Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
  • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P25/00—Drugs for disorders of the nervous system
  • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides

Definitions

• This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and 5 polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention : ⁇ s ⁇ human 7- transmembrane receptor.
• the transme ⁇ Jjrane receptor is a G-protein coupled receptor. More particularly, the 7-
• transmembrane receptor has been putatively identified as a human G-protein pituitary adenylate cyciase activating polypeptide (PACAP) -like receptor for amnesiac like neuropeptides , sometimes hereinaiter referred to as "HCEGH45".
• PACAP pituitary adenylate cyciase activating polypeptide
• G-proteins and/or second messengers e.g., cAMP
• proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins .
• GPC receptors such as
• G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon et al . , 5 Science , 252:802-8, (1991)).
• effector proteins e.g., phospholipase C, adenyl cyclase, and phosphodiesterase
• actuator proteins e.g., protein kinase A and protein kinase C (Simon et al . , 5 Science , 252:802-8, (1991)).
• the effect of hormone binding is activation of an enzyme, adenylate cyclase, inside the cell.
• Enzyme activation by hormones is dependent o the presence of the nucleotide o GTP, and GTP also influences hormone binding.
• a G- protein connects the hormone receptors to adenylate cyclase. G-protein was shown to exchange GTP for bound GDP when activated by hormone receptors. The GTP- carrying form then binds to an activated adenylate
• the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of 0 the signal.
• a PACAP receptor protein purified from bovine cerebrum is disclosed in European Patent Application
• novel polypeptides as well as fragments, analogs and derivatives thereof.
• the polypeptides of the present invention are of human origin.
• novel mature receptor polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
• the receptor polypeptides of the present invention are of human origin.
• nucleic acid molecules encoding the receptor polypeptides of the present invention, ncluding mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof .
• processes for producing such receptor polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequences encoding the receptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides .
• antibodies against such receptor polypeptides comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing nucleic acid sequences encoding the receptor polypeptides of the present invention, under conditions promoting expression of said polypeptides and subsequent recovery of said polypeptides .
• nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the polynucleotide sequences of the present invention.
• diagnostic assays for detecting diseases related to mutations in the nucleic acid sequences encoding such polypeptides and for detecting an altered level of the soluble form of the receptor polypeptides .
• Figure 1 shows the cDNA sequence and the corresponding deduced amino acid sequence of the G- protein coupled receptor of the present invention.
• the standard one-letter abbreviation for amino acids is used. Sequencing was performed using a 373 Automated DNA Sequencer (Applied Biosystems, Inc.) .
• Figure 2 is an illustration of the secondary structural features of the G-protein coupled receptor.
• the first 7 illustrations set forth the regions of the amino acid sequence which are alpha helices, beta sheets, turn regions or coiled regions.
• the boxed areas are the areas which correspond to the region indicated.
• the second set of figures illustrate areas of the amino acid sequence which are exposed to intracellular, cytoplasmic or are membrane-spanning.
• the • hydrophilicity plot illustrates areas of the protein sequence which are the lipid bilayer of the membrane and are, therefore, hydrophobic, and areas outside the lipid bilayer membrane which are hydrophilic.
• the antigenic index corresponds to the hydrophilicity plot, since antigenic areas are areas outside the lipid bilayer membrane and are capable of binding antibodies.
• the surface probability plot further corresponds to the antigenic index and the hydrophilicity plot.
• the amphipathic plots show those regions of the protein sequences which are polar and non- polar.
• the flexible regions correspond to the second set of illustrations in the sense that flexible regions are those which are outside the membrane and inflexible regions are transmembrane regions .
• Figure 3 illustrates an amino acid alignment of the G-protein coupled receptor of the present invention and rat PACAP- like receptor.
• nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as A ⁇ CC Deposit No. 97132 on April 28, 1995.
• the polynucleotide of this invention was discovered i: a cDNA library derived from human cerebellum tissue. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 874 amino acid residues. The protein exhibits the highest degree of homology to rat PACAP-like receptor with 22.910% identity and 48.607% similarity.
• the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
• the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (antisense) strand.
• the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of ' the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
• the polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5 ' and/or 3 ' of the coding sequence for the mature polypeptide.
• polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
• the present invention further relates to variants of the hereinabove described polynucleotides which encode fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
• the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non- naturally occurring variant of the polynucleotide.
• the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
• Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
• the polynucleotide may have a coding sequence which is a naturally occurring ailelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone.
• an ailelic variant is .an alternate form o - a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide .
• the polynucleotides may also encode a soluble form of the receptor polypeptide which comprises the extracellular portion of the polypeptide minus the transmembrane portion and the intracellular portion.
• the present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell.
• the polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
• the polynucleotides may also encode a proprotein which is the mature protein plus additional 5' amino acid residues.
• a mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
• the polynucleotide of the present invention may encode a mature protein, or a protein having a prosequence or a protein having both a prosequence and a resequence (leader sequence) .
• the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
• the marker sequence may be, for example, a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e . g.
• the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al . , Cell , 37 : 167 (1984)).
• gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons) .
• Fragments of the full length HCEGH45 gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity.
• Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases.
• the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete HCEGH45 gene including regulatory and pro otor regions, exons, and introns.
• An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an- oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
• the present invention further relates to polynucleotides which hybridize to the hereinabove- described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequences.
• the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides.
• stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
• polypeptides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure 1 (SEQ ID N0:1) or the deposited cDNA(s) .
• the polynucleotide may have at least 20 bases, preferably 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the pre ⁇ e ⁇ c invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity.
• such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:l, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
• the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO: 2 as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases and to polypeptides encoded by such polynucleotides .
• the deposit (s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
• the sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
• a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
• the present invention further relates to a G-protein coupled receptor polypeptide which nas the deduced amino acid sequence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
• fragment when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which either retains substantially the same biological function or activity as such polypeptide, i.e. functions as a G- protein coupled receptor, or retains the ability to bind the ligand or the receptor even though the polypeptide does not function as a G-protein coupled receptor, for example, a soluble form of the receptor.
• An analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
• the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide .
• the fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature
• polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
• isolated means that the material is removed from its original environment ⁇ e . g. , the natural environment if it is naturally occurring) .
• a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
• Such polynucleotides could be part of a vector ' and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment .
• polypeptides of the present invention include the polypeptide of SEQ ID. NO : 2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO : 2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO : 2 and still more preferably at least 95% similarity (scill more preferably at least 95% identity) to the polypeptide of SEQ ID NO : 2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
• similarity between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
• Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
• the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
• Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
• the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
• the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the HCEGH45 genes.
• the culture conditions, s -h as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
• the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
• the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
• Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e . g. , derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies .
• any other vector may be used as long as it is replicable and viable in the host.
• the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
• the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
• the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence (s) (promoter) to direct mRNA synthesis.
• s expression control sequence
• promoter promoter
• LTR or SV40 promoter the E. coll . lac or trp
• phage lambda P L promoter the phage lambda P L promoter
• the expression vector also contains a ribosome binding site for translation initiation - and a transcription terminator.
• the vector may also include appropriate sequences for amplifying expression.
• the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli .
• the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
• appropriate hosts " there may be mentioned: bacterial cells, such as E. coli , Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenovirus plant cells, etc.
• bacterial cells such as E. coli , Streptomyces, Salmonella typhimurium
• fungal cells such as yeast
• insect cells such as Drosophila and Spodoptera Sf9
• animal cells such as CHO, COS or Bowes melanoma
• adenovirus plant cells etc.
• the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
• the present invention also includes recombinant constructs compris L.ig one or more of the sequences as broadly described above.
• the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention har been inserted, in a forward or reverse orientation.
• the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
• suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example.
• Bacterial pQE70, pQE60, pQE-9 (Qiagen) , pbs, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene) ; ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
• Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3 , pBPV, pMSG, pSVL (Pharmacia) .
• any other plasmid or vector may be used as long as they are replicable and viable in the host.
• Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
• Two appropriate vectors are PKK232-8 and PCM7.
• Particular named bacterial promoters include lad, lacZ, T3 , T7 , gpt , lambda P R , P L and trp .
• Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I . Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
• the present invention rel-ices to host cells containing the above-described constructs.
• the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast ceil, or the host cell can be a prokaryotic cell, such as a bacterial cell.
• Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation. (Davis et al . , Basic Methods in Molecular Biology, Elsevier, NY (1986) ) .
• constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
• the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
• Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook et al . , Molecular Cloning: A Labora tory Manual , Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference .
• Enhancers are cis-acting elements of DNA, usually about from 10 to 30C b that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
• recombinant expression ' vectors will include origins of replication and selectable markers permitting transformation of the host cell, e . g. , the ampicillin resistance gene of E. coli and S . cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence .
• promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK) , -factor, acid phosphatase, or heat shock proteins, among others.
• PGK 3-phosphoglycerate kinase
• -factor acid phosphatase
• heat shock proteins among others.
• the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
• the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e . g. , stabilization or simplified purification of expressed recombinant product.
• Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
• the 'J vector will comprise one or nore phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
• Suitable prokaryotic hosts for transformation include E. coli , Bacillus
• J 5 subtilis Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
• 20 expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322
• Such commercial vectors include, for example,
• pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
• the selected promoter is induced by appropriate means ⁇ e . g. , temperature shift or chemical induction) and cells are cultured for an additional period.
• Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
• Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
• mammalian cell culture systems can also be employed to express recombinant protein.
• mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell , 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3 , CHO, HeLa and BHK cell lines.
• Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5 ' flanking nontranscribed sequences .
• DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
• the G-protein coupled receptor polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography
• HPLC HPLC
• polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) . Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue .
• polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
• the G-protein coupled receptor of the present invention may be employed in a process for screening for antagonists and/or agonists for the receptor.
• screening procedures involve providing appropriate cells which express the receptor on the surface thereof.
• a polynucleotide encoding the receptor of the present invention is employed to transfect cells to thereby express the G- protein coupled receptor. Such transfection may be accomplished by procedures as hereinabove described.
• such assay may be employed for screening for a receptor antagonist by contacting the melanophore cells which encode the G-protein coupled receptor with both the receptor ligand and a compound to be screened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i . e . , inhibits activation of the receptor.
• the screen may be employed for determining an agonist by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor.
• G-protein coupled receptor for example, transfected CHO cells
• Other screening techniques include the use of cells which express the G-protein coupled receptor (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science, ⁇ 246 : 181 -296 (October 1989).
• potential agonists or antagonists may be contacted with a cell which expresses the G-protein coupled receptor and a second messenger response, e . g. signal transduction or pH changes, may be measured to determine whether the potential agonist or antagonist is effective.
• Another such screening technique involves introducing RNA encoding the G-protein coupled receptor into xenopus oocytes to transiently express tb:- receptor.
• the receptor oocytes may then be contacted in the case of antagonist screening with the receptor ligand and a compound to be screened, followed by detection of inhibition of a calcium signal.
• Another screening technique involves expressing the G-protein coupled receptor in which the receptor is linked to a phospholipase C or D.
• a phospholipase C or D As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells, etc.
• the screening for an antagonist or agonist may be accomplished as hereinabove described by detecting activation of the receptor or inhibition of activation of the receptor from the phospholipase second signal.
• Another method involves screening for antagonists by determining inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof.
• Such a method involves transfecting a eukaryotic cell with DNA encoding the G-protein coupled receptor such that the cell expresses the receptor on its surface and contacting the cell with a potential antagonist in the presence of a labeled form of a known ligand.
• the ligand can be labeled, e . g. , by radioactivity.
• the amount of labeled ligand bound to the receptors is measured, e . g. , by measuring radioactivity of the receptors. If the potential antagonist binds to the receptor as determined by a reduction of labeled ligand which binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
• the present invention also provides a method for determining whether a ligand not known to be capable of binding to a G-protein coupled receptor can bind to such receptor which comprises contacting a mammalian cell which expresses a G-protein coupled receptor with the ligand under conditions permitting binding of ligands to the G-protein coupled receptor, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the G-protein coupled receptor.
• the systems hereinabove described for determining agonists and/or antagonists may also be employed for determining ligands which bind to the receptor.
• antagonists for G-protein coupled receptors which are determined by screening procedures may be employed for a variety of therapeutic purposes.
• such antagonists have been employed for treatment of hypertension, angina pectoris, myocardial infarction, ulcers, asthma, allergies, psychoses, depression, migraine, vomiting, and benign prostatic hypertrophy.
• Agonists for G-protein coupled receptors are also useful for therapeutic purposes, such as the treatment of asthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis.
• a potential antagonist is an antibody, or in some cases an oligonucleotide, which binds to the G-protein coupled receptor but does not elicit a second messenger response such that the activity of the G-protein coupled receptor is prevented.
• Potential antagonists also include proteins which are closely related to the ligand of the G-protein coupled receptor, i.e. a fragment of tha ligand, which have lost biological function and when binding to the G-protein coupled receptor, elicit no response.
• a potential antagonist also includes an antisense construct prepared through the use of antisense technology.
• Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
• the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
• a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al . , Nucl . Acids
• the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the G-protein coupled receptor (antisense - Okano, J " . Neurochem . ,
• oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of G- protein coupled receptor.
• Another potential antagonist is a small molecule which binds to the G-protein coupled receptor, making it inaccessible to ligands such that normal biological activity is prevented.
• small molecules include but are not limited to small peptides or peptide- like molecules.
• Potential antagonists also include a soluble form of a G-protein coupled receptor, e . g. a fragment of the receptor, which binds to the ligand and prevents the ligand from interacting with membrane bound G-protein coupled receptors.
• the G-protein coupled receptor of the present invention has been putatively identified as a PACAP-like or secretin receptor. This identification has been made as a result of amino acid sequence ho ology.
• the antagonists may be used to treat hypersecretory conditions and to create pharmacological amnesia or effect long-term memory.
• the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e . g. , as hereinafter described.
• the agonists identified by the screening method as described above may be employed to treat hyposecretory conditions, to improve memory, to treat amnesia and prevent nerve cell death in neuropathy to prevent and/or treat diseases such as Alzheimer's disease.
• compositions comprise a therapeutically effective amount of the polypeptide, -xnd.
• a pharmaceutically acceptable carrier or excipient includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
• the formulation should suit the mode of administration.
• the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
• a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
• Associated with such container (s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
• the polypeptides or agonists or antagonists of the present invention may be employed in conjunction with other therapeutic compounds.
• the pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal , intramuscular, subcutaneous, intranasal or intradermal routes.
• the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
• the pharmaceutical compositions will be administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
• This invention also provides a method of detecting expression of a HCEGH45 receptor polypeptide of the present invention on the surface of a cell by detecting the presence of mRNA coding for the receptor which comprises obtaining total mRNA from the cell and contacting the mRNA so obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions, detecting the presence of mRNA hybridized to the probe, and thereby detecting the expression of the receptor by the cell.
• the present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. These related receptors may be identified by homology to a HCEGH45 receptor polypeptide of the present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the neuropeptide receptor polypeptides of the present invention.
• HCEGH45 receptor polypeptides and antagonists or agonists which are polypeptides may be employed in accordar-ce with the present invention by expression of such polypeptides in vivo, which is often referred to as
• cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
• a polynucleotide DNA or RNA
• cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
• cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
• a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo .
• the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
• Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
• the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus .
• the vector includes one or more promoters .
• Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al . , Biotechniques . Vol. 7, No. 9, 980-990
• any other promoter e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ⁇ -actin promoters.
• viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters.
• TK thymidine kinase
• B19 parvovirus promoters The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
• the nucleic acid sequence encoding the polypeptide " of the present invention is under the control of a suitable promoter.
• Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or hetorologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the
• CMV cytomegalovirus
• RSV respiratory syncytial virus
• inducible promoters such as the MMT promoter, the metallothionein promoter
• heat shock promoters such as the albumin promoter
• the ApoAI promoter human globin promoters
• viral thymidine kinase promoters such as the
• Herpes Simplex thymidine kinase promoter Herpes Simplex thymidine kinase promoter; retroviral LTRs
• the promoter also may be the native promoter which controls the genes encoding the polypeptides .
• the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
• packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2, ⁇ -AM, PA12, T19-14X, VT-19-17-H2, ⁇ CRE, ij/CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy. Vol. 1, pgs . 5- 14 (1990) , which is incorporated herein by reference in its entirety.
• the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation.
• the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host .
• the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence (s) encoding the polypeptides.
• retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo .
• the transduced eukaryotic cells will express the nucleic acid sequence (s) encoding the polypeptide.
• Eukaryotic cells which may be trans u ed include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes , endothelial cells, and bronchial epithelial cells.
• the present invention also contemplates the use of the genes of the present invention as a diagnostic, for example, some diseases result from inherited defective genes . These genes can be detected by comparing the sequences of the defective gene with that of a normal one. Subsequently, one can verify that a "mutant" gene is associated with abnormal receptor activity. In addition, one can insert mutant receptor genes into a suitable vector for expression in a functional assay system (e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells) as yet another means to verify or identify mutations. Once "mutant" genes have been identified, one can then screen population for carriers of the "mutant" receptor gene.
• a functional assay system e.g., colorimetric assay, expression on MacConkey plates, complementation experiments, in a receptor deficient strain of HEK293 cells
• Nucleic acids used for diagnosis may be obtained from a patient's cells, including but not limited to such as from blood, urine, saliva, tissue biopsy and autopsy material .
• the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki, et al . , Nature, 324 : 163 - 166 1986) prior to analysis.
• RNA or cDNA may also be used for the same purpose.
• PCR primers complimentary to the nucleic acid of the instant invention can be used to identify and analyze mutations in the gene of the present invention.
• deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
• Point mutations can be identified by hybridizing amplified DNA to radio labeled RNA of the invention or alternatively, radio labeled antisense DNA sequences of the invention. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures. Such a diagnostic would be particularly useful for prenatal or even neonatal testing.
• Sequence differences between the reference gene and "mutants" may be revealed by the direct DNA sequencing method.
• cloned DNA segments may be used as probes to detect specific DNA segments.
• the sensitivity of this method is greatly enhanced when combined with PCR.
• a sequence primer is used with double stranded PCR product or a single stranded template molecule generated by a modified PCR.
• the sequence determination is performed by conventional procedures with radio labeled nucleotide or by an automatic sequencing procedure with fluorescent-tags.
• DNA sequence differences may be achieved by detection of alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents . Sequences changes at specific locations may also be revealed by nucleus protection assays, such RNase and SI protection or the chemical cleavage method (e.g. Cotton, et al . , PNAS . USA. 85:4397- 4401 1985) .
• genes of the present invention can be used as a reference to identify individuals expressing a decrease of functions associated with receptors of this type.
• the present invention also relates to a diagnostic assay for detecting altered levels of soluble forms of the HCEGH45 receptor polypeptides of the present invention in various tissues.
• Assays used to detect levels of the soluble receptor polypeptides in a sample derived from a host are well known to those of skill in the art and include radioimmunoassays , competitive- binding assays, Western blot analysis and preferably as ELISA assay.
• An ELISA assay initially comprises preparing an antibody specific to antigens of the HCEGH45 receptor polypeptides, preferably a monoclonal antibody.
• a reporter antibody is prepared against the monoclonal antibody.
• a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme .
• a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample . Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
• the monocloncs.1 antibody is incubated in the dish during which time the monoclonal antibodies attach to any HCEGH45 receptor proteins attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
• the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to HCEGH45 receptor proteins. Unattached reporter antibody is then washed out.
• Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of HCEGH45 receptor proteins present in a given volume of patient sample when compared against a standard curve.
• sequences of the present invention are also valuable for chromosome identification.
• the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
• Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
• the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
• sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment .
• PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
• sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
• Other mapping strategies that can similarly be used to map to its chromosome include in si tu hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
• Fluorescence in si tu hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
• FISH Fluorescence in si tu hybridization
• a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb) .
• polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
• These antibodies can be, for example, polyclonal or monoclonal antibodies.
• the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
• Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
• any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Na ture, 256 : 495 -491 , (1975)), the trioma technique, the human B-cell hybridoma technique (Kozbor et al . , Immunology Today 4 : 12 , (1983)), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al . , in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96, (1985)). Techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
• Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
• the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
• equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
• “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
• the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
• For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
• For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
• Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel et al., Nucleic Acids Res . , 8:4057 (1980) .
• Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated .
• Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis et al . , Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
• ligase T4 DNA ligase
• HCEGH45-HA The expression of plasmid, HCEGH45-HA is derived from a vector pcDNAl/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
• a DNA fragment encoding the entire HCEGH45 precursor and a HA tag fused in frame to its 3 ' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
• the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (Wilson et al . , Cell 37 : 161 , 1984) .
• the infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
• the plasmid construction strategy is described as follows :
• the DNA sequence encoding HCEGH45 was constructed by PCR was cloned using two primers : the 5 ' primer GGCTTCCTCGAATCCCGTCATGAACTCC (SEQ ID NO: 4) contains an EcoRI site followed by 9 nucleotides of HCEGH45 coding sequence starting from the initiation c o d o n ; t h e 3 ' s e q u e n c e GGGTTCTCGAGCGGGCACTGCTCACAGAGGAGACG (SEQ ID NO : 5 ) contains complementary sequences to an Xhol site, translation stop codon, HA tag and the last 11 nucleotides of the HCEGH45 coding sequence (not including the stop codon) .
• the PCR product contains an EcoRI site, HCEGH45 coding sequence, a translation termination stop codon and an Xhol site.
• the PCR amplified DNA fragment and the vector, pcDNAI/Amp were digested with EcoRI and Xhol restriction enzyme and ligated.
• the ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and xamined by restriction analysis for the presence of the correct fragment.
• HCEGH45 For expression of the recombinant HCEGH45, COS-7 cells were transfected with the expression vector by DEAE-DEXTRAN method. (Sambrook et al . , Molecular Cloning: A Laboratory Manual , Second Edition, Cold Spring Laboratory Press, (1989)). The expression of the HCEGH45-HA protein was detected by radiolabelling and immunoprecipitation method. (Harlow and Lane, Antibodies : A Laboratory Manual , Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 35 S-cysteine two days post transfection.
• the 5 ' primer has the sequence GTGCGTCCCGGCTTCCTCAG ⁇ CCGCCATCATGAACTCC (SEQ ID NO: 6) and contains a Smal restriction enzyme site (in bold) followed by 17 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, J " . Mol . Biol . 196 : 941 - 950 (1987), and just behind the first 9 nucleotides of the HCEGH45 gene (the initiation codon for translation "ATG” is underlined) .
• the 3 ' primer has the sequence CGGGTACCAGAGCGGGCA CTGCTCACAGAGGAGACG (SEQ ID NO: 7) and contains the cleavage site for the restriction endonuclease Asp718 and 13 nucleotides complementary to the 3 ' non-translated sequence of the HCEGH45 gene.
• the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ( "Geneclean, " BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonucleases Smal and Asp718 and then purified as described above. This fragment is designated F2.
• the vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the HCEGH45 protein using the baculovirus expression system (for review see: Summers and Smith, A Manual of Methods for Baculovirus Vectors and Insect Cell Cul ture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555, 1987) .
• This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases Smal and Asp718.
• the polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation.
• beta-galactosidase gen- from ⁇ . coii is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene .
• the polyhedrin sequences are flanked at both sides by viral sequences for the cell -mediated homologous recombination of co-transfected wild-type viral DNA.
• Many other baculovirus vectors could be used in place of pRGl such as pAc373, pVL94l and pAcIMl
• the plasmid was digested with the restriction enzymes
• V2 Smal and Asp718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
• the DNA was then isolated from a 1% agarose gel as described above. This vector DNA is designated V2.
• Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
• E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBac-HCEGH45) with the HCEGH45 gene using the enzymes Smal and Asp718.
• the sequence of the cloned fragment was confirmed by DNA sequencing.
• 5 ⁇ g of the plasmid pBac-HCEGH45 were co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus ( "BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA. ) using the lipofection method (Feigner et al . , Proc . Na tl . Acad . Sci . USA, 84 : 1413 - 1411 (1987)) .
• the plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace ' s insect medium supplemented with 10% fetal calf serum was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
• plaque assay performed similar as described by Summers and Smith (supra) .
• an agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques.
• a detailed description of a "plaque assay” can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10 .
• the agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 ⁇ l of Grace's medium.
• the agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4°C.
• Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS .
• the cells were infected with the recombinant baculovirus V-HCEGH45 at a multiplicity of infection (MOI) of 2.
• MOI multiplicity of infection
• the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg) .
• the cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography .
• RNAzolTM B system Northern blot analysis is carried out to examine the levels of expression of HCEGH45 in human tissues.
• Total cellular RNA samples are isolated with RNAzolTM B system
• RNA isolated from each human tissue specified is separated on 1% agarose gel and blotted onto a nylon filter. (Sambrook, Fritsch, and Maniatis, Molecular Cloning, Cold Spring
• the labeling reaction is done according to the Stratagene Prime- It kit with 50ng DNA fragment.
• the labeled DNA is purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road,
• the filter is then hybridized with radioactive labeled full length HCEGH45 gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at
• RNA for HCEGH45 is abundant in human cerebellum tissue.
• Fibroblasts are obtained from a subject by skin biopsy.
• the resulting tissue is placed in ' tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
• the flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37°C for approximately one week. At this time, fresh media is added and subsequently changed every several days.
• fresh media e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin
• pMV-7 (Kirschmeier, P.T. et al . , DNA, 7:219-25 " (1988)) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindiII and subsequently treated with calf intestinal phosphatase.
• the linear vector is fractionated on agarose gel and purified, using glass beads.
• the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively.
• the 5' primer contains an EcoRI site and the ' primer further includes a HindiII site.
• Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindiII fragment are added together, in the presence of T4 DNA ligase.
• the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
• the ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
• the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS) , penicillin and streptomycin.
• DMEM Dulbecco's Modified Eagles Medium
• CS calf serum
• the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells) .
• Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
• the spent media, containing the infectious viral particles is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
• Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be inf ct ad and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his .
• the engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads .
• the fibroblasts now produce the protein product.
• ADDRESSEE HUMAN GENOME SCIENCES, INC.
• MOLECULE TYPE DNA (genomic)
• ATC CAT GCC AAT GTG GCA GCC GCC CTG GGG GTG GCA GAG CTC CTC TTC 664 He His Ala Asn Val Ala Ala Ala Leu Gly Val Ala Glu Leu Leu Phe 140 145 150
• MOLECULE TYPE protein
• SEQUENCE DESCRIPTION SEQ ID NO : 2 :
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)
• MOLECULE TYPE DNA (genomic)

Landscapes

• Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biomedical Technology (AREA)
• Neurosurgery (AREA)
• Neurology (AREA)
• Medicinal Chemistry (AREA)
• General Chemical & Material Sciences (AREA)
• Cell Biology (AREA)
• Biophysics (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Endocrinology (AREA)
• Toxicology (AREA)
• Zoology (AREA)
• Immunology (AREA)
• Hospice & Palliative Care (AREA)
• Biochemistry (AREA)
• Genetics & Genomics (AREA)
• Psychiatry (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Gastroenterology & Hepatology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=21863572

Family Applications (1)

Country Status (5)

Families Citing this family (3)

Family Cites Families (3)

• 1997
  • 1997-11-21 WO PCT/US1997/020547 patent/WO1998024900A1/en not_active Application Discontinuation
  • 1997-11-21 JP JP52559098A patent/JP2001505433A/ja active Pending
  • 1997-11-21 AU AU76253/98A patent/AU7625398A/en not_active Abandoned
  • 1997-11-21 CA CA002273198A patent/CA2273198A1/en not_active Abandoned
  • 1997-11-21 EP EP97949398A patent/EP0941327A1/de not_active Withdrawn

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events