identified using NetOGly, O-glycosylation site prediction software [Hansen, et al, Glycoconjugate l. 15: 115-130 (1998)]. The width of the band migrating between 60 and 100 kDa suggests that several glycosylated forms of ICAM-6 may exist in vivo. The larger band of approximately 250 kDa suggests that a very heavily O-glycosylated form ICAM-6 may also exist.

Numerous modifications and variations in the invention as set forth in the above illustrative examples are expected to occur to those skilled in the art. Consequently only such limitations as appear in the appended claims should be placed on the invention.

Claims

What is claimed is:

1. A purified and isolated ICAM-6 polypeptide.

2. The polypeptide according to claim 1 comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 2 and SEQ ID NO: 41.

3. The polypeptide according to claim 1 which is a fusion protein.

4. The polypeptide according to claim 3 wherein the fusion protein comprises ICAM-6 amino acid sequences and immunoglobulin amino acid sequences.

5. A polynucleotide encoding the polypeptide according to any one of claims 1 through 4.

6. The polynucleotide according to claim 5 comprising a sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 40.

7. A polynucleotide encoding an ICAM-6 polypeptide selected from the group consisting of: a) the polynucleotide according to claim 6; and b) a DNA which hybridizes under moderately stringent conditions to the polynucleotide of (a).

8. The polynucleotide of claim 5 which is a DNA molecule.

9. The DNA of claim 8 which is a cDNA molecule.

10. The DNA of claim 8 which is a genomic DNA molecule.

11. The DNA of claim 8 which is a wholly or partially chemically synthesized DNA molecule.

12. An anti-sense polynucleotide which specifically hybridizes with the complement of the polynucleotide of claim 3.

13. A expression construct comprising the polynucleotide according to claim 7.

14. A host cell transformed or transfected with the polynucleotide according to claim 7.

15. A method for producing an ICAM-6 polypeptide comprising the steps of: a) growing the host cell according to claim 14 under conditions appropriate for expression of the ICAM-6 polypeptide and b) isolating the ICAM-6 polypeptide from the host cell of the medium of its growth.

16. An antibody specifically immunoreactive with the polypeptide according to any one of claims 1 through 4.

17. The antibody according to claim 16 which is a monoclonal antibody.

18. A hybridoma which secretes the antibody according to claim 17.

19. An anti-idiotype antibody specifically immunoreactive with the antibody according to claim 17.

SEQUENCE LISTING

<110> Loughney, Kate

Staunton, Donald

Vazeaux, Rosemay <120> ICAM- 6 Materials and Methods <130> 27866/35076 <140> xxxxxxxx <141> 1998-10-22 <150> 08/955,661 <151> 1997-10-22 <160> 56

<170> Patentln Ver. 2.0 <210> 1 <211> 2827 <212> DNA <213> Mus musculus <220> <221> CDS <222> (71) .. (1717) <400> 1 ggaaggttcg gcagtgaggc aagaggggca agacgaccgc tttgactcac ttttggactt 60

tctcccaaga atg aaa atg ctt ctg ttg ggt gtc tgg aca ctg ctg gcc 109 Met Lys Met Leu Leu Leu Gly Val Trp Thr Leu Leu Ala 1 5 10

ttg ate cct tgt cca ggg gcc gcc gag gag ctg ttt cag gta tct gtc 157 Leu lie Pro Cys Pro Gly Ala Ala Glu Glu Leu Phe Gin Val Ser Val 15 20 25

cat cca aat gag gcc ctg gta gag ttt gga cac tec eta act gtc aac 205 His Pro Asn Glu Ala Leu Val Glu Phe Gly His Ser Leu Thr Val Asn 30 35 40 45 tgc agt ace ace tgc cca gac cct ggg ccc agt gga ate gag ace ttc 253 Cys Ser Thr Thr Cys Pro Asp Pro Gly Pro Ser Gly lie Glu Thr Phe 50 55 60

tta aag aaa ace cag eta age aaa ggg tec cag tgg aag gag ttt etc 301 Leu Lys Lys Thr Gin Leu Ser Lys Gly Ser Gin Trp Lys Glu Phe Leu 65 70 75

ctg gag gac ate aca gag gac ttg gtg ctg cag tgc ttc ttc tct tgt 349 Leu Glu Asp lie Thr Glu Asp Leu Val Leu Gin Cys Phe Phe Ser Cys 80 85 90

gca ggg gag cag aag gac ace gtg etc get ate ace atg tac cag cca 397 Ala Gly Glu Gin Lys Asp Thr Val Leu Ala lie Thr Met Tyr Gin Pro 95 100 105

cca gag cag gtg ata ctg gac ctg cag cct gaa tgg gtg gcc gtg gat 445 Pro Glu Gin Val lie Leu Asp Leu Gin Pro Glu Trp Val Ala Val Asp 110 115 120 125

gaa gcc ttc aca gtc acg tgt cat gta cct agt gtg gca ccc ctg cag 493 Glu Ala Phe Thr Val Thr Cys His Val Pro Ser Val Ala Pro Leu Gin 130 135 140

age etc ace ctt ace etc etc cag ggt gac caa gaa ctg cac aga aaa 541 Ser Leu Thr Leu Thr Leu Leu Gin Gly Asp Gin Glu Leu His Arg Lys 145 150 155

gac ttc eta agt tta tct ttg gta tec caa aga gcc gag gtc ace gcc 589 Asp Phe Leu Ser Leu Ser Leu Val Ser Gin Arg Ala Glu Val Thr Ala 160 165 170

act gtc aga gcc cac egg gac aat gac agg cgt aat ttc tec tgc cga 637 Thr Val Arg Ala His Arg Asp Asn Asp Arg Arg Asn Phe Ser Cys Arg 175 180 185 gca gaa ctg gat ctg age cca cat ggt ggg ggg ttg ttt cac ggc age 685 Ala Glu Leu Asp Leu Ser Pro His Gly Gly Gly Leu Phe His Gly Ser 190 195 200 205

tea gcc ace aag caa etc egg ate ttt gaa ttc tct cag aat ccc cag 733 Ser Ala Thr Lys Gin Leu Arg lie Phe Glu Phe Ser Gin Asn Pro Gin 210 215 220

ate tgg gtg cct tea etc ctg gag gtt ggg aag gca gag att gtg age 781 lie Trp Val Pro Ser Leu Leu Glu Val Gly Lys Ala Glu lie Val Ser 225 230 235

tgt gag gtg ace aga gta ttt cca gcc cag gaa get gtc ttc cga atg 829 Cys Glu Val Thr Arg Val Phe Pro Ala Gin Glu Ala Val Phe Arg Met 240 245 250

ttc ctg gaa gac cag gag ctg age cct ttc teg tec tgg agg gaa gat 877 Phe Leu Glu Asp Gin Glu Leu Ser Pro Phe Ser Ser Trp Arg Glu Asp 255 260 265

gca gcg tgg gcc agt gcc ace att cag gcc atg gag act ggt gac cag 925 Ala Ala Trp Ala Ser Ala Thr lie Gin Ala Met Glu Thr Gly Asp Gin 270 275 280 285

gaa ctg act tgc ctt gtg tct ctg ggt ccc gtg gag cag aaa aca agg 973 Glu Leu Thr Cys Leu Val Ser Leu Gly Pro Val Glu Gin Lys Thr Arg 290 295 300

aaa cca gtt tat gtc tac agt ttc cct cca cca ate ctg gag ata gaa 1021 Lys Pro Val Tyr Val Tyr Ser Phe Pro Pro Pro lie Leu Glu lie Glu 305 310 315

gat get tac cct ctg gca ggg acg gac gtt aat gtg ace tgc tea ggt 1069 Asp Ala Tyr Pro Leu Ala Gly Thr Asp Val Asn Val Thr Cys Ser Gly 320 325 330 cac gtg tta aca tea cct age cct act ctt egg ctt cag gga tec eta 1117 His Val Leu Thr Ser Pro Ser Pro Thr Leu Arg Leu Gin Gly Ser Leu 335 340 345

aac cac tct gcc cct ggg aag cct gcc tgg ctt ctg ttt act gcc agg 1165 Asn His Ser Ala Pro Gly Lys Pro Ala Trp Leu Leu Phe Thr Ala Arg 350 355 360 365

gag gaa gat gat ggc egg act ctg tec tgc gag gcc tct ttg gag gta 1213 Glu Glu Asp Asp Gly Arg Thr Leu Ser Cys Glu Ala Ser Leu Glu Val 370 375 380

cag ggc cag cga ctg gtc agg ace aca gag age cag ctt cat gtc tta 1261 Gin Gly Gin Arg Leu Val Arg Thr Thr Glu Ser Gin Leu His Val Leu 385 390 395

tac aag cca agg ttt cag gaa tec cgc tgc cct ggc aac cag ata tgg 1309 Tyr Lys Pro Arg Phe Gin Glu Ser Arg Cys Pro Gly Asn Gin lie Trp 400 405 410

gta gaa ggg atg cat cag atg ctt gcc tgc ate cca gag gga aat cca 1357 Val Glu Gly Met His Gin Met Leu Ala Cys lie Pro Glu Gly Asn Pro 415 420 425

act ccg gtt ttg gtg tgt gtc tgg aat ggg atg ate ttt gac ctt gat 1405 Thr Pro Val Leu Val Cys Val Trp Asn Gly Met lie Phe Asp Leu Asp 430 435 440 445

gta cct cag aag gcc ace cag aac cac acg ggg ace tac tgc tgc aca 1453 Val Pro Gin Lys Ala Thr Gin Asn His Thr Gly Thr Tyr Cys Cys Thr 450 455 460

gcc ace aac cca eta ggc tec gtc age aaa gac ate act ate att gtc 1501 Ala Thr Asn Pro Leu Gly Ser Val Ser Lys Asp lie Thr lie lie Val 465 470 475 caa ggc ctg cct gag ggc ate age tec tec ace ate ttc att ate ate 1549 Gin Gly Leu Pro Glu Gly lie Ser Ser Ser Thr lie Phe lie lie lie 480 485 490

att ttc ace ctg ggc atg get gtg ate act gta gca tta tac ctg aac 1597 lie Phe Thr Leu Gly Met Ala Val lie Thr Val Ala Leu Tyr Leu Asn 495 500 505

tac cag ccc tgc aaa gga aac agt agg aaa egg atg cac agg ccg egg 1645 Tyr Gin Pro Cys Lys Gly Asn Ser Arg Lys Arg Met His Arg Pro Arg 510 515 520 525

gag caa age aag ggc gag gag agt cag ttc tct gac att egg gcg gag 1693 Glu Gin Ser Lys Gly Glu Glu Ser Gin Phe Ser Asp lie Arg Ala Glu 530 535 540

gaa tgc cac gcg cat etc tgc tga ceacaaaeaa aetctttget ggagtgtgac 1747 Glu Cys His Ala His Leu Cys 545

ttcagctacc agcatttaca ggggacgcaa gagegggeca aggaggaagg eggagacaat 1807

gtgaggcttc acttccttgc attccgttgt cccccaaagc agggtttcac gggcccctgt 1867

ggctggcagc cagtccgtct ggagctcatt tctcttttga gtttattcca gtttgtagac 1927

gtttcagtct gattgttcca tctggtgagg gatcctctca ttcctaccct gtatttaact 1987

aggtcactct caggcacaca gaaggctctg gcctggcctc tcatttccac tgcccacctc 2047

tcaaacagca atggagaagg gtcaccagaa atagectgge atgagttgct cagggtttcc 2107

ggatgactgg ctaggaactt atttcatagt tcagggacaa gacttcatac ataggataac 2167

aaatcaatag gcaggaatta gaactcttcc cctgacgtac tcccctgctc cccaaacggt 2227 gcccgttgac atcacgaagg atgctggctg gcttcaccct caccctcgtg taaccctctg 2287

caatttcact ttgggtcagt gaaaacaaaa aaccaaggac ttactatgta gcacaagatg 2347

gcttcaaatg tgtgatcccc atgctgagtt gtgggactac aagtgtgtac catcacaccc 2407

gaactaactt tgggagggca gctttaatgt agaagataga ctatctccat gaaatcggtc 2467

ttagggtgcc acactccgaa tccctttctg ttagaggcgg agtcccaggt ttactctccc 2527

cctccacaag aattgcctgt tttcatcgtt gtcggtgcca cagagtccca cctagaatgg 2587

aagtactcaa ccccacggca gtgtgcttaa cacacagatg ggactctgtt ctgtcaccgg 2647

aattctctgt gactggctca ccctatgcag taacagctca gcttctttca ctgtcctttg 2707

gaaggactgt ccgtctagat gatggcttga agtacatcaa gccaggtctt tgctccagag 2767

ctgtcatgaa atgtctactg agatattagc tgtggcaaaa taaaaggggg gcccggtacc 2827 <210> 2 <211> 548 <212> PRT

<213> Mus musculus <400> 2

Met Lys Met Leu Leu Leu Gly Val Trp Thr Leu Leu Ala Leu lie Pro 1 5 10 15

Cys Pro Gly Ala Ala Glu Glu Leu Phe Gin Val Ser Val His Pro Asn 20 25 30

Glu Ala Leu Val Glu Phe Gly His Ser Leu Thr Val Asn Cys Ser Thr 35 40 45

Thr Cys Pro Asp Pro Gly Pro Ser Gly lie Glu Thr Phe Leu Lys Lys 50 55 60 Thr Gin Leu Ser Lys Gly Ser Gin Trp Lys Glu Phe Leu Leu Glu Asp 65 70 75 80

lie Thr Glu Asp Leu Val Leu Gin Cys Phe Phe Ser Cys Ala Gly Glu 85 90 95

Gin Lys Asp Thr Val Leu Ala lie Thr Met Tyr Gin Pro Pro Glu Gin 100 105 110

Val He Leu Asp Leu Gin Pro Glu Trp Val Ala Val Asp Glu Ala Phe 115 120 125

Thr Val Thr Cys His Val Pro Ser Val Ala Pro Leu Gin Ser Leu Thr 130 135 140

Leu Thr Leu Leu Gin Gly Asp Gin Glu Leu His Arg Lys Asp Phe Leu 145 150 155 160

Ser Leu Ser Leu Val Ser Gin Arg Ala Glu Val Thr Ala Thr Val Arg 165 170 175

Ala His Arg Asp Asn Asp Arg Arg Asn Phe Ser Cys Arg Ala Glu Leu 180 185 190

Asp Leu Ser Pro His Gly Gly Gly Leu Phe His Gly Ser Ser Ala Thr 195 200 205

Lys Gin Leu Arg He Phe Glu Phe Ser Gin Asn Pro Gin He Trp Val 210 215 220

Pro Ser Leu Leu Glu Val Gly Lys Ala Glu He Val Ser Cys Glu Val 225 230 235 240

Thr Arg Val Phe Pro Ala Gin Glu Ala Val Phe Arg Met Phe Leu Glu 245 250 255 Asp Gin Glu Leu Ser Pro Phe Ser Ser Trp Arg Glu Asp Ala Ala Trp 260 265 270

Ala Ser Ala Thr He Gin Ala Met Glu Thr Gly Asp Gin Glu Leu Thr 275 280 285

Cys Leu Val Ser Leu Gly Pro Val Glu Gin Lys Thr Arg Lys Pro Val 290 295 300

Tyr Val Tyr Ser Phe Pro Pro Pro He Leu Glu He Glu Asp Ala Tyr 305 310 315 320

Pro Leu Ala Gly Thr Asp Val Asn Val Thr Cys Ser Gly His Val Leu 325 330 335

Thr Ser Pro Ser Pro Thr Leu Arg Leu Gin Gly Ser Leu Asn His Ser 340 345 350

Ala Pro Gly Lys Pro Ala Trp Leu Leu Phe Thr Ala Arg Glu Glu Asp 355 360 365

Asp Gly Arg Thr Leu Ser Cys Glu Ala Ser Leu Glu Val Gin Gly Gin 370 375 380

Arg Leu Val Arg Thr Thr Glu Ser Gin Leu His Val Leu Tyr Lys Pro 385 390 395 400

Arg Phe Gin Glu Ser Arg Cys Pro Gly Asn Gin He Trp Val Glu Gly 405 410 415

Met His Gin Met Leu Ala Cys He Pro Glu Gly Asn Pro Thr Pro Val 420 425 430

Leu Val Cys Val Trp Asn Gly Met He Phe Asp Leu Asp Val Pro Gin 435 440 445 Lys Ala Thr Gin Asn His Thr Gly Thr Tyr Cys Cys Thr Ala Thr Asn 450 455 460

Pro Leu Gly Ser Val Ser Lys Asp He Thr He He Val Gin Gly Leu 465 470 475 480

Pro Glu Gly He Ser Ser Ser Thr He Phe He He He He Phe Thr 485 490 495

Leu Gly Met Ala Val He Thr Val Ala Leu Tyr Leu Asn Tyr Gin Pro 500 505 510

Cys Lys Gly Asn Ser Arg Lys Arg Met His Arg Pro Arg Glu Gin Ser 515 520 525

Lys Gly Glu Glu Ser Gin Phe Ser Asp He Arg Ala Glu Glu Cys His 530 535 540

Ala His Leu Cys

545

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 3 gtaatacgac tctcactata gggc 24

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 4 aattaaccct cactaaaggg 20 <210 > 5

<211 > 28

<212 > DNA

<213 > Artificial Sequence

<220 >

<223> Description of Artificial Sequence :primer

<400> 5 caagccaagg tttcaggaat cccgctgc 28

<210> 6

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : rimer

<400> 6 ttgcctgcat cccagagg 18

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : rimer

<400> 7 tctttgctgg agtgtgac 18

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : rimer

<400> 8 gtcacactcc agcaaaga 18

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence <220 >

<223> Description of Artificial Sequence :primer

<400> 9 caaagcaagg gcgaggag 18

<210> 10

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 10 ctcctcgccc ttgctttg 18

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 11 tctaggtggg actctgtg 18

<210> 12

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 12 agtagctccc cgtgtggttc tgggtggc 28

<210> 13

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : rimer

<400> 13 ccatcctaat acgactcact atagggc 27 <210 > 14

<211 > 23

<212 > DNA

<213 > Artificial Sequence

<220 >

<223> Description of Artificial Sequence :primer

<400> 14 actcactata gggctcgagc ggc 23

<210> 15

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 15 gctcacaatc tctgccttcc caacctcc 28

<210> 16

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 16 gacagtggcg gtgacctcgg ctctttgg 28

<210> 17

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 17 aggagtgaag gcacccag 18

<210> 18

<211> 18

<212> DNA

<213> Artificial Sequence <220>

<223> Description of Artificial Sequence -primer

<400> 18 cagagcctca cccttacc 18

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence .primer

<400> 19 tcacggcagc tcagccacca age 23

<210> 20

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence primer

<400> 20 cattgcaccc agagatgc 18

<210> 21

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence primer

<400> 21 atagaattcc ttttggaggc tgggatg 27

<210> 22

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence -primer

<400> 22 taactcgagc attgcaccca gagatgc 27 <210> 23

<211 > 25

<212 > DNA

<213 > Artificial Sequence

<220 >

<223> Description of Artificial Sequence :primer

<400> 23 gcgaggtggc tagggtgttt ccagc 25

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 24 cctgatcacc agcctccatg gtccg 25

<210> 25

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 25 gcagtgcttc ttctcttgtg caggg 25

<210> 26

<211> 40

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : primer

<400> 26 gtcccggaac agtcgtttga ggtttctatt tggccaagtc 40

<210> 27

<211> 40

<212> DNA <213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : rimer

<400> 27 gatcacttgc tctggtggct gatacacagt gacgccaagg 40

<210> 28

<211> 70

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 28 gcgatgctag caagcttcac agctcatcac catggcaatg cttctgttgg gtgtctggac 60

actgctggcc 70

<210> 29

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence : rimer

<400> 29 ggacccagag acacaaggca agtcagttcc 30

<210> 30

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence .-primer

<400> 30 cctgggccca gtggaatcgc gaccttctaa 30

<210> 31

<211> 30

<212> DNA

<213> Artificial Sequence 16

<220 >

<223> Description of Artificial Sequence :primer

<400> 31 taagaaggtc gcgattccac tgggcccagg 30

<210> 32

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 32 catcaccatc accatcac 18

<210> 33

<211> 26

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 33 cgaggagctg tttcaggtac ctgtcc 26

<210> 34

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 34 atgccctcga gcaggccttg gac 23

<210> 35

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 35 tataaggatg acgatgacaa g 21 <210> 36

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 36 gcgatgctag caagcttcac agctcatcac c 31

<210> 37

<211> 29

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 37 cgttcactag ttttctgctc tcagggacc 29

<210> 38

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 38 cttttggagg ctgggatg 18

<210> 39

<211> 56

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 39 aatttctcga gtcacttgtc atcgtcgtcc ttgtagtcct caggcaggcc ttggac 56

<210> 40

<211> 1451

<212> DNA

<213> Homo sapiens <220> <221> CDS <222> (1) .. (1383) <400> 40 ggc cgc ggc teg cct ttg gcc ctt ctt ate agg atg aaa acg ctt ctg 48 Gly Arg Gly Ser Pro Leu Ala Leu Leu He Arg Met Lys Thr Leu Leu 1 5 10 15

ttt ggt gtc tgg gcc ctg ctg gcc ttg ate ctt tgc cca ggg gtc ccg 96 Phe Gly Val Trp Ala Leu Leu Ala Leu He Leu Cys Pro Gly Val Pro 20 25 30

gaa gag ttg ttt gag gtt tct att tgg cca agt cag gcc ctg gtg gag 144 Glu Glu Leu Phe Glu Val Ser He Trp Pro Ser Gin Ala Leu Val Glu 35 40 45

ttt gga cag tec eta gtg gtc aac tgc age act act tgc cca gac cca 192 Phe Gly Gin Ser Leu Val Val Asn Cys Ser Thr Thr Cys Pro Asp Pro 50 55 60

gga ccc agt gga att gag ace ttc tta aag aaa act cag gtg gac aaa 240 Gly Pro Ser Gly He Glu Thr Phe Leu Lys Lys Thr Gin Val Asp Lys 65 70 75 80

ggg cct cag tgg aaa gag ttt ctt ctg gag gat gtc aca gag aat tec 288 Gly Pro Gin Trp Lys Glu Phe Leu Leu Glu Asp Val Thr Glu Asn Ser 85 90 95

ate ctg cag tgc ttc ttc tct tgt gca ggg att caa aag gac aca age 336 He Leu Gin Cys Phe Phe Ser Cys Ala Gly He Gin Lys Asp Thr Ser 100 105 110

ctt ggc ate act gtg tat cag cca cca gag caa gtg ate ctg gag ctg 384 Leu Gly He Thr Val Tyr Gin Pro Pro Glu Gin Val He Leu Glu Leu 115 120 125 cag cct gcc tgg gtg gcc gtg gac gaa gcc ttc aca gtg aag tgt cat 432 Gin Pro Ala Trp Val Ala Val Asp Glu Ala Phe Thr Val Lys Cys His 130 135 140

gta ccc agt gta gca ccc ttg gag agt etc ace ctt gcc ctt etc cag 480 Val Pro Ser Val Ala Pro Leu Glu Ser Leu Thr Leu Ala Leu Leu Gin 145 150 155 160

ggt aac caa gaa ctg cat aga aag aac ttt acg age ttg get gtg gcc 528 Gly Asn Gin Glu Leu His Arg Lys Asn Phe Thr Ser Leu Ala Val Ala 165 170 175

tec caa aga get gaa gtc ate ate agt gtc aga gcc caa aag gag aat 576 Ser Gin Arg Ala Glu Val He He Ser Val Arg Ala Gin Lys Glu Asn 180 185 190

gac aga tgc aat tct tec tgc cat gca gaa ctg gac ttg agt ttg caa 624 Asp Arg Cys Asn Ser Ser Cys His Ala Glu Leu Asp Leu Ser Leu Gin 195 200 205

ggt ggg agg etc ttt caa ggc age tea ccc ate aga ata gtc egg ate 672 Gly Gly Arg Leu Phe Gin Gly Ser Ser Pro He Arg He Val Arg He 210 215 220

ttt gaa ttc tct cag agt ccc cac ate tgg gtc tct tec ctt ttg gag 720 Phe Glu Phe Ser Gin Ser Pro His He Trp Val Ser Ser Leu Leu Glu 225 230 235 240

get ggg atg gcg gag act gtg age tgc gag gtg get agg gtg ttt cca 768 Ala Gly Met Ala Glu Thr Val Ser Cys Glu Val Ala Arg Val Phe Pro 245 250 255

gcc aaa gaa gtt atg ttc cac atg ttc ctg gaa gac caa gag ctg age 816 Ala Lys Glu Val Met Phe His Met Phe Leu Glu Asp Gin Glu Leu Ser 260 265 270 tec ttc ctt tec tgg gag ggg gac aca gca tgg gcc aat get ace att 864 Ser Phe Leu Ser Trp Glu Gly Asp Thr Ala Trp Ala Asn Ala Thr He 275 280 285

egg ace atg gag get ggt gat cag gaa ctg tct tgc ttt gca tct ctg 912 Arg Thr Met Glu Ala Gly Asp Gin Glu Leu Ser Cys Phe Ala Ser Leu 290 295 300

ggt gca atg gaa cag aag aca aga aag eta gtg cat age tac age ttc 960 Gly Ala Met Glu Gin Lys Thr Arg Lys Leu Val His Ser Tyr Ser Phe 305 310 315 320

cct cca cca ate ctg gag eta aaa gaa tea tac cca ttg gca ggg ace 1008 Pro Pro Pro He Leu Glu Leu Lys Glu Ser Tyr Pro Leu Ala Gly Thr 325 330 335

gac att aat gtg ace tgc tea ggg cat gta tta aca tea ccc age cct 1056 Asp He Asn Val Thr Cys Ser Gly His Val Leu Thr Ser Pro Ser Pro 340 345 350

act ctt egg ctt cag gga gcc cca gac etc cct get ggg gag cct gcc 1104 Thr Leu Arg Leu Gin Gly Ala Pro Asp Leu Pro Ala Gly Glu Pro Ala 355 360 365

tgg ctt eta ctt act gcc agg gag gaa gat gat ggc nga aat ttc tec 1152 Trp Leu Leu Leu Thr Ala Arg Glu Glu Asp Asp Gly Xaa Asn Phe Ser 370 375 380

tgc gag gcc tct ttg gtg gtg cag ggt cag egg ttg atg aaa ace act 1200 Cys Glu Ala Ser Leu Val Val Gin Gly Gin Arg Leu Met Lys Thr Thr 385 390 395 400

gtg ate cag etc cat ate eta aag cca cag tta gag gaa tec agt tgc 1248 Val He Gin Leu His He Leu Lys Pro Gin Leu Glu Glu Ser Ser Cys 405 410 415 cct ggc aaa cag ace tgg ctg gaa ggg atg gaa cac acg etc gcc tgc 1296 Pro Gly Lys Gin Thr Trp Leu Glu Gly Met Glu His Thr Leu Ala Cys 420 425 430

gtc cca aag gga aac cca get cca gcc ttg gtg tgt ace tgg aat ggg 1344 Val Pro Lys Gly Asn Pro Ala Pro Ala Leu Val Cys Thr Trp Asn Gly 435 440 445

gtg gtc ttt gac ctt gaa gtg cca cag aag gca ace tag aaccacactg 1393 Val Val Phe Asp Leu Glu Val Pro Gin Lys Ala Thr 450 455 460

gaacctaccg ctacacagcc actaaccagc tgggctctgt cagcaaagac attgetgt 1451 <210> 41 <211> 460 <212> PRT

<213> Homo sapiens <400> 41

Gly Arg Gly Ser Pro Leu Ala Leu Leu He Arg Met Lys Thr Leu Leu 1 5 10 15

Phe Gly Val Trp Ala Leu Leu Ala Leu He Leu Cys Pro Gly Val Pro 20 25 30

Glu Glu Leu Phe Glu Val Ser He Trp Pro Ser Gin Ala Leu Val Glu 35 40 45

Phe Gly Gin Ser Leu Val Val Asn Cys Ser Thr Thr Cys Pro Asp Pro 50 55 60

Gly Pro Ser Gly He Glu Thr Phe Leu Lys Lys Thr Gin Val Asp Lys 65 70 75 80

Gly Pro Gin Trp Lys Glu Phe Leu Leu Glu Asp Val Thr Glu Asn Ser He Leu Gin Cys Phe Phe Ser Cys Ala Gly He Gin Lys Asp Thr Ser 100 105 110

Leu Gly He Thr Val Tyr Gin Pro Pro Glu Gin Val He Leu Glu Leu 115 120 125

Gin Pro Ala Trp Val Ala Val Asp Glu Ala Phe Thr Val Lys Cys His 130 135 140

Val Pro Ser Val Ala Pro Leu Glu Ser Leu Thr Leu Ala Leu Leu Gin 145 150 155 160

Gly Asn Gin Glu Leu His Arg Lys Asn Phe Thr Ser Leu Ala Val Ala 165 170 175

Ser Gin Arg Ala Glu Val He He Ser Val Arg Ala Gin Lys Glu Asn 180 185 190

Asp Arg Cys Asn Ser Ser Cys His Ala Glu Leu Asp Leu Ser Leu Gin 195 200 205

Gly Gly Arg Leu Phe Gin Gly Ser Ser Pro He Arg He Val Arg He 210 215 220

Phe Glu Phe Ser Gin Ser Pro His He Trp Val Ser Ser Leu Leu Glu 225 230 235 240

Ala Gly Met Ala Glu Thr Val Ser Cys Glu Val Ala Arg Val Phe Pro 245 250 255

Ala Lys Glu Val Met Phe His Met Phe Leu Glu Asp Gin Glu Leu Ser 260 265 270

Ser Phe Leu Ser Trp Glu Gly Asp Thr Ala Trp Ala Asn Ala Thr He 275 280 285 Arg Thr Met Glu Ala Gly Asp Gin Glu Leu Ser Cys Phe Ala Ser Leu 290 295 300

Gly Ala Met Glu Gin Lys Thr Arg Lys Leu Val His Ser Tyr Ser Phe 305 310 315 320

Pro Pro Pro He Leu Glu Leu Lys Glu Ser Tyr Pro Leu Ala Gly Thr 325 330 335

Asp He Asn Val Thr Cys Ser Gly His Val Leu Thr Ser Pro Ser Pro 340 345 350

Thr Leu Arg Leu Gin Gly Ala Pro Asp Leu Pro Ala Gly Glu Pro Ala 355 360 365

Trp Leu Leu Leu Thr Ala Arg Glu Glu Asp Asp Gly Xaa Asn Phe Ser 370 375 380

Cys Glu Ala Ser Leu Val Val Gin Gly Gin Arg Leu Met Lys Thr Thr 385 390 395 400

Val He Gin Leu His He Leu Lys Pro Gin Leu Glu Glu Ser Ser Cys 405 410 415

Pro Gly Lys Gin Thr Trp Leu Glu Gly Met Glu His Thr Leu Ala Cys 420 425 430

Val Pro Lys Gly Asn Pro Ala Pro Ala Leu Val Cys Thr Trp Asn Gly 435 440 445

Val Val Phe Asp Leu Glu Val Pro Gin Lys Ala Thr 450 455 460

<210> 42 <211> 2371 <212> DNA <213> Mus musculus <400> 42 ggcacccctg cagagcctca cccttaccct cctccagggt gaccaagaac tgcacagaaa 60

agacttccta agtttatctt tggtatccca aagagccgag gtcaccgcca ctgtcagagc 120

ccaccgggac aatgacaggc gtaatttctc ctgccgagca gaactggatc tgagcccaca 180

tggtgggggg ttgtttcacg gcagctcagc caccaagcaa ctccggatct ttgaattctc 240

tcagaatccc cagatctggg tgccttcact cctggaggtt gggaaggcag agattgtgag 300

ctgtgaggtg accagagtat ttccagccca ggaagctgtc ttccgaatgt tcctggaaga 360

ccaggagctg agccctttct cgtcctggag ggaagatgca gcgtgggcca gtgccaccat 420

tcaggccatg gagactggtg accaggaact gacttgcctt gtgtctctgg gtcccgtgga 480

gcagaaaaca aggaaaccag tttatgtcta cagtttccct ccaccaatcc tggagataga 540

agatgcttac cctctggcag ggacggacgt taatgtgacc tgctcaggtc acgtgttaac 600

atcacctagc cctactcttc ggcttcaggg atccctaaac cactctgccc ctgggaagcc 660

tgcctggctt ctgtttactg ccagggagga agatgatggc cggactctgt cctgcgaggc 720

ctctttggag gtacagggcc agcgactggt caggaccaca gagagccagc ttcatgtctt 780

atacaagcca aggtttcagg aatcccgctg ccctggcaac cagatatggg tagaagggat 840

gcatcagatg cttgcctgca tcccagaggg aaatccaact ccggttttgg tgtgtgtctg 900

gaatgggatg atctttgacc ttgatgtacc tcagaaggcc acccagaacc acacggggac 960

ctactgctgc acagccacca acccactagg ctccgtcagc aaagacatca ctatcattgt 1020

ccaaggcctg cctgagggca tcagctcctc caccatcttc attatcatca ttttcaccct 1080 gggcatggct gtgatcactg tagcattata cctgaactac cagccctgca aaggaaacag 1140

taggaaacgg atgcacaggc cgcgggagca aagcaagggc gaggagagtc agttctctga 1200

cattcgggcg gaggaatgcc acgcgcatct ctgctgacca caaacaaact ctttgctgga 1260

gtgtgacttc agctaccagc atttacaggg acgcaagagc gggccaagga ggaaggcgga 1320

cacaatgtga ggcttcactt ccttgcattc cgttgtcccc caaagcaggg tttcacgggc 1380

ccctgtggct ggcagccagt ccgtctggag ctcatttctc ttttgagttt attccagttt 1440

gtagacgttt cagtctgatt gttccatctg gtgagggatc ctctcattcc taccctgtat 1500

ttaactaggt cactctcagg cacacagaag gctctggcct ggcctctcat ttccactgcc 1560

cacctctcaa acagcaatgg agaagggtca ccagaaatag cctggcatga gttgctcagg 1620

gtttccggat gactggctag gaacttattt catagttcag ggacaagact tcatacatag 1680

gataacaaat caataggcag gaattagaac tcttcccctg accgtactcc cctgctcccc 1740

aaacggtgcc cgttgacatc acgaaggatg ctggctggct tcaccctcac cctcgtgtaa 1800

ccctctgcaa tttcactttg ggtcagtgaa aacaaaaaac caaggactta ctatgtagca 1860

caagatggct tcaaatgtgt gatccccatg ctgagttctg ggactacaag tgtgtaccat 1920

cacacccgaa ctaactttgg gagggcagct ttaatgtaga agatagacta tctccatgaa 1980

atcggtctta gggtgccaca ctccgaatcc ctttctgtta gaggcggagt cccaggttta 2040

ctctccccct ccacaagaat tgcctgtttt catcgttgtc ggtgccacag agtcccacct 2100

agaatggaag tactcaaccc cacggcagtg tgcttaacac acagatggga ctctgttctg 2160 tcaccggaat tctctgtgac tggctcaccc tatgcagtaa cagctcagct tctttcactg 2220

tcctttggaa ggactgtccg tctagatgat ggcttgaagt acatcaagcc aggtctttgc 2280

tccagagctg tcatgaaatg tctactgaga tattagctgt ggcaaaataa aataggcttt 2340

gtgaatagaa aaaaaaaaaa aaaaaaaaaa a 2371

<210> 43

<211> 1668

<212> DNA

<213> Homo sapiens

<400> 43 cggagcgggc gaggccgagg agcggaggct gaagccgtga ggagcggccc ggcgagggcg 60

aggggcgtgc gagcgggcgg ccgcggctcg cctttggccc ttcttatcag gatgaaaacg 120

cttctgtttg gtgtctggac cctgctggcc ttgatccttt gcccagggat tcaaaaggac 180

acaagccttg gcatcactgt gtattagcca ccagagcaag tgatcctgga gctgcagcct 240

gcctgggtgg ctgtggacga agccttcaca gtgaagtgtc atgtacccag tgtagcaccc 300

ttggagagtc tcacccttgc ccttctccag ggtaaccaag aactgcatag aaagaacttt 360

acgagcttgg ctgtggcctc ccaaagagct gaagtcatca tcagtgtcag agcccaaaag 420

gagaatgaca gatgcaattc ttcctgccat gcagaactgg acttgagttt gcaaggtggg 480

aggctctttc aaggcagctc acccatcaga atagtccgga tctttgaatt ctctcagagt 540

ccccacatct gggtctcttc ccttttggag gctgggatgg cggagactgt gagctgcgag 600

gtggctaggg tgtttccagc caaagaagtt atgttccaca tgttcctgga agaccaagag 660

ctgagctcct tcctttcctg ggagggggac acagcatggg ccaatgctac cattcggacc 720 atggaggctg gtgatcagga actgtcttgc tttgcatctc tgggtgcaat ggaacagaag 780

acaagaaagc tagtgcatag ctacaataag tggcctggct cttccttttt catacgggtt 840

ctctgctgct gaaaacacag agtaacgggt tggtgattcg gctgtagaca tccctgctgc 900

cctttgctgg gtatgctctc aagtgaacat gagtcttcat ctttctctgg cttccctcca 960

ccaatcctgg agctaaaaga atcataccca ttggcaggga ccgacattaa tgtgacctgc 1020

tcagggcatg tattaacatc acccagccct actcttcggc ttcagggagc cccagacctc 1080

cctgctgggg agcctgcctg gcttctactt actgccaggg aggaagatga tggctgaaat 1140

ttctcctgcg aggcctcttt ggtggtgcag ggtcagcggt tgatgaaaac cactgtgatc 1200

cagctccata tcctatgcaa gccacagtta gaggaatcca gttgccctgg caaacagacc 1260

tggctggaag ggatggaaca cacgctcgcc tgcgtcccaa agggaaaccc agctccagcc 1320

ttggtgtgta cctggaatgg ggtggtcttt gaccttggag tgccacagaa ggcaacctac 1380

aaccacactg gaacctaccg ctacacagcc ctaactcgag gatgggggat tgatggggcc 1440

atcttgtggg ggtcaccctg cttatctgtg gtcactgtgg gagcctcggc gatgggtacc 1500

gtcatcacca gcattcacca gggtcccctg atcactggcc tgtatcccat gctgtcccgg 1560

gagatgatgg agtccagcag ggacttctcc tcaaacctgg atttgagccc caagttccaa 1620

aaggaagaag catgcccgac cctggagcct ggcacattgg catcagat 1668

<210> 44

<211> 1744

<212> DNA

< 13> Homo sapiens <400 > 44 tctcagagtc cccacatctg ggtctcttcc cttttggagg ctgggatggc ggagactgtg 60

agctgcgagg tggctagggt gtttccagcc aaagaagtta tgttccacat gttcctggaa 120

gaccaagagc tgagctcctt cctttcctgg gagggggaca cagcatgggc caatgctacc 180

attcggacca tggaggctgg tgatcaggaa ctgtcttgct ttgcatctct gggtgcaatg 240

gaacagaaga caagaaagct agtgcatagc tacaataagt ggcctggctc ttcctttttc 300

atacgggttc tctgctgctg aaaacacaga gtaacgggtt ggtgattcgg ctgtagacat 360

ccctgctgcc ctttgctggg tatgctctca agtgaacatg agtcttcatc tttctctggt 420

aaatgcaggc agattgggga catgggctac agtagttctt tccagccttc atccccagtt 480

tccttaggct atcctgctta cagagtgatt gtggatgccc tgaactactt cttagaaaca 540

cttatttgag gtgaggagga aagctgtaag atgaaaagac atcttgcagt ccttgcagcg 600

aagcatagct aaatgtgtgc atgcataaga gaagctcttg aatccccaaa ccacctcatt 660

ctttcttcag cttttacaga agaagcaatg gtatccaaaa tctttcccct gttgtctgcc 720

ttcccaaggg cttttaccag cagcaagagt gcagaagtgt ctgctagttt tgagaaatgt 780

gtctggttct ccttttcctt tccttatagg cttccctcca ccaatcctgg agctaaaaga 840

atcataccca ttggcaggga ctgacattaa tgtgacctgc tcagggcatg tattaacatc 900

acccagccct actcttcggc ttcagggagc cccagacctc cctgctgggg agcctgcctg 960

gcttctactt actgccaggg aggaagatga tggctgaaat ttctcctgct aggcctcttt 1020

ggtggtgcag ggtcagcggt tgatgaaaac cactgtgatc cagctccata tcctatgtga 1080 gtggaggcct gatctttctt gtcaaaataa ggattattat tttcccattt ctagagagct 1140

tcttggccag cagtgcttca ttattacagt tgccacattt ttctcattaa aaaaaaaaat 1200

caaaggagaa aataaaagga aagctttcca agcttacctt actcccggga aagcaagtgg 1260

ggaaccagat gaggggaaat tgggaacata aaggaaagga gttaaagtga tcaggcaata 1320

ttaattaagg gtcgatggcc gaggagaaca aaggaagtga tagtgggagt ttatgctgaa 1380

aagggaaatt tccaaaaatt ccatatacac atttctattt tgaagagtag agaaaatagg 1440

ccaggtgcgg tggcttacgc ctgtaatccc agcactttgg gaggctgagg cgggtggatg 1500

gctagcggtc aggagttcaa gagcagcctg accaacatga tgaaaccctg tctctactaa 1560

aaatacagat attagccagg catgatcgtg ggtgcctgta attccagcta ctcaggaggc 1620

tgaggcagga gaattgcttg aaacctggga ggcggaggtg gcagtgagct gagatcacgc 1680

cactacattc tagcctggat gacaaagcga gacttcgtct caaaaaaaaa aaaaaaaaaa 1740

aaaa 1744

<210> 45

<211> 1104

<212> DNA

<213> Homo sapiens

<400> 45 gagcggaggc tgaagccgtg aggagcggcc cggcgagggc gaggggcgtg cgagcgggcg 60

gccgcggctc gcctttggcc cttcttatca ggatgaaaac gcttctgttt ggtgtctgga 120

ccctgctggc cttgatcctt tgcccagtgc tgggattaca ggcgtgagcc accgcgcctg 180

gccgatgtgg ttcatatttc aggggtcccg gaagagttgt ttgaggtttc tatttggcca 240 agtcaggccc tggtggagtt tggacagtcc ctagtggtca actgcagcac tacttgccca 300

gacccaggac ccagtggaat tgagaccttc ttaaagaaaa ctcagagcca ccagagcaag 360

tgatcctgga gctgcagcct gcctgggtgg ctgtggacga agccttcaca gtgaagtgtc 420

atgtacccag tgtagcaccc ttggagagtc tcacccttgc ccttctccag ggtaaccaag 480

aactgcatag aaagaacttt acgagcttgg ctgtggcctc ccaaagagct gaagtcatca 540

tcagtgtcag agcccaaaag gagaatgaca gatgcaattc ttcctgccat gcagaactgg 600

acttgagttt gcaaggtggg aggctctttc aaggcagctc acccatcaga atagtccgga 660

tctttgaatt ctctcagagt ccccacatct gggtctcttc ccttttggag gctgggatgg 720

cggagactgt gagctgcgag gtggctaggg tgtttccagc caaagaagtt atgttccaca 780

tgttcctgga agaccaagag ctgagctcct tcctttcctg ggagggggac acagcatggg 840

ccaatgctac cattcggacc atggaggctg gtgatcagga actgtcttgc tttgcatctc 900

tgggtgcaat ggaacagaga caagaaagct agtgcatagt acaataagtg gcctggcttt 960

tcctttttca tacgggtttt tgtgtgaaac acagagtaac gggttggtga ttcggctgta 1020

gacatgccct gctgcccttt gctgggtatg ctctcaagtg aacatgagtt ttcatctttc 1080

tttggtaaag caggcagatt gggg 1104

<210> 46

<211> 250

<212> DNA

<213> Mus musculus

<400> 46 ccagcttcat gtcttataca agccaaggtt tcaggaatcc cgctgccctg gcaaccagat 60 atgggtagaa gggatgcatc agatgcttgc ctgcatccca gaggagaatc caactccggt 120

tttggtgtgt gtctggaatg ggatgatctt tgaccttgat gtacctcaga aggccaccca 180

gaaccacacg gggagctact gctgcacagc caccaaccca actaggtgcg tcagcaaaga 240

cataactatt 250

<210> 47

<211> 379

<212> DNA

<213> Homo sapiens

<400> 47 gaggaaagct gtaagatgaa aagacatctt gcagtccttg cagcgacatg agctaaatgt 60

gtgcatgcat aagagaagct cttgaatccc caaaccacct cattctttct tcagctttta 120

cagaagaagc aatggtatcc aaaatctttc ccctgttgtc tgccttccca agggctttta 180

ccagcagcaa gagtgcagaa gtgtctgcta gttttgagaa atgtgtctgg ttctcctttt 240

cctttcctta taggcttccc tccaccaatc ctggagctaa aagaatcata cccattggca 300

gggactgaca ttaatgtgac ctgctcaggg catgtattta acatacccag ccctaactct 360

ttcggttcag ggggagccc 379

<210> 48

<211> 414

<212> DNA

<213> Homo sapiens

<400> 48 gagaaagctt aagagaaaag acatcttcag tccttgcagc gactagctaa tgtgtgcatg 60

cataagagaa gctcttatcc ccaaaccacc tcatctttct tcagctttac agaagaagca 120

atggtatcca aaatctttcc cctgttgtct gccttcccaa gtgcttttac cagcagcaag 180 agtgcagaag cgtctgctag ttttgagaaa tgtgtctggt tctcctttcc tttccttata 240

ggcttccctc caccactcct gggagctaaa agaatcatac ccattgggca gggactgaca 300

ttcaatgtga acctgctcag gggcatgtat taacattcac ccaccctact cttcgggctt 360

tcaggggagg ccccaggacc tcctggttgg gggcagcctg tcggggtttt tatt 414

<210> 49

<211> 297

<212> DNA

<213> Homo sapiens

<400> 49 tgtagctatg cactagcttt cttgtcttct gttccattgc acccagagat gcaaacaaga 60

cagttcctga tcaccagcct ccatggtccg aatggtagca ttggcccatg ctgtgtcccc 120

ctcccaggaa aggaaggagc tcagctcttg gtcttccagg aacatgtgga acataacttc 180

tttggctgga aacaccctag ccacctcgca gctcacagtc tccgccatcc cagcctccaa 240

aagggaagag acccagatgt ggggactctg agagaattct gccaaaaaaa tgaggac 297

<210> 50

<211> 375

<212> DNA

<213> Homo sapiens

<400> 50 aaaacgcttc tgtttggtgt ctgggccctg ctggccttga tcctttgccc agacccagga 60

cccagtggaa ttgagacctt cttaaagaaa actcaggtgg gcaaagggcc tcagtggaaa 120

gagtttcttc tggaggatgt cacagagaat tccatcctgc agtgcttctt ctcttgtgca 180

gggattcaaa aggacacaag ccttggcgtc actgtgtatc agccaccaga gcaagtgatc 240

ctggagctgc agcctgcctg ggtggccgtg gacgaagcct tcacagtgaa gtgtcatgta 300 cccagtgtag cacccttgga gagtctcacc cttgcccttc tccagggtaa ccaagaactg 360

cataggaaga acttt 375

<210> 51

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 51 cttccctcca ccaatcctgg age 23

<210> 52

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence:primer

<400> 52 ggatatggag ctggatcaca gtgg 24

<210> 53

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 53 tggctggaag ggatggaaca cacg 24

<210> 54

<211> 24

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 54 tgacagagee cagctggtta gtgg 24 <210 > 55

<211> 36

<212 > DNA

<213 > Artificial Sequence

<220 >

<223> Description of Artificial Sequence :primer

<400> 55 cccaagctta ccgccaccat gaaaacgctt ctgttt 36

<210> 56

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence :primer

<400> 56 ccgctcgaga aagatccgga ctattctgat ggg 33