EP0953053A2 - Viral particles which are masked or unmasked with respect to a cell receptor - Google Patents

Viral particles which are masked or unmasked with respect to a cell receptor

Info

Publication number
EP0953053A2
EP0953053A2 EP97925095A EP97925095A EP0953053A2 EP 0953053 A2 EP0953053 A2 EP 0953053A2 EP 97925095 A EP97925095 A EP 97925095A EP 97925095 A EP97925095 A EP 97925095A EP 0953053 A2 EP0953053 A2 EP 0953053A2
Authority
EP
European Patent Office
Prior art keywords
peptide
receptor
terminal
protein domain
retro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97925095A
Other languages
German (de)
French (fr)
Inventor
François-Loíc COSSET
Sandrine Valsesia
Stephen J. Russell
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP0953053A2 publication Critical patent/EP0953053A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6901—Conjugates being cells, cell fragments, viruses, ghosts, red blood cells or viral vectors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K1/00—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/107—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides
    • C07K1/1072—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides by covalent attachment of residues or functional groups
    • C07K1/1075—General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length by chemical modification of precursor peptides by covalent attachment of residues or functional groups by covalent attachment of amino acids or peptide residues
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/485—Epidermal growth factor [EGF] (urogastrone)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/13045—Special targeting system for viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
    • C12N2740/13061—Methods of inactivation or attenuation
    • C12N2740/13062—Methods of inactivation or attenuation by genetic engineering
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6009—Vectors comprising as targeting moiety peptide derived from defined protein from viruses dsDNA viruses
    • C12N2810/6018—Adenoviridae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/60—Vectors comprising as targeting moiety peptide derived from defined protein from viruses
    • C12N2810/6045—RNA rev transcr viruses
    • C12N2810/6054—Retroviridae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/851—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from growth factors; from growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/852—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from cytokines; from lymphokines; from interferons
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/50—Vectors comprising as targeting moiety peptide derived from defined protein
    • C12N2810/80—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates
    • C12N2810/85—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian
    • C12N2810/854—Vectors comprising as targeting moiety peptide derived from defined protein from vertebrates mammalian from hormones

Definitions

  • Retroviruses and therefore retroviral vectors initiate their infectious cycle by recognizing specific cell surface molecules, called retroviral receptors, with envelope glycoproteins expressed on the surface of retroviral particles. This recognition then leads to the fusion between the viral and cellular membranes, a complex and poorly understood process which is also mediated by a second function of the envelope glycoprotein.
  • the present invention also relates to the construction of chimeric envelope glycoproteins using these new peptides.
  • the invention relates to the use of a peptide for the transfer of genes into a target eukaryotic cell, which peptide has from approximately 10 to approximately 200, in particular from approximately 15 to approximately 150 amino acids, and advantageously approximately 20 amino acids, in which at least 30% of the amino acids consist of proline residues, which proline residues are regularly arranged so as to induce folds of the polypeptide chain at approximately 180 ° (" ⁇ -turn” or "reverse- turn "), these folds being regularly spaced and assembling in a polyproline helix with folding type ⁇ (" polyproline ⁇ -turn helix "), in a polypeptide construction containing, on the N-terminal side (upstream) of said peptide, an N-terminal (upstream) protein domain capable of recognizing a targeted surface molecule or an antigen expressed on a cell surface, in particular an appropriate receptor (targeted receptor) located on said cell
  • this ⁇ -folded polyproline helix contains 4 ⁇ folds and therefore 4 turns, and is moreover incompatible with a secondary structure in ⁇ -helix or in ⁇ sheet.
  • the ⁇ -folding polyproline helix placed between the two domains of the chimeric protein (N-terminal domain and auxiliary domain) intrinsically has, 1) an elastomeric force, 2) the property of self-assembling with other polyproline helices, probably in relation to the trimeric nature of the envelope, 3) the property of transmitting to the auxiliary domain a deformation induced by the binding of the N-terminal domain with its receptor, causing activation of the auxiliary domain .
  • markers specifically present on various differentiated tissues (example: receptor for growth factors, peptide hormones).
  • a targeted surface molecule As an example of a targeted surface molecule, mention may be made in particular of a receptor which will hereinafter be designated as a targeted receptor.
  • substantially intact refers to a viral glycoprotein which retains all of its determinants necessary for preserving the post-translational processes, if necessary, the oligomerization, the viral incorporation and fusion properties.
  • certain alterations can be made to the glycoprotein without significantly affecting these functions and the glycoproteins containing such minor modifications are considered to be substantially intact for the purposes of the invention.
  • the glycoprotein may lack a few amino acids (e.g. about 1 to 10), especially at the N-terminus, but will generally be the same size as the wild type protein and has essentially the same biological properties than wild protein.
  • non-viral recombinant gene transfer vector denotes macromolecular complexes associating the DNA containing the transferred gene, its expression regulation sequences, and molecules belonging to the class of lipids, carbohydrates, or proteins. , which have functional properties capable, 1) of targeting the deposition of DNA on the surface of the target cell, 2) of introducing this DNA into the target cell, and 3) of introducing this DNA into the nucleus of the target cell.
  • the envelope glycoprotein comprising:
  • the C-terminal (downstream) protein domain corresponds to a (retro) viral envelope glycoprotein, essentially intact, comprising the natural binding domain, the fusion and anchoring functions of the wild envelope glycoprotein from which the envelope glycoprotein carried by the recombinant (retro) viral particle is derived.
  • N-terminal protein domain upstream of the above peptide, capable of reacting with an appropriate receptor (targeted receptor) located on a eukaryotic cell, which protein domain makes it possible to specifically bind a recombinant (retro) viral particle containing said protein domain N-terminal and
  • MLV-A, GALV, FeLVB or viruses such as adenovirus, herpes virus, AAV virus (Adeno Associated Virus), or more generally viral glycoproteins derived from viruses of eukaryotic origin, in particular orthomyxovirus (such as influenza virus) or paramyxovirus (such as SV5).
  • viruses such as adenovirus, herpes virus, AAV virus (Adeno Associated Virus), or more generally viral glycoproteins derived from viruses of eukaryotic origin, in particular orthomyxovirus (such as influenza virus) or paramyxovirus (such as SV5).
  • the invention also relates to a recombinant (retro) viral particle characterized in that the 5 'end of the nucleotide sequence coding for the N-terminal (upstream) protein domain is contiguous with the 3' end of the nucleotide sequence coding for the signal peptide, the 3 'end of the nucleotide sequence coding for the N-terminal (upstream) protein domain is contiguous with the 5' end of the nucleotide sequence coding for the peptide, the 3 'end of the nucleotide sequence coding for the peptide is contiguous with the 5 ′ end of the nucleotide sequence coding for the C-terminal protein domain (downstream).
  • the invention also relates to a nucleic acid coding for a peptide or for a recombinant particle according to the invention.
  • the invention containing the nucleic acid to be transferred.
  • the invention also relates to a pharmaceutical composition containing as active substance a (retro) v ⁇ rale particle according to the invention, and also containing a gene to be transferred, in association with a physiologically appropriate pharmaceutical vehicle.
  • genes to be transferred which are important for gene therapy, these are for example IFN, IL2, p53, VEGF, TNF, CFTR, HSV-TK, lacZ, GFP, various cytokine genes, other types of suicide genes including conditional suicide genes, other genes with anti-viral activity, other genes with anti-tumor activity, other marker genes and any therapeutic gene for mono- or multi-gene disease.
  • the pathologies most specifically concerned are: most single and multi-gene diseases (mucovisidosis, myopathy, lysosomal diseases, various forms of cancer, viral diseases (AIDS), ...)
  • FIG. 1 shows the two-stage entry process of the targeting viral particle.
  • the viral particles are generated (A) with targeting envelope glycoproteins composed of an N-terminal domain (ligand, monobrin antibody, etc.), of the masking / unmasking peptide, and of a C-terminal domain (B).
  • the steps leading to the introduction of the virion into the targeted cell involve a mechanism coordinated by the masking / unmasking peptide (C).
  • FIG. 2 is a schematic representation of some of the targeting envelopes studied. The position of some functional regions is shown. Vertical arrows: proteolytic cleavage sites.
  • SU surface subunit
  • TM transmembrane subunit
  • SP signal peptide
  • PRO poly-proline region
  • T transmembrane domain
  • Ram-1 ligand binding domain for the amphotropic receptor
  • Rec-1 ligand binding domain for the ecotropic receptor
  • EGF epidermal growth factor.
  • Dark gray boxes sequence derived from the env gene of MoMLV
  • Light gray boxes sequence derived from the env gene of MLV-4070A
  • White boxes other sequences derived from MLV.
  • Black boxes spacer peptides derived from the poly-proline region. All env genes are expressed from the same promoter (LTR) and polyadenylation signal (pA) from the subgenomic mRNA using the retroviral, donor (SD) and acceptor splice sites.
  • LTR promoter
  • SA SA with an identical intronic sequence of 190 nts containing the end of the pol gene ( ⁇ POL). The position of some restriction sites is shown.
  • FIG. 5 shows the expression and viral incorporation of the chimeric envelopes of the AMO series.
  • FIG. 7 shows the amino acid and nucleotide sequence of PRO (4070A).
  • FIG. 9 shows the amino acid and nucleotide sequence of PRO ⁇ (MoMLV).
  • FIG. 10 shows the amino acid and nucleotide sequence of
  • FIG. 30 shows the amino acid and nucleotide sequence of AMOEL3.
  • FIG. 35 shows the amino acid and nucleotide sequence of EL5.
  • FIG. 36 shows the amino acid and nucleotide sequence of ⁇ PR04-beta.
  • FIG. 39 shows the amino acid and nucleotide sequence of PRO-beta.
  • FIG. 40 shows the amino acid and nucleotide sequence of PRO-int.
  • Retroviruses use a number of cell surface molecules, called viral receptors, to initiate the infectious process (23). With notable exceptions, notably in the case of human immunodeficiency viruses, most of the receptors used by other retroviruses and in particular mammalian type C retroviruses are distributed on most cell types of the host organism. For example, the amphotropic murine leukemia virus (MLV-A) is capable of infecting most mammalian cells because its receptor, the phosphate transporter Ram-1, is expressed on almost all cells.
  • MLV-A amphotropic murine leukemia virus
  • polypeptides capable of binding various cell surface molecules have been inserted at the N-terminal end of the SU subunit of the envelope glycoprotein (6) (10) (13) (15) (21).
  • the study of virions generated with these various types of targeting envelopes has shown that it is possible to specifically and effectively redirect the binding of viral particles to new surface molecules.
  • Some factors that limit the effectiveness of targeting have also been identified. The first seems to depend on physiological properties of the targeted surface molecule (dimerization, internalization, intracellular transport process) (6), the second is linked to the low intrinsic fusiogenicity of the glycerol of envelope chimeras generated by insertion.
  • N terminal ligands (6) (21).
  • the natural binding domain of the support envelope is always functional.
  • this functionality of the natural binding domain does not pose problems of infection "background noise” because the ecotropic envelope of the virus is used as the support glycoprotein.
  • MoMLV which does not recognize a receptor on the cells of higher mammals.
  • N-terminal targeting glycoprotein and then an auxiliary mechanism to facilitate the entry of the virus specifically linked to the right cellular target through the natural retroviral receptor.
  • spacer masking / unmasking peptides have also been developed, inserted between the targeting domain and the glycoprotein of support envelope, and which are capable of masking the natural binding domain as long as the viral particle has not interacted with the targeted surface molecule. The realization of this interaction induces the unmasking of the natural binding domain and the interaction between the natural binding domain and the natural retroviral receptor (auxiliary mechanism) which then takes over to introduce the virus into the cell.
  • the TELCeB ⁇ cell line (7) is derived from the TELacZ line (19) by transfection and clonal selection of cells expressing the gag and pol proteins of MoMLV (Moloney Murine Leukemia Virus: Moloney murine leukemia virus).
  • TELacZ cells express the retroviral vector MFGnlslacZ capable of transducing a nuclear ⁇ -galactosidase.
  • TELCeB ⁇ cells allow the production of retroviral capsids (non-infectious because they lack envelopes) carrying the retroviral marker vector nlsLacZ.
  • the A431 (ATCC CRL1555) and TE671 (ATCC CRL8805) cells are cultured in DMEM medium (Gibco-BRL) supplemented with 10% fetal calf serum (Gibco-BRL).
  • the CHO, CERD9 (9) and CEAR13 (9) cells are cultured in DMEM medium (Gibco-BRL) supplemented with 10% fetal calf serum and proline (Gibco-BRL).
  • the NIH-3T3 and NIH-3T3 cell lines are cultured in DMEM medium (Gibco-BRL) supplemented with 10% newborn calf serum (Gibco-BRL). Chimerical envelopes. DNA fragments encoding polypeptides recognizing either EGFR
  • the chimeric envelope is formed by cloning of the Xhol / Notl PCR fragment and of the Notl / Clal fragment, isolated from the env EMO gene (coding for the SU and TM-P15E transmembrane proteins of MoMLV), between the Xhol / Clal sites of the env 4070A MLV gene.
  • the resulting constructs are recovered in the form of a BglII / ClaI fragment (corresponding to positions 5408 and 7676 in MoMLV) and cloned at the BamHI and ClaI sites of an expression plasmid FBMOSALF (7) in which a selection marker gene (8) fused to the polyadenylation sequences of the PGK (phospho-glycerate kinase) gene was introduced downstream of the 3 'LTR of the MLV-C57 virus.
  • a selection marker gene (8) fused to the polyadenylation sequences of the PGK (phospho-glycerate kinase) gene was introduced downstream of the 3 'LTR of the MLV-C57 virus.
  • the new recognition domain was separated from the rest of the MLV envelope by a spacer peptide consisting of three alanines, provided by the Notl cloning site (15).
  • spacer amino acids were introduced either after the domain of EGFR recognition (EGF), either after the Ram-1 recognition domain (AS208) as described below.
  • AMOl the first 208 amino acids, derived from the envelope of MLV 4070 A, were fused to amino acid 1 of the SU of MoMLV.
  • AMOlFx a site of 4 amino acids corresponding to the cleavage site of blood coagulation factor Xa (Ile-Glu-Gly-Arg) (12) was inserted after the recognition domain of Ram-1 and fused to codon + 1 of MoMLV's SU. The strategy used for these constructions is described above.
  • an oligonucleotide (5'-TCCAATTCCTTCCAAGGGGC-3 '), located just upstream of the Xhol site of the env gene of 4070A (nt 594) was used in combination with either one of the following two oligonucleotides providing Notl site:
  • PCR fragments were subjected to digestion with Xhol and NotI and cloned into the plasmid FBAMOSALF opened in Xhol / NotI, a plasmid expressing an envelope of AMO type.
  • the plasmids expressing the AMOFx, AMOl and AMOlFx envelopes were generated by cloning the NdeI / NotI fragment of FBAMOSALF (comprising the recognition domain Ram-1) in a series of plasmids (13) expressing the MoMLV envelopes modified in order to create a site Notl at codon 1 or codon 6 with (AMOlFx, AMOFx) or without (AMOl) the sequence Xa.
  • Envelopes derived from AMO and containing other types of spacer peptides were constructed. All of these spacer peptides are shown in Figure 3 A.
  • 3 'fragments were generated by PCR using the MoMLV env gene as a template, as a 5' oligonucleotide (5 '-ACTGGGGCTTACGTTTGT-3') upstream of the BamHI site, and as a 3 'oligonucleotide (5' -TATGTGCGGCCGCCGGTGGAAGTTGGGTAGGG- ') or (5' -TATGTGCGGCCGCGTCTGGCAGAACGGGGTTTGG-3 ') to build the MOAPRO and MOA ⁇ PRO envelopes, respectively.
  • These PCR fragments were digested with BamHI and NotI, and co-ligated with the 5 'fragment.
  • the sequence of spacer peptides for these two constructs is shown in Figure 3B.
  • plasmids expressing the EMOI and EMOlFx envelopes were generated.
  • the sequence of spacer peptides. for these two constructions is shown in Figure 3C.
  • the plasmids expressing the EAPRO + and EA ⁇ PRO + envelopes were generated by replacing the Sfil / Not fragment of the FBEASALF plasmid by the Sfil / Notl fragments derived from the plasmids expressing the EMOPRO + and EMO ⁇ PRO + envelopes.
  • the virus-producing cells are lysed for 10 min at 4 ° C. in 20 mM Tris-HCL buffer (pH 7.5), containing 1% tritonXIOO, 0.05% SDS, 5 mg / ml deoxycholate, 150 mM NaCl and PMSF
  • Target cells were washed with PBS and detached by incubation
  • the target cells are incubated for 30 min at 37 ° C. in a medium containing 10 ⁇ 6 M of recombinant human EGF (236-EG, R&D Systems, UK). The cells are then rinsed and the infections carried out as previously described. In order to block the acidification of the endosomes, 100 mM of chloroquine phosphate (Sigma, UK) is added to the medium. Six hours after infection, the cells are rinsed and incubated in a normal medium. Results and discussion.
  • a first envelope targeting Ram-1, AMO was constructed by N-terminal insertion of the MoMLV envelope (by fusion with codon 7) of a polypeptide recognizing Ram-1 (AS208, FIG. 3 A) and corresponding to the first 208 amino acids of the SU of MLV-A (1).
  • the sequence coding for EGF was inserted into the env gene of MLV at position +6 of the SU of
  • the new binding domains were separated from the recognition domain of the retroviral receptor by a spacer peptide corresponding to three alanines.
  • various constructions were then generated by insertion of spacers of different sizes and structures. The protein sequences of these different spacers are reported in Figure 3 A for the envelopes targeting Ram-1 and in Figure 3C for the envelopes targeting EGFR.
  • the plasmids expressing the various envelopes were transfected into the TELCeB ⁇ cell line which expresses the proteins coded by the gag and pol genes, as well as a retroviral vector nlsLacZ ( 7).
  • Cell surface expression was determined by FACS analysis of producer cells, using antibodies against SU, or using anti-EGF monoclonal antibody.
  • the cells transfected with the different envelopes can be labeled with the anti-SU antibody (not shown).
  • Only cells expressing EGF fusion envelopes can be labeled using anti-EGF monoclonal antibodies ( Figure 4). This demonstrates the expression of the chimeric envelopes on the cell surface and the correct folding of the EGF on the chimeric glycoproteins.
  • Envelopes targeting EGFR are also capable of binding to A431 cells, over expressing EGFR ( Figure 6A). This connection seems specific since a pre-incubation of A431 cells in the presence of EGF (inducing the endocytosis of EGFR) inhibits this binding (not shown). Ram-1 and Rec-1 cooperation in infection.
  • the transduction of the pseudotyped retroviral vectors by the various targeting envelopes was measured on cells expressing different types of receptors: human TE671 cells expressing the EGF receptors and
  • Viruses with AMO chimeric envelopes are capable of infecting TE671 cells in a titer of 4.10 ⁇ lacZ i.u./ml (Table 1). In comparison; despite a similar receptor binding efficiency ( Figure 6B), the titers obtained with wild envelopes are 10,000 times higher. Su ⁇ renantly, the viruses expressing AMOPRO envelopes, despite good binding efficiency, have been found incapable of infecting human TE671 cells.
  • Viruses carrying the chimeric envelopes in which the Ram-1 binding domain has been separated from the SU of MoMLV by different spacers prove to be very infectious on 3T3 cells.
  • an increase from 200 (for AMOPRO) to more than 1000 times (for AMOlFx) of the viral titers was measured (Table 1).
  • the virions containing the AMO ⁇ PRO envelope can effectively infect cells when Ram-1 is expressed there alone.
  • the infectivity is increased by approximately 10 times when Rec-1 is also present on the cell surface. This difference is not due to the simple fact that AMO ⁇ PRO virions preferentially use Rec-1 for infection.
  • infection of cells on which only Rec-1 is available is extremely low (Table 1) or even undetectable (Table 2) compared to when Ram-1 and Rec-1 are co-expressed.
  • the RecID index is less than 10 ⁇ 5 (Table 2). This also demonstrates that the two receptors can synergize the infection.
  • the AMO ⁇ PRO virions are compared to the virions containing the envelopes with the flexible spacers AMOlFx, AMOGIFx and AMOG2.
  • the ⁇ PRO peptide is contains 5 prolines probably arranged in a polyproline type II helix, while the AMOGIFx and AMOG2 envelopes essentially contain glycines.
  • virions containing AMOPRO envelopes require the simultaneous presence of both types of receptors to infect cells.
  • the infectious titer in cell types co-expressing the two receptors is however lower than that which is observed with the AMO ⁇ PRO virions, without however excluding the hypothesis that the slightest inco deoration of these envelopes is responsible for this result.
  • AMOPRO viruses cannot infect cells when either of the two receptors is expressed alone (Table 2).
  • the two indices RamID and RecID are indeed lower than A.
  • MOAPRO envelopes include the binding domain of the ecotropic envelope followed by the proline region rich in this same envelope, all fused to the N-terminal end of the amphotropic envelope ( Figure 2).
  • Table 2 The results, shown in Table 2, indicate that, similarly to the virions containing the AMOPRO envelopes, the MOAPRO virions can hardly, if at all, infect cells expressing only one or the other of the Rec-1 receptors or Ram-1.
  • the Ram-1 field in the MOAPRO envelope is even less accessible (Ramid less than 7xl0 "5) than the field is the Rec-1 in AMOPRO envelope (RECID less than 5, 6x10-4
  • the MOAPRO envelopes can effectively infect cells expressing the two types of receptors, with titers of the order of 10 ⁇ lacZ iu / ml, suggesting that, in the case of this envelope too, the presence of the two receptors synergizes the infectious process.
  • the spacer peptide inserted between the targeting domain and the rest of the retroviral envelope exerts a control on the accessibility of the domain located downstream of said peptide and on the activation of the fusion. This control depends on the peptide itself and is influenced by its length and by its biochemical composition.
  • the hypothesis formulated is that the spacer peptide PRO would ultimately play the same role as the proline-rich region from which it originates and which is located, in the unmodified glycoprotein, between the receptor binding domain and the fusion domain. This role would be the masking of the downstream domain (fusion domain for the wild envelope or binding domain for the chimeric envelope) and the unmasking following the interaction of the upstream domain with its receptor.
  • this unmasking would lead to activation of the fusion, while in the case of chimeric envelopes, the unmasking would lead to the accessibility of the binding domain to the viral receptor. If the receptor is expressed on the cell surface, there can then be interaction, this then triggering the activation of the fusion domain explaining why the simultaneous presence of the two receptors synergizes the infection.
  • a targeting envelope in two stages for which a targeting envelope is constructed with different domains whose functions are activated and coordinated by means of specific spacer peptides containing sequences rich in proline.
  • These chimeric envelope glycoproteins can be designed in the following way, with from N-terminal to C-terminal, a "targeting" domain capable of recognizing a cell surface molecule specifically expressed on the targeted tissue or cell (for example a single chain antico ⁇ s or a ligand for a surface receptor); a spacer peptide capable of masking an auxiliary domain itself capable of facilitating the penetration of the virus when it is activated.
  • auxiliary domain can be an entire retroviral envelope, i.e.
  • the helper domain should be masked until the virus particle has specifically interacted with the targeted surface molecule.
  • the targeted surface molecule is Ram-1 while the auxiliary domain is the ecotropic envelope. EGFR and Rec-1 cooperation in infection.
  • the targeting domain is EGF
  • the auxiliary domain is the ecotropic envelope.
  • the infection tests were carried out with cells expressing Rec-1 only (Cerd9 cells) or with cells co-expressing Rec-1 and EGFR (3T3 cells). The results of a typical experiment are reported in Table 3. As expected by the results obtained with the AMO envelopes, viruses containing the EMO envelopes can effectively infect Cerd9 and 3T3 cells, indicating that the Rec- binding domain 1 in these envelopes is not hidden. Compared to EMO viruses, viral particles containing the EMOPRO + and EMO ⁇ PRO + envelopes can only with difficulty infect Cerd9 cells (between 1,000 and 10,000 times worse than EMO viruses).
  • the viral particles containing the EMOPRO + and EMO ⁇ PRO + envelopes are 20 and 60 times more infectious, respectively, compared to when Rec-1 is expressed alone.
  • the masking is apparently less successful, and this results in significant infectivity on Cerd9 cells. This may be due to the fact that the spacer peptides PRO + and ⁇ PRO + are not optimized for their function, but perhaps also to the fact that the Cerd9 cells express a little EGF receptor which would help activate the EMOPRO + and EMO ⁇ envelopes PRO +.
  • a percentages calculated taking as values 100 the titers obtained on 3T3 b: infection on 3T3 chronically infected with MLV-A (3T3-MLV-A) or with MoMLV (3T3-MoMLV) c: receptor available on the surface of the cell considered
  • EXAMPLE 2 In order to characterize the cooperation between the Rec-1 and Ram-1 receptors, as well as the peptides capable of regulating this cooperation of receptors, a new series of AMO-type chimeric envelope glycoproteins (see previous example) a been built - in order to check whether the infection obtained with the AMOPRO and AMODeltaPRO envelopes passes, in a second step, through an interaction with Rec-1, the binding site with Rec-1 was inactivated by point mutagenesis (D84K mutation) (MacKrell et al.,]. Virology, 70: 1768-1774.
  • the AMOEL3 and AMOEL5 envelopes were constructed. These envelopes respectively carry 3 and 5 turns of a type II polyproline helix characterized in the literature (Urry, Journal of Protein Chemistry 7: 1-34. (1988)).
  • Retroviruses were generated with these chimeric envelopes and were characterized by infection of cells expressing either Rec-1 alone, or Ram-1 alone, or the two molecules Ram-1 and Rec-1.
  • oligonucleotides elast3U (5'-TTT ATG GTC ACC GCG GCC GCA CCT GGG GTA GGG GCT CCG GGG GTA GGG GCT CCT GGG GTG GCC ATA TAA) and elast3L (5'-TTA TAT GGC CAC CCC AGG AGC CCC TAC
  • the oligonucleotides UpE15 (5 * -G AT GTA CCT GGG GTA GGC GCC CCT GGA GTC GGG GCT CCT GGG GTA GGA TTC AT) and LowE15: (5 '-ATG AAT CCT ACC CCA GGA GCC CCG ACT CCA GGG GCG CCT
  • the DELASTIN3-V Upper oligonucleotides (5'-GTC ACC GCG GCC GTC CCT GGG GTA GGG GTG CCG GGG GTA GGG GTG CCT GGG GTG GCC ATA TA A) and DELASTIN3-V Lower (5'-TTA TAT GGC CAC CCC AGG CAC CCC TAC CCC CGG CAC CCC TAC CCC AGG GAC GGC CGC GGT GAC) have been hybridized.
  • the resulting double-stranded DNA fragment was digested with the restriction enzyme Eael and cloned into the expression plasmid FBAMOSALF previously opened in NotI. This results in the plasmid
  • FBAMOEL3-VSALF (see sequence of the AMOEL3-V gene in FIG. 34) comprising the peptide EL3-V whose peptide sequence is represented in table 4 (see nucleotide sequence in FIG. 35).
  • FBAMOEL3-ISALF comprising the peptide EL3-I whose peptide sequence is represented in table 4.
  • Expression and viral inco ⁇ oration of chimeric envelopes Expression plasmids for the envelopes AMO, AMODeltaPRO, AMOPRO, AMOEL3, AMOEL5, AMOEL3-V, AMOEL3-I, AMOIFX, AMOG1X, AMOD84K, AMODeltaPROD84K, AMOPROD84K, AMOG1XD84K, AMODeltaPR02
  • the corresponding DNA fragments were digested with the enzyme EagI and separately inserted into the plasmid FBEASALF (expressing the chimeric envelope glycoproteins EA) (Cosset et al., Journal of Virology 69: 6314-6322.

Abstract

The invention features the use of a peptide for transferring genes in a eukaryotic target cell, which peptide has about 10 to about 200, in particular about 15 to about 150 amino acids, and advantageously about 20 amino acids, in which 30 % at least of the amino acids are constituted by proline radicals, which proline radicals are regularly arranged so as to induce polypeptide chain turnings at about 180° ('β-turn' or 'reverse-turn'), these turns being regularly spaced and gathering in a polyproline β-turn helix, in a polypeptide construction containing, on the said peptide N-terminal side (upstream), an N-terminal (upstream) proteinic domain capable of recognising a targeted surface molecule or an antigen expressed on a cellular surface, in particular an appropriate receptor (targeted receptor) located on the said eukaryotic cell, and on the said peptide C-terminal side (downstream), a C-terminal (downstream) protein domain capable of recognising an appropriate receptor (auxiliary receptor) located on the said eukaryotic cell, which peptide is capable of facilitating or inhibiting interaction between the C-terminal (downstream) protein domain and the auxiliary receptor, the inhibition of this interaction taking place so long as the N-terminal (upstream) protein domain has not interacted with the targeted receptor, and the facilitating of the interaction between the C-terminal (downstream) protein domain and the auxiliary receptor taking place when the N-terminal (upstream) protein domain has interacted with the targeted receptor.

Description

PARTICULES VIRALES MASQUEES OU DEMASQUEES VIS-A-VIS DU RECEPTEUR CELLULAIREMASKED OR UNMASKED VIRAL PARTICLES TOWARDS THE CELL RECEPTOR
L'invention a pour objet des particules virales recombinantes comportant un peptide ayant des propriétés de masquage et de démasquage vis-à-vis d'un mécanisme biologique, notamment vis-à-vis d'un mécanisme d'interaction cellulaire. L'invention concerne également l'application des susdites particules virales, notamment au ciblage cellulaire du transfert de gènes.The invention relates to recombinant viral particles comprising a peptide having masking and unmasking properties vis-à-vis a biological mechanism, in particular vis-à-vis a cellular interaction mechanism. The invention also relates to the application of the above viral particles, in particular to cell targeting of gene transfer.
Les rétrovirus et donc les vecteurs rétroviraux initient leur cycle infectieux par la reconnaissance de molécules de surface cellulaire spécifiques, appelées récepteurs rétroviraux, avec des glycoprotéines d'enveloppe exprimées à la surface des particules rétrovirales. Cette reconnaissance aboutit ensuite à la fusion entre les membranes virales et cellulaires, processus complexe et mal connu qui est médié également par une deuxième fonction de la glycoprotéine d'enveloppe.Retroviruses and therefore retroviral vectors initiate their infectious cycle by recognizing specific cell surface molecules, called retroviral receptors, with envelope glycoproteins expressed on the surface of retroviral particles. This recognition then leads to the fusion between the viral and cellular membranes, a complex and poorly understood process which is also mediated by a second function of the envelope glycoprotein.
La possibilité de modifier la spécificité de l'interaction avec la surface de la cellule cible a été antérieurement démontrée, notamment par le biais de modifications génétiques introduites dans la glycoprotéine d'enveloppe rétrovirale.The possibility of modifying the specificity of the interaction with the surface of the target cell has been previously demonstrated, in particular by means of genetic modifications introduced into the retroviral envelope glycoprotein.
Un certain nombre de travaux ont montré que de telles modifications n'entraînent pas d'effets perturbateurs dans les processus complexes qui permettent à la glycoprotéine d'enveloppe rétrovirale d'être maturée, exprimée à la surface cellulaire, et incorporée sélectivement dans les virions. De plus, il est maintenant prouvé que ces modifications peuvent entraîner la reconnaissance spécifique de cellules par interaction avec les molécules de surface correspondant à ces polypeptides. Enfin, dans certains cas, cette reconnaissance permet la poursuite du cycle infectieux et l'intégration du transgène dans la cellule ciblée avec, dans le meilleur des cas, une efficacité extrêmement réduite par rapport à l'efficacité que fournit une enveloppe rétrovirale non modifiée via son récepteur rétroviral normal. On en conclut, d'une part, que certaines molécules de surface cibles ne peuvent être utilisées comme récepteur pour initier l'infection et, d'autre part, dans le cas où elles peuvent l'être, les processus consécutifs à l'interaction primaire se font extrêmement peu efficacement. Ces conclusions sont vraies en ce qui concerne les stratégies deA number of studies have shown that such modifications do not cause disruptive effects in the complex processes that allow the retroviral envelope glycoprotein to be matured, expressed on the cell surface, and selectively incorporated into virions. In addition, it is now proven that these modifications can lead to the specific recognition of cells by interaction with the surface molecules corresponding to these polypeptides. Finally, in some cases, this recognition allows the continuation of the infectious cycle and the integration of the transgene into the targeted cell with, in the best of cases, an extremely reduced efficiency compared to the efficiency provided by an unmodified retroviral envelope via its normal retroviral receptor. We conclude, on the one hand, that certain target surface molecules cannot be used as receptor to initiate the infection and, on the other hand, if they can be, the processes consecutive to the interaction primary are done extremely poorly. These conclusions are true with regard to
"ciblage à une étape" , c'est-à-dire d'approches où l'interaction primaire a pour but d'entraîner directement la poursuite du cycle infectieux, sans intervention de procédés auxiliaires."one-step targeting", that is, approaches where the primary interaction has aim to directly lead to the continuation of the infectious cycle, without the intervention of auxiliary processes.
Les vecteurs rétroviraux sont actuellement les vecteurs les plus utilisés pour le transfert de gène et en particulier pour la thérapie génique, dès lors que l'on recherche une intégration et une expression stable du transgène. D'autres vecteurs de transfert de gène existent (adénovirus-vecteurs, liposomes, vecteurs dérivés du virus de l'herpès, ou encore vecteurs dérivés des AAV), mais ne permettent pas l'intégration stable et efficace du transgène. Si la plupart des protocoles de thérapie génique explorés jusqu'à présent et utilisant les vecteurs rétroviraux sont basés sur l' explantation de cellules du patient, leur transgénèse et expansion in vitro, suivi de leur réimplantation, il serait hautement souhaitable d'être capable de transférer un gène thérapeutique dans le contexte in vivo par le biais de vecteurs rétroviraux. Pour cela, la particule rétrovirale qui véhicule le gène thérapeutique devrait être dotée de certaines caractéristiques supplémentaires, et plus particulièrement, celle de pouvoir reconnaître très spécifiquement les cellules cibles du transfert génétique. En effet, les molécule de surface naturellement reconnues par les retrovirus pour l'initiation de l'infection sont exprimées très largement sur la plupart des cellules. Ceci n'autorise pas de discrimination précise des cellules dans lesquelles on souhaite effectuer un transfert de gène.Retroviral vectors are currently the most widely used vectors for gene transfer and in particular for gene therapy, when integration and stable expression of the transgene are sought. Other gene transfer vectors exist (adenovirus-vectors, liposomes, vectors derived from the herpes virus, or vectors derived from AAV), but do not allow the stable and efficient integration of the transgene. If most of the gene therapy protocols explored so far using retroviral vectors are based on the explantation of the patient's cells, their transgenesis and expansion in vitro, followed by their reimplantation, it would be highly desirable to be able to transferring a therapeutic gene into the in vivo context through retroviral vectors. For this, the retroviral particle which carries the therapeutic gene should be endowed with certain additional characteristics, and more particularly, that of being able to recognize very specifically the target cells for genetic transfer. Indeed, the surface molecules naturally recognized by retroviruses for the initiation of infection are expressed very widely on most cells. This does not allow precise discrimination of the cells into which it is desired to carry out a gene transfer.
Plusieurs travaux ont eu pour objet la modification du tropisme d'infection des vecteurs rétroviraux. Certains de ces travaux s'appuient sur des modifications biochimiques des particules rétrovirales, d'autres sur des modifications génétiques des glycoprotéines d'enveloppe rétrovirales, ce qui garantit que toutes les particules rétrovirales seront modifiées. Dans ce dernier contexte, les travaux ont consisté en un "ciblage en une étape", pour laquelle la particule virale modifiée se fixe sur la molécule de surface cellulaire ciblée; ceci entraînant la poursuite du cycle infectieux. Cependant, l'efficacité des vecteurs rétroviraux ainsi modifiés est très faible en regard de ce que l'on attend pour obtenir un outil utilisable dans une perspective thérapeutique.Several studies have focused on modifying the tropism of infection of retroviral vectors. Some of this work is based on biochemical modifications of retroviral particles, others on genetic modifications of retroviral envelope glycoproteins, which guarantees that all retroviral particles will be modified. In this latter context, the work consisted of "one-step targeting", for which the modified viral particle binds to the targeted cell surface molecule; this leading to the continuation of the infectious cycle. However, the efficiency of the retroviral vectors thus modified is very low compared to what is expected to obtain a tool usable from a therapeutic perspective.
Il est possible que le développement de stratégies de ciblage ne puisse pas aboutir avec le système "à une étape", dues à certaines raison déjà évoquées plus haut inefficacité du processus fusiogénique des glycoprotéines d'enveloppe chimériques après leur liaison sur la molécule de surface ciblée, impossibilité d'utiliser certaines molécules de surface comme récepteurs rétroviraux.It is possible that the development of targeting strategies cannot succeed with the "one-step" system, due to certain reasons already mentioned above ineffectiveness of the fusiogenic process of the chimeric envelope glycoproteins after their binding to the targeted surface molecule , impossibility of using certain surface molecules as retroviral receptors.
Un certain nombre de protocoles de thérapie génique chez l'homme vont requérir des vecteurs rétroviraux capables d'effectuer un transfert de gène in vivo, par inoculation directe des particules rétrovirales recombinantes. Parmi les améliorations que ceci suppose par rapport aux vecteurs rétroviraux développés jusqu'à présent, on peut citer :A number of gene therapy protocols in humans will require retroviral vectors capable of performing gene transfer in vivo, by direct inoculation of the recombinant retroviral particles. Among the improvements that this implies compared to the retroviral vectors developed so far, we can cite:
- l'amélioration des titres infectieux, - l'amélioration de la stabilité des particules virales dans le sérum et plus généralement dans les divers fluides de l'organisme,- improving infectious titers, - improving the stability of viral particles in serum and more generally in the various fluids of the body,
- la possibilité d'infecter les cellules quiescentes,- the possibility of infecting quiescent cells,
- la possibilité de discriminer les cellules cibles de la thérapie génique. L'invention a pour objet de proposer des moyens permettant de discriminer les cellules cibles de la thérapie génique. Il est essentiel, pour certaines applications en thérapie génique, de garantir que le transfert de gène n'aura eu lieu que dans les cellules à traiter et pas dans d'autres catégories cellulaires. Par exemple, quand on souhaite conférer un avantage sélectif à des cellules normales vis-à-vis d'une chimiothérapie, il est impératif que le gène transféré conférant cet avantage n'ait pas été introduit dans des cellules cancéreuses.- the possibility of discriminating the target cells of gene therapy. The object of the invention is to propose means making it possible to discriminate target cells from gene therapy. It is essential, for certain applications in gene therapy, to guarantee that the gene transfer will have taken place only in the cells to be treated and not in other cell categories. For example, when it is desired to confer a selective advantage on normal cells with regard to chemotherapy, it is imperative that the transferred gene conferring this advantage has not been introduced into cancer cells.
L'invention a pour objet un mécanisme à deux étapes, dans lequel la deuxième étape est conditionnée par la réalisation de la première étape.The subject of the invention is a two-stage mechanism, in which the second stage is conditioned by the performance of the first stage.
L'invention a pour objet une alternative intéressante sur le plan des performances du ciblage, notamment puisqu'elle combine la reconnaissance spécifique de la cellule cible et l'entrée dans la cellule cible associée à un mécanisme rétro viral naturel, connu pour son efficacité.The subject of the invention is an interesting alternative in terms of targeting performance, in particular since it combines the specific recognition of the target cell and the entry into the target cell associated with a natural retro-viral mechanism known for its effectiveness.
L'invention a plus particulièrement pour objet un mécanisme de ciblage à deux étapes : - la première étape permettant la reconnaissance d'une molécule de surface ciblée par l'intermédiaire du nouveau domaine de liaison N-terminal, inséré dans une glycoprotéine d'enveloppe,The invention more particularly relates to a targeting mechanism with two steps: - the first step allowing the recognition of a targeted surface molecule via the new N-terminal binding domain, inserted into an envelope glycoprotein ,
- la deuxième étape permettant la reconnaissance, conditionnelle, d'un récepteur rétroviral normal par l'intermédiaire d'un domaine propre à la glycoprotéine d'enveloppe initiale et ainsi, autorisant un relais dans le processus d'entrée de la particule virale dans la cellule, le terme "conditionnel" signifiant que le relais dans le mécanisme d'entrée ne peut être effectué que si la particule virale a préalablement interagi avec la molécule de surface initiale qui, elle, garantit que l'infection est réellement ciblée. L' invention a pour objet de nouveaux peptides permettant la réalisation de la première étape dans un mécanisme à deux étapes et jouant le rôle de "masquage" vis-à-vis de la deuxième étape, tant que la première étape n' a pas eu lieu et permettant la deuxième étape, c'est-à-dire jouant le rôle de démasquage vis-à-vis de la deuxième étape si, et seulement si, la première étape a eu lieu.- the second step allowing the conditional recognition of a normal retroviral receptor via a domain specific to the initial envelope glycoprotein and thus, authorizing a relay in the process of entry of the viral particle into the cell, the term "conditional" meaning that the relay in the entry mechanism can only be carried out if the viral particle has previously interacted with the initial surface molecule which, in turn, guarantees that the infection is actually targeted. The subject of the invention is new peptides allowing the realization of the first step in a two-step mechanism and playing the role of "masking" with respect to the second step, as long as the first step has not had place and allowing the second stage, i.e. playing the role of unmasking with regard to the second step if, and only if, the first step has taken place.
La présente invention a également pour objet la construction de glycoprotéines d'enveloppe chimériques utilisant ces nouveaux peptides. L'invention concerne l'utilisation d'un peptide en vue d'un transfert de gènes dans une cellule eucaryote cible, lequel peptide présente d'environ 10 à environ 200, notamment d'environ 15 à environ 150 acides aminés, et avantageusement environ 20 acides aminés, dans lequel 30% au moins des acides aminés sont constitués par des résidus proline, lesquels résidus proline sont régulièrement agencés de manière à induire des repliements de la chaîne polypeptidique à environ 180° ("β-turn" ou "reverse-turn"), ces repliements étant régulièrement espacés et s'assemblant en une hélice polyproline à repliement de type β ("polyproline β-turn helix"), dans une construction polypeptidique contenant, du côté N-terminal (en amont) dudit peptide, un domaine protéique N-terminal (amont) susceptible de reconnaître une molécule de surface ciblée ou un antigène exprimé sur une surface cellulaire, notamment un récepteur approprié (récepteur ciblé) situé sur ladite cellule eucaryote, et du côté C-terminal (en aval) dudit peptide, un domaine protéique C-terminal (aval) susceptible de reconnaître un récepteur approprié (récepteur auxiliaire) situé sur la susdite cellule eucaryote, lequel peptide est capable de faciliter ou d'inhiber l'interaction entre le domaine protéique C-terminal (aval) et le récepteur auxiliaire, l'inhibition de cette interaction ayant lieu tant que le domaine protéique N-terminal (amont) n'a pas interagi avec le récepteur ciblé et la favorisation de l'interaction entre le domaine protéique C-terminal (aval) et le récepteur auxiliaire ayant lieu lorsque le domaine protéique N-terminal (amont) a interagi avec le récepteur ciblé.The present invention also relates to the construction of chimeric envelope glycoproteins using these new peptides. The invention relates to the use of a peptide for the transfer of genes into a target eukaryotic cell, which peptide has from approximately 10 to approximately 200, in particular from approximately 15 to approximately 150 amino acids, and advantageously approximately 20 amino acids, in which at least 30% of the amino acids consist of proline residues, which proline residues are regularly arranged so as to induce folds of the polypeptide chain at approximately 180 ° ("β-turn" or "reverse- turn "), these folds being regularly spaced and assembling in a polyproline helix with folding type β (" polyproline β-turn helix "), in a polypeptide construction containing, on the N-terminal side (upstream) of said peptide, an N-terminal (upstream) protein domain capable of recognizing a targeted surface molecule or an antigen expressed on a cell surface, in particular an appropriate receptor (targeted receptor) located on said cell eukaryotic lule, and on the C-terminal side (downstream) of said peptide, a C-terminal protein domain (downstream) capable of recognizing an appropriate receptor (auxiliary receptor) located on the said eukaryotic cell, which peptide is capable of facilitating or d '' inhibit the interaction between the C-terminal (downstream) protein domain and the auxiliary receptor, the inhibition of this interaction taking place as long as the N-terminal (upstream) protein domain has not interacted with the targeted receptor and the promoting the interaction between the C-terminal protein domain (downstream) and the auxiliary receptor taking place when the N-terminal protein domain (upstream) has interacted with the targeted receptor.
Dans le cas d'un peptide de 20 acides aminés (ΔPRO défini ci-après), cette hélice polyproline à repliement de type β contient 4 repliements β et donc 4 spires, et est par ailleurs incompatible avec une structure secondaire en hélice α ou en feuillet β. De façon avantageuse, l'hélice polyproline à repliement de type β placée entre les deux domaines de la protéine chimère (domaine N-terminal et domaine auxiliaire) possède intrinsèquement , 1) une force élastomérique, 2) la propriété de s'auto-assembler avec d'autres hélices polyproline, probablement en relation avec la nature trimère de l'enveloppe, 3) la propriété de transmettre au domaine auxiliaire une déformation induite par la liaison du domaine N-terminal avec son récepteur, provoquant l'activation du domaine auxiliaire. L'invention vise généralement également tout mécanisme en deux étapes, la deuxième étape ne pouvant être réalisée que si la première étape a eu lieu, et concerne par exemple un mécanisme enzymatique impliquant une protéine chimère et ne devant intervenir que si la protéine chimère a été capable de reconnaître son substrat.In the case of a peptide of 20 amino acids (ΔPRO defined below), this β-folded polyproline helix contains 4 β folds and therefore 4 turns, and is moreover incompatible with a secondary structure in α-helix or in β sheet. Advantageously, the β-folding polyproline helix placed between the two domains of the chimeric protein (N-terminal domain and auxiliary domain) intrinsically has, 1) an elastomeric force, 2) the property of self-assembling with other polyproline helices, probably in relation to the trimeric nature of the envelope, 3) the property of transmitting to the auxiliary domain a deformation induced by the binding of the N-terminal domain with its receptor, causing activation of the auxiliary domain . The invention generally also relates to any two-step mechanism, the second step being able to be carried out only if the first step has taken place, and relates for example to an enzymatic mechanism involving a chimeric protein and which should only intervene if the chimeric protein has been able to recognize its substrate.
L'expression "domaine protéique N-terminal (amont) susceptible de reconnaître une molécule de surface ciblée, ou un antigène exprimé sur une surface cellulaire" , signifie que :The expression "N-terminal (upstream) protein domain capable of recognizing a targeted surface molecule, or an antigen expressed on a cell surface", means that:
1) l'on peut caractériser l'interaction entre ce domaine protéique N-terminal et la molécule de surface ciblée par une constante de dissociation (de l'ordre du nanomolaire en ce qui concerne l'interaction glycoprotéine d'enveloppe rétrovirale sauvage et récepteur rétroviral);1) the interaction between this N-terminal protein domain and the targeted surface molecule can be characterized by a dissociation constant (of the order of nanomolar with regard to the interaction of wild retroviral envelope glycoprotein and receptor retroviral);
2) la forme soluble de ce domaine protéique N-terminal (c'est-à-dire non associée dans la construction de la glycoprotéine d'enveloppe chimère) possède des caractéristiques de liaison similaires à ce même domaine protéique quand il est inséré en position N-terminale dans la glycoprotéine d'enveloppe chimère ;2) the soluble form of this N-terminal protein domain (that is to say not associated in the construction of the chimeric envelope glycoprotein) has binding characteristics similar to this same protein domain when it is inserted in position N-terminal in the chimeric envelope glycoprotein;
3) la glycoprotéine d'enveloppe chimère contenant le domaine protéique N-terminal peut être caractérisée selon des techniques classiques en virologie (exemple : test de liaison, cf. "Exemples"). Comme exemple de molécule de surface ciblée ou d'antigène exprimé sur une surface cellulaire, on peut citer :3) the chimeric envelope glycoprotein containing the N-terminal protein domain can be characterized according to conventional techniques in virology (example: binding test, cf. "Examples"). As an example of a targeted surface molecule or of antigen expressed on a cell surface, there may be mentioned:
- marqueurs de différenciation des divers lignages hématopoïétiques, en particulier marqueurs exprimés sur les cellules précoces et/ou les cellules souches hématopoïétiques (exemple : CD34), - marqueurs exprimés sur les cellules tumorales (exemple : antigènes carcino-embryonnaires) ,- markers for differentiation of the various hematopoietic lineages, in particular markers expressed on early cells and / or hematopoietic stem cells (example: CD34), - markers expressed on tumor cells (example: carcinoembryonic antigens),
- marqueurs présents spécifiquement sur des tissus différenciés divers (exemple : récepteur de facteurs de croissance, d'hormones peptidiques).- markers specifically present on various differentiated tissues (example: receptor for growth factors, peptide hormones).
Comme exemple de molécule de surface ciblée, on peut citer notamment un récepteur qui sera dans la suite désigné par récepteur ciblé.As an example of a targeted surface molecule, mention may be made in particular of a receptor which will hereinafter be designated as a targeted receptor.
Pour les commodités de langage, dans ce qui suit, on englobera par l'expression "récepteur ciblé" toute molécule de surface ciblée ou tout antigène exprimé sur une surface cellulaire.For convenience of language, in what follows, the expression "targeted receptor" will be understood to include any targeted surface molecule or any antigen expressed on a cell surface.
L'expression "domaine protéique C-terminal (aval) susceptible de reconnaître un récepteur approprié (récepteur auxiliaire)" signifie que le domaine protéique C-terminal peut interagir avec le récepteur auxiliaire, cette interaction étant caractérisée par une constante de dissociation qui est de l'ordre du nanomolaire si le domaine protéique C-terminal est dérivée d'une glycoprotéine d'enveloppe rétrovirale et si le récepteur auxiliaire est le récepteur rétroviral utilisé par cette même glycoprotéine, cette interaction permettant de déclencher le processus fusiogénique dans un mécanisme strictement similaire au processus naturel, c'est-à-dire en dehors du contexte d'une glycoprotéine d'enveloppe chimère.The expression "C-terminal protein domain (downstream) capable of recognizing an appropriate receptor (auxiliary receptor)" means that the C-terminal protein domain can interact with the auxiliary receptor, this interaction being characterized by a dissociation constant which is the order of the nanomolar if the C-terminal protein domain is derived from a retroviral envelope glycoprotein and if the auxiliary receptor is the retroviral receptor used by this same glycoprotein, this interaction making it possible to trigger the fusiogenic process in a mechanism strictly similar to the natural process, that is to say outside the context of a chimeric envelope glycoprotein.
Le peptide qui fait l'objet de l'invention est tel que, placé entre deux domaines proteiques, (un domaine protéique N-terminal par rapport audit peptide et un domaine protéique C-terminal par rapport audit peptide), il peut induire la fonction du domaine protéique C-terminal (par exemple la liaison si telle est la fonction de ce domaine C-terminal) si, et seulement si, le domaine protéique N-terminal a été mobilisé dans sa fonction (par exemple la liaison).The peptide which is the subject of the invention is such that, placed between two protein domains, (an N-terminal protein domain with respect to said peptide and a C-terminal protein domain with respect to said peptide), it can induce the function of the C-terminal protein domain (for example the binding if this is the function of this C-terminal domain) if, and only if, the N-terminal protein domain has been mobilized in its function (for example the binding).
La non induction de la fonction du domaine protéique C-terminal par le peptide de l'invention correspond au mécanisme de "masquage" du peptide de l'invention, tandis que l'induction de la fonction du domaine protéique C-terminal par le peptide de l'invention correspond au mécanisme deThe non-induction of the function of the C-terminal protein domain by the peptide of the invention corresponds to the "masking" mechanism of the peptide of the invention, while the induction of the function of the C-terminal protein domain by the peptide of the invention corresponds to the mechanism of
"démasquage" du peptide de l'invention. C'est pourquoi, dans la suite du texte, on désignera le peptide de l'invention également par "peptide masquant/démasquant" ."unmasking" of the peptide of the invention. This is why, in the following text, the peptide of the invention will also be designated by "masking / unmasking peptide".
L'invention concerne l'utilisation d'un peptide selon l'invention, dans la construction d'une glycoprotéine à activité ciblante et fusiogénique, essentiellement intacte, portée par un vecteur recombinant viral ou non viral de transfert de gène capable d' infecter une cellule eucaryote, ladite cellule eucaryote comportant un récepteur ciblé et un récepteur auxiliaire permettant de faciliter l'entrée du susdit vecteur viral ou non viral dans la cellule eucaryote, la susdite glycoprotéine comprenant :The invention relates to the use of a peptide according to the invention, in the construction of a glycoprotein with targeting and fusiogenic activity, essentially intact, carried by a recombinant viral or non-viral gene transfer vector capable of infecting a eukaryotic cell, said eukaryotic cell comprising a targeted receptor and an auxiliary receptor making it possible to facilitate the entry of the aforesaid viral or non-viral vector into the eukaryotic cell, the aforementioned glycoprotein comprising:
- le susdit peptide,- the above peptide,
- un domaine protéique du côté N-terminal (en amont) du susdit peptide, susceptible d' interagir avec le susdit récepteur ciblé, lequel domaine protéique permet de lier spécifiquement le susdit vecteur de transfert de gènes et - un domaine protéique du côté C-terminal (en aval) du susdit peptide, susceptible d' interagir avec le susdit récepteur auxiliaire, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée du susdit vecteur de transfert de gènes dans la cellule eucaryote, le processus d'entrée cellulaire du vecteur viral ou non viral recombinant dans la cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le vecteur viral ou non viral recombinant avec le récepteur ciblé de la cellule eucaryote, entraînant par l ' intermédiaire du susdit peptide un mécanisme de "démasquage" ou encore d'accessibilité du récepteur auxiliaire vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre le susdit vecteur de transfert de gènes et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de "masquage" ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur auxiliaire vis-à-vis du domaine protéique C-terminal (aval).- a protein domain on the N-terminal side (upstream) of the above-mentioned peptide, capable of interacting with the above-mentioned targeted receptor, which protein domain makes it possible to specifically bind the above-mentioned gene transfer vector and - a protein domain on the C side- terminal (downstream) of the aforementioned peptide, capable of interacting with the aforesaid auxiliary receptor, which interaction plays the role of an auxiliary mechanism of entry of the above-mentioned gene transfer vector into the eukaryotic cell, the process of cell entry of the vector recombinant viral or non-viral in the eukaryotic cell through the C-terminal protein domain (downstream) which can only take place when the N-terminal protein domain (upstream) has recognized and linked the recombinant viral or non-viral vector with the receptor target of the eukaryotic cell, causing through the above peptide a mechanism of "unmasking" or accessibility of the auxiliary receptor vis-à-vis the C-terminal protein domain (downstream), and, in the case where there is no recognition between the above-mentioned gene transfer vector and the receptor targeted to the eukaryotic cell through the N-terminal protein domain (upstream), a mechanism of "masking" or even of inaccessibility, via the above peptide, of the auxiliary receptor vis-à-vis the domain occurs. C-terminal protein (downstream).
L'expression glycoprotéine à activité ciblante et fusiogénique, désigne une glycoprotéine : 1) capable d'être incorporée efficacement sur des particules (rétro)virales véhiculant un transgène,The expression glycoprotein with targeting and fusiogenic activity designates a glycoprotein: 1) capable of being efficiently incorporated into (retro) viral particles carrying a transgene,
2) capable de reconnaître spécifiquement la molécule de surface cellulaire ciblée et de rediriger spécifiquement la liaison de la particule (rétro)virale qui la porte vers cette molécule, 3) capable de faire fusionner, après fixation sur la cible moléculaire, membrane de la particule (rétro)virale et membrane cytoplasmique de la cellule, selon le mécanisme naturellement utilisé par le (rétro)virus dont est issue la glycoprotéine d'enveloppe.2) capable of specifically recognizing the targeted cell surface molecule and of specifically redirecting the binding of the (retro) viral particle which carries it towards this molecule, 3) capable of causing the membrane of the particle to merge, after fixation on the molecular target (retro) viral and cytoplasmic membrane of the cell, according to the mechanism naturally used by the (retro) virus from which the envelope glycoprotein is derived.
L'expression "substantiellement intacte" se réfère à une glycoprotéine virale qui retient tous ses déterminants nécessaires pour conserver les processus post-traductionnels, le cas échéant, l'oligomérisation, les propriétés d'incorporation virale et de fusion. Cependant, certaines altérations (telles que mutations, délétions, additions) peuvent être faites à la glycoprotéine sans affecter significativement ces fonctions et les glycoprotéines contenant de telles modifications mineures sont considérées substantiellement intactes pour les besoins de l'invention. En particulier, la glycoprotéine peut manquer de quelques acides aminés (par exemple environ 1 à 10), en particulier à l'extrémité N-terminale, mais sera généralement de la même taille que la protéine de type sauvage et possède essentiellement les mêmes propriétés biologiques que la protéine sauvage.The expression "substantially intact" refers to a viral glycoprotein which retains all of its determinants necessary for preserving the post-translational processes, if necessary, the oligomerization, the viral incorporation and fusion properties. However, certain alterations (such as mutations, deletions, additions) can be made to the glycoprotein without significantly affecting these functions and the glycoproteins containing such minor modifications are considered to be substantially intact for the purposes of the invention. In particular, the glycoprotein may lack a few amino acids (e.g. about 1 to 10), especially at the N-terminus, but will generally be the same size as the wild type protein and has essentially the same biological properties than wild protein.
Par "vecteur recombinant viral de transfert de gène", on désigne n'importe quel virus capable d'infecter des cellules de type eucaryote, et de façon avantageuse un virus approprié pour la thérapie génique, tel qu'un adénovirus ou un retrovirus (par exemple un retrovirus de type C). Par "vecteur recombinant non viral de transfert de gène", on désigne des complexes macromoléculaires associant l'ADN contenant le gène transféré, ses séquences de régulation d'expression, et des molécules appartenant à la classe des lipides, des carbohydrates, ou des protéines, lesquels possèdent des propriétés fonctionnelles capables, 1) de cibler le dépôt de l'ADN sur la surface de la cellule cible, 2) d'introduire cet ADN à l'intérieur de la cellule ciblée, et 3) d'introduire cet ADN dans le noyau de la cellule ciblée.By "recombinant viral gene transfer vector" is meant any virus capable of infecting eukaryotic type cells, and advantageously a virus suitable for gene therapy, such as an adenovirus or a retrovirus (by example a type C retrovirus). The term “non-viral recombinant gene transfer vector” denotes macromolecular complexes associating the DNA containing the transferred gene, its expression regulation sequences, and molecules belonging to the class of lipids, carbohydrates, or proteins. , which have functional properties capable, 1) of targeting the deposition of DNA on the surface of the target cell, 2) of introducing this DNA into the target cell, and 3) of introducing this DNA into the nucleus of the target cell.
Par "processus d'entrée cellulaire du vecteur recombinant viral de transfert de gène" , on désigne l'ensemble des événements aboutissant à l'introduction du gène véhiculé dans le cytoplasme de la cellule ciblée suite au contact initial entre la surface de cette cellule et le vecteur de transfert de gène.By “cellular entry process of the viral recombinant gene transfer vector”, is meant the set of events leading to the introduction of the gene carried into the cytoplasm of the targeted cell following initial contact between the surface of this cell and the gene transfer vector.
A titre d'exemple, pour les vecteurs rétroviraux, en fonction d'une cible cellulaire définie pour laquelle on connaît une molécule de surface "ciblable" (c'est-à-dire suffisamment spécifiques par rapport aux autres tissus) et un ligand pour cette molécule de surface (ligand ou anticorps monochaîne), on peut construire génétiquement un gène codant pour la glycoprotéine d'enveloppe ciblant cette molécule de surface. Ceci est réalisé en fusionnant (de N à C-terminal) un peptide signal, le ligand, le peptide "masquant/démasquant", et le reste de l'enveloppe rétrovirale. Un vecteur d'expression pour cette molécule chimère est inséré dans une lignée cellulaire "semi-transcomplémentante" exprimant les protéines gag et pol du virus MLV (codant pour la capside rétrovirale et les enzymes de réplication du retrovirus). On obtient une lignée "transcomplémentante" qui peut alors servir à produire des vecteurs rétroviraux si on y introduit, en plus, un plasmide portant ce vecteur rétroviral, comme ceci a lieu pour les lignées transcomplémentantes classiques exprimant des enveloppes rétrovirales normales.For example, for retroviral vectors, as a function of a defined cellular target for which a "targetable" surface molecule (that is to say sufficiently specific with respect to other tissues) and a ligand for is known. this surface molecule (ligand or monochain antibody), we can genetically construct a gene coding for the envelope glycoprotein targeting this surface molecule. This is achieved by fusing (from N to C-terminal) a signal peptide, the ligand, the "masking / unmasking" peptide, and the rest of the retroviral envelope. An expression vector for this chimeric molecule is inserted into a “semi-transcomplementing” cell line expressing the gag and pol proteins of the MLV virus (coding for the retroviral capsid and the replication enzymes of the retrovirus). A “transcomplementing” line is obtained which can then be used to produce retroviral vectors if there is introduced, in addition, a plasmid carrying this retroviral vector, as occurs for conventional transcomplementing lines expressing normal retroviral envelopes.
L'invention a également pour objet l'utilisation d'un peptide selon l'invention, dans la construction d'une glycoprotéine d'enveloppe (rétro)virale essentiellement intacte, portée par une particule (rétro)virale recombinante capable d'infecter une cellule eucaryote, ladite glycoprotéine d'enveloppe étant avantageusement sous forme polymérique, notamment sous forme trimérique, chaque monomère de la forme polymérique étant lui-même sous forme d'hétérodimère, ladite cellule eucaryote comportant un récepteur ciblé et un récepteur auxiliaire permettant de faciliter l'entrée de la susdite particuleA subject of the invention is also the use of a peptide according to the invention, in the construction of an essentially intact (retro) viral envelope glycoprotein, carried by a recombinant (retro) viral particle capable of infecting a eukaryotic cell, said envelope glycoprotein advantageously being in polymeric form, in particular in trimeric form, each monomer of the polymeric form itself being in the form of heterodimer, said eukaryotic cell comprising a targeted receptor and an auxiliary receptor making it possible to facilitate the entry of the above particle
(rétro)virale (récepteur (rétro)viral) dans la cellule eucaryote, la glycoprotéine d'enveloppe comprenant :(retro) viral ((retro) viral receptor) in the eukaryotic cell, the envelope glycoprotein comprising:
- le susdit peptide,- the above peptide,
- un domaine protéique du côté N-terminal (en amont) du susdit peptide, susceptible d' interagir avec le susdit récepteur ciblé, laquelle interaction permet de lier spécifiquement la particule (rétro)virale eta protein domain on the N-terminal side (upstream) of the above-mentioned peptide, capable of interacting with the above-mentioned targeted receptor, which interaction makes it possible to specifically bind the (retro) viral particle and
- un domaine protéique du côté C-terminal (en aval) du susdit peptide, susceptible d' interagir avec le susdit récepteur (rétro)viral, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée de la particule (rétro) virale dans la cellule eucaryote, le processus d'entrée cellulaire de la particule (rétro)virale recombinante dans la cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le récepteur ciblé de la cellule eucaryote avec la particule (rétro)virale recombinante, entraînant par l'intermédiaire du susdit peptide un mécanisme de "démasquage" ou encore d'accessibilité du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre la particule virale recombinante et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de "masquage" ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval). Les glycoprotéines d'enveloppe (rétro) virales sont des trimères d'hétéro- dimères de sous-unité de surface (SU) et de sous-unité transmembranaire (TM). Cette notion de trimérisation est fondamentale pour la fonctionnalité de l'enveloppe (rétro)virale. Les glycoprotéines d'enveloppe de l'invention sont avantageusement sous forme trimérique. Selon un mode de réalisation avantageux de l'invention, le domaine protéique N-terminal (amont) est choisi parmi les polypeptides suivants :- a protein domain on the C-terminal side (downstream) of the above peptide, capable of interacting with the above-mentioned (retro) viral receptor, which interaction plays the role of an auxiliary mechanism for entry of the (retro) viral particle into the eukaryotic cell, the process of cellular entry of the recombinant (retro) viral particle into the eukaryotic cell through the C-terminal protein domain (downstream ) which can only take place when the N-terminal protein domain (upstream) has recognized and linked the targeted receptor of the eukaryotic cell with the recombinant (retro) viral particle, causing via the above-mentioned peptide a "unmasking" mechanism or accessibility of the (retro) viral receptor vis-à-vis the C-terminal protein domain (downstream), and, in the case where there is no recognition between the recombinant viral particle and the targeted receptor of the eukaryotic cell through the N-terminal protein domain (upstream), there is a mechanism of "masking" or even of inaccessibility, via the above peptide, of the (retro) viral receptor vis-à-vis the domain protein e C-terminal (downstream). The (retro) viral envelope glycoproteins are trimers of hetero-dimers of surface subunit (SU) and transmembrane subunit (TM). This notion of trimerization is fundamental for the functionality of the (retro) viral envelope. The envelope glycoproteins of the invention are advantageously in trimeric form. According to an advantageous embodiment of the invention, the N-terminal (upstream) protein domain is chosen from the following polypeptides:
- anticorps monobrin reconnaissant des molécules de surface cellulaire,- single-stranded antibody recognizing cell surface molecules,
- tout ligand pour une molécule de surface cellulaire, notamment hormones polypeptidiques, cytokine, facteurs de croissance. Selon un mode de réalisation avantageux de l'invention, le domaine protéique C-terminal (aval) correspond à une glycoprotéine d'enveloppe (rétro) virale, essentiellement intacte comportant le domaine naturel de liaison, les fonctions de fusion et d'ancrage de la glycoprotéine d'enveloppe sauvage dont dérive la glycoprotéine d'enveloppe portée par la particule (rétro)virale recombinante.- any ligand for a cell surface molecule, in particular polypeptide hormones, cytokine, growth factors. According to an advantageous embodiment of the invention, the C-terminal (downstream) protein domain corresponds to a (retro) viral envelope glycoprotein, essentially intact, comprising the natural binding domain, the fusion and anchoring functions of the wild envelope glycoprotein from which the envelope glycoprotein carried by the recombinant (retro) viral particle is derived.
Selon un mode de réalisation avantageux de l'invention, le peptide provient de la glycoprotéine d'enveloppe des retrovirus de type C, et en ce que le virus est avantageusement choisi parmi : le virus MLV écotrope, le virus MLV amphotrope, le virus MLV xénotrope, le virus MLV MCF, le virus MLV 10A1 , GALV (Gibbon Ape Leukemia Virus), SSAV (Simian SarcomaAccording to an advantageous embodiment of the invention, the peptide comes from the envelope glycoprotein of type C retroviruses, and in that the virus is advantageously chosen from: the ecotropic MLV virus, the amphotropic MLV virus, the MLV virus xenotropic, MLV MCF virus, MLV 10A1 virus, GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma
Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Féline Leukemia Virus), et notamment en ce que le peptide est choisi parmi ceux contenant ou étant constitués par l'une des séquences suivantes : PRO (4070A), PRO(MoMLV), ΔPRO, PRO + , ΔPRO + , PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Feline Leukemia Virus), and in particular in that the peptide is chosen from those containing or consisting of one of the following sequences: PRO (4070A), PRO ( MoMLV), ΔPRO, PRO +, ΔPRO +, PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.
L'invention a pour objet l'utilisation d'un peptide dérivé ou adapté de l'élastine bovine et choisi parmi ceux contenant ou étant constitué par l'une des séquences suivantes : EL3, EL3-V, EL5.The subject of the invention is the use of a peptide derived or adapted from bovine elastin and chosen from those containing or consisting of one of the following sequences: EL3, EL3-V, EL5.
L'invention a également pour objet des séquences peptidiques choisies parmi celles contenant ou constituées par l'une des séquences suivantes :The subject of the invention is also peptide sequences chosen from those containing or consisting of one of the following sequences:
-PRO (4070A), PRO(MoMLV), PROβ, PRO+, ΔPRO, ΔPROβ, ΔPRO+,-PRO (4070A), PRO (MoMLV), PROβ, PRO +, ΔPRO, ΔPROβ, ΔPRO +,
-MOAPRO, MOAΔPRO, - EMOPRO, EMOPROβ, EMOPRO+ , EAPRO, EAPROβ, EAPRO+ ,-MOAPRO, MOAΔPRO, - EMOPRO, EMOPROβ, EMOPRO +, EAPRO, EAPROβ, EAPRO +,
EMOΔPRO, EMOΔPROβ, EMOΔPRO + , EAΔPRO, EAΔPROβ, EAΔPRO + , AMOEL3, AMOEL3-V, AMOEL5.EMOΔPRO, EMOΔPROβ, EMOΔPRO +, EAΔPRO, EAΔPROβ, EAΔPRO +, AMOEL3, AMOEL3-V, AMOEL5.
PRO (4070A), PRO(MoMLV), PROβ, PRO + , ΔPRO, ΔPROβ, ΔPRO+ , EL3, EL3-V, EL5 sont des peptides masquants/démasquants de l'invention. AMOPRO, AMOΔPRO, AMOEL3, AMOEL3-V, AMOEL5 correspondent à des enveloppes ciblant Ram-1.PRO (4070A), PRO (MoMLV), PROβ, PRO +, ΔPRO, ΔPROβ, ΔPRO +, EL3, EL3-V, EL5 are masking / unmasking peptides of the invention. AMOPRO, AMOΔPRO, AMOEL3, AMOEL3-V, AMOEL5 correspond to envelopes targeting Ram-1.
MOAPRO, MOAΔPRO correspondent à des enveloppes ciblant Rec-1. EMOPRO, EMOPROβ, EMOPRO + , EAPRO, EAPROβ, EAPRO+ , EMOΔPRO, EMOΔPROβ, EMOΔPRO + , EAΔPRO, EAΔPROβ, EAΔPRO + correspondent à des enveloppes ciblant EGFR.MOAPRO, MOAΔPRO correspond to envelopes targeting Rec-1. EMOPRO, EMOPROβ, EMOPRO +, EAPRO, EAPROβ, EAPRO +, EMOΔPRO, EMOΔPROβ, EMOΔPRO +, EAΔPRO, EAΔPROβ, EAΔPRO + correspond to envelopes targeting EGFR.
L' invention a également pour objet une séquence polypeptidique contenant un peptide d'environ 10 à environ 200, notamment d'environ 15 à environ 150 acides aminés, et avantageusement d'environ 20, dans lequel 30% au moins des acides aminés sont constitués par des résidus proline, lesquels résidus proline sont régulièrement agencés de manière à induire des repliements de la chaîne polypeptidique à environ 180° ("β-turn" ou "reverse-turn"), ces repliements étant régulièrement espacés et s'assemblant en une hélice polyproline à repliement de type β ("polyproline β-turn helix"),A subject of the invention is also a polypeptide sequence containing a peptide of approximately 10 to approximately 200, in particular approximately 15 to approximately 150 amino acids, and advantageously approximately 20, in which at least 30% of the amino acids consist by proline residues, which proline residues are regularly arranged so as to induce folds of the polypeptide chain at around 180 ° ("β-turn" or "reverse-turn"), these folds being regularly spaced and assembling into a β-folding polyproline propeller ("polyproline β-turn helix"),
- un domaine protéique N-terminal (en amont) du susdit peptide, susceptible de réagir avec un récepteur approprié (récepteur ciblé) situé sur une cellule eucaryote, lequel domaine protéique permet de lier spécifiquement une particule (rétro)virale recombinante contenant ledit domaine protéique N-terminal etan N-terminal protein domain (upstream) of the above peptide, capable of reacting with an appropriate receptor (targeted receptor) located on a eukaryotic cell, which protein domain makes it possible to specifically bind a recombinant (retro) viral particle containing said protein domain N-terminal and
- un domaine protéique C-terminal (en aval) du susdit peptide, susceptible d' interagir avec un récepteur (rétro) viral auxiliaire approprié (récepteur (rétro)viral) situé sur ladite cellule eucaryote, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée de la particule (rétro)virale dans ladite cellule eucaryote, le processus d'entrée cellulaire de ladite particule (rétro)virale recombinante dans ladite cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le récepteur ciblé de la cellule eucaryote avec ladite particule (rétro)virale recombinante, entraînant par l ' intermédiaire du susdit peptide un mécanisme de démasquage ou encore d'accessibilité du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre la particule virale recombinante et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de masquage ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval).- a C-terminal protein domain (downstream) of the above peptide, capable of interacting with an appropriate auxiliary (retro) viral receptor ((retro) viral receptor) located on said eukaryotic cell, which interaction plays the role of an auxiliary mechanism of entry of the (retro) viral particle into said eukaryotic cell, the process of cellular entry of said recombinant (retro) viral particle into said eukaryotic cell through the C-terminal (downstream) protein domain can only take place when the N-terminal (upstream) protein domain has recognized and linked the targeted receptor of the eukaryotic cell with said recombinant (retro) viral particle, causing via the above peptide a mechanism for unmasking or even for accessibility of the (retro) viral receptor with respect to the C-terminal protein domain ( downstream), and, in the case where there is no recognition between the recombinant viral particle and the targeted receptor of the eukaryotic cell through the N-terminal protein domain (upstream), a masking mechanism occurs or else non-accessibility, via the above peptide, of the (retro) viral receptor vis-à-vis the C-terminal protein domain (downstream).
L' invention concerne également une particule (rétro)virale recombinante susceptible d' infecter une cellule eucaryote, laquelle cellule comporte un récepteur ciblé et un récepteur auxiliaire de la susdite particule (rétro) virale, comprenant une glycoprotéine d'enveloppe substantiellement intacte, notamment sous forme polymérique et avantageusement sous forme trimérique, chaque monomère de la forme polymérique étant avantageusement lui-même sous forme hétérodimère, contenant un peptide d'environ 10 à environ 200, notamment d'environ 15 à environ 150 acides aminés, et avantageusement d'environ 20, dans lequel 30% au moins des acides aminés sont constitués par des résidus proline, lesquels résidus proline sont régulièrement agencés de manière à induire des repliements de la chaîne polypeptidique à environ 180Λ (" β-turn" ou "reverse-turn"), ces repliements étant régulièrement espacés et s'assemblant en une hélice polyproline à repliement de type β ("polyproline β-turn helix"),The invention also relates to a recombinant (retro) viral particle capable of infecting a eukaryotic cell, which cell comprises a targeted receptor and an auxiliary receptor for the said (retro) viral particle, comprising a substantially intact envelope glycoprotein, especially under polymeric form and advantageously in trimeric form, each monomer of the polymeric form being advantageously itself in heterodimer form, containing a peptide of approximately 10 to approximately 200, in particular approximately 15 to approximately 150 amino acids, and advantageously approximately 20, in which at least 30% of the amino acids consist of proline residues, which proline residues are regularly arranged so as to induce folds of the polypeptide chain at around 180Λ ("β-turn" or "reverse-turn") , these folds being regularly spaced and assembling in a polyproline helix with folding type β ("polyproline β-turn helix"),
- un domaine protéique du côté N-terminal (en amont) du susdit peptide, susceptible d' interagir avec le susdit récepteur ciblé, lequel domaine peptidique permet de lier spécifiquement la particule (rétro)virale eta protein domain on the N-terminal side (upstream) of the above-mentioned peptide, capable of interacting with the above-mentioned targeted receptor, which peptide domain makes it possible to specifically bind the (retro) viral particle and
- un domaine protéique du côté C-terminal (en aval) du susdit peptide, susceptible d' interagir avec le susdit récepteur (rétro)viral, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée de la particule (rétro) virale dans la cellule eucaryote, le processus d'entrée cellulaire de la particule (rétro)virale recombinante dans la cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le récepteur ciblé de la cellule eucaryote avec la particule (rétro)virale recombinante, entraînant par l' intermédiaire du susdit peptide un mécanisme de démasquage ou encore d'accessibilité du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre la particule virale recombinante et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de masquage ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur rétroviral vis-à-vis du domaine protéique C-terminal (aval).- a protein domain on the C-terminal side (downstream) of the aforementioned peptide, capable of interacting with the aforesaid (retro) viral receptor, which interaction plays the role of auxiliary mechanism of entry of the (retro) viral particle in the eukaryotic cell, the process of cellular entry of the recombinant (retro) viral particle into the eukaryotic cell via the C-terminal (downstream) protein domain can only take place when the N-terminal (upstream) protein domain has recognized and bound the targeted receptor of the eukaryotic cell with the recombinant (retro) viral particle, causing via the above peptide a mechanism of unmasking or accessibility of the (retro) viral receptor vis-à-vis the C-terminal protein domain (downstream), and, in the case where there is no recognition between the recombinant viral particle and the targeted receptor for the eukaryotic cell by means of the N-terminal protein domain (upstream), a mechanism of masking occurs or else of non-accessibility, via the aforesaid peptide, of the retroviral receptor vis-à-vis the C-terminal protein domain (downstream).
L'invention concerne également une particule (rétro)virale recombinante caractérisée en ce que le domaine protéique N-terminal (amont) est choisi parmi les peptides suivants :The invention also relates to a recombinant (retro) viral particle characterized in that the N-terminal (upstream) protein domain is chosen from the following peptides:
- anticorps monobrin reconnaissant des molécules de surface cellulaire,- single-stranded antibody recognizing cell surface molecules,
- tout ligand pour une molécule de surface cellulaire, notamment hormones polypeptidiques, cytokine, facteurs de croissance.- any ligand for a cell surface molecule, in particular polypeptide hormones, cytokine, growth factors.
L'invention concerne également une particule (rétro)virale recombinante caractérisée en ce que le domaine protéique C-terminal (aval) correspond à un polypeptide d'origine (rétro)virale comportant les fonctions de liaison, de fusion et d'ancrage de la glycoprotéine d'enveloppe sauvage dont dérive la glycoprotéine d'enveloppe portée par la particule (rétro) virale recombinante, et peut provenir des domaines naturels comportant les fonctions de liaison, de fusion et d'ancrage des glycoprotéines d'enveloppe issues des retrovirusThe invention also relates to a recombinant (retro) viral particle characterized in that the C-terminal (downstream) protein domain corresponds to a polypeptide of (retro) viral origin comprising the binding, fusion and anchoring functions of the wild envelope glycoprotein from which the envelope glycoprotein carried by the recombinant (retro) viral particle is derived, and can come from natural domains comprising the functions of binding, fusion and anchoring of envelope glycoproteins derived from retroviruses
MLV-A, GALV, FeLVB, ou des virus tels que adénovirus, herpès virus, virus AAV (Adeno Associated Virus), ou plus généralement de glycoprotéines virales issues de virus d'origine eucaryote, notamment orthomyxovirus (tel que virus influenza) ou paramyxovirus (tel que SV5). L'invention concerne également une particule (rétro)virale recombinante caractérisée en ce que le peptide provient de la glycoprotéine d'enveloppe de retrovirus de type C, et en ce que le peptide provient avantageusement d'un virus choisi parmi : le virus MLV écotrope, le virus MLV amphotrope, le virus MLV xénotrope, le virus MLV MCF, le virus MLV 10A1 , GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLVMLV-A, GALV, FeLVB, or viruses such as adenovirus, herpes virus, AAV virus (Adeno Associated Virus), or more generally viral glycoproteins derived from viruses of eukaryotic origin, in particular orthomyxovirus (such as influenza virus) or paramyxovirus (such as SV5). The invention also relates to a recombinant (retro) viral particle characterized in that the peptide comes from the envelope glycoprotein of type C retrovirus, and in that the peptide advantageously comes from a virus chosen from: the ecotropic MLV virus , amphotropic MLV virus, xenotropic MLV virus, MLV MCF virus, MLV 10A1 virus, GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV
B, FeLV C (FeLV : Féline Leukemia Virus), et notamment en ce que le peptide est choisi parmi ceux contenant ou étant constitués par l 'une des séquences suivantes : PRO (4070A), PRO(MoMLV), ΔPRO, PRO+ , ΔPRO+ , PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb. L'invention a également pour objet une particule (rétro)virale recombinante caractérisée en ce que :B, FeLV C (FeLV: Feline Leukemia Virus), and in particular in that the peptide is chosen from those containing or consisting of one of the following sequences: PRO (4070A), PRO (MoMLV), ΔPRO, PRO +, ΔPRO + , PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb. The subject of the invention is also a recombinant (retro) viral particle characterized in that:
- le peptide provient de la glycoprotéine d'enveloppe des retrovirus de type C, et en ce que le virus est avantageusement choisi parmi : le virus MLV écotrope, le virus MLV amphotrope, le virus MLV xénotrope, le virus MLV MCF, le virus MLV 10A1 , GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Féline Leukemia Virus), et notamment en ce que le peptide est choisi parmi ceux contenant ou étant constitués par l'une des séquences suivantes : PRO (4070A),the peptide comes from the envelope glycoprotein of type C retroviruses, and in that the virus is advantageously chosen from: the ecotropic MLV virus, amphotropic MLV virus, xenotropic MLV virus, MLV MCF virus, MLV 10A1 virus, GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Feline Leukemia Virus ), and in particular in that the peptide is chosen from those containing or consisting of one of the following sequences: PRO (4070A),
PRO(MoMLV), ΔPRO, PRO + , ΔPRO + , PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.PRO (MoMLV), ΔPRO, PRO +, ΔPRO +, PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.
- le domaine protéique N-terminal (amont) est choisi parmi les peptides suivants:- the N-terminal (upstream) protein domain is chosen from the following peptides:
* anticorps monobrin reconnaissant des molécules de surface cellulaire, * tout ligand pour une molécule de surface cellulaire, notamment hormones polypeptidiques, cytokine, facteurs de croissance,* monobrin antibody recognizing cell surface molecules, * any ligand for a cell surface molecule, in particular polypeptide hormones, cytokine, growth factors,
- le domaine protéique C-terminal correspond à un polypeptide d'origine (rétro)virale comportant les fonctions de liaison, de fusion et d'ancrage de la glycoprotéine d'enveloppe sauvage dont dérive la glycoprotéine d'enveloppe portée par la particule (rétro)virale recombinante, et peut provenir des domaines naturels comportant les fonctions de liaison, de fusion et d'ancrage des glycoprotéines d'enveloppe issues des retrovirus MLV-A, GALV, FeLVB, ou des virus tels que adénovirus, herpès virus, virus AAV (Adeno Associated Virus), ou plus généralement de glycoprotéines virales issues de virus d'origine eucaryote, notamment orthomyxovirus (tel que virus influenza) ou paramyxovirus (tel que SV5).the C-terminal protein domain corresponds to a polypeptide of (retro) viral origin comprising the binding, fusion and anchoring functions of the wild envelope glycoprotein from which the envelope glycoprotein carried by the particle is derived (retro ) recombinant viral, and can come from natural domains comprising the functions of binding, fusion and anchoring of envelope glycoproteins derived from MLV-A, GALV, FeLVB retroviruses, or viruses such as adenovirus, herpes virus, AAV virus (Adeno Associated Virus), or more generally viral glycoproteins derived from viruses of eukaryotic origin, in particular orthomyxovirus (such as influenza virus) or paramyxovirus (such as SV5).
L'invention concerne également une particule (rétro)virale recombinante caractérisée en ce que l'extrémité 5' de la séquence nucléotidique codant pour le domaine protéique N-terminal (amont) est contiguë à l'extrémité 3' de la séquence nucléotidique codant pour le peptide signal, l'extrémité 3' de la séquence nucléotidique codant pour le domaine protéique N-terminal (amont) est contiguë à l'extrémité 5' de la séquence nucléotidique codant pour le peptide, l'extrémité 3' de la séquence nucléotidique codant pour le peptide est contiguë à l'extrémité 5' de la séquence nucléotidique codant pour le domaine protéique C-terminal (aval).The invention also relates to a recombinant (retro) viral particle characterized in that the 5 'end of the nucleotide sequence coding for the N-terminal (upstream) protein domain is contiguous with the 3' end of the nucleotide sequence coding for the signal peptide, the 3 'end of the nucleotide sequence coding for the N-terminal (upstream) protein domain is contiguous with the 5' end of the nucleotide sequence coding for the peptide, the 3 'end of the nucleotide sequence coding for the peptide is contiguous with the 5 ′ end of the nucleotide sequence coding for the C-terminal protein domain (downstream).
L'invention a également pour objet un acide nucléique codant pour un peptide ou pour une particule recombinante selon l'invention.The invention also relates to a nucleic acid coding for a peptide or for a recombinant particle according to the invention.
L'invention a également pour objet une méthode de transfert sélective in vitro ou ex vivo d'un acide nucléique dans des cellules eucaryotes cibles présentes parmi d'autres cellules non-cibles, comprenant l'administration aux cellules cibles et non-cibles d'une particule recombinante (rétro)virale selonThe invention also relates to a method for the selective transfer in vitro or ex vivo of a nucleic acid into target eukaryotic cells present among other non-target cells, comprising the administration to target and non-target cells of a recombinant (retro) viral particle according to
/'invention, contenant l'acide nucléique à transférer. L'invention a également pour objet une composition pharmaceutique contenant à titre de substance active une particule (rétro)vιrale selon l' invention, et contenant également un gène à transférer, en association avec un véhicule pharmaceutique physiologiquement approprié. S 'agissant des gènes à transférer importants pour la thérapie génique, il s'agit par exemple de IFN, IL2, p53, VEGF, TNF, CFTR, HSV-TK, lacZ, GFP, gène de cytokines diverses, autres types de gènes suicides y compris gènes de suicide conditionnels, autres gènes à activité anti virale, autres gènes à activité antitumorale, autres gènes marqueurs et tout gène thérapeutique de maladie mono- ou multi-génique A titre d'exemple, les pathologies les plus spécifiquement concernées sont : la plupart des maladies mono- ou multi- génique (mucovisidose, myopathie, maladies lysosomales, les formes diverses de cancer, les maladies virales (SIDA), ...)the invention containing the nucleic acid to be transferred. The invention also relates to a pharmaceutical composition containing as active substance a (retro) vιrale particle according to the invention, and also containing a gene to be transferred, in association with a physiologically appropriate pharmaceutical vehicle. As regards the genes to be transferred which are important for gene therapy, these are for example IFN, IL2, p53, VEGF, TNF, CFTR, HSV-TK, lacZ, GFP, various cytokine genes, other types of suicide genes including conditional suicide genes, other genes with anti-viral activity, other genes with anti-tumor activity, other marker genes and any therapeutic gene for mono- or multi-gene disease. For example, the pathologies most specifically concerned are: most single and multi-gene diseases (mucovisidosis, myopathy, lysosomal diseases, various forms of cancer, viral diseases (AIDS), ...)
Pour bien comprendre le mécanisme de l'invention (voir figure 1), il faut considérer que les glycoprotéines d'enveloppe selon l'invention (également désignées par "enveloppes chimères") possèdent, outre un domaine de reconnaissance additionnel, les fonctions correspondant à leurs domaines propres , c'est-à-dire (voir figure 2),To fully understand the mechanism of the invention (see FIG. 1), it must be considered that the envelope glycoproteins according to the invention (also designated by "chimeric envelopes") possess, in addition to an additional recognition domain, the functions corresponding to their own domains, that is to say (see Figure 2),
1) le domaine de liaison naturel situé dans la partie N-terminale de la sous- unité de surface (SU) de la glycoprotéine d'enveloppe sauvage, et donc, juste en aval du domaine de liaison surnuméraire et1) the natural binding domain located in the N-terminal part of the surface subunit (SU) of the wild-type glycoprotein, and therefore, just downstream of the supernumerary binding domain and
2) le domaine de fusion localisé dans la partie C-terminale de la sous-unité (SU) et dans la sous-unité transmembranaire (TM) du complexe de glycoprotéine d'enveloppe. Pour les enveloppes chimères construites précédemment (enveloppes EMO et AMO, par exemple) en s 'appuyant sur la structure générale schématisée en Figure 2, le domaine de liaison naturel est fonctionnel. Si le récepteur rétroviral qu'il reconnaît est exprimé à la surface de la cellule cible, alors ce domaine le reconnaîtra, et permettra le poursuite de l'infection. Il n'y aura alors pas de possibilité de ciblage spécifique, même si une molécule de surface reconnaissant spécifiquement le domaine de liaison surnuméraire est aussi exprimée2) the fusion domain located in the C-terminal part of the subunit (SU) and in the transmembrane subunit (TM) of the envelope glycoprotein complex. For the chimeric envelopes constructed previously (EMO and AMO envelopes, for example) based on the general structure shown schematically in Figure 2, the natural binding domain is functional. If the retroviral receptor it recognizes is expressed on the surface of the target cell, then this domain will recognize it, and allow the infection to continue. There will then be no possibility of specific targeting, even if a surface molecule specifically recognizing the supernumerary binding domain is also expressed.
Cependant, en fonction du peptide inséré entre le domaine de liaison surnuméraire et le domaine de liaison naturel, il est possible de moduler fortement la fonctionnalité du domaine de liaison naturel et, dans le cas de certains de ces peptides, d'empêcher efficacement son accessibilité pour la reconnaissance du récepteur rétroviral (première action). Ce même domaine pourra être démasqué, et donc devenir accessible à une interaction avec le récepteur rétroviral normal, si et seulement si le domaine de liaison surnuméraire a préalablement interagi avec la molécule de surface ciblée. Cette deuxième action est également médiée par le peptide séparant les deux domaines. Le récepteur rétroviral normal joue ici le rôle de molécule auxiliaire.However, depending on the peptide inserted between the supernumerary binding domain and the natural binding domain, it is possible to strongly modulate the functionality of the natural binding domain and, in the case of some of these peptides, to effectively prevent its accessibility. for recognition of the retroviral receptor (first action). This same domain can be unmasked, and therefore become accessible to interaction with the normal retroviral receptor, if and only if the binding domain supernumerary previously interacted with the targeted surface molecule. This second action is also mediated by the peptide separating the two domains. The normal retroviral receptor here acts as an auxiliary molecule.
Légende des figures :Legend of figures:
- la Figure 1 représente le processus d'entrée en deux étapes de la particule virale ciblante. Les particules virales sont générées (A) avec des glycoprotéines d'enveloppes ciblantes composées d'un domaine N-terminal (ligand, anticorps monobrin, etc), du peptide masquant/démasquant, et d'un domaine C-terminal (B). Les étapes donnant lieu à l'introduction du virion dans la cellule ciblée font intervenir un mécanisme coordonné par le peptide masquant/démasquant (C).- Figure 1 shows the two-stage entry process of the targeting viral particle. The viral particles are generated (A) with targeting envelope glycoproteins composed of an N-terminal domain (ligand, monobrin antibody, etc.), of the masking / unmasking peptide, and of a C-terminal domain (B). The steps leading to the introduction of the virion into the targeted cell involve a mechanism coordinated by the masking / unmasking peptide (C).
- la Figure 2 est une représentation schématique de certaines des enveloppes ciblantes étudiées. La position de quelques régions fonctionnelles est montrée. Flèches verticales: sites des clivage protéoly tique. SU: sous-unité de surface, TM: sous-unité de transmembrane, SP: peptide signal, PRO: région poly-proline, T: domaine transmembranaire, Ram-1 ligand: domaine de liaison pour le récepteur amphotrope, Rec-1 ligand: domaine de liaison pour le récepteur écotrope, EGF: facteur de croissance épidermique ("epidermal growth factor"). Boites gris foncé: séquence dérivées du gène env de MoMLV, Boites gris clair: séquence dérivées du gène env de MLV-4070A, Boites blanches: autres séquences dérivées des MLV. Boites noires: peptides espaceurs dérivés de la région poly-proline. Tous les gènes env sont exprimés à partir du même promoteur (LTR) et signal de polyadenylation (pA) à partir du ARNm sous- génomique utilisant les sites d'épisage rétroviraux, donneur (SD) et accepteur- Figure 2 is a schematic representation of some of the targeting envelopes studied. The position of some functional regions is shown. Vertical arrows: proteolytic cleavage sites. SU: surface subunit, TM: transmembrane subunit, SP: signal peptide, PRO: poly-proline region, T: transmembrane domain, Ram-1 ligand: binding domain for the amphotropic receptor, Rec-1 ligand : binding domain for the ecotropic receptor, EGF: epidermal growth factor. Dark gray boxes: sequence derived from the env gene of MoMLV, Light gray boxes: sequence derived from the env gene of MLV-4070A, White boxes: other sequences derived from MLV. Black boxes: spacer peptides derived from the poly-proline region. All env genes are expressed from the same promoter (LTR) and polyadenylation signal (pA) from the subgenomic mRNA using the retroviral, donor (SD) and acceptor splice sites.
(SA), avec une séquence intronique identique de 190 nts contenant la fin du gène pol (ΔPOL). La position de certains sites de restriction est représentée.(SA), with an identical intronic sequence of 190 nts containing the end of the pol gene (ΔPOL). The position of some restriction sites is shown.
- la Figure 3 représente la séquence des peptides espaceurs et des domaines de liaison étudiés. (A) Séquence des peptides espaceurs dans la série AMO. AS208 et fusionnés avec les divers peptides espaceurs, et l'ensemble est fusionné avec le codon 7 de la SU de l'enveloppe du MoMLV. (B) Séquence des peptides espaceurs dans la série MOA. Le domaine de liaison à Rec-1 est fusionné avec les divers peptides espaceurs, et l'ensemble est fusionné avec le codon 5 de la SU de l'enveloppe du MLV-Amphotrope. (C) Séquence des peptides espaceurs dans la série EMO et EA. Le domaine de liaison EGF est fusionné avec les divers peptides espaceurs, et l'ensemble est fusionné avec le codon 5 de la SU de l'enveloppe du MLV-Amphotrope ou avec le codon 7 de la SU de l'enveloppe du MoMLV. - la Figure 4 représente la détection de l'expression membranaire des enveloppes de la série EMO. Des populations de cellules transfectées et sélectionnées à la phléomycine sont marquées avec (histogrammes noirs) ou sans (histogrammes blancs) anticorps anti-hEGF, puis avec des anticorps anti-IgG de souris couplés à la FITC.- Figure 3 shows the sequence of spacer peptides and the binding domains studied. (A) Sequence of spacer peptides in the AMO series. AS208 and fused with the various spacer peptides, and the assembly is fused with codon 7 of the SU of the envelope of MoMLV. (B) Sequence of spacer peptides in the MOA series. The Rec-1 binding domain is fused with the various spacer peptides, and the assembly is fused with codon 5 of the SU of the MLV-Amphotropic envelope. (C) Sequence of spacer peptides in the EMO and EA series. The EGF binding domain is fused with the various spacer peptides, and the whole is fused with codon 5 of the SU of the envelope of the MLV-Amphotrope or with codon 7 of the SU of the envelope of the MoMLV. - Figure 4 represents the detection of the membrane expression of the envelopes of the EMO series. Populations of cells transfected and selected with phleomycin are labeled with (black histograms) or without (white histograms) anti-hEGF antibodies, then with anti-mouse IgG antibodies coupled to FITC.
- la Figure 5 représente l'expression et l' incorporation virale des enveloppes chimères de la série AMO. Immunoblots sur des lysats de cellules TELCeBό transfectées par les plasmides exprimant les enveloppes chimères (voir Figure 2 et Figure 3A) et sur des culots de particules virales purifiées par ultracentrifugation. Les immunoblots sont révélés avec un anti-sérum anti-SU- Figure 5 shows the expression and viral incorporation of the chimeric envelopes of the AMO series. Immunoblots on lysates of TELCeBό cells transfected with plasmids expressing the chimeric envelopes (see Figure 2 and Figure 3A) and on pellets of viral particles purified by ultracentrifugation. The immunoblots are revealed with an anti-SU anti-serum
(partie haute) ou avec un anti-sérum anti-p30-CA (partie basse, taille inférieure à 46 KD). Les positions de la p30-CA (CA), et, pour les enveloppes sauvages MO, du précurseur (PR) et de la protéine surface (SU) du complexe d'enveloppe sont représentées. - la Figure 6 représente les tests de liaison sur cellules humaines des enveloppes de la série EMO (A) et AMO (B). Le bruit de fond de fluorescence est fourni par incubation des cellules humaines avec l'enveloppe écotrope (histogrammes blancs),(upper part) or with an anti-p30-CA anti-serum (lower part, size less than 46 KD). The positions of p30-CA (CA), and, for wild MO envelopes, of the precursor (PR) and of the surface protein (SU) of the envelope complex are shown. - Figure 6 shows the binding tests on human cells of the envelopes of the EMO (A) and AMO (B) series. The fluorescence background noise is provided by incubation of human cells with the ecotropic envelope (white histograms),
- la Figure 7 représente la séquence en acides aminés et en nucléotides de PRO(4070A).- Figure 7 shows the amino acid and nucleotide sequence of PRO (4070A).
- la Figure 8 représente la séquence en acides aminés et en nucléotides de PRO(MoMLV).- Figure 8 shows the amino acid and nucleotide sequence of PRO (MoMLV).
- la Figure 9 représente la séquence en acides aminés et en nucléotides de PROβ(MoMLV). - la Figure 10 représente la séquence en acides aminés et en nucléotides de- Figure 9 shows the amino acid and nucleotide sequence of PROβ (MoMLV). - Figure 10 shows the amino acid and nucleotide sequence of
PRO +(4070 A).PRO + (4070 A).
- la Figure 11 représente la séquence en acides aminés et en nucléotides de ΔPRO.- Figure 11 shows the amino acid and nucleotide sequence of ΔPRO.
- la Figure 12 représente la séquence en acides aminés et en nucléotides de ΔPROβ.- Figure 12 shows the amino acid and nucleotide sequence of ΔPROβ.
- la Figure 13 représente la séquence en acides aminés et en nucléotides de ΔPRO+ .- Figure 13 shows the amino acid and nucleotide sequence of ΔPRO +.
- la Figure 14 représente la séquence en acides aminés et en nucléotides de AMOPRO. - la Figure 15 représente la séquence en acides aminés et en nucléotides de- Figure 14 shows the amino acid and nucleotide sequence of AMOPRO. - Figure 15 shows the amino acid and nucleotide sequence of
AMOΔPRO.AMOΔPRO.
- la Figure 16 représente la séquence en acides aminés et en nucléotides de MOAPRO. - la Figure 17 représente la séquence en acides aminés et en nucléotides de MOAΔPRO.- Figure 16 shows the amino acid and nucleotide sequence of MOAPRO. - Figure 17 shows the amino acid and nucleotide sequence of MOAΔPRO.
- la Figure 18 représente la séquence en acides aminés et en nucléotides de EMOPRO. - la Figure 19 représente la séquence en acides aminés et en nucléotides de- Figure 18 shows the amino acid and nucleotide sequence of EMOPRO. - Figure 19 shows the amino acid and nucleotide sequence of
EMOPROβ.EMOPROβ.
- la Figure 20 représente la séquence en acides aminés et en nucléotides de EMOPRO+ .- Figure 20 shows the amino acid and nucleotide sequence of EMOPRO +.
- la Figure 21 représente la séquence en acides aminés et en nucléotides de EAPRO.- Figure 21 shows the amino acid and nucleotide sequence of EAPRO.
- la Figure 22 représente la séquence en acides aminés et en nucléotides de EAPROβ.- Figure 22 shows the amino acid and nucleotide sequence of EAPROβ.
- la Figure 23 représente la séquence en acides aminés et en nucléotides de EAPRO + . - la Figure 24 représente la séquence en acides aminés et en nucléotides de- Figure 23 shows the amino acid and nucleotide sequence of EAPRO +. - Figure 24 shows the amino acid and nucleotide sequence of
EMOΔPRO.EMOΔPRO.
- la Figure 25 représente la séquence en acides aminés et en nucléotides de EMOΔPROβ.- Figure 25 shows the amino acid and nucleotide sequence of EMOΔPROβ.
- la Figure 26 représente la séquence en acides aminés et en nucléotides de EMOΔPRO + .- Figure 26 shows the amino acid and nucleotide sequence of EMOΔPRO +.
- la Figure 27 représente la séquence en acides aminés et en nucléotides de EAΔPRO.- Figure 27 shows the amino acid and nucleotide sequence of EAΔPRO.
- la Figure 28 représente la séquence en acides aminés et en nucléotides de EAΔPROβ. - la Figure 29 représente la séquence en acides aminés et en nucléotides de- Figure 28 shows the amino acid and nucleotide sequence of EAΔPROβ. - Figure 29 shows the amino acid and nucleotide sequence of
EAΔPRO + .EAΔPRO +.
- la Figure 30 représente la séquence en acides aminés et en nucléotides de AMOEL3.- Figure 30 shows the amino acid and nucleotide sequence of AMOEL3.
- la Figure 31 représente la séquence en acides aminés et en nucléotides de EL3.- Figure 31 shows the amino acid and nucleotide sequence of EL3.
- la Figure 32 représente la séquence en acides aminés et en nucléotides de AMOEL3-V.- Figure 32 shows the amino acid and nucleotide sequence of AMOEL3-V.
- la Figure 33 représente la séquence en acides aminés et en nucléotides de EL3-V. - la Figure 34 représente la séquence en acides aminés et en nucléotides de- Figure 33 shows the amino acid and nucleotide sequence of EL3-V. - Figure 34 shows the amino acid and nucleotide sequence of
AMOEL5.AMOEL5.
- la Figure 35 représente la séquence en acides aminés et en nucléotides de EL5. - la Figure 36 représente la séquence en acides aminés et en nucléotides de ΔPR04-beta.- Figure 35 shows the amino acid and nucleotide sequence of EL5. - Figure 36 shows the amino acid and nucleotide sequence of ΔPR04-beta.
- la Figure 37 représente la séquence en acides aminés et en nucléotides de ΔPR04-int. - la Figure 38 représente la séquence en acides aminés et en nucléotides de- Figure 37 shows the amino acid and nucleotide sequence of ΔPR04-int. - Figure 38 shows the amino acid and nucleotide sequence of
ΔPR04-vrb.ΔPR04-vrb.
- la Figure 39 représente la séquence en acides aminés et en nucléotides de PRO-beta.- Figure 39 shows the amino acid and nucleotide sequence of PRO-beta.
- la Figure 40 représente la séquence en acides aminés et en nucléotides de PRO-int.- Figure 40 shows the amino acid and nucleotide sequence of PRO-int.
- la Figure 41 représente la séquence en acides aminés et en nucléotides de PRO-vrb.- Figure 41 shows the amino acid and nucleotide sequence of PRO-vrb.
EXEMPLESEXAMPLES
EXEMPLE 1 :EXAMPLE 1:
Les retrovirus utilisent un certain nombre de molécules de surface cellulaire, appelées récepteurs viraux, pour initier le processus infectieux (23). Sauf exceptions notables, cas des virus de l' immunodéficience humaine notamment, la plupart des récepteurs utilisés par les autres retrovirus et en particulier les retrovirus mammifères de type C sont distribués sur la plupart des types cellulaires de l'organisme hôte. Par exemple le virus de leucémie murine amphotrope (MLV-A) est capable d'infecter la plupart des cellules mammifères car son récepteur, le transporteur de phosphate Ram-1 , est exprimé sur quasiment toutes les cellules.Retroviruses use a number of cell surface molecules, called viral receptors, to initiate the infectious process (23). With notable exceptions, notably in the case of human immunodeficiency viruses, most of the receptors used by other retroviruses and in particular mammalian type C retroviruses are distributed on most cell types of the host organism. For example, the amphotropic murine leukemia virus (MLV-A) is capable of infecting most mammalian cells because its receptor, the phosphate transporter Ram-1, is expressed on almost all cells.
Les retrovirus mammifères de type C sont couramment utilisés pour faire des vecteurs rétroviraux, en particulier à des fins de transfert de gène chez l'homme, en thérapie génique. Certains protocoles de thérapie géniques seraient facilités si les vecteurs rétroviraux étaient capables de reconnaître très précisément les réelles cellules cibles du transfert de gène. Pour cela, un certain nombre de groupes de recherche, dont le nôtre, ont développé des stratégies diverses visant à modifier la reconnaissance entre la particule virale et la surface cellulaire. Cette interaction implique essentiellement la glycoprotéine d'enveloppe rétrovirale; il paraît donc logique de réaliser des modifications génétiques sur cette protéine afin de lui permettre de reconnaître des molécules de surface cellulaire spécifiquement exprimées sur les cellules cibles du transfert de gène. Deux types de stratégies permettant de telles modifications ont été récemment développés. Dans une première stratégie, c'est le domaine de liaison naturel de la glycoprotéine d'enveloppe rétrovirale pour son récepteur qui a été modifié par insertion ou substitution de peptides de tailles réduites capables de lier une molécule de surface cellulaire. Ces travaux ont permis de démontrer la faisabilité du ciblage cellulaire du transfert de gène (20).Mammalian type C retroviruses are commonly used to make retroviral vectors, particularly for gene transfer in humans, in gene therapy. Certain gene therapy protocols would be facilitated if the retroviral vectors were able to recognize very precisely the actual target cells for gene transfer. To do this, a certain number of research groups, including our own, have developed various strategies aimed at modifying the recognition between the viral particle and the cell surface. This interaction essentially involves the retroviral envelope glycoprotein; it therefore seems logical to make genetic modifications to this protein in order to allow it to recognize cell surface molecules specifically expressed on target cells for gene transfer. Two types of strategies allowing such modifications have been recently developed. In a first strategy, it is the natural binding domain of the retroviral envelope glycoprotein for its receptor which has been modified by insertion or substitution of peptides of reduced sizes capable of binding a cell surface molecule. This work has demonstrated the feasibility of cell targeting of gene transfer (20).
Dans une deuxième approche, des polypeptides (ligands, anticorps monobrins) capables de lier des molécules de surface cellulaire diverses ont été insérés à l'extrémité N-terminale de la sous-unité SU de la glycoprotéine d'enveloppes (6) (10) (13) (15) (21). D'une manière générale, l'étude des virions générés avec ces divers types d'enveloppes ciblantes a montré qu'il était possible de rediriger spécifiquement et efficacement la liaison des particules virales vers de nouvelles molécules de surface. Certains facteurs qui limitent l'efficacité du ciblage ont été également identifiés. Le premier semble dépendre de propriétés physiologiques de la molécule de surface ciblée (dimérisation, internalisation, processus de transport ("trafficking") intracellulaire) (6), le deuxième est lié à la faible fusiogénicité intrinsèque des glycoprotéines d'enveloppes chimères générées par insertion N terminale de ligands (6) (21). Il a été observé que cette faible fusiogénicité peut être partiellement surmontée en introduisant un peptide espaceur entre le nouveau domaine de liaison et l'enveloppe (21). Cependant, les meilleurs titres infectieux obtenus sont 100 fois inférieurs à ceux que l'on peut obtenir avec des vecteurs rétroviraux portant une enveloppe sauvage. De plus, il est possible que ces résultats acquis dans un modèle de ciblage particulier (ciblage de Ram-1), ne puisse être étendu à d'autres types de glycoprotéines d'enveloppes ciblantes. Il paraissait donc essentiel de développer des stratégies alternatives pour répondre aux problèmes évoqués.In a second approach, polypeptides (ligands, single-stranded antibodies) capable of binding various cell surface molecules have been inserted at the N-terminal end of the SU subunit of the envelope glycoprotein (6) (10) (13) (15) (21). In general, the study of virions generated with these various types of targeting envelopes has shown that it is possible to specifically and effectively redirect the binding of viral particles to new surface molecules. Some factors that limit the effectiveness of targeting have also been identified. The first seems to depend on physiological properties of the targeted surface molecule (dimerization, internalization, intracellular transport process) (6), the second is linked to the low intrinsic fusiogenicity of the glycerol of envelope chimeras generated by insertion. N terminal ligands (6) (21). It has been observed that this low fusiogenicity can be partially overcome by introducing a spacer peptide between the new binding domain and the envelope (21). However, the best infectious titers obtained are 100 times lower than those which can be obtained with retroviral vectors carrying a wild envelope. In addition, it is possible that these results, acquired in a particular targeting model (targeting Ram-1), cannot be extended to other types of targeting envelope glycoproteins. It therefore seemed essential to develop alternative strategies to respond to the problems raised.
Par ailleurs, une constatation générale faite avec les glycoprotéines d'enveloppes ciblantes générées par insertions N terminales est que le domaine de liaison naturel de l'enveloppe support est toujours fonctionnel. Dans la mesure où les cellules cibles sont des cellules humaines en thérapie génique, cette fonctionnalité du domaine de liaison naturel ne pose pas de problèmes de "bruit de fond" d'infection car on utilise, comme glycoprotéine support, l'enveloppe écotrope du virus MoMLV qui ne reconnaît pas de récepteur sur les cellules des mammifères supérieurs. Cependant, il a paru intéressant de caractériser ces glycoprotéines d'enveloppes chimères capables de reconnaître deux molécules de surface différentes, de voir quelle pouvait être l'influence du peptide espaceur dans cette reconnaissance, et d'estimer les contributions relatives des deux types d'interaction dans le processus infectieux.Furthermore, a general observation made with the targeting envelope glycoproteins generated by N terminal insertions is that the natural binding domain of the support envelope is always functional. Insofar as the target cells are human cells in gene therapy, this functionality of the natural binding domain does not pose problems of infection "background noise" because the ecotropic envelope of the virus is used as the support glycoprotein. MoMLV which does not recognize a receptor on the cells of higher mammals. However, it appeared interesting to characterize these glycoproteins of chimeric envelopes capable of recognizing two different surface molecules, to see what could be the influence of the peptide spacer in this recognition, and to estimate the relative contributions of the two types of interaction in the infectious process.
Ces observations, qui font l'objet des travaux décrits ci-dessous, ont conduit à développer une stratégie de ciblage en deux étapes qui fait d'abord intervenir une reconnaissance spécifique entre le ligand inséré à l'extrémitéThese observations, which are the subject of the work described below, led to the development of a targeting strategy in two stages which first involves a specific recognition between the ligand inserted at the end
N-terminale de la glycoprotéine ciblante, et ensuite un mécanisme auxiliaire permettant de faciliter l'entrée du virus spécifiquement lié à la bonne cible cellulaire par le biais du récepteur rétroviral naturel. Pour éviter tout problème de bruit de fond d'infection lié à l'interaction directe entre le domaine naturel de liaison et le récepteur rétroviral naturel, des peptides espaceurs masquant/démasquant ont également été développés, insérés entre le domaine ciblant et la glycoprotéine d'enveloppe support, et qui sont capables de masquer le domaine de liaison naturel tant que la particule virale n'a pas interagi avec la molécule de surface ciblée. La réalisation de cette interaction induit le démasquage du domaine de liaison naturel et l'interaction entre le domaine naturel de liaison et le récepteur rétroviral naturel (mécanisme auxiliaire) qui prend alors le relais pour introduire le virus dans la cellule.N-terminal targeting glycoprotein, and then an auxiliary mechanism to facilitate the entry of the virus specifically linked to the right cellular target through the natural retroviral receptor. To avoid any problem of background infection due to the direct interaction between the natural binding domain and the natural retroviral receptor, spacer masking / unmasking peptides have also been developed, inserted between the targeting domain and the glycoprotein of support envelope, and which are capable of masking the natural binding domain as long as the viral particle has not interacted with the targeted surface molecule. The realization of this interaction induces the unmasking of the natural binding domain and the interaction between the natural binding domain and the natural retroviral receptor (auxiliary mechanism) which then takes over to introduce the virus into the cell.
Matériels et Méthodes : Lignées cellulaires. La lignée cellulaire TELCeBό (7) dérive de la lignée TELacZ (19) par transfection et sélection clonale des cellules exprimant les protéines gag et pol de MoMLV (Moloney Murine Leukemia Virus : Virus de la leucémie murine Moloney). Les cellules TELacZ expriment le vecteur rétroviral MFGnlslacZ capable de transduire une β-galactosidase nucléaire. Les cellules TELCeBό permettent la production de capsides rétrovirales (non infectieuses car dépourvues d'enveloppes) véhiculant le vecteur rétroviral marqueur nlsLacZ. Les cellules A431 (ATCC CRL1555) et TE671 (ATCC CRL8805) sont cultivées en milieu DMEM (Gibco-BRL) supplémenté par 10% de sérum de veau foetal (Gibco-BRL). Les cellules CHO, CERD9 (9), et CEAR13 (9) sont cultivées en milieu DMEM (Gibco-BRL) supplémenté par 10% de sérum de veau foetal et proline (Gibco-BRL). Les lignées cellulaires NIH-3T3 et dérivées de NIH-3T3 sont cultivées en milieu DMEM (Gibco-BRL) supplémenté par 10% de sérum de veau nouveau né (Gibco-BRL). Enveloppes chimères. Les fragments ADN codant pour les polypeptides reconnaissant soit EGFRMaterials and Methods: Cell lines. The TELCeBό cell line (7) is derived from the TELacZ line (19) by transfection and clonal selection of cells expressing the gag and pol proteins of MoMLV (Moloney Murine Leukemia Virus: Moloney murine leukemia virus). TELacZ cells express the retroviral vector MFGnlslacZ capable of transducing a nuclear β-galactosidase. TELCeBό cells allow the production of retroviral capsids (non-infectious because they lack envelopes) carrying the retroviral marker vector nlsLacZ. The A431 (ATCC CRL1555) and TE671 (ATCC CRL8805) cells are cultured in DMEM medium (Gibco-BRL) supplemented with 10% fetal calf serum (Gibco-BRL). The CHO, CERD9 (9) and CEAR13 (9) cells are cultured in DMEM medium (Gibco-BRL) supplemented with 10% fetal calf serum and proline (Gibco-BRL). The NIH-3T3 and NIH-3T3 cell lines are cultured in DMEM medium (Gibco-BRL) supplemented with 10% newborn calf serum (Gibco-BRL). Chimerical envelopes. DNA fragments encoding polypeptides recognizing either EGFR
(Récepteur à l'EGF) soit Ram-1 (Récepteur MLV- A) ont été générés après PCR (polymerase chain reaction) par utilisation d'oligonucléotides comprenant des sites de restrictions. Ces polypeptides ont été introduits en N-terminal de la protéine SU de MLV (protéine de Surface gp70) dans laquelle les sites de restrictions Sfil et Notl ont été créés au codon +6 (33). Un diagramme schématique des différents gènes env utilisés dans cet article est rapporté en Figure 2. Brièvement, un fragment ADN dérivé d'une amplification PCR, codant pour les 53 acides aminés de l'EGF humain (3) a été généré en utilisant une matrice ADNc (ATCC 59957) et deux oligonucléotides: OUEGF: (5' > ATGCTCAGAGGGGTCAGTACGGCCCAGCCGGCCATGGCCAATAG TGACTCTGAATGTCC) avec un site de restriction Sfil et OLEGF: (5'>ACCTGAAGTGGTGGGAACTGCGCGCGGCCGCATGTGGGGGTCCA GACTCC) comprenant un site Notl. Après digestion par Sfil et Notl, ces fragments ont été clones dans un gène codant soit pour la protéine SU de MoMLV dans le cas de la protéine chimère EMO, soit SU du virus 4070A pour la protéine chimère EA (6) .(EGF receptor) or Ram-1 (MLV-A receptor) were generated after PCR (polymerase chain reaction) using oligonucleotides comprising restriction sites. These polypeptides were introduced at the N-terminal of the SU protein of MLV (Surface protein gp70) in which the restriction sites Sfil and Notl were created at codon +6 (33). A schematic diagram of the various env genes used in this article is reported in Figure 2. Briefly, a DNA fragment derived from PCR amplification, encoding the 53 amino acids of human EGF (3) was generated using a template CDNA (ATCC 59957) and two oligonucleotides: OUEGF: (5 '> ATGCTCAGAGGGGTCAGTACGGCCCAGCCGGCCATGGCCAATAG TGACTCTGAATGTCC) with a restriction site Sfil and OLEGF: (5'> ACCTGAAGTGGTGGGGCCGCCGCC After digestion with Sfil and Notl, these fragments were cloned into a gene coding either for the SU protein of MoMLV in the case of the chimeric protein EMO, or SU of the virus 4070A for the chimeric protein EA (6).
Pour la construction AMO (6), un site Notl a été créé à la fin du domaine de reconnaissance du récepteur dans l'enveloppe 4070 A (appelé AS208), (2), et le nucléotide (nt) 750 (14) en utilisant un fragment PCR généré à partir du site Xhol (nt 594) jusqu'au nt 750 avant la région riche en proline, grâce à deux oligonucléotides: 805FC (5 ' > TCCAATTCCTTCCAAGGGGC) en amont deFor the construction of AMO (6), a NotI site was created at the end of the recognition domain of the receptor in the envelope 4070 A (called AS208), (2), and the nucleotide (nt) 750 (14) using a PCR fragment generated from the Xhol site (nt 594) up to nt 750 before the proline-rich region, using two oligonucleotides: 805FC (5 '> TCCAATTCCTTCCAAGGGGC) upstream of
Xhol etXhol and
806FC (5 ' > ACCCCCACATGCGGCCGCTCCCACATTAAGGACCTGCCG) comprenant un site de restriction Notl. L'enveloppe chimère est constituée par clonage du fragment PCR Xhol/Notl et du fragment Notl/Clal, isolé à partir du gène env EMO (codant pour les protéines SU et TM- P15E Transmembranaire de MoMLV), entre les sites Xhol/Clal du gène env 4070A MLV.806FC (5 '> ACCCCCACATGCGGCCGCTCCCACATTAAGGACCTGCCG) comprising a NotI restriction site. The chimeric envelope is formed by cloning of the Xhol / Notl PCR fragment and of the Notl / Clal fragment, isolated from the env EMO gene (coding for the SU and TM-P15E transmembrane proteins of MoMLV), between the Xhol / Clal sites of the env 4070A MLV gene.
Les constructions résultantes sont récupérées sous la forme d'un fragment BglII/Clal (correspondant aux positions 5408 et 7676 dans MoMLV) et clonées aux sites BamHI et Clal d'un plasmide d'expression FBMOSALF (7) dans lequel un gène marqueur de sélection (8) fusionnés au séquences de polyadénylation du gène PGK (phospho-glycerate kinase) a été introduit en aval de la LTR 3' du virus MLV-C57.The resulting constructs are recovered in the form of a BglII / ClaI fragment (corresponding to positions 5408 and 7676 in MoMLV) and cloned at the BamHI and ClaI sites of an expression plasmid FBMOSALF (7) in which a selection marker gene (8) fused to the polyadenylation sequences of the PGK (phospho-glycerate kinase) gene was introduced downstream of the 3 'LTR of the MLV-C57 virus.
Pour EMO, EA, ou AMO, le nouveau domaine de reconnaissance a été séparé du reste de l'enveloppe MLV par un peptide espaceur constitué par trois alanines, apporté par le site de clonage Notl (15). Dans trois autres séries d'enveloppes ciblantes (dérivées des enveloppes EMO, EA ou AMO), des acides aminés espaceurs ont été introduits soit après le domaine de reconnaissance de EGFR (EGF), soit après le domaine de reconnaissance de Ram-1 (AS208) comme décrit ci-après.For EMO, EA, or AMO, the new recognition domain was separated from the rest of the MLV envelope by a spacer peptide consisting of three alanines, provided by the Notl cloning site (15). In three other series of targeting envelopes (derived from the EMO, EA or AMO envelopes), spacer amino acids were introduced either after the domain of EGFR recognition (EGF), either after the Ram-1 recognition domain (AS208) as described below.
La série d'enveloppes ciblant Ram-1 a été générée en introduisant différents espaceurs entre le domaine de reconnaissance de Ram-1 et l'enveloppe MoMLV (Figure 3A). Pour AMOPRO, une région de 59 acides aminés riche en proline provenant de la SU 4070A (amphotrope) (nucléotides 751 à 927) (14) a été utilisée. Une plus courte région riche en proline également isolée à partir de l'enveloppe MLV 4070A (nt 751-789) a été utilisée pour AMOΔPRO. Cette région correspond à l' espaceur de 13 acides aminés du produit v-mpl (provenant du virus de la leucémie myeloprolifératrice) (18) localisé entre sa région dérivée de env et l'équivalent du gène cellulaire mpl.The series of envelopes targeting Ram-1 was generated by introducing different spacers between the recognition domain of Ram-1 and the MoMLV envelope (Figure 3A). For AMOPRO, a region of 59 proline-rich amino acids from SU 4070A (amphotropic) (nucleotides 751 to 927) (14) was used. A shorter proline-rich region also isolated from the MLV 4070A envelope (nt 751-789) was used for AMOΔPRO. This region corresponds to the 13 amino acid spacer of the v-mpl product (from the myeloproliferative leukemia virus) (18) located between its region derived from env and the equivalent of the cellular gene mpl.
Dans le cas de AMOl , les 208 premiers acides aminés, dérivés de l'enveloppe de MLV 4070 A, ont été fusionnés à l'acide aminé 1 de la SU de MoMLV. Pour AMOlFx, un site de 4 acides aminés correspondant au site de clivage du facteur de coagulation sanguine Xa (Ile-Glu-Gly-Arg) (12) a été inséré après le domaine de reconnaissance de Ram-1 et fusionné au codon + 1 de la SU de MoMLV. La stratégie utilisée pour ces constructions est décrite ci- avant. Brièvement, un oligonucléotide (5'-TCCAATTCCTTCCAAGGGGC-3'), localisé juste en amont du site Xhol du gène env de 4070A (nt 594) a été utilisé en combinaison avec soit l'un ou l'autre des deux oligonucléotides suivants apportant le site Notl :In the case of AMOl, the first 208 amino acids, derived from the envelope of MLV 4070 A, were fused to amino acid 1 of the SU of MoMLV. For AMOlFx, a site of 4 amino acids corresponding to the cleavage site of blood coagulation factor Xa (Ile-Glu-Gly-Arg) (12) was inserted after the recognition domain of Ram-1 and fused to codon + 1 of MoMLV's SU. The strategy used for these constructions is described above. Briefly, an oligonucleotide (5'-TCCAATTCCTTCCAAGGGGC-3 '), located just upstream of the Xhol site of the env gene of 4070A (nt 594) was used in combination with either one of the following two oligonucleotides providing Notl site:
5'-AGTATGCGGCCGCTGGGGGTGGCTGTGGGACAC-3'et 5 ' -T ATCTGCGGCCGCGTCGGGT AAT ACTGGGTTGG-3 ' afin de générer par PCR, en utilisant une matrice env 4070A, des fragments 3' pour les enveloppes AMOPRO et AMOΔPRO respectivement.5'-AGTATGCGGCCGCTGGGGGTGGCTGTGGGACAC-3 'and 5' -T ATCTGCGGCCGCGTCGGGT AAT ACTGGGTTGG-3 'in order to generate by PCR, using an env 4070A template, 3' fragments for the AMOPRO and AMOΔPRO envelopes respectively.
Ces fragments PCR ont été soumis à une digestion par Xhol et Notl et clones dans le plasmide FBAMOSALF ouvert en Xhol/Notl, un plasmide exprimant une enveloppe de type AMO. Les plasmides exprimant les enveloppes AMOFx, AMOl et AMOlFx ont été générées par clonage du fragment Ndel/Notl de FBAMOSALF (comprenant le domaine de reconnaissance Ram-1) dans une série de plasmides (13) exprimant les enveloppes MoMLV modifiées afin de créer un site Notl au codon 1 ou au codon 6 avec (AMOlFx, AMOFx) ou sans (AMOl) la séquence Xa. Des enveloppes dérivées de AMO et contenant d'autres types de peptides espaceurs ont été construits. L'ensemble de ces peptides espaceurs est représenté en Figure 3 A.These PCR fragments were subjected to digestion with Xhol and NotI and cloned into the plasmid FBAMOSALF opened in Xhol / NotI, a plasmid expressing an envelope of AMO type. The plasmids expressing the AMOFx, AMOl and AMOlFx envelopes were generated by cloning the NdeI / NotI fragment of FBAMOSALF (comprising the recognition domain Ram-1) in a series of plasmids (13) expressing the MoMLV envelopes modified in order to create a site Notl at codon 1 or codon 6 with (AMOlFx, AMOFx) or without (AMOl) the sequence Xa. Envelopes derived from AMO and containing other types of spacer peptides were constructed. All of these spacer peptides are shown in Figure 3 A.
Les enveloppes MOAPRO et MOAΔPRO ont été générées selon une méthode similaire à celle des enveloppes AMOPRO et AMOΔPRO. Le plasmide FBEASALF, exprimant les enveloppes EA a été ouvert en Ndel/Notl. Cet ADN a été utilisé pour cloner deux fragments: le fragment 5 ' Ndel/BamHI provenant de la digestion du plasmide FBMOSALF (exprimant les enveloppes MO, écotropes) et contenant outre la LTR5' et la séquence rétrovirale leader, l 'extrémité N-terminale du gène env du virus MoMLV (position 6565), (17). Des fragments 3 ' ont été générés par PCR en utilisant comme matrice le gène env de MoMLV, comme oligonucléotide 5 ' (5 ' -ACTGGGGCTTACGTTTGT-3 ') en amont du site BamHI, et comme oligonucléotide 3' (5 '-TATGTGCGGCCGCCGGTGGAAGTTGGGTAGGGG-3 ') ou (5 ' -TATGTGCGGCCGCGTCTGGCAGAACGGGGTTTGG-3 ' ) pour construire les enveloppes MOAPRO et MOAΔPRO, respectivement. Ces fragments de PCR ont été digérés par BamHI et Notl, et co-ligués avec le fragment 5 ' . La séquence des peptides espaceurs pour ces deux constructions est représentée dans la Figure 3B.The MOAPRO and MOAΔPRO envelopes were generated using a method similar to that of the AMOPRO and AMOΔPRO envelopes. The plasmid FBEASALF, expressing the EA envelopes, was opened in NdeI / NotI. This DNA was used to clone two fragments: the 5 'NdeI / BamHI fragment originating from the digestion of the plasmid FBMOSALF (expressing the MO, ecotropic envelopes) and containing, in addition to the LTR5' and the leader retroviral sequence, the N-terminal end of the gene env of the MoMLV virus (position 6565), (17). 3 'fragments were generated by PCR using the MoMLV env gene as a template, as a 5' oligonucleotide (5 '-ACTGGGGCTTACGTTTGT-3') upstream of the BamHI site, and as a 3 'oligonucleotide (5' -TATGTGCGGCCGCCGGTGGAAGTTGGGTAGGG- ') or (5' -TATGTGCGGCCGCGTCTGGCAGAACGGGGTTTGG-3 ') to build the MOAPRO and MOAΔPRO envelopes, respectively. These PCR fragments were digested with BamHI and NotI, and co-ligated with the 5 'fragment. The sequence of spacer peptides for these two constructs is shown in Figure 3B.
FBEMOSALF, exprimant les enveloppes chimères EMO (6), a été soumis à une digestion par BssHII, un remplissage par l'enzyme Klenow et digestion par Ndel. Le fragment résultant de 1 ,8 Kb, comprenant la LTR5 ' , la séquence leader, la fin du gène pol et EGF humain, a été isolé et inséré soit dans FBAMOΔPROSALF soit FBAMOPROSALF (plasmides exprimant respectivement les enveloppes chimères AMOΔPRO et AMOPRO) dans lesquels le fragment Ndel/EcoRI a été éliminé et le site EcoRI rempli afin de générer les plasmides exprimant les enveloppes EMOΔPRO + et EMOPRO + , respectivement. Des plasmides exprimant les enveloppes EMOI , EMOlFx ont d'autre part été générés. La séquence des peptides espaceurs . pour ces deux constructions est représentée dans la Figure 3C. Les plasmides exprimant les enveloppes EAPRO + et EAΔPRO + ont été générés par remplacement du fragment Sfil/Not du plasmide FBEASALF par les fragments Sfil/Notl issus des plasmides exprimant les enveloppes EMOPRO + et EMOΔPRO + .FBEMOSALF, expressing the EMO chimeric envelopes (6), was subjected to digestion with BssHII, filling with the enzyme Klenow and digestion with NdeI. The resulting fragment of 1.8 Kb, comprising the LTR5 ', the leader sequence, the end of the pol and human EGF gene, was isolated and inserted either into FBAMOΔPROSALF or FBAMOPROSALF (plasmids expressing respectively the chimeric envelopes AMOΔPRO and AMOPRO) in which the NdeI / EcoRI fragment was eliminated and the EcoRI site filled in order to generate the plasmids expressing the EMOΔPRO + and EMOPRO + envelopes, respectively. On the other hand, plasmids expressing the EMOI and EMOlFx envelopes were generated. The sequence of spacer peptides. for these two constructions is shown in Figure 3C. The plasmids expressing the EAPRO + and EAΔPRO + envelopes were generated by replacing the Sfil / Not fragment of the FBEASALF plasmid by the Sfil / Notl fragments derived from the plasmids expressing the EMOPRO + and EMOΔPRO + envelopes.
Enfin pour ces diverses enveloppes EMODPRO + , EMOPRO + , EAPRO + et EAΔPRO + , les peptides espaceurs ont été réduits dans leur partieFinally for these various envelopes EMODPRO +, EMOPRO +, EAPRO + and EAΔPRO +, the spacer peptides have been reduced in part
N-terminale. Pour cela, un fragment d'ADN a été généré par PCR en utilisant comme matrice le gène EMO, oligonucléotide 5 'N-terminal. For this, a DNA fragment was generated by PCR using as a template the gene EMO, oligonucleotide 5 '
(5 '-ACCATCCTCTAGACGGACATG-3 ' ) en amont du site Xbal précédant le codon initiateur et comme oligonucléotide 3 ' (5'- TATCAGGATCCCAAATGTAAGCCCTGGATCGCGCAGTTCCCACCACTT(5 '-ACCATCCTCTAGACGGACACG-3') upstream of the Xbal site preceding the initiator codon and as a 3 'oligonucleotide (5'- TATCAGGATCCCAAATGTAAGCCCTGGATCGCGCAGTTCCCACCACTT
CAGGTCTCGGTACTGAC-3 ') contenant un site BamHI. Cet ADN a été digéré par Xbal/BamHI et clone dans l 'un ou l'autre des plasmides exprimant les enveloppes EMOPRO + ou EMOΔPRO + , préalablement débarrassés des fragments Xbal/Notl, par co-ligation avec les fragments BamHI/Notl obtenus à partir des plasmides exprimant les enveloppes MOAPRO et MOAΔPRO. Il en résulte deux plasmides capables d'exprimer les enveloppes EMOPROβ et EMOΔPROβ, respectivement (Figure 3C), dans lesquelles EGF est fusionné juste en amont du site BamHI de l'enveloppe du virus MoMLV (nt 6537), (17) avant la région riche en proline et en laissant intact le feuillet β potentiel. L'un ou l'autre des fragments Sfil/Notl issus de ces deux dernières constructions ont ensuite été réintroduits dans le plasmide FBEASALF préalablement débarrassés du fragment Sfil/Not; il en résulte deux plasmides capables d'exprimer les enveloppes EAPROβ et EAΔPROβ, respectivement (Figure 3C).CAGGTCTCGGTACTGAC-3 ') containing a BamHI site. This DNA was digested with Xbal / BamHI and cloned into one or other of the plasmids expressing the EMOPRO + or EMOΔPRO + envelopes, previously rid of the Xbal / NotI fragments, by co-ligation with the BamHI / NotI fragments obtained from the plasmids expressing the MOAPRO and MOAΔPRO envelopes. This results in two plasmids capable of expressing the EMOPROβ and EMOΔPROβ envelopes, respectively (FIG. 3C), in which EGF is fused just upstream of the BamHI site of the envelope of the MoMLV virus (nt 6537), (17) before the region rich in proline and leaving the potential β sheet intact. One or other of the Sfil / NotI fragments originating from these latter two constructions were then reintroduced into the plasmid FBEASALF previously rid of the Sfil / Not fragment; this results in two plasmids capable of expressing the envelopes EAPROβ and EAΔPROβ, respectively (Figure 3C).
Dans une autre série de construction (EMOPRO, EMOΔPRO, EAPRO, EAΔPRO), le feuillet β potentiel a été enlevé, et EGF fusionné directement au niveau de la région riche en proline (Figure 3C). Production de virus. Les plasmides exprimant les enveloppes ont été transfectés par la méthode de précipité de phosphate de calcium (16) dans la lignée cellulaire TeLCeBό. Les cellules ont été soumises à une sélection par la phléomycine (50 mg/ml), puis les clones résistants ont été trypsinés en masse. Ces cellules à confluence sont utilisées pour récupérer les surnageants viraux après une nuit d'incubation dans du milieu DMEM en présence de FCS (10%). Ces surnageants sont soumis à une ultracentrifugation dans le but d'obtenir des échantillons d'analyse en Western Blots, en tests de liaison (tests de "binding") et d'infection. Immunoblots. Les cellules productrices de virus sont lysées pendant 10 min à 4°C dans du tampon Tris-HCL 20mM (pH 7,5), contenant du tritonXIOO 1 % , SDS 0,05 % , deoxycholate 5 mg/ml, NaCl 150 mM et PMSFIn another construction series (EMOPRO, EMOΔPRO, EAPRO, EAΔPRO), the potential β sheet was removed, and EGF fused directly at the proline-rich region (Figure 3C). Virus production. The plasmids expressing the envelopes were transfected by the calcium phosphate precipitate method (16) in the TeLCeBό cell line. The cells were subjected to a selection with phleomycin (50 mg / ml), then the resistant clones were trypsinized en masse. These confluence cells are used to recover the viral supernatants after an overnight incubation in DMEM medium in the presence of FCS (10%). These supernatants are subjected to ultracentrifugation in order to obtain analysis samples in Western Blots, in binding tests ("binding" tests) and infection. Immunoblots. The virus-producing cells are lysed for 10 min at 4 ° C. in 20 mM Tris-HCL buffer (pH 7.5), containing 1% tritonXIOO, 0.05% SDS, 5 mg / ml deoxycholate, 150 mM NaCl and PMSF
1 mM. Après centrifugation 10 min à 10 000 g, afin de culotter les noyaux cellulaires, les surnageants sont congelés à -70 °C jusqu'à analyse. Ces échantillons viraux sont obtenus par ultracentrifugation des surnageants viraux (10 ml) dans un rotor SW41 Beckman (30 000 rpm, lh à 4°C). Les culots sont resuspendus dans 100 ml de PBS (Phosphate Buffered saline) et congelés à1 mM. After centrifugation for 10 min at 10,000 g, in order to pellet the cell nuclei, the supernatants are frozen at -70 ° C until analysis. These viral samples are obtained by ultracentrifugation of the viral supernatants (10 ml) in a Beckman SW41 rotor (30,000 rpm, lh at 4 ° C). The pellets are resuspended in 100 ml of PBS (phosphate buffered saline) and frozen at
-70°C. Les échantillons (30 mg de lysats cellulaires ou 10 ml de virus purifiés) sont mélangés avec un ratio de 5: 1 à du tampon 375 mM Tris-HCl (pH 6,8) contenant SDS 6% , b-mercaptoéthanol 30% , glycérol 10% et bleu de bromophénol 0,06% , puis bouillis 3 min et analysés sur gels d'acrylamide 10% /SDS. Après transfert des protéines sur membrane de nitrocellulose; le marquage immunologique est effectué dans du TBS (Tris base Saline, pH 7,4) en présence de lait écrémé 5 % et du tween 0, 1 % . Des anticorps (Quality Biotech Inc, USA) provenant d'anti-sérum de chèvre, dirigés contre gp70-SU de RLV (Rauscher Leukemia Virus) ou p30 de RLV ont été utilisés à la dilution 1 :1000 ou 1/10000 respectivement. Les blots ont été révélés par utilisation d'un anticorps conjugué d'origine lapin dirigés contre les Immunoglobulines de chèvres (DAKO, UK) grâce à un kit électrochemoluminescence (Amersham Life Science).-70 ° C. The samples (30 mg of cell lysates or 10 ml of purified virus) are mixed with a ratio of 5: 1 to 375 mM Tris-HCl buffer (pH 6.8) containing SDS 6%, b-mercaptoethanol 30%, glycerol 10% and bromophenol blue 0.06%, then boiled for 3 min and analyzed on 10% acrylamide / SDS gels. After transfer of proteins on nitrocellulose membrane; the immunological labeling is carried out in TBS (Tris base Saline, pH 7.4) in the presence of skimmed milk 5% and tween 0, 1%. Antibodies (Quality Biotech Inc, USA) from goat anti-serum, directed against gp70-SU from RLV (Rauscher Leukemia Virus) or pL of RLV were used at a dilution of 1: 1000 or 1/10000 respectively. The blots were revealed by using a conjugated antibody of rabbit origin directed against the immunoglobulins of goats (DAKO, UK) using an electrochemoluminescence kit (Amersham Life Science).
Tests de liaison ("binding").Binding tests.
Les cellules cibles ont été lavées par du PBS et décollées par incubationTarget cells were washed with PBS and detached by incubation
10 min à 37°C par du versene 0,02% dans du PBS. Ces cellules sont rincées par du PBA (PBS contenant 2% de FCS et du sodium d'azide 0, 1 %). 106 cellules sont alors incubées en présence de virus pendant 30 min à 4°C pour la série d'enveloppe EMO ou 45 min à 37 °C pour la série des enveloppes AMO. Après rinçage par du PBA, les cellules sont incubées en présence d'anticorps monoclonal 83A25 (Evans et al., 1990) pendant 30 min à 4°C. Après deux rinçages par du PBA, les cellules sont incubées 30 min à 4°C en présence d'anticorps conjugués anti-rat couplés au FITC (Dako; UK). 5 min avant les deux rinçages finaux dans du PBA, les cellules sont contre colorées par de l'iodure de propidium (20 mg/ml). La fluorescence des cellules vivantes est analysée dans un FACS (FACScalibur, Beckton Dickinson).10 min at 37 ° C with 0.02% versene in PBS. These cells are rinsed with PBA (PBS containing 2% FCS and sodium azide 0, 1%). 10 6 cells are then incubated in the presence of virus for 30 min at 4 ° C for the series of EMO envelopes or 45 min at 37 ° C for the series of AMO envelopes. After rinsing with PBA, the cells are incubated in the presence of monoclonal antibody 83A25 (Evans et al., 1990) for 30 min at 4 ° C. After two rinses with PBA, the cells are incubated for 30 min at 4 ° C. in the presence of conjugated anti-rat antibodies coupled to FITC (Dako; UK). 5 min before the two final rinses in PBA, the cells are counterstained with propidium iodide (20 mg / ml). The fluorescence of living cells is analyzed in a FACS (FACScalibur, Beckton Dickinson).
Tests d'infection. Les cellules cibles sont ensemencées dans des plaques de culture 24 puits à une densité de 3.10^ cellules par puits. Différentes dilutions des surnageants viraux, contenant du polybrène à raison de 4 mg/ml sont ajoutées sur les cellules pendant 3 à 5 h à 37°C. Les surnageants sont par la suite remplacés par du milieu frais et les cellules incubées pendant 24 à 48 h à 37 °C. Une coloration X-gal est alors effectuée comme précédemment décrit (4). Les titres viraux sont estimés comme précédemment rapporté (5) en nombre de colonies par mlInfection tests. Target cells are seeded in 24-well culture plates at a density of 3.10 ^ cells per well. Different dilutions of the viral supernatants, containing polybrene at a rate of 4 mg / ml are added to the cells for 3 to 5 h at 37 ° C. The supernatants are subsequently replaced with fresh medium and the cells incubated for 24 to 48 h at 37 ° C. X-gal staining is then carried out as previously described (4). The viral titers are estimated as previously reported (5) in number of colonies per ml
(lacZ i.u./ml).(lacZ i.u./ml).
Afin de bloquer les EGFR, les cellules cibles sont incubées pendant 30 min à 37°C dans un milieu contenant 10~6 M d'EGF recombinant humain (236-EG, R&D Systems, UK). Les cellules sont alors rincées et les infections effectuées comme précédemment décrit. Afin de bloquer l'acidification des endosomes, 100 mM de phosphate de chloroquine (Sigma, UK) est ajoutée au milieu. Six h après infection, les cellules sont rincées et incubées dans un milieu normal. Résultats et discussion.In order to block EGFR, the target cells are incubated for 30 min at 37 ° C. in a medium containing 10 ~ 6 M of recombinant human EGF (236-EG, R&D Systems, UK). The cells are then rinsed and the infections carried out as previously described. In order to block the acidification of the endosomes, 100 mM of chloroquine phosphate (Sigma, UK) is added to the medium. Six hours after infection, the cells are rinsed and incubated in a normal medium. Results and discussion.
Construction des enveloppes mutantes.Construction of the mutant envelopes.
Deux séries d'enveloppes modifiées capables de reconnaître soit le récepteur rétroviral Ram-1 (11), (22), soit le récepteur de l'EGF ont été générées. Une première enveloppe ciblant Ram-1 , AMO, a été construite par insertion en N-terminal de l'enveloppe de MoMLV (par fusion avec le codon 7) d'un polypeptide reconnaissant Ram-1 (AS208, Figure 3 A) et correspondant aux 208 premiers acides aminés de la SU de MLV-A (1). La séquence codant pour l'EGF a été insérée dans le gène env de MLV en position +6 de la SU deTwo series of modified envelopes capable of recognizing either the retroviral Ram-1 receptor (11), (22) or the EGF receptor were generated. A first envelope targeting Ram-1, AMO, was constructed by N-terminal insertion of the MoMLV envelope (by fusion with codon 7) of a polypeptide recognizing Ram-1 (AS208, FIG. 3 A) and corresponding to the first 208 amino acids of the SU of MLV-A (1). The sequence coding for EGF was inserted into the env gene of MLV at position +6 of the SU of
MoMLV (Figure 2). Il a préalablement été démontré que ce site d'insertion permettait l'expression d'un fragment simple chaîne d'anticorps à la surface des virions (15). Dans le cas de l'enveloppe chimère EMO (Figure 2), l'EGF humain a été inséré dans l'enveloppe de MoMLV à la même position, alors que pour l'enveloppe EA, l'insertion a été effectuée dans l'enveloppe amphotrope deMoMLV (Figure 2). It has previously been demonstrated that this insertion site allows the expression of a single chain fragment of antibodies on the surface of virions (15). In the case of the EMO chimeric envelope (Figure 2), the human EGF was inserted into the MoMLV envelope at the same position, whereas for the EA envelope, the insertion was carried out in the envelope amphotropic of
MLV en position +5.MLV in position +5.
Pour les enveloppes AMO, EMO et EA, les nouveaux domaines de liaison ("binding") ont été séparés du domaine de reconnaissance du récepteur rétroviral par un peptide espaceur correspondant à trois alanines. Pour les deux types d'enveloppes parentales ciblant Ram-1 ou ciblant EGFR, diverses constructions ont ensuite été générées par insertion d' espaceurs de différentes tailles et structures. Les séquences proteiques de ces différents espaceurs sont rapportés dans la Figure 3 A dans le cas des enveloppes ciblant Ram-1 et dans la Figure 3C pour les enveloppes ciblant EGFR. Les plasmides exprimant les différentes enveloppes, y compris les enveloppes contrôles écotropes (MO) et amphotropes (A), ont été transfectées dans la lignée cellulaire TELCeBό qui exprime les protéines codées par les gènes gag et pol, ainsi qu'un vecteur rétroviral nlsLacZ (7).For the AMO, EMO and EA envelopes, the new binding domains were separated from the recognition domain of the retroviral receptor by a spacer peptide corresponding to three alanines. For the two types of parental envelopes targeting Ram-1 or targeting EGFR, various constructions were then generated by insertion of spacers of different sizes and structures. The protein sequences of these different spacers are reported in Figure 3 A for the envelopes targeting Ram-1 and in Figure 3C for the envelopes targeting EGFR. The plasmids expressing the various envelopes, including the ecotropic (MO) and amphotropic (A) control envelopes, were transfected into the TELCeBό cell line which expresses the proteins coded by the gag and pol genes, as well as a retroviral vector nlsLacZ ( 7).
Expression et incorporation des enveloppes dans les virions.Expression and incorporation of envelopes in virions.
Les lysats proteiques des cellules correspondantes ont été analysés pour l'expression d'enveloppes à l'aide d'anticorps dirigés contre la SU de MLV (Figure 5) pour la plupart des enveloppes de la série AMO, non montré pour les autres enveloppes chimères). Pour toutes les enveloppes chimères, les précurseurs et la forme mature SU des enveloppes ont pu être décelés à la taille attendue et à un niveau similaire aux enveloppes sauvages, suggérant que ces enveloppes chimères sont normalement produites et maturées.The protein lysates of the corresponding cells were analyzed for the expression of envelopes using antibodies directed against the SU of MLV (FIG. 5) for most of the envelopes of the AMO series, not shown for the other chimeric envelopes. ). For all the chimeric envelopes, the precursors and the mature SU form of the envelopes could be detected at the expected size and at a level similar to wild envelopes, suggesting that these chimeric envelopes are normally produced and matured.
L'expression à la surface cellulaire a été déterminée par analyse au FACS des cellules productrices, en utilisant des anticorps dirigés contre la SU ou en utilisant un anticorps monoclonal anti-EGF. Les cellules transfectées par les différentes enveloppes peuvent être marquées par l'anticorps anti-SU (non présenté). Seules les cellules exprimant les enveloppes fusion EGF enveloppes peuvent être marquées à l'aide des anticorps monoclonaux anti-EGF (Figure 4). Ceci démontre l'expression des enveloppes chimères à la surface cellulaire et le repliement correct de l'EGF sur les glycoprotéines chimères.Cell surface expression was determined by FACS analysis of producer cells, using antibodies against SU, or using anti-EGF monoclonal antibody. The cells transfected with the different envelopes can be labeled with the anti-SU antibody (not shown). Only cells expressing EGF fusion envelopes can be labeled using anti-EGF monoclonal antibodies (Figure 4). This demonstrates the expression of the chimeric envelopes on the cell surface and the correct folding of the EGF on the chimeric glycoproteins.
Afin de démontrer l'incorporation des enveloppes chimères dans les particules rétrovirales, les surnageants des lignées cellulaires TELCeBό transfectées par les différentes enveloppes ont été soumis à une ultracentrifugation et les culots de particules virales ont été récupérés. Ces culots ont été analysés par immunoblots pour leur expression de produits du gène gag (CAp30) et des protéines d'enveloppes (Figure 5 pour la plupart des enveloppes de la série AMO, non montré pour les autres enveloppes chimères). Dans le but de comparer l'efficacité d'incorporation virale entre les diverses enveloppes chimères, des quantités identiques de particules virales (déterminées par le marquage des protéines gag à l'aide d'un anticorps anti-CAp30) ont été déposées sur les gels.In order to demonstrate the incorporation of the chimeric envelopes into the retroviral particles, the supernatants of the TELCeBό cell lines transfected with the various envelopes were subjected to ultracentrifugation and the pellets of viral particles were recovered. These pellets were analyzed by immunoblots for their expression of gag gene products (CAp30) and envelope proteins (Figure 5 for most of the envelopes of the AMO series, not shown for the other chimeric envelopes). In order to compare the efficiency of viral incorporation between the various chimeric envelopes, identical amounts of viral particles (determined by labeling the gag proteins with an anti-CAp30 antibody) were deposited on the gels .
Les protéines SU ont pu être mises en évidence pour tous les mutants, à la taille attendue mais à un taux légèrement inférieur à celui observé pour les enveloppes sauvages. Dans le cas des enveloppes AMOG2X et AMOG3X seulement, l'efficacité d'incoφoration est sensiblement plus faible par rapport aux enveloppes sauvages. Comme attendu, aucune expression d'enveloppe n'est observée dans les culots de surnageants TELacZ (n'exprimant pas de protéines gag et pol) transfectées par les différentes enveloppes. Ces résultats démontrent que les protéines SU chimères sont associées aux particules rétrovirales.SU proteins could be detected for all mutants, at the expected size but at a rate slightly lower than that observed for wild envelopes. In the case of AMOG2X and AMOG3X envelopes only, the incoφoration efficiency is significantly lower compared to wild envelopes. As expected, no envelope expression is observed in the pellets of TELacZ supernatants (not expressing gag and pol proteins) transfected by the various envelopes. These results demonstrate that the chimeric SU proteins are associated with retroviral particles.
Liaison des enveloppes aux récepteurs.Linking of envelopes to receivers.
Des cellules humaines exprimant les récepteurs Ram-1 et/ou de l'EGF ont été utilisées pour cette étude. Ces cellules sont incubées en présence de préparation virales et la liaison des enveloppes virales sur le récepteur cible est déterminé par analyse au FACS à l'aide d'anticorps dirigés contre la SU (FigureHuman cells expressing the Ram-1 and / or EGF receptors were used for this study. These cells are incubated in the presence of viral preparations and the binding of the viral envelopes to the target receptor is determined by FACS analysis using antibodies directed against SU (Figure
6B). Comme attendu, aucune liaison n'est observée dans le cas des virus exprimant des enveloppe écotropes MO sur les diverses cellules humaines (non montré), alors que les virus présentant des enveloppes chimères ciblant Ram-1 sont capables de se lier aux cellules TE671 avec une efficacité similaire à celle observée pour les virus exprimant des enveloppes amphotropes non modifiées.6B). As expected, no binding is observed in the case of viruses expressing MO ecotropic envelopes on the various human cells (not shown), while the viruses presenting chimeric envelopes targeting Ram-1 are capable of binding to TE671 cells with an efficacy similar to that observed for viruses expressing unmodified amphotropic envelopes.
Toutes les enveloppes ciblant Ram-1 , dérivées de AMO, sont capables de se lier aux cellules TE671 avec une efficacité similaire. Cette liaison peut être inhibée après compétition par du fragment AS208 (le domaine purifié de reconnaissance de Ram-1) (2), ce qui suggère que cette reconnaissance est spécifique (résultats non présentés).All envelopes targeting Ram-1, derived from AMO, are able to bind to TE671 cells with similar efficiency. This binding can be inhibited after competition with the AS208 fragment (the purified Ram-1 recognition domain) (2), which suggests that this recognition is specific (results not shown).
Les enveloppes ciblant EGFR (série EMO) sont par ailleurs capables de se lier aux cellules A431 , sur exprimant EGFR (Figure 6A). Cette liaison semble spécifique puisqu'une pré-incubation des cellules A431 en présence d'EGF (induisant l'endocytose des EGFR) inhibe cette liaison (non montré). Coopération Ram-1 et Rec-1 dans l'infection.Envelopes targeting EGFR (EMO series) are also capable of binding to A431 cells, over expressing EGFR (Figure 6A). This connection seems specific since a pre-incubation of A431 cells in the presence of EGF (inducing the endocytosis of EGFR) inhibits this binding (not shown). Ram-1 and Rec-1 cooperation in infection.
La transduction des vecteurs rétroviraux pseudotypés par les diverses enveloppes ciblantes a été mesurée sur des cellules exprimant différents types de récepteurs: des cellules humaines TE671 exprimant les récepteurs EGF etThe transduction of the pseudotyped retroviral vectors by the various targeting envelopes was measured on cells expressing different types of receptors: human TE671 cells expressing the EGF receptors and
Ram-1 ; des cellules 3T3 exprimant les récepteurs EGF murins, Rec-1 et Ram-1 ; des cellules CEAR13 exprimant Rec-1 et Ram-1 ; des cellules CERD9 exprimant seulement Rec-1. Les titrations ont été effectuées comme précédemment décrit (6). Comme attendu, il a été montré que les virus pseudotypés par des enveloppes écotropes MO n'étaient pas capables d'infecter les cellules TE671, mais permettaient l'infection de cellules murines 3T3, CEAR13 et Cerd9 (avec des titres de l'ordre de 10? lacZ i.u./ml). Réciproquement, les virus portant les enveloppes amphotropes A sont capables d'infecter les cellules murines 3T3, CEAR13 et TE671 (avec des titres de l'ordre de l'ordre de 10^ lacZ i.u./ml).Ram-1; 3T3 cells expressing the murine EGF receptors, Rec-1 and Ram-1; CEAR13 cells expressing Rec-1 and Ram-1; CERD9 cells expressing only Rec-1. The titrations were carried out as previously described (6). As expected, it has been shown that viruses pseudotyped by MO ecotropic envelopes were not capable of infecting TE671 cells, but allowed the infection of murine 3T3, CEAR13 and Cerd9 cells (with titles of the order of 10? LacZ iu / ml). Conversely, the viruses carrying the amphotropic envelopes A are capable of infecting the murine cells 3T3, CEAR13 and TE671 (with titers of the order of about 10 ^ lacZ i.u./ml).
Les virus présentant des enveloppes chimères AMO sont capables d'infecter les cellules TE671 à un titre de 4.10^ lacZ i.u./ml (Tableau 1). En comparaison; malgré une efficacité de liaison au récepteur similaire (Figure 6B), les titres obtenus avec les enveloppes sauvages sont 10 000 fois plus élevés. De façon suφrenante, les virus exprimant des enveloppes AMOPRO, malgré une bonne efficacité de liaison, se sont avérés incapables d'infecter les cellules humaines TE671. Comparés aux titres obtenus pour les enveloppes AMO (Tableau 1), les autres types d' espaceurs insérés dans les enveloppes de la série AMO permettent une augmentation des titres de 30 fois (pour AMOΔPRO) à plus de 100 fois (pour AMOlFx) permettant d'atteindre des titres de 4.10^ lacZ i.u./ml. Il est démontré que ces infections ont lieu via le récepteur ciblé Ram-1. Ceci a été mis en évidence par un test d'interférence sur des cellules cibles infectées chroniquement par du virus MLV-A. Ces cellules deviennent spécifiquement réfractaires à une infection par des virus portant les enveloppes ciblants Ram-1 (résultats non montrés). Les virus portant les enveloppes chimères dans lesquelles le domaine de liaison à Ram-1 a été séparé de la SU de MoMLV par différents espaceurs s'avèrent très infectieux sur cellules 3T3. Comparé aux titres obtenus pour les enveloppes AMO, une augmentation de 200 (pour AMOPRO) à plus de 1000 fois (pour AMOlFx) des titres viraux a été mesurée (Tableau 1).Viruses with AMO chimeric envelopes are capable of infecting TE671 cells in a titer of 4.10 ^ lacZ i.u./ml (Table 1). In comparison; despite a similar receptor binding efficiency (Figure 6B), the titers obtained with wild envelopes are 10,000 times higher. Suφrenantly, the viruses expressing AMOPRO envelopes, despite good binding efficiency, have been found incapable of infecting human TE671 cells. Compared to the titles obtained for the AMO envelopes (Table 1), the other types of spacers inserted in the AMO series envelopes allow an increase in the titles from 30 times (for AMOΔPRO) to more than 100 times (for AMOlFx) allowing '' reach titers of 4.10 ^ lacZ iu / ml. These infections have been shown to occur via the targeted Ram-1 receptor. This was demonstrated by an interference test on target cells chronically infected with the MLV-A virus. These cells become specifically refractory to infection by viruses carrying the Ram-1 targeting envelopes (results not shown). Viruses carrying the chimeric envelopes in which the Ram-1 binding domain has been separated from the SU of MoMLV by different spacers prove to be very infectious on 3T3 cells. Compared to the titles obtained for the AMO envelopes, an increase from 200 (for AMOPRO) to more than 1000 times (for AMOlFx) of the viral titers was measured (Table 1).
L'infection des 3T3 s'effectue via Rec-1 ou via Ram-1 (Tableau 1). Ceci peut être démontré par des tests d'interférence effectués sur des cellules 3T3 infectées chroniquement soit par MLV-A (bloquant Ram-1) soit par MoMLV (bloquant Rec-1). Les virus exprimant les enveloppes AMO semblent être capables d'infecter les 3T3 indifféremment selon que l'un ou l'autre, ou les deux, récepteurs Rec-1 et Ram-1 sont disponibles sur la cellule cible. Comparativement à ces virus AMO, les particules virales contenant les autres enveloppes capables de cibler Ram-1 sont bien moins capables d'infecter les 3T3 quand seulement un des deux récepteurs est disponible. Par exemple, quand 100 particules (selon le titre déterminé sur 3T3 intactes) contenant les enveloppes AMOFx sont utilisées pour infecter des 3T3 interférentes, 4 virus sont capables d'infecter les cellules si seulement Rec-1 est disponible et 2 virus sont capables d'infecter les cellules si seulement Ram-1 est disponible. Ceci indique une perte considérable de l'infectivité (plus de 94% des virus ne sont pas infectieux) quand un seul récepteur est disponible comparé à quand les deux récepteurs le sont. Ceci suggère également que les deux récepteurs Ram-1 et Rec-1 coopèrent dans l'infection des 3T3. Il apparaît que ce phénomène de coopération est encore nettement plus marqué dans le cas des virus portant les enveloppesThe 3T3 infection is carried out via Rec-1 or via Ram-1 (Table 1). This can be demonstrated by interference tests performed on 3T3 cells chronically infected either with MLV-A (blocker Ram-1) or with MoMLV (blocking Rec-1). Viruses expressing AMO envelopes appear to be capable of infecting 3T3 regardless of whether one or the other, or both, Rec-1 and Ram-1 receptors are available on the target cell. Compared to these AMO viruses, the viral particles containing the other envelopes capable of targeting Ram-1 are much less capable of infecting 3T3 when only one of the two receptors is available. For example, when 100 particles (depending on the titer determined on intact 3T3) containing the AMOFx envelopes are used to infect interfering 3T3s, 4 viruses are capable of infecting cells if only Rec-1 is available and 2 viruses are capable of infect cells if only Ram-1 is available. This indicates a considerable loss of infectivity (more than 94% of viruses are not infectious) when only one receptor is available compared to when both receptors are available. This also suggests that the two receptors Ram-1 and Rec-1 cooperate in the infection of 3T3. It appears that this phenomenon of cooperation is even more marked in the case of viruses carrying the envelopes
AMOPRO. Ces derniers virus peuvent difficilement infecter les 3T3 quand seul Rec-1 est disponible et ne peuvent pas du tout les infecter quand seul Ram-1 est disponible. Cependant quand Rec-1 et Ram-1 sont tout deux disponibles, l'infection est possible et des titres de l'ordre de 6x10^ lacZ i.u./ml peuvent être obtenus (Tableau 1).AMOPRO. These latter viruses can hardly infect 3T3 when only Rec-1 is available and cannot infect them at all when only Ram-1 is available. However, when Rec-1 and Ram-1 are both available, infection is possible and titers of the order of 6x10 ^ lacZ i.u./ml can be obtained (Table 1).
Dans le but de mieux définir ce phénomène de coopérativité, des tests d'infection ont été menés en utilisant comme cibles des cellules CHOIn order to better define this cooperative phenomenon, infection tests were carried out using CHO cells as targets
(naturellement dépourvues des récepteurs Ram-1 et Rec-1) modifiées de manière à exprimer soit Rec-1 seul (cellules Cerd9), soit Rec-1 et Ram-1 (cellules Cearl3) ou des cellules TE671 exprimant Ram-1 seul. Par ailleurs d'autres enveloppes dérivées de l'enveloppe AMO ont été générées. Ces enveloppes possèdent d'autres types de peptides espaceurs (voir Figure 3A) après le domaine ciblant Ram-1, notamment des espaceurs flexibles. Les résultats d'une expérience typique sont montrés dans le tableau 2. Pour chaque enveloppe, des index de coopérativité ont été calculés comme le rapport du titre obtenu sur le type cellulaire exprimant seulement un seul récepteur sur le titre obtenu sur le type cellulaire exprimant les deux types de récepteurs. Un index de 1 indique donc que le titre est le même, qu'il y ait un seul ou les deux récepteurs. C'est évidemment le cas^ des enveloppes sauvages écotropes ou amphotropes. Un index inférieur à 1 indique que le titre est moins bon quand un seul récepteur est exprimé par rapport à quand les deux le sont, et qu'il y a nécessité de deux récepteurs pour favoriser l'infection. Plus cet index est faible, plus le requièrement des deux récepteurs est fort. Comme suggéré dans le tableau 1 , l'infectivité des virions avec les enveloppes AMO originales n'est pas affectée, qu'il y ait qu'un seul type de récepteur ou les deux types (Tableau 2). En fait, les index sont même supérieurs à 1 suggérant que la présence simultanée des deux récepteurs gène le processus infectieux, peut-être parce que les deux domaines de liaison se gênent mutuellement.il en va différemment dans le cas des virus avec les enveloppes AMOlFx bien que, comparés aux virions AMO, leur infectivité est au moins 100 fois meilleure dans les cellules TE671 qui expriment Ram-1 seul. Cet accroissement de l'infectivité via Ram-1 peut être expliqué par la taille accrue du peptide espaceur séparant les deux domaines de liaison: il est possible que le domaine AS208 induise moins d'encombrement stérique vis-à-vis du reste de la glycoprotéine et que ces enveloppes puissent plus facilement induire le processus fusiogénique. De même, les virions AMOlFx infectent relativement bien les cellules Cerd9 exprimant Rec-1 seul. Cependant, en accord avec les résultats du tableau 1 , l'infection est facilitée par un facteur 10 quand les deux molécules Ram-1 et Rec-1 sont co-exprimées(naturally devoid of the Ram-1 and Rec-1 receptors) modified so as to express either Rec-1 alone (Cerd9 cells), or Rec-1 and Ram-1 (Cearl3 cells) or TE671 cells expressing Ram-1 alone. In addition, other envelopes derived from the AMO envelope were generated. These envelopes have other types of spacer peptides (see Figure 3A) after the Ram-1 targeting domain, including flexible spacers. The results of a typical experiment are shown in Table 2. For each envelope, cooperativity indexes were calculated as the ratio of the titer obtained on the cell type expressing only one receptor over the titer obtained on the cell type expressing the two types of receptors. An index of 1 therefore indicates that the title is the same, whether there is only one or both receivers. This is obviously the case with wild ecotropic or amphotropic envelopes. An index less than 1 indicates that the titer is poorer when one receptor is expressed than when both are expressed, and that two receptors are needed to promote infection. The lower this index, the stronger the demand of the two receivers. As suggested in Table 1, the infectivity of virions with the original AMO envelopes is not affected, whether there is only one type of receptor or both types (Table 2). In fact, the indexes are even greater than 1 suggesting that the simultaneous presence of the two receptors interferes with the infectious process, perhaps because the two binding domains interfere with each other. It is different in the case of viruses with AMOlFx envelopes although, compared to AMO virions, their infectivity is at least 100 times better in TE671 cells which express Ram-1 alone. This increase in infectivity via Ram-1 can be explained by the increased size of the spacer peptide separating the two binding domains: it is possible that the AS208 domain induces less steric hindrance vis-à-vis the rest of the glycoprotein and that these envelopes can more easily induce the fusiogenic process. Likewise, AMOlFx virions infect Rec-1 expressing Cerd9 cells relatively well. However, in agreement with the results in Table 1, the infection is facilitated by a factor of 10 when the two molecules Ram-1 and Rec-1 are co-expressed
(index d'environ 0, 1) comparativement à quand seulement l'un ou l'autre des deux récepteurs est présent. Les enveloppes avec les espaceurs "flexibles" (AMOGIFx, AMOG2, AMOG2Fx and AMOG3) semblent se comporter comme les enveloppes AMOlFx vis-à-vis de l'infection par l'intermédiaire de Rec-1 exprimé seul. Cependant l'infectivité par Ram-1 exprimé seul (RamID) tend à diminuer en fonction de la longueur de l'espaceur. Ceci reflète probablement une diminution de la transmission du signal fusiogénique consécutif à la liaison sur Ram-1 du fait de l'accroissement de la distance entre le domaine AS208 et le domaine de fusion. Dans le cas de ces enveloppes également, l'infection est favorisée quand les deux récepteurs sont co-exprimés à la surface de la même cellule.(index of approximately 0.1) compared to when only one or the other of the two receptors is present. Envelopes with "flexible" spacers (AMOGIFx, AMOG2, AMOG2Fx and AMOG3) appear to behave like AMOlFx envelopes against infection via Rec-1 expressed alone. However, infectivity by Ram-1 expressed alone (RamID) tends to decrease as a function of the length of the spacer. This probably reflects a reduction in the fusiogenic signal transmission following the Ram-1 bond due to the increase in the distance between the AS208 domain and the fusion domain. In the case of these envelopes also, infection is favored when the two receptors are co-expressed on the surface of the same cell.
Comme pour les enveloppes AMOlFx, mais de manière non symétrique (RamID similaire, mais RecID très différents), les virions contenant l'enveloppe AMOΔPRO peuvent efficacement infecter des cellules quand Ram-1 y est exprimé seul. Dans le cas de cette enveloppe également, l'infectivité est accrue d'environ 10 fois quand Rec-1 est également présent à la surface cellulaire. Cette différence n'est pas due au simple fait que les virions AMOΔPRO utilisent préférentiellement Rec-1 pour l'infection. En effet, l'infection de cellules sur lesquelles Rec-1 seul est disponible est extrêmement faible (Tableau 1) voire non détectable (Tableau 2) comparativement à quand Ram-1 et Rec-1 sont co- exprimés. L'indice RecID est inférieur à 10~5 (Tableau 2). Ceci démontre également que les deux récepteurs peuvent synergiser l'infection. Ces résultats suggèrent également que le domaine de liaison au récepteur écotrope Rec-1 n'est pas accessible quand l'enveloppe AMOΔPRO est exprimée sur des particules virales, et ne devient accessible que si ces virions interagissent préalablement avec Ram-1. On peut également suggérer que suite à la liaison avec Ram-1 , le domaine de liaison à Rec-1 est démasqué et recruté pour faciliter le processus infectieux. Il est possible que ce masquage/démasquage se produise selon un mécanisme de type allostérique causant un changement de conformation de la glycoprotéine chimère qui est induit par l'interaction Ram-l/AS208 et qui implique le peptide espaceur. Il est probable que ce mécanisme dépende fortement de la composition en acides aminés du peptide espaceur. A taille comparable, il y a une différence d'au moins 1 000 fois dans les RecID quand les virions AMOΔPRO sont comparés aux virions contenant les enveloppes avec les espaceurs flexibles AMOlFx, AMOGIFx et AMOG2. Le peptide ΔPRO est contient 5 prolines probablement agencées en hélice polyproline de type II, tandis que les enveloppes AMOGIFx et AMOG2 contiennent essentiellement des glycines.As with the AMOlFx envelopes, but in a non-symmetrical manner (RamID similar, but RecID very different), the virions containing the AMOΔPRO envelope can effectively infect cells when Ram-1 is expressed there alone. In the case of this envelope also, the infectivity is increased by approximately 10 times when Rec-1 is also present on the cell surface. This difference is not due to the simple fact that AMOΔPRO virions preferentially use Rec-1 for infection. In fact, infection of cells on which only Rec-1 is available is extremely low (Table 1) or even undetectable (Table 2) compared to when Ram-1 and Rec-1 are co-expressed. The RecID index is less than 10 ~ 5 (Table 2). This also demonstrates that the two receptors can synergize the infection. These results also suggest that the Rec-1 ecotropic receptor binding domain is not not accessible when the AMOΔPRO envelope is expressed on viral particles, and only becomes accessible if these virions interact beforehand with Ram-1. It can also be suggested that following binding with Ram-1, the Rec-1 binding domain is unmasked and recruited to facilitate the infectious process. It is possible that this masking / unmasking occurs according to an allosteric type mechanism causing a change in conformation of the chimeric glycoprotein which is induced by the interaction Ram-1 / AS208 and which involves the spacer peptide. It is likely that this mechanism is highly dependent on the amino acid composition of the spacer peptide. At comparable size, there is a difference of at least 1,000 times in the RecIDs when the AMOΔPRO virions are compared to the virions containing the envelopes with the flexible spacers AMOlFx, AMOGIFx and AMOG2. The ΔPRO peptide is contains 5 prolines probably arranged in a polyproline type II helix, while the AMOGIFx and AMOG2 envelopes essentially contain glycines.
De manière similaire aux virions AMOΔPRO, les virions contenant les enveloppes AMOPRO requièrent la présence simultanée des deux types de récepteurs pour infecter les cellules. Le titre infectieux dans des types cellulaires co-exprimant les deux récepteurs sont cependant inférieurs à ceux que l'on observe avec les virions AMOΔPRO, sans pour autant que l'on puisse exclure l'hypothèse que la moindre incoφoration de ces enveloppes est responsable de ce résultat. De manière encore plus marquée que AMOΔPRO, les virus AMOPRO ne peuvent pas infecter les cellules quand l'un ou l'autre des deux récepteurs est exprimé seul (Tableau 2). Les deux indices RamID et RecID sont en effet inférieurs à lθA Ces résultats suggèrent:Similar to AMOΔPRO virions, virions containing AMOPRO envelopes require the simultaneous presence of both types of receptors to infect cells. The infectious titer in cell types co-expressing the two receptors is however lower than that which is observed with the AMOΔPRO virions, without however excluding the hypothesis that the slightest inco deoration of these envelopes is responsible for this result. Even more markedly than AMOΔPRO, AMOPRO viruses cannot infect cells when either of the two receptors is expressed alone (Table 2). The two indices RamID and RecID are indeed lower than A. These results suggest:
1) que l'interaction des virions AMOPRO avec Ram-1 quand il est exprimé seul ne suffit pas à déclencher les changements de conformations de la glycoprotéine lui permettant d'être fusiogène. Il est d'ailleurs possible que le peptide espaceur PRO est soit trop rigide, soit trop long pour favoriser une telle transition,1) that the interaction of AMOPRO virions with Ram-1 when it is expressed alone is not enough to trigger the conformation changes of the glycoprotein allowing it to be fusiogenic. It is also possible that the PRO spacer peptide is either too rigid or too long to promote such a transition,
2) le domaine de liaison avec Rec-1 n'est pas accessible pour interagir avec Rec-1 et prendre le relais dans le processus d'entrée tant que le virions AMOPRO n'a pas interagi avec Ram-1.2) the binding domain with Rec-1 is not accessible to interact with Rec-1 and take over in the entry process until the AMOPRO virions have interacted with Ram-1.
Dans le but de mieux discriminer si le masquage du domaine de liaison situé en aval du domaine ciblant est une propriété unique du peptide AS208 conjugué au peptide espaceur PRO, la construction réciproque a été faite. Les enveloppes MOAPRO comportent le domaine de liaison de l'enveloppe écotrope suivie de la région proline riche de cette même enveloppe, le tout fusionné à l'extrémité N-terminale de l'enveloppe amphotrope (Figure 2). Les résultats, montrés dans le tableau 2, indiquent que, de manière similaire aux virions contenant les enveloppes AMOPRO, les virions MOAPRO peuvent difficilement, voire pas du tout, infecter les cellules exprimant seulement l'un ou l'autre des récepteurs Rec-1 ou Ram-1 . Il semble même que le domaine Ram-1 dans l 'enveloppe MOAPRO soit encore moins accessible (RamID inférieur à 7xl0"5) que ne l 'est le domaine Rec-1 dans l'enveloppe AMOPRO (RecID inférieur à 5 ,6x10-4). Les enveloppes MOAPRO peuvent efficacement infecter les cellules exprimant les deux types de récepteurs, avec des titres de l'ordre de 10^ lacZ i.u./ml, suggérant que, dans le cas de cette enveloppe également, la présence des deux récepteurs synergise le processus infectieux.In order to better discriminate if the masking of the binding domain located downstream of the targeting domain is a unique property of the AS208 peptide conjugated to the PRO spacer peptide, the reciprocal construction has been made. MOAPRO envelopes include the binding domain of the ecotropic envelope followed by the proline region rich in this same envelope, all fused to the N-terminal end of the amphotropic envelope (Figure 2). The results, shown in Table 2, indicate that, similarly to the virions containing the AMOPRO envelopes, the MOAPRO virions can hardly, if at all, infect cells expressing only one or the other of the Rec-1 receptors or Ram-1. It even seems that the Ram-1 field in the MOAPRO envelope is even less accessible (Ramid less than 7xl0 "5) than the field is the Rec-1 in AMOPRO envelope (RECID less than 5, 6x10-4 The MOAPRO envelopes can effectively infect cells expressing the two types of receptors, with titers of the order of 10 ^ lacZ iu / ml, suggesting that, in the case of this envelope too, the presence of the two receptors synergizes the infectious process.
L'ensemble de ces résultats suggère que le peptide espaceur inséré entre le domaine ciblant et le reste de l 'enveloppe rétrovirale exerce un contrôle sur l'accessibilité du domaine situé en aval dudit peptide et sur l' activation de la fusion. Ce contrôle dépend du peptide lui-même et est influencé par sa longueur et par sa composition biochimique. L'hypothèse que formulée est que le peptide espaceur PRO jouerait finalement le même rôle que la région riche en proline dont il est issu et qui est situé, dans la glycoprotéine non modifiée, entre le domaine de liaison au récepteur et le domaine de fusion. Ce rôle serait le masquage du domaine en aval (domaine fusion pour l'enveloppe sauvage ou domaine de liaison pour l'enveloppe chimère) et le démasquage consécutif à l'interaction du domaine en amont avec son récepteur. Dans le cas de l'enveloppe sauvage, ce démasquage conduirait à l'activation de la fusion, tandis que dans le cas des enveloppes chimères, le démasquage conduirait à l 'accessibilité du domaine de liaison au récepteur viral. Si le récepteur est exprimé à la surface cellulaire, il peut alors y avoir interaction, ceci déclenchant ensuite l'activation du domaine fusion expliquant pourquoi la présence simultanée des deux récepteurs synergise l'infection.All of these results suggest that the spacer peptide inserted between the targeting domain and the rest of the retroviral envelope exerts a control on the accessibility of the domain located downstream of said peptide and on the activation of the fusion. This control depends on the peptide itself and is influenced by its length and by its biochemical composition. The hypothesis formulated is that the spacer peptide PRO would ultimately play the same role as the proline-rich region from which it originates and which is located, in the unmodified glycoprotein, between the receptor binding domain and the fusion domain. This role would be the masking of the downstream domain (fusion domain for the wild envelope or binding domain for the chimeric envelope) and the unmasking following the interaction of the upstream domain with its receptor. In the case of the wild envelope, this unmasking would lead to activation of the fusion, while in the case of chimeric envelopes, the unmasking would lead to the accessibility of the binding domain to the viral receptor. If the receptor is expressed on the cell surface, there can then be interaction, this then triggering the activation of the fusion domain explaining why the simultaneous presence of the two receptors synergizes the infection.
Ces données permettent de proposer une stratégie de ciblage en deux étapes pour laquelle une enveloppe ciblante est construite avec différents domaines dont les fonctions sont activées et coordonnées par le biais de peptides espaceurs spécifiques contenant des séquences riches en proline. Ces glycoprotéines d'enveloppe chimères peuvent être conçue de la manière suivante, avec de N-terminal à C-terminal, un domaine "ciblant" capable de reconnaître une molécule de surface cellulaire spécifiquement exprimée sur le tissu ou la cellule ciblé(e) (par exemple un anticoφs simple chaîne ou un ligand pour un récepteur de surface); un peptide espaceur capable de masquer un domaine auxiliaire lui-même capable de faciliter la pénétration du virus quand il est activé. Un tel domaine auxiliaire peut être une enveloppe rétrovirale entière, c'est-à-dire une structure capable de médier et de prendre le relais de l'infection virale par le biais de l'interaction avec un récepteur rétroviral ubiquiste, qui a donc une très forte probabilité d'être co-exprimé avec la molécule de surface ciblée. Idéalement, le domaine auxiliaire devrait être masqué jusqu'à ce que la particule virale ait spécifiquement interagi avec la molécule de surface ciblée. Par exemple, dans le cas des enveloppes AMOPRO et AMOΔPRO, la molécule de surface ciblée est Ram-1 tandis que le domaine auxiliaire est l'enveloppe écotrope. Coopération EGFR et Rec-1 dans l'infection.These data make it possible to propose a targeting strategy in two stages for which a targeting envelope is constructed with different domains whose functions are activated and coordinated by means of specific spacer peptides containing sequences rich in proline. These chimeric envelope glycoproteins can be designed in the following way, with from N-terminal to C-terminal, a "targeting" domain capable of recognizing a cell surface molecule specifically expressed on the targeted tissue or cell ( for example a single chain anticoφs or a ligand for a surface receptor); a spacer peptide capable of masking an auxiliary domain itself capable of facilitating the penetration of the virus when it is activated. Such an auxiliary domain can be an entire retroviral envelope, i.e. a structure capable of mediating and taking over from viral infection through interaction with a ubiquitous retroviral receptor, which therefore has a very high probability of being co-expressed with the targeted surface molecule. Ideally, the helper domain should be masked until the virus particle has specifically interacted with the targeted surface molecule. For example, in the case of the AMOPRO and AMOΔPRO envelopes, the targeted surface molecule is Ram-1 while the auxiliary domain is the ecotropic envelope. EGFR and Rec-1 cooperation in infection.
Dans le but de vérifier si les peptides espaceurs PRO et ΔPRO pouvaient médier le mécanisme de masquage/démasquage dans le cas d'un autre type d'enveloppe ciblante, un autre modèle de ciblage en deux étapes a été exploré par le biais du récepteur EGF. Les résultats obtenus avec le ciblage de Ram-1 ont permis de proposer des extrémités C-terminales des peptides espaceurs masquant/démasquant. Cependant il n'a pas été possible de définir exactement leurs extrémités N-terminales. C'est pourquoi, dans un premier temps, les enveloppes EMOPRO + et EMOΔPRO + ont été construites (Figure 3B), enveloppes dans lesquelles les peptides espaceurs PRO et ΔPRO contiennent en plus, en N-terminal, 41 acides aminés dérivés de l'enveloppe amphotrope et localisés immédiatement en amont de la région riche en proline. Pour les enveloppes EMOPRO+ et EMOΔPRO + , le domaine ciblant est EGF, tandis que le domaine auxiliaire est l'enveloppe écotrope. Ces deux enveloppes ont été comparées avec l'enveloppe EMO (Figure 2 et 2B) qui ne contient pas de peptide espaceur.In order to verify whether the spacer peptides PRO and ΔPRO could mediate the masking / unmasking mechanism in the case of another type of targeting envelope, another two-step targeting model was explored using the EGF receptor . The results obtained with targeting Ram-1 have made it possible to propose C-terminal ends of the masking / unmasking spacer peptides. However, it was not possible to define their N-terminal ends exactly. This is why, as a first step, the EMOPRO + and EMOΔPRO + envelopes were constructed (FIG. 3B), envelopes in which the spacer peptides PRO and ΔPRO additionally contain, in N-terminal, 41 amino acids derived from the amphotropic envelope and located immediately upstream of the proline-rich region. For the EMOPRO + and EMOΔPRO + envelopes, the targeting domain is EGF, while the auxiliary domain is the ecotropic envelope. These two envelopes were compared with the EMO envelope (Figure 2 and 2B) which does not contain a spacer peptide.
Les tests d'infection ont été effectués avec des cellules exprimant Rec-1 seulement (cellules Cerd9) ou avec des cellules co-exprimant Rec-1 et EGFR (cellules 3T3). Les résultats d'une expérience typique sont rapportés dans le tableau 3. De manière attendue par les résultats obtenus avec les enveloppes AMO, les virus contenant les enveloppes EMO peuvent efficacement infecter les cellules Cerd9 et 3T3, indiquant que le domaine de liaison à Rec-1 dans ces enveloppes n'est pas masqué. Comparativement aux virus EMO, les particules virales contenant les enveloppes EMOPRO + et EMOΔPRO + ne peuvent que difficilement infecter les cellules Cerd9 (entre 1000 et 10000 fois moins bien que les virus EMO). Cependant, quand Rec-1 et EGFR sont co-exprimés, bien que ceci n'affecte pas le titre des virions EMO, les particules virales contenant les enveloppes EMOPRO + et EMOΔPRO + sont 20 et 60 fois plus infectieuses, respectivement, comparativement à quand Rec-1 est exprimé seul. Par rapport aux résultats obtenus avec les enveloppes AMOPRO et AMOΔ PRO, le masquage se fait apparemment moins bien, et il en résulte une infectivité non négligeable sur cellules Cerd9. Ceci est peut-être dû au fait que les peptides espaceurs PRO+ et ΔPRO+ ne sont pas optimisés pour leur fonction, mais peut-être aussi au fait que les cellules Cerd9 expriment un peu de récepteurs EGF qui contribuerait à activer les enveloppes EMOPRO + et EMOΔ PRO+ .The infection tests were carried out with cells expressing Rec-1 only (Cerd9 cells) or with cells co-expressing Rec-1 and EGFR (3T3 cells). The results of a typical experiment are reported in Table 3. As expected by the results obtained with the AMO envelopes, viruses containing the EMO envelopes can effectively infect Cerd9 and 3T3 cells, indicating that the Rec- binding domain 1 in these envelopes is not hidden. Compared to EMO viruses, viral particles containing the EMOPRO + and EMOΔPRO + envelopes can only with difficulty infect Cerd9 cells (between 1,000 and 10,000 times worse than EMO viruses). However, when Rec-1 and EGFR are co-expressed, although this does not affect the titer of EMO virions, the viral particles containing the EMOPRO + and EMOΔPRO + envelopes are 20 and 60 times more infectious, respectively, compared to when Rec-1 is expressed alone. Compared to the results obtained with the AMOPRO and AMOΔ PRO envelopes, the masking is apparently less successful, and this results in significant infectivity on Cerd9 cells. This may be due to the fact that the spacer peptides PRO + and ΔPRO + are not optimized for their function, but perhaps also to the fact that the Cerd9 cells express a little EGF receptor which would help activate the EMOPRO + and EMOΔ envelopes PRO +.
Tableau 1 Titres (lacZ i.u./ml) obtenus pour les virus contenant les enveloppes ciblant Ram-1 en tests d'interférenceTable 1 Titers (lacZ i.u./ml) obtained for the viruses containing the envelopes targeting Ram-1 in interference tests
env TE671 3T3a 3T3-MLV-Aa'b 3T3-MoMLVa'b env TE671 3T3 a 3T3-MLV-A a ' b 3T3-MoMLV a ' b
Ram-Ie Ram-1 + Rec-lc Rec-lc Ram-1e Ram-I e Ram-1 + Rec-l c Rec-l c Ram-1 e
MO <1 92,000,000 (100) 46,000,000 (100) 40MO <1 92,000,000 (100) 46,000,000 (100) 40
A 10, 000,000 12,000,000 (100) 240 8,000,000 (100)A 10, 000,000 12,000,000 (100) 240 8,000,000 (100)
AMO 4, 000 24 (100) 32 (266.7) 8 (50)AMO 4, 000 24 (100) 32 (266.7) 8 (50)
AMOFx 230,000 440,000 (100) 8,000 (3.6) 6,000 (2)AMOFx 230,000 440,000 (100) 8,000 (3.6) 6,000 (2)
AMOl 330,000 1,920,000 (100) 78,000 (8.1) 62,000 (4.8)AMOl 330,000 1,920,000 (100) 78,000 (8.1) 62,000 (4.8)
AMOlFx 400,000 1,620,000 (100) 60,000 (7.4) 74,000 (6.8)AMOlFx 400,000 1,620,000 (100) 60,000 (7.4) 74,000 (6.8)
AMOΔPRO 150, 000 280,000 (100) 400 (0.29) 64,000 (34.3)AMOΔPRO 150, 000 280,000 (100) 400 (0.29) 64,000 (34.3)
AMOPRO 10 60,000 (100) 4 (0.013) <1 (0.0025)AMOPRO 10 60,000 (100) 4 (0.013) <1 (0.0025)
a: pourcentages calculés en prenant comme valeur 100 les titres obtenus sur 3T3 b: infection sur 3T3 chroniquement infectées par MLV-A (3T3-MLV-A) ou par MoMLV (3T3-MoMLV) c: récepteur disponible à la surface de la cellule considérée a: percentages calculated taking as values 100 the titers obtained on 3T3 b: infection on 3T3 chronically infected with MLV-A (3T3-MLV-A) or with MoMLV (3T3-MoMLV) c: receptor available on the surface of the cell considered
Tableau 2 Titres (lacZ î u /ml) obtenus pour les virus contenant les enveloppes ciblant Ram-1Table 2 Titers (lacZ î u / ml) obtained for the viruses containing the envelopes targeting Ram-1
Peptide env 3T3 TE671 CERD9 RamID RecID espaceurPeptide env 3T3 TE671 CERD9 RamID RecID spacer
MO 2 8xl0+6 <1 7xl0+0 2 8xl0+6 <6 1x10 7 1MO 2 8xl0 +6 <1 7xl0 +0 2 8xl0 +6 <6 1x10 7 1
- A 5xl0+5 5xl0+5 6 2xl0+0 1 1 2xl0~5 - A 5xl0 +5 5xl0 +5 6 2xl0 +0 1 1 2xl0 ~ 5
3 AMO lxl0+2 2 2xl0+2 6 2xl0+0 2 2xl0+0 6 2x10 2 3 AMO lxl0 +2 2 2xl0 +2 6 2xl0 +0 2 2xl0 +0 6 2x10 2
13 AMOlFx 6xl0+4 1 6xl0+4 2 2xl0+5 2 7xl0_1 3 7xl0+0 13 AMOlFx 6xl0 +4 1 6xl0 +4 2 2xl0 +5 2 7xl0 _1 3 7xl0 +0
16 AMOΔPRO 1 9xl0+4 5xl0+3 6 2xl0+0 2 6x10 1 3 3xl0"4 16 AMOΔPRO 1 9xl0 +4 5xl0 +3 6 2xl0 +0 2 6x10 1 3 3xl0 "4
18 AMOGIFx 4xl0+4 4 5xl0+3 8 7xl0+3 l.lxlO"1 2 2X10"1 18 AMOGIFx 4xl0 +4 4 5xl0 +3 8 7xl0 +3 l.lxlO "1 2 2X10 " 1
19 AMOG2 8xl0+3 2 7xl0+3 3 lxl0+3 3 4x10 1 3 9X10" 1 19 AMOG2 8xl0 +3 2 7xl0 +3 3 lxl0 +3 3 4x10 1 3 9X10 "1
23 AMOG2FX 6X10"*3 1 2xl0+3 1 2xl0+3 2x10 X 2xl0_1 23 AMOG2FX 6X10 " * 3 1 2xl0 +3 1 2xl0 +3 2x10 X 2xl0 _1
28 AMOG3FX 9xl0+2 lxl0+2 1 2xl0+3 1 lxlO"1 1 3xl0+0 28 AMOG3FX 9xl0 +2 lxl0 +2 1 2xl0 +3 1 lxlO "1 1 3xl0 +0
62 AMOPRO 1 8xl0+3 <1 7xl0+0 <.lxl0+2 <9 4xl0~4 <5 6xl0"4 62 AMOPRO 1 8xl0 +3 <1 7xl0 +0 <.lxl0 +2 <9 4xl0 ~ 4 <5 6xl0 "4
MOAPRO 1 3xl0+5 <9 lxl0+0 1 7xl0+3 <7xl0 5 1 3xl0~2 MOAPRO 1 3xl0 +5 <9 lxl0 +0 1 7xl0 +3 <7xl0 5 1 3xl0 ~ 2
Tableau 3Table 3
Titres (lacZ i.u./ml) obtenus pour les virus contenant les enveloppes ciblant EGFRTiters (lacZ i.u./ml) obtained for viruses containing envelopes targeting EGFR
env 3T3 CeRD9 RecIDapprox 3T3 CeRD9 RecID
MO 9.2x10e 1.3X107 MO 9.2x10 e 1.3X10 7
EMOΔPRO 3.5xl04 8.5xl02 1 7x10 " EMOΔPRO 3.5xl0 4 8.5xl0 2 1 7x10 "
EMOPRO 9.6xl02 7xlOx 5 . 2x10 " EMOPRO 9.6xl0 2 7xlO x 5. 2x10 "
EMOI 2x106 3x10e EMOI 2x106 3x10 e
EXEMPLE 2 : Dans le but caractériser la coopération entre les récepteurs Rec-1 et Ram-1 , ainsi que les peptides capables de réguler cette coopération de récepteurs, une nouvelle série de glycoprotéines d'enveloppes chimères de type AMO (voir exemple précédent) a été construite - afin de vérifier si l'infection obtenue avec les enveloppes AMOPRO et AMODeltaPRO passe, dans une deuxième étape, par une interaction avec Rec-1 , le site de liaison avec Rec-1 a été inactivé par mutagenèse ponctuelle (mutation D84K) (MacKrell et al. , ]. Virology, 70: 1768-1774. (1996)) dans les enveloppes AMOPRO et AMODeltaPRO ainsi que dans l'enveloppe contrôle AMOG1X laquelle ne fait pas appel à la coopération de récepteurs pour permettre l'infection (Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)).EXAMPLE 2 In order to characterize the cooperation between the Rec-1 and Ram-1 receptors, as well as the peptides capable of regulating this cooperation of receptors, a new series of AMO-type chimeric envelope glycoproteins (see previous example) a been built - in order to check whether the infection obtained with the AMOPRO and AMODeltaPRO envelopes passes, in a second step, through an interaction with Rec-1, the binding site with Rec-1 was inactivated by point mutagenesis (D84K mutation) (MacKrell et al.,]. Virology, 70: 1768-1774. (1996)) in the AMOPRO and AMODeltaPRO envelopes as well as in the AMOG1X control envelope which does not require the cooperation of receptors to allow infection (Valsesia- Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)).
- afin de démontrer le rôle de la structure en hélice polyproline de type II pour les peptides coopérants, les enveloppes AMOEL3 et AMOEL5 ont été construites. Ces enveloppes portent respectivement 3 et 5 spires d'une hélice polyproline de type II caractérisée dans la littérature (Urry, Journal of Protein Chemistry 7: 1-34. (1988)).- in order to demonstrate the role of the polyproline type II helical structure for cooperating peptides, the AMOEL3 and AMOEL5 envelopes were constructed. These envelopes respectively carry 3 and 5 turns of a type II polyproline helix characterized in the literature (Urry, Journal of Protein Chemistry 7: 1-34. (1988)).
Des retrovirus ont été générés avec ces enveloppes chimères et ont été caractérisés par infection de cellules exprimant soit Rec-1 seul, soit Ram-1 seul, soit les deux molécules Ram-1 et Rec-1.Retroviruses were generated with these chimeric envelopes and were characterized by infection of cells expressing either Rec-1 alone, or Ram-1 alone, or the two molecules Ram-1 and Rec-1.
Matériel et Méthodes.Material and methods.
Les oligonucléotides elast3U: (5'-TTT ATG GTC ACC GCG GCC GCA CCT GGG GTA GGG GCT CCG GGG GTA GGG GCT CCT GGG GTG GCC ATA TAA) et elast3L (5'-TTA TAT GGC CAC CCC AGG AGC CCC TACThe oligonucleotides elast3U: (5'-TTT ATG GTC ACC GCG GCC GCA CCT GGG GTA GGG GCT CCG GGG GTA GGG GCT CCT GGG GTG GCC ATA TAA) and elast3L (5'-TTA TAT GGC CAC CCC AGG AGC CCC TAC
CCC CGG AGC CCC TAC CCC AGG TGC GGC CGC GGT GΛC CΛT AAA) ont été hybrides entre eux. Le fragment d'ADN bicaténaire résultant a été digéré par l'enzyme de restriction Eael et clone dans le plasmide d'expression FBAMOSALF préalablement ouvert en Notl. Il en résulte le plasmide FBAMOEL3SALF (voir séquence du gène env AMOEL3 en Fig. 30) comportant le peptide EL3 dont la séquence peptidique est représentée dans le tableau 4 (voir séquence nucléotidique en Fig. 31).CCC CGG AGC CCC TAC CCC AGG TGC GGC CGC GGT GΛC CΛT AAA) were hybrid with each other. The resulting double-stranded DNA fragment was digested with the restriction enzyme Eael and cloned into the expression plasmid FBAMOSALF previously opened in NotI. This results in the plasmid FBAMOEL3SALF (see sequence of the env gene AMOEL3 in FIG. 30) comprising the peptide EL3 whose peptide sequence is represented in table 4 (see nucleotide sequence in FIG. 31).
Les oligonucléotides UpE15: (5* -G AT GTA CCT GGG GTA GGC GCC CCT GGA GTC GGG GCT CCT GGG GTA GGA TTC AT) et LowE15: (5' -ATG AAT CCT ACC CCA GGA GCC CCG ACT CCA GGG GCG CCTThe oligonucleotides UpE15: (5 * -G AT GTA CCT GGG GTA GGC GCC CCT GGA GTC GGG GCT CCT GGG GTA GGA TTC AT) and LowE15: (5 '-ATG AAT CCT ACC CCA GGA GCC CCG ACT CCA GGG GCG CCT
ACC CCA GGT ACA TC) ont été hybrides entre eux. Le fragment d'ADN bicaténaire résultant a été digéré par l'enzyme de restriction EcoNI et clone dans le plasmide d'expression FBAMOEL3SALF préalablement ouvert en EcoNI. Il en résulte le plasmide FBAMOEL5SALF (voir séquence du gène env AMOEL5 en Fig. 32) comportant le peptide EL5 dont la séquence peptidique est représentée dans le tableau 4 (voir séquence nucléotidique en Fig. 33).ACC CCA GGT ACA TC) were hybrid with each other. The resulting double-stranded DNA fragment was digested with the restriction enzyme EcoNI and cloned into the expression plasmid FBAMOEL3SALF previously opened in EcoNI. This results in the plasmid FBAMOEL5SALF (see sequence of the env gene AMOEL5 in FIG. 32) comprising the peptide EL5 whose peptide sequence is represented in table 4 (see nucleotide sequence in FIG. 33).
Les oligonucléotides DELASTIN3-V Upper: (5'-GTC ACC GCG GCC GTC CCT GGG GTA GGG GTG CCG GGG GTA GGG GTG CCT GGG GTG GCC ATA TA A) et DELASTIN3-V Lower (5'-TTA TAT GGC CAC CCC AGG CAC CCC TAC CCC CGG CAC CCC TAC CCC AGG GAC GGC CGC GGT GAC) ont été hybrides entre eux. Le fragment d'ADN bicaténaire résultant a été digéré par l'enzyme de restriction Eael et clone dans le plasmide d'expression FBAMOSALF préalablement ouvert en Notl. Il en résulte le plasmideThe DELASTIN3-V Upper oligonucleotides: (5'-GTC ACC GCG GCC GTC CCT GGG GTA GGG GTG CCG GGG GTA GGG GTG CCT GGG GTG GCC ATA TA A) and DELASTIN3-V Lower (5'-TTA TAT GGC CAC CCC AGG CAC CCC TAC CCC CGG CAC CCC TAC CCC AGG GAC GGC CGC GGT GAC) have been hybridized. The resulting double-stranded DNA fragment was digested with the restriction enzyme Eael and cloned into the expression plasmid FBAMOSALF previously opened in NotI. This results in the plasmid
FBAMOEL3-VSALF (voir séquence du gène AMOEL3-V en Fig. 34) comportant le peptide EL3-V dont la séquence peptidique est représentée dans le tableau 4 (voir séquence nucléotidique en Fig. 35).FBAMOEL3-VSALF (see sequence of the AMOEL3-V gene in FIG. 34) comprising the peptide EL3-V whose peptide sequence is represented in table 4 (see nucleotide sequence in FIG. 35).
Les oligonucléotides DELASTIN3-I Upper: (5' -GTC ACC GCG GCC GTC ATA GGG GTA GGG GTG ATT GGG GTA GGG GTG ATC GGG GTG GCCThe oligonucleotides DELASTIN3-I Upper: (5 '-GTC ACC GCG GCC GTC ATA GGG GTA GGG GTG ATT GGG GTA GGG GTG ATC GGG GTG GCC
ATA TAA) et DELASTIN3-I Lower (5'-TTA TAT GGC CAC CCC GAT CAC CCC TAC CCC AAT CAC CCC TAC CCC TAT GAC GGC CGC GGT GAC) ont été hybrides entre eux. Le fragment d'ADN bicaténaire résultant a été digéré par l'enzyme de restriction Eael et clone dans le plasmide d'expression FBAMOSALF préalablement ouvert en Notl. Il en résulte le plasmideATA TAA) and DELASTIN3-I Lower (5'-TTA TAT GGC CAC CCC GAT CAC CCC TAC CCC AAT CAC CCC TAC CCC TAT GAC GGC CGC GGT GAC) were hybrid with each other. The resulting double-stranded DNA fragment was digested with the restriction enzyme Eael and cloned into the expression plasmid FBAMOSALF previously opened in NotI. This results in the plasmid
FBAMOEL3-ISALF comportant le peptide EL3-I dont la séquence peptidique est représentée dans le tableau 4.FBAMOEL3-ISALF comprising the peptide EL3-I whose peptide sequence is represented in table 4.
Les oligonucléotides UpXhoD84K: (5'-AGG CTG CTC GAG AAΛ ATG CGA AGA ACC TTT AAC CTC CC) et LoXhoD84K: (5' -ATT TTC TCG AGC AGC CTG GGC TGC TGC CCC C) ont été synthétisés. A partir des oligonucléotides 805FC et LMOADeltaPR03 (voir séquence plus haut), les couples 805FC/LoXhoD84K ou UpXhoD84K/LMOADeltaPR03 ont été utilisés indépendamment pour amplifier par PCR deux fragments d'ADN -à partir de la matrice FBAMOSALF. Ces deux ADN ont été respectivement digérés par les enzymes Notl/Xhol ou XhoI/BamHI et co-ligués dans l'un ou l'autre des trois plasmides FBAMOSALF, FBAMODeltaPROSALF, et FBAMOProSALF préalablement ouverts en Notl et BamHI. Les plasmides résultants expriment respectivement les enveloppes AMOD84K, AMODeltaProD84K, et AMOProD84K. Deux fragments d'ADN de 2005 pbs et 241 pbs ont été isolés à partir du plasmide FBAMOG1X (Valsesia-Wittmann et al. , The EMBO Journal 16: 1214- 1223. (1997)) par digestion avec les enzymes de restriction Ndel/Xhol et XhoI/BstEII respectivement. Ces deux inserts ont été clones dans le plasmide FBAMOD84KSALF préalablement digérés par les enzymes Ndel et BstEII, résultant en un plasmide capable d'exprimer l'enveloppe AMOG1XD84K. Résultats et Discussion.The oligonucleotides UpXhoD84K: (5'-AGG CTG CTC GAG AAΛ ATG CGA AGA ACC TTT AAC CTC CC) and LoXhoD84K: (5 '-ATT TTC TCG AGC AGC CTG GGC TGC TGC CCC C) were synthesized. From the oligonucleotides 805FC and LMOADeltaPR03 (see sequence above), the pairs 805FC / LoXhoD84K or UpXhoD84K / LMOADeltaPR03 were used independently to amplify by PCR two DNA fragments - from the FBAMOSALF template. These two DNAs were respectively digested by the enzymes NotI / Xhol or XhoI / BamHI and co-ligated in one or the other of the three plasmids FBAMOSALF, FBAMODeltaPROSALF, and FBAMOProSALF previously opened in NotI and BamHI. The resulting plasmids express the AMOD84K, AMODeltaProD84K, and AMOProD84K envelopes respectively. Two DNA fragments from 2005 bp and 241 bp were isolated from the plasmid FBAMOG1X (Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)) by digestion with the restriction enzymes Ndel / Xhol and XhoI / BstEII respectively. These two inserts were cloned into the plasmid FBAMOD84KSALF previously digested with the enzymes NdeI and BstEII, resulting in a plasmid capable of expressing the envelope AMOG1XD84K. Results and discussion.
Expression et incoφoration virale des enveloppes chimères. Les plasmides d'expression pour les enveloppes AMO, AMODeltaPRO, AMOPRO, AMOEL3, AMOEL5, AMOEL3-V, AMOEL3-I, AMOIFX, AMOG1X, AMOD84K, AMODeltaPROD84K, AMOPROD84K, AMOG1XD84K, AMODeltaPR02Expression and viral incoφoration of chimeric envelopes. Expression plasmids for the envelopes AMO, AMODeltaPRO, AMOPRO, AMOEL3, AMOEL5, AMOEL3-V, AMOEL3-I, AMOIFX, AMOG1X, AMOD84K, AMODeltaPROD84K, AMOPROD84K, AMOG1XD84K, AMODeltaPR02
(Valsesia-Wittmann et al. , The EMBO Journal 16: 1214-1223. (1997)), et AMODeltaPR04 (Valsesia-Wittmann et al. , The EMBO Journal 16: 1214-1223. (1997)) ont été introduits par transfection dans les cellules de la lignée TELCeBό (Cosset et al , Journal of Virology 69:7430-7436. (1995b)). Après sélection par la phléomycine, les colonies résistantes à la phléomycine ont été réunies pour chaque ADN et des virions ont été générés et analysés en suivant les procédures initialement décrites (Cosset et al. , Journal of Virology 69:6314-6322. (1995a)).(Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)), and AMODeltaPR04 (Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)) were introduced by transfection in cells of the TELCeBό line (Cosset et al, Journal of Virology 69: 7430-7436. (1995b)). After selection by phleomycin, colonies resistant to phleomycin were pooled for each DNA and virions were generated and analyzed according to the procedures initially described (Cosset et al., Journal of Virology 69: 6314-6322. (1995a) ).
Ces diverses enveloppes chimères sont normalement exprimées et maturées dans les cellules, et, de plus, efficacement incoφorées sur les particules virales (résultats non montrés). Les tests de liaison effectués démontrent que ces retrovirus peuvent spécifiquement se lier sur des cellules humaines par l'intermédiaire de la molécule de surface ciblée Ram-1 (résultats non montrés).These various chimeric envelopes are normally expressed and matured in cells, and, moreover, effectively incoφorated on viral particles (results not shown). The binding tests carried out demonstrate that these retroviruses can specifically bind to human cells via the targeted surface molecule Ram-1 (results not shown).
Ces divers virus ont été utilisés pour infecter des cellules exprimant soit Rec-1 seul (Cerd9), soit Ram-1 seul (CHO-Ram-1), soit les deux molécules Ram-1 et Rec-1 (Cearl3). Les résultats de la titration de ces virus sont présentés dans le tableau 4.These various viruses were used to infect cells expressing either Rec-1 alone (Cerd9), or Ram-1 alone (CHO-Ram-1), or the two molecules Ram-1 and Rec-1 (Cearl3). The results of the titration of these viruses are presented in Table 4.
Ces résultats peuvent être résumés de la manière suivante:These results can be summarized as follows:
- dans une enveloppe AMO, la substitution du peptide espaceur par trois "beta-turns" d'une hélice polyproline synthétique (AMOEL3) ou naturelle, décrite dans la littérature (AMOEL3-V, issue de l'élastine bovine) confère, en terme de capacité à masquer la fonction de l'enveloppe écotrope et à réguler la coopération des récepteurs Ram-1 et Rec-1 , un phénotype similaire aux virus portant les enveloppes "AMO" comprenant les peptides espaceurs coopérants- in an AMO envelope, the substitution of the spacer peptide by three "beta-turns" of a synthetic (AMOEL3) or natural polyproline helix, described in the literature (AMOEL3-V, derived from bovine elastin) gives, in terms ability to mask the function of the ecotropic envelope and to regulate the cooperation of the Ram-1 and Rec-1 receptors, a phenotype similar to viruses carrying the "AMO" envelopes including the cooperating spacer peptides
DeltaPR02, DeltaPRO, DeltaPR04, ou PRO. Puisque les peptides dérivés de l'élastine (AMOEL3-V et AMOEL3) sont agencés en hélice polyproline de typeDeltaPR02, DeltaPRO, DeltaPR04, or PRO. Since the peptides derived from elastin (AMOEL3-V and AMOEL3) are arranged in a polyproline helix of the type
II, les résultats obtenus permettent de suggérer que la régulation de la coopération des récepteurs Ram-1 et Rec-1 par les peptides DeltaPro et Pro est probablement due à leur structure secondaire présumée, en hélice polyproline de type IL De plus, des mutations introduites dans le peptide espaceur dérivé de l'élastine (AMOEL3-V) et ayant pour but de détruire le repliement du peptide en hélice polyproline de type II (AMOEL3-I, mutations obtenues par remplacement de la proline de chaque "beta-turn" par une isoleucine) résultent en une annulation de la coopération de récepteurs. - la destruction de la capacité de liaison au récepteur écotrope (mutations D84K) enraye la coopération de récepteur pour les enveloppes comportant des peptides espaceurs coopérants, notamment PRO (voir résultats AMOPRO vs AMOPROD84K), mais n'affecte pas la fonctionnalité des enveloppes contrôles portant le peptide espaceur G IX flexible (voir résultatsII, the results obtained make it possible to suggest that the regulation of the cooperation of the Ram-1 and Rec-1 receptors by the peptides DeltaPro and Pro is probably due to their presumed secondary structure, in IL-type polyproline helix. In addition, the mutations introduced in the spacer peptide derived from elastin (AMOEL3-V) and intended to destroy the folding of the peptide into a polyproline type II helix (AMOEL3-I, mutations obtained by replacing the proline of each "beta-turn" by an isoleucine) result in a cancellation of the cooperation of receptors. - the destruction of the capacity for binding to the ecotropic receptor (D84K mutations) hampers receptor cooperation for the envelopes comprising cooperating spacer peptides, in particular PRO (see results AMOPRO vs AMOPROD84K), but does not affect the functionality of the control envelopes carrying the flexible G IX spacer peptide (see results
AMOG1X vs AMOG1XD84K). On en déduit que la liaison au récepteur écotrope est nécessaire pour l'infection, dans une seconde étape, suite à la fixation sur le récepteur Ram-I.AMOG1X vs AMOG1XD84K). It is deduced therefrom that the binding to the ecotropic receptor is necessary for the infection, in a second step, following the binding to the Ram-I receptor.
Rappelons que les présents résultats montrent que dans le cas des retrovirus générés avec l'enveloppe chimère AMOPro, le site de liaison au récepteur écotrope est masqué (Valsesia-Wittmann et al., The EMBO Journal 16: 1214- 1223. (1997)). L'ensemble des résultats est donc compatible avec un modèle d'interaction en deux étapes dans lequel:Recall that the present results show that in the case of retroviruses generated with the chimeric envelope AMOPro, the binding site to the ecotropic receptor is masked (Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)) . The set of results is therefore compatible with a two-step interaction model in which:
- dans sa configuration "naïve" , c'est-à-dire quand il n'a pas été autorisé à interagir avec une cellule, le retrovirus "AMOPRO" peut potentiellement interagir avec le récepteur "primaire" ciblé (la molécule Ram-1), mais ne peut directement interagir avec le récepteur auxiliaire (la molécule Rec-1). Ce masquage semble être dû à une première propriété du peptide espaceur Pro. - quand ce virus est autorisé à interagir avec Ram-1 , il se produit un changement de conformation local au niveau du peptide espaceur Pro qui va rendre accessible le site de liaison à Rec-1. Ce changement de conformation est dû à une deuxième propriété du peptide espaceur Pro.- in its "naive" configuration, that is to say when it has not been authorized to interact with a cell, the "AMOPRO" retrovirus can potentially interact with the targeted "primary" receptor (the Ram-1 molecule ), but cannot directly interact with the auxiliary receptor (the Rec-1 molecule). This masking seems to be due to a first property of the Pro spacer peptide. - When this virus is authorized to interact with Ram-1, a local conformation change occurs at the level of the Pro spacer peptide which will make the Rec-1 binding site accessible. This change in conformation is due to a second property of the Pro spacer peptide.
- si le récepteur Rec-1 est présent à la surface de la même cellule qui présente Ram-1 et sur laquelle s'est lié le virus, alors, dans une deuxième étape, ce récepteur va servir de molécule d'entrée pour le virus. - if the Rec-1 receptor is present on the surface of the same cell which has Ram-1 and on which the virus has bound, then, in a second step, this receptor will serve as an entry molecule for the virus .
'10'10
Tableau 4 Résultats de titrationTable 4 Titration results
Env séquence du peptide cspaceura Cearl 3b CHO-Ram- l b Ccrd9bEnv sequence of the peptide cspacer a Cearl 3 b CHO-Ram- l b Ccrd9b
ΛMO NVG AAΛ PHQV 4 + ΛΛMO NVG AAΛ PHQV 4 + Λ
ΛMOD84K NVG PRVP1GPNPAA PHQV + + -ΛMOD84K NVG PRVP1GPNPAA PHQV + + -
ΛMODcltaPro2 NVG PRVPIGPNPΛA PHQV H-++) ++-+ 4/-ΛMODcltaPro2 NVG PRVPIGPNPΛA PHQV H - ++) ++ - + 4 / -
ΛM01FX NVG AAAIEGRASPGSS PHQV +-H-+ +++ +++ΛM01FX NVG AAAIEGRASPGSS PHQV + -H- + +++ +++
AMODeltaPro NVG PRVPIGPNPVLPDΛAA PHQV ++++ +++ -AMODeltaPro NVG PRVPIGPNPVLPDΛAA PHQV ++++ +++ -
ΛMθDcltal'roD84K NVG PRVPIGPNPVLPDAAA PHQV ++4 +++ -ΛMθDcltal'roD84K NVG PRVPIGPNPVLPDAAA PHQV ++ 4 +++ -
AMOEL3 NVG AΛAPGVGAPGVGAPGVAA PHQV +++ + -AMOEL3 NVG AΛAPGVGAPGVGAPGVAA PHQV +++ + -
AMOEL3-V NVG AΛVPGVGVPGVGVPGVAA PHQV +++ + -AMOEL3-V NVG AΛVPGVGVPGVGVPGVAA PHQV +++ + -
AMOEL3-I NVG AAVIGVGVIGVGVIGVΛA PHQV +++ +++ +++AMOEL3-I NVG AAVIGVGVIGVGVIGVΛA PHQV +++ +++ +++
AMOG1 X NVG AAΛGGGGS1EGRASPGSS PHQV +++ ++ ++AMOG1 X NVG AAΛGGGGS1EGRASPGSS PHQV +++ ++ ++
AMOG1 XD84K NVG AAAGGGGSIEGRASPGSS PHQV ++ ++ -AMOG1 XD84K NVG AAAGGGGSIEGRASPGSS PHQV ++ ++ -
AMODeltaPro4 NVG PRVPIGPNPVLPDQRLPSSAA PHQV +-H ++ -AMODeltaPro4 NVG PRVPIGPNPVLPDQRLPSSAA PHQV + -H ++ -
AMOEL5 NVG ΛAAPGVGAPGVGAPGVGAPGVGΛPGVAA PHQV +++ _ _AMOEL5 NVG ΛAAPGVGAPGVGAPGVGAPGVGΛPGVAA PHQV +++ _ _
AMOPRO NVG PRVP1GPNPVLPDQRLPSSPIEIVPΛPQPPSP . LNTSYPPSTTSTPSTSPTSPSVPQPPPAAA PHQV M→AMOPRO NVG PRVP1GPNPVLPDQRLPSSPIEIVPΛPQPPSP. LNTSYPPSTTSTPSTSPTSPSVPQPPPAAA PHQV M →
AMOPROD84K NVG PRVPIGPNPVLPDQRLPSSPIEIVPAPQQPPSP LNTSYPPSTT STPSTSPTSPSVPQPPPAAA PHQV -AMOPROD84K NVG PRVPIGPNPVLPDQRLPSSPIEIVPAPQQPPSP LNTSYPPSTT STPSTSPTSPSVPQPPPAAA PHQV -
a peptide inséré entre le domaine de liaison pour Ram-I et l'enveloppe MoMLV "PHQV" représente les acides aminés 7 à 10 de l'enveloppe de MoMLV et "NVG' représente les 3 derniers acides aminés du domaine de liaison à Ram- 1 b titres relatifs obtenus sur les cellules indiquées Cearl 3, exprimant les récepteurs Ram-I et Rec-1, CHO-Ram- 1 , exprimant Ram-I seul, Cerd9, exprimant Rec-I seul EXEMPLE 3.a peptide inserted between the binding domain for Ram-I and the MoMLV envelope "PHQV" represents amino acids 7 to 10 of the MoMLV envelope and " NVG 'represents the last 3 amino acids of the Ram- binding domain 1 b relative titers obtained on the cells indicated Cearl 3, expressing the Ram-I and Rec-1 receptors, CHO-Ram-1, expressing Ram-I alone, Cerd9, expressing Rec-I alone EXAMPLE 3.
Le développement de stratégies du ciblage du transfert de gène par le biais de la construction de glycoprotéines d'enveloppes chimères, générées pai insertions N-terminales de ligands, se heurte, notamment, à la faible capacité, voire à l' incapacité de l' interaction virus/molécule de surface ciblée à activer la 0 fusion de ces enveloppes ciblantes (Cosset and Russell , Gène Therapy 3 946-956The development of strategies for targeting gene transfer through the construction of chimeric envelope glycoproteins, generated by N-terminal insertions of ligands, is notably hampered by the low capacity, or even the inability of the virus / surface molecule interaction targeted to activate the fusion of these targeting envelopes (Cosset and Russell, Gene Therapy 3 946-956
( 1996)) La possibilité de laire coopérer deux molécules de surface (Valsesia- Wittmann et al. , The EMBO Journal 16. 1214- 1223 ( 1997)), l une étant le récepteur ciblée ou molécule de surface cellulaire d'attachement, l' autie étant un récepteur (rétro)vιral spécialise dans la fusion ou molécule de surface auxiliaire, 5 permet d'entrevoir un moyen de surmonter ce problème de faible fusiogénicité des enveloppes chimères et plus généralement de faible efficacité des retrovirus ciblants On a testé la coopération de récepteurs dans trois modèles de ciblage dans lesquels les trois molécules de surface cellulaire suivantes servent de points d'attachement aux retrovirus ciblants (î) recepteui de l' EGF (epidermal growth ^.0 lactor), et (π) molécule de classe I du CMH humain Ixs domaines de liaison pour ces deux molécules de surface sont soit des facteurs de croissance (EGFR), soit un anticoφs mono-brin (CMH-I). Ces ligands ont été insertion par fusion à l'extrémité N-terminales de l'enveloppe MLV amphotrope (4070A) et divers peptides issus de la région riche en proline portée par la sous-unité SU du virus MLV amphotrope ont été insérés entre les ligands et l'enveloppe 4070A (voir(1996)) The ability to cooperate lar two surface molecules (Valsesia- Wittmann et al., The EMBO Journal 16. 1214- 1223 (1997)), l a r e being the receiver or targeted molecule attachment cell surface , the autie being a r e receiver (retro) vιral specializes in fusion or auxiliary surface molecule 5 allows to foresee a way to overcome this problem of low fusiogénicité chimeric envelopes and generally low efficiency of retroviruses is systematic targeted tested receptor cooperation in three targeting models in which the following three cell surface molecules serve as attachment points for retroviruses targeting (Î) receptor for EGF (epidermal growth ^. 0 lactor), and (π) human MHC class I molecule Ixs binding domains for these two surface molecules are either growth factors (EGFR), or a single-stranded anticoφs (CMH-I). These ligands were inserted by fusion at the N-terminal end of the amphotropic MLV envelope (4070A) and various peptides from the proline-rich region carried by the SU subunit of the amphotropic MLV virus were inserted between the ligands. and envelope 4070A (see
Tableau 5).Table 5).
Matériels et MéthodesMaterials and methods
Des fragments d'ADN codants pour les peptides espaceurs DeltaPro2, DeltaPro3, DeltaPro4, et Pro (voir tableau 5) ont été générés par PCR en utilisant comme matrice ADN le gène env 4070A, en 5' l' oligonucléotide PRO-5-NE (5'-ATC GAG GTC ACC GCG GCC GCG GGA CCC CGA GTC CCC ATA GGG CCC) qui est le même pour les 4 fragments PCR et comme oligonucléotides 3' les séquences AMODPRO(-H -f-P-A): (5*-TAT GAG CGG CCG GGT TGG GCC CTA TGG GGA C), DPro3: (5'-TTA TAC GGC CGT GTC GGG TAA TAC TGG), AMODPRO(+H+S-A): (5'-TAT GTG CGG CCG AGG AAG GGA GTC TTT GGT C) et PRO-3-NE: (5'ATA ATC GGC CGG GGG TGG CTGTGG GAC).DNA fragments coding for the spacer peptides DeltaPro2, DeltaPro3, DeltaPro4, and Pro (see Table 5) were generated by PCR using as DNA template the env 4070A gene, in 5 'the oligonucleotide PRO-5-NE ( 5'-ATC GAG GTC ACC GCG GCC GCG GGA CCC CGA GTC CCC ATA GGG CCC) which is the same for the 4 PCR fragments and as 3 'oligonucleotides the AMODPRO sequences (-H -fPA): (5 * -TAT GAG CGG CCG GGT TGG GCC CTA TGG GGA C), DPro3: (5'-TTA TAC GGC CGT GTC GGG TAA TAC TGG), AMODPRO (+ H + SA): (5'-TAT GTG CGG CCG AGG AAG GGA GTC TTT GGT C ) and PRO-3-NE: (5'ATA ATC GGC CGG GGG TGG CTGTGG GAC).
Les fragments d'ADN correspondants ont été digérés par l'enzyme EagI et séparément insérés dans le plasmide FBEASALF (exprimant les glycoprotéines d'enveloppe chimère EA) (Cosset et al., Journal of Virology 69:6314-6322.The corresponding DNA fragments were digested with the enzyme EagI and separately inserted into the plasmid FBEASALF (expressing the chimeric envelope glycoproteins EA) (Cosset et al., Journal of Virology 69: 6314-6322.
(1995a)) préalablement ouvert au site de restriction Notl. Les plasmides résultants expriment les enveloppes EADeltaPro2, EADeltaPro3, EADeltaPro4, et EAPro.(1995a)) previously opened at the Notl restriction site. The resulting plasmids express the EADeltaPro2, EADeltaPro3, EADeltaPro4, and EAPro envelopes.
Le fragment Ndel/Notl contenant le promoteur FB29 ainsi que le scFv anti- MHC-I muni du peptide signal de la glycoprotéine d'enveloppe du virus MoMLVThe NdeI / NotI fragment containing the FB29 promoter as well as the anti-MHC-I scFv provided with the signal peptide of the envelope glycoprotein of the MoMLV virus
(Marin et al., Journal of Virology 70:2957-2962. (1996)) a été clone dans le plasmide FBEASALF préalablement débarrassé du fragment Ndel/Notl. Il en résulte le plasmide FB34ASALF capable d'exprimer une enveloppe chimère 4070 à l'extrémité N-terminale de laquelle est fusionné le scFv. Ce plasmide a été ensuite ouvert en Notl afin d'y insérer les peptides espaceurs DeltaPro2,(Marin et al., Journal of Virology 70: 2957-2962. (1996)) was cloned into the plasmid FBEASALF previously freed from the NdeI / NotI fragment. This results in the plasmid FB34ASALF capable of expressing a 4070 chimeric envelope at the N-terminal end from which the scFv is fused. This plasmid was then opened in NotI in order to insert therein the DeltaPro2 spacer peptides,
DeltaPro3, DeltaPro4, et Pro (voir tableau 5) préalablement digérés avec l'enzyme EagI. Il en résulte une série de vecteurs d'expression pour les enveloppes 34DeltaPro2, 34DeltaPro3, 34DeltaPro4, et 34Pro.DeltaPro3, DeltaPro4, and Pro (see Table 5) previously digested with the enzyme EagI. The result is a series of expression vectors for the 34DeltaPro2, 34DeltaPro3, 34DeltaPro4, and 34Pro envelopes.
Résultats et Discussion.Results and discussion.
Ces divers ADN ont été introduits par transfection dans les cellules de la lignée TELCeBό et des retrovirus ont été générés en suivant la procédure habituelle (voir exemples 1 et 2). On a montré que ces retrovirus expriment correctement les glycoprotéines d'enveloppe chimères et que ces dernières permettent de rediriger efficacement la liaison des particules virales sur les cibles cellulaires spécifiques (résultats non montrés).These various DNAs were introduced by transfection into the cells of the TELCeBό line and retroviruses were generated by following the usual procedure (see examples 1 and 2). These retroviruses have been shown to express correctly the chimeric envelope glycoproteins and that the latter make it possible to efficiently redirect the binding of the viral particles to the specific cellular targets (results not shown).
I.es virus produits avec les enveloppes chimères des divers groupes ont été utilisés pour infecter des cellules n'exprimant que le récepteur amphotrope et pas la molécule de surface ciblée Les résultats de la titration de ces virus sont montrés dans le tableau 5.The viruses produced with the chimeric envelopes of the various groups were used to infect cells expressing only the amphotropic receptor and not the targeted surface molecule. The results of the titration of these viruses are shown in Table 5.
Ces résultats montrent qu'il est possible de masquer les lonctions de l'enveloppe amphotrope par le biais de fragments de la région riche en proline Dans le cas des chimères réalisées avec EGF, il est nécessaire d' insérer au moins cinq "beta-turns" pour obtenir un effet masquant significatil, l' insertion de la région riche en proline dans sa totalité résultant en une inhibition totale Pour les chimères réalisées avec le scFv anti-MHC-1, trois "beta-turns" sont requis pour obtenir un effet masquant totalThese results show that it is possible to mask the junctions of the amphotropic envelope by means of fragments of the proline-rich region. In the case of chimeras produced with EGF, it is necessary to insert at least five "beta-turns "to obtain a significant masking effect, the insertion of the proline-rich region in its entirety resulting in total inhibition For the chimeras carried out with the anti-MHC-1 scFv, three" beta-turns "are required to obtain an effect hiding total
Tableau 5 Résultats de titration.Table 5 Titration results.
peptιdea ligand pour" nom séquence EGFR MHC-Ipeptιde a ligand for "sequence name EGFR MHC-I
sansc AAA PHQV 6e3 39e2 DeltaPro2 AAA GPRVPIGPNPAA PHOV 7c3 18e lwithout c AAA PHQV 6e3 39e2 DeltaPro2 AAA GPRVPIGPNPAA PHOV 7c3 18th l
DeltaPro3 AAA GPRVPIGPNPVLPDTAA PHQV 1 2e 3 < l e l DeltaPro4 AAA GPRVPIGPNPVLPDQRLPSSAA PHQV 7e 1 < I c i Pro AAA G^RYPIGJUffiVLEDQRLESSEIEIVPAPQPPDeltaPro3 AAA GPRVPIGPNPVLPDTAA PHQV 1 2nd 3 <l e l DeltaPro4 AAA GPRVPIGPNPVLPDQRLPSSAA PHQV 7e 1 <I c i Pro AAA G ^ RYPIGJUffiVLEDQRLESSEIEIVPAPQPP
SPLNTSYPPSTTSTPSTSPTSPSVPQPPPΛΛ PI IQV < le l < lelSPLNTSYPPSTTSTPSTSPTSPSVPQPPPΛΛ PI IQV <le l <lel
a: peptide inséré entre le domaine de liaison ciblant et l'enveloppe 4070A "AAA" code pour le site Notl utilisé pour réaliser la fusion dans l'enveloppe chimère, "PHQV" représente les acides aminés 4 à 7 de l'enveloppe amphotrope Les "beta-turns" sont soulignés b titration sur les cellules Ceaι l3 pour les enveloppes ciblantes EGFR (ligand. EGF) et pour les enveloppes ciblantes ciblant MIIC-I (ligand scl v anti MHC-I) c le ligand est directement fusionné à l'extrémité de la SU amphotrope (avec le 4eme acide aminé), et n'a pas de peptide espaceui EXEMPLE 4.a: peptide inserted between the targeting binding domain and the 4070A envelope "AAA" code for the NotI site used to carry out the fusion in the chimeric envelope, "PHQV" represents amino acids 4 to 7 of the amphotropic envelope Les "beta-turns" are underlined b titration on Ceaι l3 cells for the EGFR targeting envelopes (ligand. EGF) and for the targeting envelopes targeting MIIC-I (scl v anti MHC-I ligand) c the ligand is directly fused to the end of the amphotropic SU (with the 4th amino acid), and has no spaced peptide EXAMPLE 4.
Les études précédentes ont permis de délimiter les extrémités C-terminales des peptides coopérants et de déterminer le nombre de tours d'hélice polyproline de type II nécessaire pour obtenir un effet masquant et un effet coopérant minimal. Dans le cas du modèle des enveloppes chimères AMO (voir plus haut), il suffit d'un minimum de deux tours d'hélice (Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)). Cependant, pour des enveloppes chimères générés avec d'autres domaines de liaison que celui pour Ram-1 (cas des chimères AMO) et utilisant l'enveloppe amphotrope comme enveloppe support, l'effet coopératif est moins marqué, d'une part car le masquage des fonctions de l'enveloppe amphotrope nécessite quatre tours d'hélice polyproline (voir tableau 5) et d'autre part car l'activation des fonctions de l'enveloppe amphotrope est moins forte suite à la liaison des virus sur les molécules de surface ciblées. Une explication possible est que, dans le modèle des chimères AMO, outre le peptide espaceur PRO, le domaine de liaison à Ram-1 porte lui- même des déterminants importants pour induire, de manière concertée avec ce peptide PRO, l'activation des fonctions de l'enveloppe écotrope. Le domaine de liaison pour Ram-1 est en effet un fragment d'enveloppe rétrovirale (issu de l'enveloppe amphotrope) qui est naturellement situé immédiatement en amont de la région riche en proline. Afin de déterminer la présence et l'importance de telles régions dans la coopération de récepteurs, on a construit des enveloppes chimères associant un domaine ciblant avec l'enveloppe amphotrope et, inséré entre ces deux polypeptides, divers peptides testés pour leur effet coopérant contenant notamment la région riche en proline (ou un fragment de cette région) combinée avec des fragments peptidiques issus du domaine N-terminal de l'enveloppe amphotrope.The previous studies made it possible to delimit the C-terminal ends of the cooperating peptides and to determine the number of turns of polyproline type II helix necessary to obtain a masking effect and a minimal cooperating effect. In the case of the AMO chimera envelope model (see above), a minimum of two helix turns is sufficient (Valsesia-Wittmann et al., The EMBO Journal 16: 1214-1223. (1997)). However, for chimeric envelopes generated with other binding domains than that for Ram-1 (case of AMO chimeras) and using the amphotropic envelope as a support envelope, the cooperative effect is less marked, on the one hand because the masking of the functions of the amphotropic envelope requires four turns of the polyproline helix (see table 5) and on the other hand because the activation of the functions of the amphotropic envelope is less strong following the binding of the viruses to the surface molecules targeted. One possible explanation is that, in the model of AMO chimeras, in addition to the PRO spacer peptide, the Ram-1 binding domain itself carries important determinants to induce, in a concerted manner with this PRO peptide, the activation of the functions of the ecotropic envelope. The binding domain for Ram-1 is indeed a fragment of retroviral envelope (from the amphotropic envelope) which is naturally located immediately upstream of the proline-rich region. In order to determine the presence and the importance of such regions in the cooperation of receptors, chimeric envelopes were associated associating a targeting domain with the amphotropic envelope and, inserted between these two polypeptides, various peptides tested for their cooperating effect containing in particular the proline-rich region (or a fragment of this region) combined with peptide fragments from the N-terminal domain of the amphotropic envelope.
Matériels et MéthodesMaterials and methods
Des fragments d'ADN codant pour les peptides espaceurs DeltaPro4-beta, DeltaPro4-int, DeltaPro4-vrb et ont été générés par PCR en utilisant comme matrice ADN le gène env 4070A, en 3' l' oligonucléotide AMODPRO(+H+S- A): (5' -TAT GTG CGG CCG AGG AAG GGA GTC TTT GGT C) et en 5' les oligonucléotides UPro-beta: (5' -ATG CTG GCG GCC GCG GAT CCT ATT ACC ATG TTC TCC CTG ACC CGG C), UPro-int: (5 ' ATG CTG GCG GCC GCG AAC CCT CTA GTC CTA GAA TTC ACT GAT GC), et UPRO-vrb.DNA fragments coding for the spacer peptides DeltaPro4-beta, DeltaPro4-int, DeltaPro4-vrb and were generated by PCR using as DNA template the env 4070A gene, in 3 'the oligonucleotide AMODPRO (+ H + S- A): (5 '-TAT GTG CGG CCG AGG AAG GGA GTC TTT GGT C) and in 5' the oligonucleotides UPro-beta: (5 '-ATG CTG GCG GCC GCG GAT CCT ATT ACC ATG TTC TCC CTG ACC CGG C) , UPro-int: (5 'ATG CTG GCG GCC GCG AAC CCT CTA GTC CTA GAA TTC ACT GAT GC), and UPRO-vrb.
(5 ' ATG CTG GCG GCC GCG GAA ACC ACC GGA CAG GCT TAC TGG AAG CCC), respectivement (voir figs 36 à 38). Des fragments d'ADN codant pour les peptides espaceurs Pro-beta, Pro-int et Pro-vrb ont été générés par PCR en utilisant comme matrice ADN le gène env 4070A, en 3' l' oligonucléotide PRO-3-NE: (ATA ATC GGC CGG GGG TGG CTG TGG GAC) et en 5' les oligonucléotides UPro-beta: (5' -ATG CTG GCG GCC GCG GAT CCT ATT ACC ATG TTC TCC CTG ACC CGG(5 'ATG CTG GCG GCC GCG GAA ACC ACC GGA CAG GCT TAC TGG AAG CCC), respectively (see figs 36 to 38). DNA fragments coding for the spacer peptides Pro-beta, Pro-int and Pro-vrb were generated by PCR using as DNA template the gene env 4070A, in 3 'the oligonucleotide PRO-3-NE: (ATA ATC GGC CGG GGG TGG CTG TGG GAC) and in 5 'the oligonucleotides UPro-beta: (5' -ATG CTG GCG GCC GCG GAT CCT ATT ACC ATG TTC TCC CTG ACC CGG
C), UPro-int: (5'-ATG CTG GCG GCC GCG AAC CCT CTA GTC CTA GAA TTC ACT GAT GC), et UPRO-vrb: (5' -ATG CTG GCG GCC GCG GAA ACC ACC GGA CAG GCT TAC TGG AAG CCC), respectivement (voir figs 39 à 41). Ces fragments d'ADN ont été digérés avec l'enzyme EagI et insérés soit dans le plasmide FBEASALF (voir plus haut) résultant en l'obtention des vecteurs d'expression pour les enveloppes chimères EADeltaPro4-beta, EADeltaPro4-int, EADeltaPro4-vrb, EAPro-beta, EAPro-int et EAPro-vrb, soit dans le plasmide FB34ASALF (voir plus haut) résultant en l'obtention des vecteurs d'expression pour les enveloppes chimères 34ADeltaPro4-beta,C), UPro-int: (5'-ATG CTG GCG GCC GCG AAC CCT CTA GTC CTA GAA TTC ACT GAT GC), and UPRO-vrb: (5 '-ATG CTG GCG GCC GCG GAA ACC ACC GGA CAG GCT TAC TGG AAG CCC), respectively (see figs 39 to 41). These DNA fragments were digested with the enzyme EagI and inserted either into the plasmid FBEASALF (see above) resulting in obtaining the expression vectors for the chimeric envelopes EADeltaPro4-beta, EADeltaPro4-int, EADeltaPro4-vrb , EAPro-beta, EAPro-int and EAPro-vrb, either in the plasmid FB34ASALF (see above) resulting in the obtaining of the expression vectors for the chimeric envelopes 34ADeltaPro4-beta,
34ADeltaPro4-int, 34ADeltaPro4-vrb, 34APro-beta, 34APro-int et 34APro-vrb. 34ADeltaPro4-int, 34ADeltaPro4-vrb, 34APro-beta, 34APro-int and 34APro-vrb.
BIBLIOGRAPHIEBIBLIOGRAPHY
1 . Battini, J. L. , O. Danos, and J. M. Heard. 1995. Receptor-binding domain of murine leukemia virus envelope glycoproteins. J. Virol. 62:713-719.1. Battini, J. L., O. Danos, and J. M. Heard. 1995. Receptor-binding domain of murine leukemia virus envelope glycoproteins. J. Virol. 62: 713-719.
2. Battini, J. L., P. Rodrigues, R. MΫller, O. Danos, and J .-M. Heard. 1996. Receptor-binding properties of a purified fragment of the 4070A amphotropic murine leukemia virus envelope giycoprotein. J. Virol. in press.2. Battini, J. L., P. Rodrigues, R. MΫller, O. Danos, and J.-M. Heard. 1996. Receptor-binding properties of a purified fragment of the 4070A amphotropic murine leukemia virus envelope giycoprotein. J. Virol. in press.
3. Bell, G. L , N. M. Fong, M. M. Stempien, M. A. Wormsted, D. Caput, L. Ku, M. S. Urdea, L. B. Rail, and R. Sanchez-Pescador. 1986. Human epidermal growth factor precursor: cDNA séquence, expression in vitro and gène organization. Nucleic Acid Res. 14:8427-8446.3. Bell, G. L, N. M. Fong, M. M. Stempien, M. A. Wormsted, D. Caput, L. Ku, M. S. Urdea, L. B. Rail, and R. Sanchez-Pescador. 1986. Human epidermal growth factor precursor: cDNA sequence, in vitro expression and gene organization. Nucleic Acid Res. 14: 8427-8446.
4. Cosset, F.-L. , C. Legras, Y. Chebloune, P. Savatier, P. Thoraval, J. L. Thomas, J. Samarut, V. M. Nigon, and G. Verdier. 1990. A new avian leukosis virus-based packaging cell Une that uses two separate transcomplementing helper génomes. J Virol. M: 1070-1078.4. Cosset, F.-L. , C. Legras, Y. Chebloune, P. Savatier, P. Thoraval, J. L. Thomas, J. Samarut, V. M. Nigon, and G. Verdier. 1990. A new avian leukosis virus-based packaging cell Une that uses two separate transcomplementing helper genomes. J Virol. M: 1070-1078.
5. Cosset, F.-L. , C. Legras, J. L. Thomas, R. M. Molina, Y. Chebloune, C. Faure, V. M. Nigon, and G. Verdier. 1991. Improvement of avian leukosis virus (ALV)- based retrovirus vectors by using différent cis-acting séquences from ALVs. J Virol. 65_:3388-3394.5. Cosset, F.-L. , C. Legras, J. L. Thomas, R. M. Molina, Y. Chebloune, C. Faure, V. M. Nigon, and G. Verdier. 1991. Improvement of avian leukosis virus (ALV) - based retrovirus vectors by using different cis-acting sequences from ALVs. J Virol. 65_: 3388-3394.
6. Cosset, F.-L. , F. J. Morling, Y. Takeuchi, R. A. Weiss, M. K. L. Collins, and S. J. Russell. 1995a. Rétroviral retargeting by envelopes expressing an N-terminal binding domain. J. Virol. 62:6314-6322.6. Cosset, F.-L. , F. J. Morling, Y. Takeuchi, R. A. Weiss, M. K. L. Collins, and S. J. Russell. 1995a. Rétroviral retargeting by envelopes expressing an N-terminal binding domain. J. Virol. 62: 6314-6322.
7. Cosset, F.-L., Y. Takeuchi, J. L. Battini, R. A. Weiss, and M. K. L.7. Cosset, F.-L., Y. Takeuchi, J. L. Battini, R. A. Weiss, and M. K. L.
Collins. 1995b. High titer packaging Systems producing recombinant retroviruses résistant to human sérum. J. Virol. 62:7430-7436.Collins. 1995b. High titer packaging Systems producing recombinant retroviruses resistant to human serum. J. Virol. 62: 7430-7436.
8. Gatignol, A. , H. Durand, and G. Tiraby. 1988. Bleomycin résistance conferred by a drug-binding protein. FEBS Letters. 230: 171-175.8. Gatignol, A., H. Durand, and G. Tiraby. 1988. Bleomycin resistance conferred by a drug-binding protein. FEBS Letters. 230: 171-175.
9. Kozak, S. L. , D. C. Siess, M. P. Kavanaugh, A. D. Miller, and D. Kabat. 1995. The envelope giycoprotein of an amphotropic murine retrovirus binds specifically to the cellular receptor/phosphate transporter of susceptible species. J. Virol. 62:3433-3440.9. Kozak, SL, DC Siess, MP Kavanaugh, AD Miller, and D. Kabat. 1995. The envelope giycoprotein of an amphotropic murine retrovirus binds specifically to the cellular receptor / phosphate transporter of susceptible species. J. Virol. 62: 3433-3440.
10. Marin, M. , D. No'l, S. Valsesia-Wittmann, F. Brockly, M. Etienne-Julan, S. J. Russell, F.-L. Cosset, and M. Piechaczyk. 1996. Targeted infection of human cells via MHC class I molécules by MoMuLV-derived viruses displaying single-chain antibody fragment-envelope fusion proteins, in press.10. Marin, M., D. No'l, S. Valsesia-Wittmann, F. Brockly, M. Etienne-Julan, S. J. Russell, F.-L. Cosset, and M. Piechaczyk. 1996. Targeted infection of human cells via MHC class I molecules by MoMuLV-derived viruses displaying single-chain antibody fragment-envelope fusion proteins, in press.
11. Miller, D. G. , R. H. Edwards, and A. D. Miller. 1994. Cloning of the cellular receptor for amphotropic murine retroviruses reveals homology to that for gibbon ape leukemia virus. Proc Natl Acad Sci USA. 21:78-82.11. Miller, D. G., R. H. Edwards, and A. D. Miller. 1994. Cloning of the cellular receptor for amphotropic murine retroviruses reveals homology to that for gibbon ape leukemia virus. Proc Natl Acad Sci USA. 21: 78-82.
12. Nagai, K. , and H. C. Thorgersen. 1984. Génération of beta- globin by sequence-specific proteolysis of a hybrid protein produced in12. Nagai, K., and H. C. Thorgersen. 1984. Generation of beta-globin by sequence-specific proteolysis of a hybrid protein produced in
Escherishia coll. Nature (London). 202:810-812.Escherishia coll. Nature (London). 202: 810-812.
13. Nilson, B. H. K. , F. J. Morling, F.-L. Cosset, and S. J . Russell. 1996. Targeting of rétroviral vectors through protease-substrate interactions. Gène Ther. in press.13. Nilson, B. H. K., F. J. Morling, F.-L. Cosset, and S. J. Russell. 1996. Targeting of retroviral vectors through protease-substrate interactions. Gene Ther. in press.
14. Ott, D. , R. Friedrich, and A. Rein. 1990. Séquence analysis of amphotropic and 10A1 murine leukemia virus: close relationship to mink cell focus forming viruses. J. Virol. 64:757-766.14. Ott, D., R. Friedrich, and A. Rein. 1990. Sequence analysis of amphotropic and 10A1 murine leukemia virus: close relationship to mink cell focus forming viruses. J. Virol. 64: 757-766.
15. Russell, S. J. , R. E. Hawkins, and G. Winter. 1993. Rétroviral vectors displaying functional antibody fragments. Nucleic Acids Research. 21:1081-1085.15. Russell, S. J., R. E. Hawkins, and G. Winter. 1993. Retroviral vectors displaying functional antibody fragments. Nucleic Acids Research. 21: 1081-1085.
16. Sambrook, J. , E. F. Fritsch, and T. Maniatis . 1989. ,16. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989.,
Molecular cloning, A laboratory manual, 2nd éd. Cold Spring Harbor Laboratory Press, New York.Molecular cloning, A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, New York.
17. Shinnick, T. M., R. A. Lerner, and J. G. Sutcliffe. 1981. Nucleotide séquence of Moloney murine leukemia virus. Nature. 223_:543-548.17. Shinnick, T. M., R. A. Lerner, and J. G. Sutcliffe. 1981. Nucleotide sequence of Moloney murine leukemia virus. Nature. 223_: 543-548.
18. Souyri, M., I. Vigon, J. F. Penciolelli, J. M. Heard, P. Tambourin, and F. Wendling. 1990. A putative truncated cytokine receptor gène transduced by the myeloproliferativc leukemia virus immortalizes hematopoietic progenitors. Cell. 6_3_: 1137-1147.18. Souyri, M., I. Vigon, JF Penciolelli, JM Heard, P. Tambourin, and F. Wendling. 1990. A putative truncated cytokine receptor gene transduced by the myeloproliferativc leukemia virus immortalizes hematopoietic progenitors. Cell. 6_3_: 1137-1147.
19. Takeuchi, Y., F. L. Cosset, P. J. Lachmann, H. Okada, R. A. Weiss, and M. K. L. Collins. 1994. Type C retrovirus inactivation by human complément is determined by both the viral génome and producer cell. J. Virol. 63: 8001-8007.19. Takeuchi, Y., F. L. Cosset, P. J. Lachmann, H. Okada, R. A. Weiss, and M. K. L. Collins. 1994. Type C retrovirus inactivation by human complement is determined by both the viral genome and producer cell. J. Virol. 63: 8001-8007.
20. Valsesia-Wittmann, S. , A. Drynda, G. Deleage, M. Aumailley, J.-M. Heard, O. Danos, G. Verdier, and F.-L. Cosset. 1994. Modifications in the binding domain of avian retrovirus envelope protein to redirect the host range of rétroviral vectors. J. Virol. 68:4609-4619.20. Valsesia-Wittmann, S., A. Drynda, G. Deleage, M. Aumailley, J.-M. Heard, O. Danos, G. Verdier, and F.-L. Cosset. 1994. Modifications in the binding domain of avian retrovirus envelope protein to redirect the host range of retroviral vectors. J. Virol. 68: 4609-4619.
21. Valsesia-Wittmann, S. , F. J. Morling, B. H. K. Nilson, Y. Takeuchi, S. J. Russell, and F.-L. Cosset. 1996. Improvement of rétroviral retargeting by using amino acid spacers between an additional binding domain and the N terminus of Moloney murine leukemia virus SU. J. Virol. 70_:2059- 2064.21. Valsesia-Wittmann, S., F. J. Morling, B. H. K. Nilson, Y. Takeuchi, S. J. Russell, and F.-L. Cosset. 1996. Improvement of retroviral retargeting by using amino acid spacers between an additional binding domain and the N terminus of Moloney murine leukemia virus SU. J. Virol. 70_: 2059-2064.
22. VanZeijl, M., S. V. Johann, E. Cross, J. Cunningham, R.22. VanZeijl, M., S. V. Johann, E. Cross, J. Cunningham, R.
Eddy, T. B. Shows, and B. O'Hara. 1994. An amphotropic virus receptor is a second member of the gibbon ape leukemia virus receptor family. Proc. Natl. Acad. Sci. USA. 21: 1168-1172.Eddy, T. B. Shows, and B. O'Hara. 1994. An amphotropic virus receptor is a second member of the gibbon ape leukemia virus receptor family. Proc. Natl. Acad. Sci. USA. 21: 1168-1172.
23. Weiss, R. A. 1993. Cellular receptors and viral glycoproteins involved in rétroviral entry, p. 1-108. In J. Levy (éd.), The Retroviridae, vol. 2. Plénum Press. 23. Weiss, R. A. 1993. Cellular receptors and viral glycoproteins involved in retroviral entry, p. 1-108. In J. Levy (ed.), The Retroviridae, vol. 2. Plenum Press.

Claims

REVENDICATIONS
1. Utilisation d'un peptide en vue d'un transfert de gènes dans une cellule eucaryote cible, lequel peptide présente d'environ 10 à environ 200, notamment d'environ 15 à environ 150 acides aminés, et avantageusement environ 20 acides aminés, dans lequel 30% au moins des acides aminés sont constitués par des résidus proline, lesquels résidus proline sont régulièrement agencés de manière à induire des repliements de la chaîne polypeptidique à environ 180° ("β-turn" ou "reverse-turn"), ces repliements étant régulièrement espacés et s'assemblant en une hélice polyproline à repliement de type β ("polyproline β-turn helix"), dans une construction polypeptidique contenant, du côté N-terminal (en amont) dudit peptide, un domaine protéique N-terminal (amont) susceptible de reconnaître une molécule de surface ciblée ou un antigène exprimé sur une surface cellulaire, notamment un récepteur approprié (récepteur ciblé) situé sur ladite cellule eucaryote, et du côté C-terminal (en aval) dudit peptide, un domaine protéique C-terminal (aval) susceptible de reconnaître un récepteur approprié (récepteur auxiliaire) situé sur la susdite cellule eucaryote, lequel peptide est capable de faciliter ou d'inhiber l'interaction entre le domaine protéique C-terminal (aval) et le récepteur auxiliaire, l'inhibition de cette interaction ayant lieu tant que le domaine protéique1. Use of a peptide for the transfer of genes into a target eukaryotic cell, which peptide has from approximately 10 to approximately 200, in particular from approximately 15 to approximately 150 amino acids, and advantageously approximately 20 amino acids, in which at least 30% of the amino acids consist of proline residues, which proline residues are regularly arranged so as to induce folding of the polypeptide chain at around 180 ° ("β-turn" or "reverse-turn"), these folds being regularly spaced and assembling in a polyproline helix with folding type β ("polyproline β-turn helix"), in a polypeptide construction containing, on the N-terminal side (upstream) of said peptide, a protein domain N -terminal (upstream) capable of recognizing a targeted surface molecule or an antigen expressed on a cell surface, in particular an appropriate receptor (targeted receptor) located on said eukaryotic cell, and d u C-terminal side (downstream) of said peptide, a C-terminal protein domain (downstream) capable of recognizing an appropriate receptor (helper receptor) located on the aforementioned eukaryotic cell, which peptide is capable of facilitating or inhibiting the interaction between the C-terminal protein domain (downstream) and the auxiliary receptor, the inhibition of this interaction taking place as long as the protein domain
N-terminal (amont) n'a pas interagi avec le récepteur ciblé et la favorisation de l'interaction entre le domaine protéique C-terminal (aval) et le récepteur auxiliaire ayant lieu lorsque le domaine protéique N-terminal (amont) a interagi avec le récepteur ciblé.N-terminal (upstream) did not interact with the targeted receptor and the interaction between the C-terminal (downstream) protein domain and the auxiliary receptor takes place when the N-terminal (upstream) protein domain interacted with the target receptor.
2. Utilisation d'un peptide selon la revendication 1 , dans la construction d'une glycoprotéine à activité ciblante et fusogénique, essentiellement intacte, portée par un vecteur recombinant viral ou non viral de transfert de gène capable d'infecter une cellule eucaryote, ladite cellule eucaryote comportant un récepteur ciblé et un récepteur auxiliaire permettant de faciliter l'entrée du susdit vecteur viral ou non viral dans la cellule eucaryote, la susdite glycoprotéine comprenant :2. Use of a peptide according to claim 1, in the construction of a glycoprotein with targeting and fusogenic activity, essentially intact, carried by a viral or non-viral recombinant gene transfer vector capable of infecting a eukaryotic cell, said eukaryotic cell comprising a targeted receptor and an auxiliary receptor making it possible to facilitate the entry of the aforesaid viral or non-viral vector into the eukaryotic cell, the aforementioned glycoprotein comprising:
- le susdit peptide,- the above peptide,
- un domaine protéique du côté N-terminal (en amont) du susdit peptide, susceptible d'interagir avec le susdit récepteur ciblé, lequel domaine protéique permet de lier spécifiquement le susdit vecteur de transfert de gènes eta protein domain on the N-terminal side (upstream) of the aforementioned peptide, capable of interacting with the aforementioned targeted receptor, which protein domain makes it possible to specifically bind the aforesaid gene transfer vector and
- un domaine protéique du côté C-terminal (en aval) du susdit peptide, susceptible d'interagir avec le susdit récepteur auxiliaire, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée du susdit vecteur de transfert de gènes dans la cellule eucaryote, le processus d'entrée cellulaire du vecteur viral ou non viral recombinant dans la cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le vecteur viral ou non viral recombinant avec le récepteur ciblé de la cellule eucaryote, entraînant par l'intermédiaire du susdit peptide un mécanisme de "démasquage" ou encore d'accessibilité du récepteur auxiliaire vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre le susdit vecteur de transfert de gènes et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de "masquage" ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur auxiliaire vis-à-vis du domaine protéique C-terminal (aval).- a protein domain on the C-terminal side (downstream) of the above-mentioned peptide, capable of interacting with the above-mentioned auxiliary receptor, which interaction plays the role of an auxiliary mechanism for entry of the above-mentioned gene transfer vector into the eukaryotic cell, the process of cellular entry of the recombinant viral or non-viral vector into the eukaryotic cell via the C-terminal protein domain (downstream) can only take place when the N-terminal (upstream) protein domain has recognized and linked the recombinant viral or non-viral vector with the targeted receptor of the eukaryotic cell, causing, via the above peptide, a "unmasking" mechanism or further accessibility of the auxiliary receptor vis-à-vis the C-terminal protein domain (downstream), and, in the case where there is no recognition between the aforementioned gene transfer vector and the targeted receptor of the cell eukaryote through the N-terminal protein domain (upstream), there is a mechanism of "masking" or even of inaccessibility, via the above peptide, of the auxiliary receptor vis-à-vis the domain C-terminal protein (downstream).
3. Utilisation d'un peptide selon l'une des revendications 1 à 2, dans la construction d'une glycoprotéine d'enveloppe (rétro)virale essentiellement intacte, portée par une particule (rétro) virale recombinante capable d' infecter une cellule eucaryote, ladite glycoprotéine d'enveloppe étant avantageusement sous forme polymérique, notamment sous forme trimérique, chaque monomère de la forme polymérique étant lui-même sous forme d'hétérodimère, ladite cellule eucaryote comportant un récepteur ciblé et un récepteur auxiliaire permettant de faciliter l'entrée de la susdite particule (rétro)vifàle (récepteur (rétro)viral) dans la cellule eucaryote, la glycoprotéine d'enveloppe comprenant: - le susdit peptide,3. Use of a peptide according to one of claims 1 to 2, in the construction of an essentially intact (retro) viral envelope glycoprotein, carried by a recombinant (retro) viral particle capable of infecting a eukaryotic cell. , said envelope glycoprotein advantageously being in polymeric form, in particular in trimeric form, each monomer of the polymeric form being itself in the form of heterodimer, said eukaryotic cell comprising a targeted receptor and an auxiliary receptor making it possible to facilitate entry the above (retro) active particle ((retro) viral receptor) in the eukaryotic cell, the envelope glycoprotein comprising: - the above peptide,
- un domaine protéique du côté N-terminal (en amont) du susdit peptide, susceptible d'interagir avec le susdit récepteur ciblé, laquelle interaction permet de lier spécifiquement la particule (rétro)virale eta protein domain on the N-terminal side (upstream) of the above-mentioned peptide, capable of interacting with the above-mentioned targeted receptor, which interaction makes it possible to specifically bind the (retro) viral particle and
- un domaine protéique du côté C-terminal (en aval) du susdit peptide, susceptible d'interagir avec le susdit récepteur (rétro)viral, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée de la particule (rétro)virale dans la cellule eucaryote, le processus d'entrée cellulaire de la particule (rétro)virale recombinante dans la cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le récepteur ciblé de la cellule eucaryote avec la particule (rétro)virale recombinante, entraînant par l' intermédiaire du susdit peptide un mécanisme de "démasquage" ou encore d'accessibilité du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre la particule virale recombinante et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de "masquage" ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval).- a protein domain on the C-terminal side (downstream) of the aforementioned peptide, capable of interacting with the aforesaid (retro) viral receptor, which interaction plays the role of auxiliary mechanism of entry of the (retro) viral particle in the eukaryotic cell, the process of cellular entry of the recombinant (retro) viral particle into the eukaryotic cell via the C-terminal (downstream) protein domain can only take place when the N-terminal (upstream) protein domain has recognized and bound the targeted receptor of the eukaryotic cell with the recombinant (retro) viral particle, causing via the above peptide a mechanism of "unmasking" or accessibility of the (retro) viral receptor vis-à-vis the C-terminal protein domain (downstream), and, in the case where there is no recognition between the recombinant viral particle and the receptor targeted by the eukaryotic cell through the N-terminal protein domain (upstream), a "masking" or even non-accessibility mechanism occurs, via the above peptide, of the (retro) viral receptor vis-à-vis screw of the C-terminal protein domain (downstream).
4. Utilisation d'un peptide selon l'une quelconque des revendications 1 à 3, caractérisé en ce que le domaine protéique N-terminal (amont) est choisi parmi les polypeptides suivants :4. Use of a peptide according to any one of claims 1 to 3, characterized in that the N-terminal (upstream) protein domain is chosen from the following polypeptides:
- anticorps monobrin reconnaissant des molécules de surface cellulaire,- single-stranded antibody recognizing cell surface molecules,
- tout ligand pour une molécule de surface cellulaire, notamment hormones polypeptidiques, cytokine, facteurs de croissance.- any ligand for a cell surface molecule, in particular polypeptide hormones, cytokine, growth factors.
5. Utilisation d'un peptide selon l'une quelconque des revendications 1 à5. Use of a peptide according to any one of claims 1 to
4, caractérisé en ce que le domaine protéique C-terminal (aval) correspond à une glycoprotéine d'enveloppe (rétro)virale, essentiellement intacte comportant le domaine naturel de liaison, les fonctions de fusion et d'ancrage de la glycoprotéine d'enveloppe sauvage dont dérive la glycoprotéine d'enveloppe portée par la particule (rétro) virale recombinante.4, characterized in that the C-terminal (downstream) protein domain corresponds to an (retro) viral envelope glycoprotein, essentially intact, comprising the natural binding domain, the fusion and anchoring functions of the envelope glycoprotein wild from which the envelope glycoprotein carried by the recombinant (retro) viral particle is derived.
6. Utilisation d'un peptide selon l'une quelconque des revendications 1 à6. Use of a peptide according to any one of claims 1 to
5, caractérisée en ce que le peptide provient de la glycoprotéine d'enveloppe des retrovirus de type C, et en ce que le virus est avantageusement choisi parmi : le virus MLV écotrope, le virus MLV amphotrope, le virus MLV xénotrope, le virus MLV MCF, le virus MLV 10A1 , GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Féline Leukemia Virus), et notamment en ce que le peptide est choisi parmi ceux contenant ou étant constitués par l'une des séquences suivantes :5, characterized in that the peptide comes from the envelope glycoprotein of type C retroviruses, and in that the virus is advantageously chosen from: the ecotropic MLV virus, the amphotropic MLV virus, the xenotropic MLV virus, the MLV virus MCF, MLV 10A1 virus, GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Féline Leukemia Virus), and in particular in that the peptide is chosen from those containing or consisting of one of the following sequences:
PRO (4070A), PRO(MoMLV), ΔPRO, PRO + , ΔPRO + , PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.PRO (4070A), PRO (MoMLV), ΔPRO, PRO +, ΔPRO +, PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.
7. Utilisation d'un peptide selon l'une quelconque des revendications 1 à 5, caractérisée en ce que le peptide est dérivé ou adapté de l'élastine bovine et choisi parmi ceux contenant ou étant constitué par l'une des séquences suivantes: EL3, EL3-V, EL5. 7. Use of a peptide according to any one of claims 1 to 5, characterized in that the peptide is derived or adapted from bovine elastin and chosen from those containing or consisting of one of the following sequences: EL3 , EL3-V, EL5.
8. Séquences peptidiques choisies parmi celles contenant ou constituées par l'une des séquences suivantes :8. Peptide sequences chosen from those containing or consisting of one of the following sequences:
- PRO (4070A), PRO(MoMLV), PROβ, PRO + , ΔPRO, ΔPROβ, ΔPRO + ,- PRO (4070A), PRO (MoMLV), PROβ, PRO +, ΔPRO, ΔPROβ, ΔPRO +,
- MOAPRO, MOAΔPRO, - EMOPRO, EMOPROβ, EMOPRO + , EAPRO, EAPROβ, EAPRO+ ,- MOAPRO, MOAΔPRO, - EMOPRO, EMOPROβ, EMOPRO +, EAPRO, EAPROβ, EAPRO +,
EMOΔPRO, EMOΔPROβ, EMOΔPRO + , EAΔPRO, EAΔPROβ, EAΔPRO + , EL3, EL3-V, EL5, AMOEL3, AMOEL3-V, AMOEL5, ΔPR04-β , ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.EMOΔPRO, EMOΔPROβ, EMOΔPRO +, EAΔPRO, EAΔPROβ, EAΔPRO +, EL3, EL3-V, EL5, AMOEL3, AMOEL3-V, AMOEL5, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int-PRO vrb.
9. Séquence polypeptidique contenant un peptide d'environ 10 à environ9. Polypeptide sequence containing a peptide from approximately 10 to approximately
200, notamment d'environ 15 à environ 150 acides aminés, et avantageusement d'environ 20, dans lequel 30% au moins des acides aminés sont constitués par des résidus proline, lesquels résidus proline sont régulièrement agencés de manière à induire des repliements de la chaîne polypeptidique à environ 180° ("β-turn" ou "reverse-turn"), ces repliements étant régulièrement espacés et s'assemblant en une hélice polyproline à repliement de type β ("polyproline β-turn helix"),200, in particular from approximately 15 to approximately 150 amino acids, and advantageously from approximately 20, in which at least 30% of the amino acids consist of proline residues, which proline residues are regularly arranged so as to induce folding of the polypeptide chain at approximately 180 ° ("β-turn" or "reverse-turn"), these folds being regularly spaced and assembling into a polyproline helix with β-type folding ("polyproline β-turn helix"),
- un domaine protéique N-terminal (en amont) du susdit peptide, susceptible de réagir avec un récepteur approprié (récepteur ciblé) situé sur une cellule eucaryote, lequel domaine protéique permet de lier spécifiquement une particule- an N-terminal protein domain (upstream) of the above peptide, capable of reacting with an appropriate receptor (targeted receptor) located on a eukaryotic cell, which protein domain makes it possible to specifically bind a particle
(rétro)virale recombinante contenant ledit domaine protéique N-terminal et(retro) viral recombinant containing said N-terminal protein domain and
- un domaine protéique C-terminal (en aval) du susdit peptide, susceptible d'interagir avec un récepteur (rétro)viral auxiliaire approprié (récepteur (rétro)viral) situé sur ladite cellule eucaryote, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée de la particule (rétro)virale dans ladite cellule eucaryote, le processus d'entrée cellulaire de ladite particule (rétro)virale recombinante dans ladite cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le récepteur ciblé de la cellule eucaryote avec ladite particule- a C-terminal protein domain (downstream) of the above peptide, capable of interacting with an appropriate auxiliary (retro) viral receptor ((retro) viral receptor) located on said eukaryotic cell, which interaction plays the role of an auxiliary mechanism d entry of the (retro) viral particle into said eukaryotic cell, the process of cellular entry of said recombinant (retro) viral particle into said eukaryotic cell through the C-terminal (downstream) protein domain can only take place when the N-terminal (upstream) protein domain has recognized and linked the targeted eukaryotic cell receptor with said particle
(rétro)virale recombinante, entraînant par l'intermédiaire du susdit peptide un mécanisme de démasquage ou encore d'accessibilité du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre la particule virale recombinante et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de masquage ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval). (retro) viral recombinant, causing through the above peptide a mechanism of unmasking or accessibility of the (retro) viral receptor vis-à-vis the C-terminal protein domain (downstream), and, in the case where there is no recognition between the recombinant viral particle and the targeted receptor of the eukaryotic cell through the N-terminal protein domain (upstream), a masking or non-accessibility mechanism occurs, via the aforementioned peptide, of the (retro) viral receptor with respect to the C-terminal protein domain (downstream).
10. Particule (rétro)virale recombinante susceptible d'infecter une cellule eucaryote, laquelle cellule comporte un récepteur ciblé et un récepteur auxiliaire de la susdite particule (rétro)virale, comprenant une glycoprotéine d'enveloppe substantiellement intacte, notamment sous forme polymérique et avantageusement sous forme trimérique, chaque monomère de la forme polymérique étant avantageusement lui-même sous forme hétérodimère, contenant un peptide d'environ 10 à environ 200, notamment d'environ 15 à environ 150 acides aminés, et avantageusement d'environ 20, dans lequel 30% au moins des acides aminés sont constitués par des résidus proline, lesquels résidus proline sont régulièrement agencés de manière à induire des repliements de la chaîne polypeptidique à environ 180° ("β-turn" ou "reverse-turn"), ces repliements étant régulièrement espacés et s'assemblant en une hélice polyproline à repliement de type β ("polyproline β-turn helix"), - un domaine protéique du côté N-terminal (en amont) du susdit peptide, susceptible d'interagir avec le susdit récepteur ciblé, lequel domaine peptidique permet de lier spécifiquement la particule (rétro)virale et - un domaine protéique du côté C-terminal (en aval) du susdit peptide, susceptible d'interagir avec le susdit récepteur (rétro)viral, laquelle interaction joue le rôle de mécanisme auxiliaire d'entrée de la particule (rétro)virale dans la cellule eucaryote, le processus d'entrée cellulaire de la particule (rétro)virale recombinante dans la cellule eucaryote par le biais du domaine protéique C-terminal (aval) ne pouvant avoir lieu que lorsque le domaine protéique N-terminal (amont) a reconnu et lié le récepteur ciblé de la cellule eucaryote avec la particule (rétro)virale recombinante, entraînant par l'intermédiaire du susdit peptide un mécanisme de démasquage ou encore d'accessibilité du récepteur (rétro)viral vis-à-vis du domaine protéique C-terminal (aval), et, dans le cas où il n'y a pas reconnaissance entre la particule virale recombinante et le récepteur ciblé de la cellule eucaryote par le biais du domaine protéique N-terminal (amont), se produit un mécanisme de masquage ou encore de non accessibilité, par l'intermédiaire du susdit peptide, du récepteur rétroviral vis-à-vis du domaine protéique C-terminal (aval).10. Recombinant (retro) viral particle capable of infecting a eukaryotic cell, which cell comprises a targeted receptor and an auxiliary receptor for the said (retro) viral particle, comprising a substantially intact envelope glycoprotein, in particular in polymeric form and advantageously in trimeric form, each monomer of the polymeric form being advantageously itself in heterodimer form, containing a peptide of approximately 10 to approximately 200, in particular of approximately 15 to approximately 150 amino acids, and advantageously of approximately 20, in which At least 30% of the amino acids consist of proline residues, which proline residues are regularly arranged so as to induce folds of the polypeptide chain at around 180 ° ("β-turn" or "reverse-turn"), these folds being regularly spaced and assembling in a polyproline helix with folding type β ("polyproline β-turn helix"), - a protein domain on the N-terminal side (upstream) of the above peptide, capable of interacting with the aforementioned targeted receptor, which peptide domain makes it possible to specifically bind the (retro) viral particle and - a protein domain on the C-terminal side (in downstream) of the above peptide, capable of interacting with the above-mentioned (retro) viral receptor, which interaction plays the role of an auxiliary mechanism for entry of the (retro) viral particle into the eukaryotic cell, the process of cellular entry of the recombinant (retro) viral particle in the eukaryotic cell through the C-terminal protein domain (downstream) which can only take place when the N-terminal protein domain (upstream) has recognized and linked the targeted receptor of the eukaryotic cell with the recombinant (retro) viral particle, causing via the above-mentioned peptide a mechanism for unmasking or accessibility of the (retro) viral receptor vis-à-vis the C-termi protein domain nal (downstream), and, in the case where there is no recognition between the recombinant viral particle and the targeted receptor of the eukaryotic cell through the N-terminal protein domain (upstream), a masking mechanism occurs or else of non-accessibility, via the above peptide, of the retroviral receptor vis-à-vis the C-terminal protein domain (downstream).
11. Particule (rétro) virale recombinante selon la revendication 10, caractérisée en ce que le domaine protéique N-terminal (amont) est choisi parmi les peptides suivants : - anticorps monobrin reconnaissant des molécules de surface cellulaire, - tout ligand pour une molécule de surface cellulaire, notamment hormones polypeptidiques, cytokine, facteurs de croissance.11. Recombinant (retro) viral particle according to claim 10, characterized in that the N-terminal (upstream) protein domain is chosen from the following peptides: - monobrin antibody recognizing cell surface molecules, - any ligand for a cell surface molecule, in particular polypeptide hormones, cytokine, growth factors.
12. Particule (rétro)virale recombinante selon l'une des revendications 10 ou 11, caractérisée en ce que le domaine protéique C-terminal (aval) correspond à un polypeptide d'origine (rétro)virale comportant les fonctions de liaison, de fusion et d'ancrage de la glycoprotéine d'enveloppe sauvage dont dérive la glycoprotéine d'enveloppe portée par la particule (rétro)virale recombinante, et peut provenir des domaines naturels comportant les fonctions de liaison, de fusion et d'ancrage des glycoprotéines d'enveloppe issues des retrovirus12. Recombinant (retro) viral particle according to one of claims 10 or 11, characterized in that the C-terminal (downstream) protein domain corresponds to a polypeptide of (retro) viral origin comprising the binding, fusion functions. and of anchoring of the wild envelope glycoprotein from which the envelope glycoprotein derived by the recombinant (retro) viral particle is derived, and can come from natural domains comprising the functions of binding, fusion and anchoring of the glycoproteins of envelope from retroviruses
MLV-A, GALV, FeLVB, ou des virus tels que adénovirus, herpès virus, virus AAV (Adeno Associated Virus), ou plus généralement de glycoprotéines virales issues de virus d'origine eucaryote, notamment orthomyxovirus (tel que virus influenza) ou paramyxovirus (tel que SV5).MLV-A, GALV, FeLVB, or viruses such as adenovirus, herpes virus, AAV virus (Adeno Associated Virus), or more generally viral glycoproteins derived from viruses of eukaryotic origin, in particular orthomyxovirus (such as influenza virus) or paramyxovirus (such as SV5).
13. Particule (rétro)virale recombinante selon l'une quelconque des revendications 10 à 12, caractérisée en ce que le peptide provient de la glycoprotéine d'enveloppe de retrovirus de type C, et en ce que le peptide provient avantageusement d'un virus choisi parmi : le virus MLV écotrope, le virus MLV amphotrope, le virus MLV xénotrope, le virus MLV MCF, le virus13. Recombinant (retro) viral particle according to any one of claims 10 to 12, characterized in that the peptide comes from the envelope glycoprotein of type C retrovirus, and in that the peptide advantageously comes from a virus chosen from: ecotropic MLV virus, amphotropic MLV virus, xenotropic MLV virus, MLV MCF virus, virus
MLV 10A1 , GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV : Féline Leukemia Virus), et notamment en ce que le peptide est choisi parmi ceux contenant ou étant constitués par l'une des séquences suivantes PRO (4070A), PRO(MoMLV), ΔPRO, PRO+ , ΔPRO+ , PROβ, ΔPROβ, ΔPR04-β,MLV 10A1, GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Féline Leukemia Virus), and in particular in that the peptide is chosen from those containing or consisting of by one of the following sequences PRO (4070A), PRO (MoMLV), ΔPRO, PRO +, ΔPRO +, PROβ, ΔPROβ, ΔPR04-β,
ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb.
14. Particule (rétro)virale recombinante selon l'une quelconque des revendications 10 à 13, caractérisée en ce que : - le peptide provient de la glycoprotéine d'enveloppe des retrovirus de type C, et en ce que le virus est avantageusement choisi parmi : le virus MLV écotrope, le virus MLV amphotrope, le virus MLV xénotrope, le virus MLV MCF, le virus MLV 10A1 , GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Féline Leukemia Virus), et notamment en ce que le peptide est choisi parmi ceux contenant ou étant constitués par l'une des séquences suivantes : PRO (4070 A), PRO(MoMLV), ΔPRO, PRO+ , ΔPRO + , PROβ, ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb, - le domaine protéique N-terminal (amont) est choisi parmi les peptides suivants:14. Recombinant (retro) viral particle according to any one of claims 10 to 13, characterized in that: - the peptide comes from the envelope glycoprotein of type C retroviruses, and in that the virus is advantageously chosen from : ecotropic MLV virus, amphotropic MLV virus, xenotropic MLV virus, MLV MCF virus, MLV 10A1 virus, GALV (Gibbon Ape Leukemia Virus), SSAV (Simian Sarcoma Associated Virus), FeLV A, FeLV B, FeLV C (FeLV: Feline Leukemia Virus), and in particular in that the peptide is chosen from those containing or consisting of one of the following sequences: PRO (4070 A), PRO (MoMLV), ΔPRO, PRO +, ΔPRO +, PROβ , ΔPROβ, ΔPR04-β, ΔPR04-int, ΔPR04-vrb, PROβ, PRO-int, PRO-vrb, - the N-terminal (upstream) protein domain is chosen from the following peptides:
* anticorps monobrin reconnaissant des molécules de surface cellulaire,* single-stranded antibody recognizing cell surface molecules,
* tout ligand pour une molécule de surface cellulaire, notamment hormones polypeptidiques, cytokine, facteurs de croissance, s - le domaine protéique C-terminal correspond à un polypeptide d'origine* any ligand for a cell surface molecule, in particular polypeptide hormones, cytokine, growth factors, s - the C-terminal protein domain corresponds to an original polypeptide
(rétro)virale comportant les fonctions de liaison, de fusion et d'ancrage de la glycoprotéine d'enveloppe sauvage dont dérive la glycoprotéine d'enveloppe portée par la particule (rétro)virale recombinante, et peut provenir des domaines naturels comportant les fonctions de liaison, de 0 fusion et d'ancrage des glycoprotéines d'enveloppe issues des retrovirus(retro) viral comprising the binding, fusion and anchoring functions of the wild envelope glycoprotein from which the envelope glycoprotein carried by the recombinant (retro) viral particle is derived, and can come from natural domains comprising the functions of binding, 0 fusion and anchoring of envelope glycoproteins from retroviruses
MLV-A, GALV, FeLVB, ou des virus tels que adénovirus, herpès virus, virus AAV (Adeno Associated Virus), ou plus généralement de glycoprotéines virales issues de virus d'origine eucaryote, notamment orthomyxovirus (tel que virus influenza) ou paramyxovirus (tel que SV5). 5MLV-A, GALV, FeLVB, or viruses such as adenovirus, herpes virus, AAV virus (Adeno Associated Virus), or more generally viral glycoproteins derived from viruses of eukaryotic origin, in particular orthomyxovirus (such as influenza virus) or paramyxovirus (such as SV5). 5
15. Particule (rétro) virale recombinante selon l'une des revendications 10 à 14, caractérisée en ce que l'extrémité 5 ' de la séquence nucléotidique codant pour le domaine protéique N-terminal (amont) est contiguë à l'extrémité 3' de la séquence nucléotidique codant pour le peptide signal, l'extrémité 3' de la 0 séquence nucléotidique codant pour le domaine protéique N-terminal (amont) est contiguë à l'extrémité 5 ' de la séquence nucléotidique codant pour le peptide, l'extrémité 3 ' de la séquence nucléotidique codant pour le peptide est contiguë à l'extrémité 5 ' de la séquence nucléotidique codant pour le domaine protéique C-terminal (aval).15. Recombinant (retro) viral particle according to one of claims 10 to 14, characterized in that the 5 'end of the nucleotide sequence coding for the N-terminal protein domain (upstream) is contiguous with the 3' end of the nucleotide sequence coding for the signal peptide, the 3 'end of the 0 nucleotide sequence coding for the N-terminal (upstream) protein domain is contiguous with the 5' end of the nucleotide sequence coding for the peptide, l ' the 3 'end of the nucleotide sequence coding for the peptide is contiguous with the 5' end of the nucleotide sequence coding for the C-terminal protein domain (downstream).
2525
16. Acide nucléique codant pour un peptide ou pour une particule recombinante selon l'une quelconque des revendications 10 à 15.16. Nucleic acid coding for a peptide or for a recombinant particle according to any one of claims 10 to 15.
17. Méthode de transfert sélective in vitro ou ex vivo d'un acide nucléique 30 dans des cellules eucaryotes cibles présentes parmi d'autres cellules non-cibles, comprenant l'administration aux cellules cibles et non-cibles d'une particule recombinante (rétro)virale selon l'une des revendications 10 à 15, contenant l'acide nucléique à transférer.17. A method for the selective transfer in vitro or ex vivo of a nucleic acid into target eukaryotic cells present among other non-target cells, comprising the administration to the target and non-target cells of a recombinant particle (retro ) viral according to one of claims 10 to 15, containing the nucleic acid to be transferred.
35 18. Composition pharmaceutique contenant à titre de substance active une particule (rétro)virale selon l'une quelconque des revendications 10 à 15, et contenant également un gène à transférer, en association avec un véhicule pharmaceutique physiologiquement approprié. pharmaceutique physiologiquement approprié. 18. Pharmaceutical composition containing as active substance a (retro) viral particle according to any one of claims 10 to 15, and also containing a gene to be transferred, in association with a physiologically appropriate pharmaceutical vehicle. physiologically appropriate pharmaceutical.
EP97925095A 1996-05-20 1997-05-16 Viral particles which are masked or unmasked with respect to a cell receptor Withdrawn EP0953053A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9606234A FR2748747B1 (en) 1996-05-20 1996-05-20 RECOMBINANT VIRAL PARTICLES COMPRISING A PEPTIDE HAVING MASKING AND UNMASKING PROPERTIES WITH RESPECT TO A BIOLOGICAL MECHANISM
FR9606234 1996-05-20
PCT/FR1997/000870 WO1997044474A2 (en) 1996-05-20 1997-05-16 Viral particles which are masked or unmasked with respect to a cell receptor

Publications (1)

Publication Number Publication Date
EP0953053A2 true EP0953053A2 (en) 1999-11-03

Family

ID=9492280

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97925095A Withdrawn EP0953053A2 (en) 1996-05-20 1997-05-16 Viral particles which are masked or unmasked with respect to a cell receptor

Country Status (6)

Country Link
EP (1) EP0953053A2 (en)
JP (1) JP2000511051A (en)
AU (1) AU725632B2 (en)
CA (1) CA2253874A1 (en)
FR (1) FR2748747B1 (en)
WO (1) WO1997044474A2 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2773561A1 (en) * 1998-01-15 1999-07-16 Centre Nat Rech Scient Retroviral glycoprotein envelope proline-rich sequences, mutant and chimeric proteins, useful for gene therapy expression of retroviral vectors
WO2000071578A2 (en) * 1999-05-20 2000-11-30 Cnrs Centre National De La Recherche Scientifique New polypeptides and their use for the rescue of fusion defective virus or retrovirus glycoproteins

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE68918388T2 (en) * 1988-04-21 1995-03-02 Uab Research Foundation BIOELASTOMER WITHOUT ADHESIVE PROPERTY FOR USE IN THE WoundsITE.
US5637481A (en) * 1993-02-01 1997-06-10 Bristol-Myers Squibb Company Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell
ATE263252T1 (en) * 1992-11-09 2004-04-15 Us Health Achievable VECTOR PARTICLES
US5773577A (en) * 1994-03-03 1998-06-30 Protein Polymer Technologies Products comprising substrates capable of enzymatic cross-linking
GB9412844D0 (en) * 1994-06-27 1994-08-17 Medical Res Council Improvements in or relating to therapeutic methods
US5662885A (en) * 1994-07-22 1997-09-02 Resolution Pharmaceuticals Inc. Peptide derived radionuclide chelators

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9744474A2 *

Also Published As

Publication number Publication date
WO1997044474A2 (en) 1997-11-27
CA2253874A1 (en) 1997-11-27
AU3035697A (en) 1997-12-09
JP2000511051A (en) 2000-08-29
FR2748747A1 (en) 1997-11-21
WO1997044474A3 (en) 1998-03-05
AU725632B2 (en) 2000-10-19
FR2748747B1 (en) 1998-08-07

Similar Documents

Publication Publication Date Title
Romano et al. Gene transfer technology in therapy: current applications and future goals
Cosset et al. High-titer packaging cells producing recombinant retroviruses resistant to human serum
EP0840797B1 (en) Methods and means for targeted gene delivery
EP1104482B1 (en) Cell type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins and wild-type envelope fusion proteins
US5869331A (en) Cell type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins and wild-type envelope fusion proteins
EP0769062A2 (en) Novel internal ribosome entry site, vector containing same and therapeutical use thereof
JPH09509329A (en) Compositions and methods targeting gene delivery vehicles
CA2196208A1 (en) Retroviral vectors produced by producer cell lines resistant to lysis by human serum
EP0672129A1 (en) Cell-type specific gene transfer using retroviral vectors containing antibody-envelope fusion proteins
US5858743A (en) Delivery of nucleic acids
US6448390B1 (en) Stable envelope proteins for retroviral, viral and liposome vectors and use in gene drug therapy
EP0786010A1 (en) Cell-type specific gene transfer using retroviral vectors containing antibody-envelope and wild-type envelope-fusion proteins
EP2353389A1 (en) Methods and compositions for treating disorders
WO1997044474A2 (en) Viral particles which are masked or unmasked with respect to a cell receptor
CA2317026A1 (en) Use of a proline-rich sequence to improve the fusogenic character of retroviral envelopes
EP0817860B1 (en) Pseudotyped retroviral particles
Romano et al. Gene transfer technology in therapy: current applications and future goals
JP2005532075A (en) Method for preparing virus particles with modified cell binding activity and use thereof
FR2727429A1 (en) ENCAPSIDATION LINES AND EXPRESSION VECTORS FOR TRANSCOMPLEMENTATION OF DEFECTIVE RETROVIRAL VECTORS
EP1006123A2 (en) Envelope proteins, methods and uses
Chowdhury Retroviral targeting to tumour antigens
CA2524892A1 (en) A purified polypeptide, isolated nucleic acids encoding said polypeptide, vectors and use thereof
Yee Prospects for using retroviral vectors for human gene therapy
AU2004232328B2 (en) Methods and compositions for treating disorders
KUPSCH et al. LSkkkk topicATIN ETUMOR CELLS to enharte their inil

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19981111

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20030925

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040206