EP0880361A1 - Immunogene entoxifizierte mutanten des choleratoxins - Google Patents

Immunogene entoxifizierte mutanten des choleratoxins

Info

Publication number
EP0880361A1
EP0880361A1 EP97902552A EP97902552A EP0880361A1 EP 0880361 A1 EP0880361 A1 EP 0880361A1 EP 97902552 A EP97902552 A EP 97902552A EP 97902552 A EP97902552 A EP 97902552A EP 0880361 A1 EP0880361 A1 EP 0880361A1
Authority
EP
European Patent Office
Prior art keywords
amino acid
protein
immunogenic
dna
immunogenic detoxified
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97902552A
Other languages
English (en)
French (fr)
Inventor
Maria Rita Fontana
Mariagrazia Pizza
Rino Rappuoli
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GSK Vaccines SRL
Original Assignee
Chiron SRL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chiron SRL filed Critical Chiron SRL
Publication of EP0880361A1 publication Critical patent/EP0880361A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
    • C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
    • C07K16/1239—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Vibrionaceae (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/28—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Vibrionaceae (F)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the present invention relates to immunogenic detoxified proteins of cholera toxin (CT) wherein at least one amino acid is substituted with another amino acid with the result that, in purified form, the immunogenic detoxified protein exhibits a residual toxicity greater than 10000 fold lower than its naturally occuring counterpart and to their use in vaccines which are useful for the prevention or treatment of cholera and as mucosal adjuvants for other immunogenic proteins.
  • CT cholera toxin
  • the detoxified immunogenic proteins can be suitably produced using recombinant DNA techniques by site- directed mutagenesis of DNA encoding the wild type toxins.
  • Cholera is a contagious disease widely distributed in the world, in particular in the Third World, where, in certain areas, it is endemic. The serious disorders which develop in the intestinal system prove fatal in a high percentage of the recorded cases of the disease.
  • the etiological agent of cholera is the Gram-negative microorganism Vibrio cholerae (V . cholerae) .
  • V . cholerae The Gram-negative microorganism
  • the principal syroptom is severe diarrhoea as a result of which the patient can lose as much as 10-15 litres of liquids per day via the faeces. As a result of the severe dehydration and loss of electrolytes, the patient does not withstand the infection in 50-60% of cases, and dies.
  • the diarrhoea caused by V The diarrhoea caused by V .
  • cholerae is due to the secretion of cholera toxin, CT, which acts by stimulating the activity of the adenylate cyclase enzyme so as to induce disturbances at cell level.
  • CT cholera toxin
  • cholera can be effectively cured by controlled and intense rehydration, the distribution of a vaccine is desirable with a view to complete control and future eradication of the disease.
  • the CT toxin comprises a single A subunit (or protomer A) responsible for the enzymic activity of the toxin (herein CT-A) and five identical B subunits (or protomer B) which are involved in the binding of the toxin to the intestinal epithelial cells (herein CT-B) .
  • the A subunit penetrates the cell membrane and causes activation of adenylate cyclase by NAD-dependent ADP- ribosylation of a GTP-binding protein which controls the activity of the enzyme.
  • the clinical effect of this is to cause massive fluid loss into the intestine.
  • Burnette, W.N. et al (Inf. and Immun. 59 dl) . 4266-4270, (1991)) describe site-specific mutagenesis of CT-A to produce an Arg-7-Lys mutation paralleling that of a known detoxifying mutation in the A subunit of the Bordetella pertussis toxin.
  • the mutation resulted in the complete abolition of detectable ADP-ribosyltransferase activity.
  • the amino acid sequence may include other mutations such as, for example, substitutions at one or more of Arg-7 , Asp-9, Arg-ll, His- 44, Arg-54, Ser-61, His-70, His-107, Glu-110, Glu-112 , Ser- 114, Trp-127, Arg-146 or Arg-192. These mutations are described as being completely detoxified as measured by the assays described.
  • a double mutant comprising the amino acid sequence of CT-A or a fragment thereof is described in UK patent application 9513371.6 (filed 30th June 1995) wherein the amino acids at, or in positions corresponding to, Ser-63 and Arg-192 are replaced with another amino acid.
  • mutant protein Although detoxified in the sense of having a much lower toxicity than the wild-type protein, these proteins retain traces of enzymatic activity.
  • the mutation causes a decrease of in vivo toxicity of at least 10000 fold and this makes the protein very useful for human use.
  • the mutant protein In addition to the immunological and adjuvant properties typical of mutants devoid of enzymatic activity, the mutant protein surprisingly exhibits an increase in adjuvant activity.
  • an immunogenic detoxified protein comprising the amino acid sequence of subunit A of a cholera toxin (CT-A) or a fragment thereof wherein at least one amino acid is substituted with another amino acid characterised in that, in purified form, the immunogenic detoxified protein exhibits a residual toxicity greater than 10000 fold lower than its naturally occuring counterpart.
  • CT-A cholera toxin
  • the immunogenic detoxified protein according to the present invention exhibits a carefully selected balance of toxicity maximising the immunogenicity and/or adjuvant effects of the protein whilst maintaining a sufficiently low toxicity to be tolerated by the immunised individual.
  • amino acid at, or in a position corresponding to, Pro-106 is replaced with another amino acid.
  • references to CT encompass the various naturally occurring strain variants as well other variants encompassing changes from the sequences disclosed herein which do not affect the immunogenicity of the assembled toxoid.
  • the amino acid sequences for CT are definitively described in Do enighini et al Molecular Microbiology (1995) 15 (6) 1165-1167.
  • the amino acid substituted for the wild type amino acid may be a naturally occurring amino acid or may be a modified or synthetic amino acid, provided that the mutant retains the necessary immunogenic properties and exhibits a greater than 10 000 fold reduction in toxicity relative to the naturally occuring counterpart.
  • the substitution may involve deletion or addition of one or more amino acids.
  • the term "detoxified” means that the immunogenic composition exhibits greater than 10 000 fold reduction in toxicity relative to its naturally occurring toxin counterpart. The reduction in toxicity should be sufficiently low for the protein to be used in an immunogenic composition in an immunologically effective amount as a vaccine with causing significant side effects.
  • residual toxicity means that the detoxified immunogenic protein retains a measurable toxicity. More particularly the level of toxicity is o p t i m i s e d b y b a l a n c i ng i n c r e a s e d immunogenicity/adjuvanticity against the toxic effects of administration in a benefit/side effect trade-off.
  • the residual toxicity of the immunogenic composition is greater than 10 000 fold reduced relative to its natural occurring counterpart, preferably greater than 30 000 fold and most preferably greater than 50 000 fold.
  • the toxicity may be measured in mouse CHO cells or preferably by the rabbit ileal loop assay or by evaluation of the morphological changes induced in Yl cells.
  • the toxicity of the immunogenic composition is reduced relative to its natural occurring counterpart by about 30 000 fold as measured by the evaluation of the morphological changes induced in Yl cells or 10 000 fold as measured by the rabbit ileal loop assay.
  • toxoid means a genetically detoxified toxin.
  • the immunogenic protein may be a CT subunit A toxoid, but is preferably an assembled toxin molecule comprising a mutated CT-A subunit and five B subunits of CT.
  • the B subunit may be a naturally occurring subunit or may itself be mutated.
  • the immunogenic protein is preferably a naturally occurring CT-A suitably modified as described above. However, conservative amino acid changes may be made which do not affect the immunogenicity or the toxicity of immunogenic protein and preferably do not affect the ability of the immunogenic protein to form complete toxin with B subunit protein. Also, the immunogenic protein may be a fragment of CT-A provided that the fragment is immunogenic and non toxic and contains at least one of the conserved regions containing one of the mutations according to the invention.
  • Pro-106 is replaced with Ser-106.
  • an immunogenic composition for use as a vaccine comprising an immunogenic detoxified protein of the first aspect of the invention and a pharmaceutically acceptable carrier.
  • the invention also provides a vaccine composition
  • a vaccine composition comprising an immunogenic detoxified protein according to the first aspect of the invention and a pharmaceutically acceptable carrier.
  • the vaccine composition may further comprise an adjuvant.
  • the vaccine composition may comprise a second antigen capable of raising an immunological response to another disease.
  • the immunogenic detoxified protein acts as a mucosal adjuvant.
  • a method of vaccinating a mammal against Vibrio cholerae comprising administering an immunologically effective amount of an immunogenic detoxified protein according to the first aspect of the invention.
  • the immunogenic detoxified protein of the invention may act as an adjuvant for a second immunogenic protein administered separately, sequentially or with the immunogenic detoxified protein of the invention.
  • the immunogenic detoxified proteins of the invention may be synthesised chemically using conventional peptide synthesis techniques, but are preferably produced by recombinant DNA means.
  • a DNA sequence encoding an immunogenic detoxified protein according to the first aspect of the invention is provided.
  • the DNA sequence contains a DNA sequence encoding a complete CT comprising DNA encoding both the detoxified subunit A and subunit B in a polycistronic unit.
  • the DNA may encode only the detoxified subunit A.
  • a vector carrying a DNA according to the fourth aspect of the invention.
  • a host cell line transformed with the vector according to the fifth aspect of the invention.
  • the host cell may be any host capable of producing CT or but is preferably a bacterium, most suitably E . coli or V.cholerae suitably engineered to produce the desired immunogenic detoxified protein.
  • the host cell may itself provide a protective species, for example a V . cholerae strain mutated to a phenotype lacking wild type CT and carrying and expressing an immunogenic detoxified protein of the first aspect of the invention.
  • a protective species for example a V . cholerae strain mutated to a phenotype lacking wild type CT and carrying and expressing an immunogenic detoxified protein of the first aspect of the invention.
  • the host cell is capable of expressing a chromosomal CT-A gene according to the first aspect of the invention.
  • a process for the production of an immunogenic detoxified protein according to the first aspect of the invention comprising culturing a host cell according to the sixth aspect of the invention.
  • a process for the production of DNA according to the fourth aspect of the invention comprising the steps of subjecting a DNA encoding a CT-A or a fragment thereof to site-directed mutagenesis.
  • a process for the formulation of a vaccine comprising bringing an immunogenic detoxified protein according to the first aspect of the invention into association with a pharmaceutically acceptable carrier and optionally with an adjuvant.
  • the immunogenic detoxified protein of the invention constitutes the active component of a vaccine composition useful for the prevention and treatment of cholera infections.
  • the immunogenic detoxified protein may also be used in a vaccine composition as a mucosal adjuvant.
  • the compositions are thus applicable for use in the pharmaceutical industry.
  • a significant advantage of producing the immunogenic detoxified protein by recombinant DNA techniques rather than by isolating and purifying a protein from natural sources is that equivalent quantities of the protein can be produced by using less starting material than would be required for isolating the protein from a natural source.
  • Producing the protein by recombinant techniques also permits the protein to be isolated in the absence of some molecules normally present in cells. Indeed, protein compositions entirely free of any trace of human protein contaminants can readily be produced because the only human protein produced by the recombinant non-human host is the recombinant protein at issue. Potential viral agents from natural sources and viral components pathogenic to humans are also avoided. Also, genetically detoxified toxin are less likely to revert to a toxic from than more traditional, chemically detoxified toxins.
  • Pharmaceutically acceptable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition.
  • Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes) and inactive virus particles.
  • Such carriers are well known to those of ordinary skill in the art. Additionally, these carriers may function as immunostimulating agents (adjuvants) .
  • Preferred adjuvants to enhance effectiveness of the compo ⁇ sition include, but are not limited to: aluminum salts (alum) such as aluminium hydroxide, aluminium phosphate, aluminium sulfate etc., oil emulsion formulations, with or without other specific immunostimulating agents such as muramyl peptides or bacterial cell wall components, such as for example (1) MF59 (Published International patent application WO-A-90/14837, containing 5% Squalene, 0.5% Tween® 80, 0.5% Span® 85 (optionally containing various amounts of MTP-PE (see below) , although not required) formulated into submicron particles using a microfluidizer such as Model HOY microfluidizer (Microfluidics, Newton, MA 02164), (2) SAF, containing 10% squalene, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (see below) either microfluidized into
  • saponin adjuvants such as Sti ulonTM (Cambridge Bioscience, Worcester, MA) may be used or particles generated therefrom such as ISCOMS (immunostimulating complexes) .
  • ISCOMS immunostain-associated complexes
  • CFA Complete Freunds Adjuvant
  • IFA Incomplete Freunds Adjuvant
  • Alum and MF59 are preferred.
  • the immunogenic detoxified protein of the invention may used as an adjuvant for a second antigen in an immunologically active composition for the treatment or vaccination of the human or animal body.
  • the immunogenic compositions typically will contain diluents, such as water, saline, glycerol, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
  • the immunogenic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.
  • the preparation also may be emulsified or encapsulated in liposomes for enhanced adjuvant effect as discussed above under pharmaceutically acceptable carriers.
  • Immunogenic compositions used as vaccines comprise an immunologically effective amount of the antigenic polypeptides, as well as any other of the above-mentioned components, as needed.
  • immunologically effective amount it is meant that the administration of that amount to an individual, either in a single dose or as part of a series, is effective for treatment or prevention. This amount varies depending upon the health and physical condition of the individual to be treated, the taxonomic group of individual to be treated (e.g., nonhuman primate, primate, etc.), the capacity of the individual's immune system to synthesize antibodies, the degree of protection desired, the formulation of the vaccine, the treating doctor's assessment of the medical situation, and other rel ⁇ evant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.
  • the immunogenic compositions are conventionally administered parenterally, e.g. by injection either subcutaneously or intramuscularly. Additional formulations suitable for other modes of administration include oral and pulmonary formulations, suppositories and transdermal applications. Dosage treatment may be a single dose schedule or a multiple dose schedule.
  • the vaccine may be administered in conjunc ⁇ tion with other immunoregulatory agents.
  • polynucleotide intends a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature, (2) is linked to a polynucleotide other than that to which it is linked in nature, or (3) does not occur in nature.
  • polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA and RNA.
  • a “replicon” is any genetic element, e.g. , a plasmid, a chromosome, a virus, a cosmid, etc. that behaves as an autonomous unit of polynucleotide replication within a cell; i.e., capable of replication under its own control. This may include selectable markers.
  • a “vector” is a replicon in which another polynucleotide segment is attached, so as to bring about the replication and/or expression of the attached segment.
  • Control sequence refers to polynucleotide sequences which are necessary to effect the expression of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence; in eukaryotes, generally, such control sequences include promoters and transcription termination sequence.
  • control sequences is intended to include, at a minimum, all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
  • Operaably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
  • ORF "open reading frame” is a region of a polynucleotide sequence which encodes a polypeptide; this region may represent a portion of a coding sequence or a total coding sequence.
  • a "coding sequence” is a polynucleotide sequence which is translated into a polypeptide, usually via mRNA, when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3 '-terminus.
  • a coding sequence can include, but is not limited to, cDNA, and recombinant polynucleotide sequences.
  • PCR refers to the technique of polymerase chain reaction as described in Saiki, et al., Nature 324:163 (1986); and Scharf et al., Science (1986) 233:1076-1078; and U.S. 4,683,195; and U.S. 4,683,202.
  • x is "heterologous" with respect to y if x is not naturally associated with y in the identical manner; i.e., x is not associated with y in nature or x is not associated with y in the same manner as is found in nature.
  • “Homology” refers to the degree of similarity between x and y.
  • the correspondence between the sequence from one form to another can be determined by techniques known in the art. For example, they can be determined by a direct comparison of the sequence information of the polynucleotide.
  • homology can be determined by hybridization of the polynucleotides under conditions which form stable duplexes between homologous regions (for example, those which would be used prior to S. digestion) , followed by digestion with single-stranded specific nuclease(s) , fol- lowed by size determination of the digested fragments.
  • polypeptide refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not refer to or exclude post expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
  • a polypeptide or amino acid sequence "derived from" a designated nucleic acid sequence refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a portion thereof wherein the portion consists of at least 3-5 amino acids, and more preferably at least 8-10 amino acids, and even more preferably at least 11-15 amino acids, or which is im ⁇ munologically identifiable with a polypeptide encoded in the sequence.
  • This terminology also includes a polypeptide expressed from a designated nucleic acid sequence.
  • the protein may be used for producing antibodies, either monoclonal or polyclonal, specific to the protein.
  • the methods for producing these antibodies are known in the art.
  • Recombinant host cells denote, for example, microorganisms, insect cells, and mammalian cells, that can be, or have been, used as recipients for recombinant vector or other transfer DNA, and include the progeny of the original cell which has been transformed. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. Examples for mammalian host cells include Chinese hamster ovary (CHO) and monkey kidney (COS) cells.
  • CHO Chinese hamster ovary
  • COS monkey kidney
  • cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
  • the term "cell lines” also includes immortalized cells. Preferably, cell lines include nonhybrid cell lines or hybridomas to only two cell types.
  • microorganism includes prokaryotic and eukaryotic microbial species such as bacteria and fungi, the latter including yeast and filamentous fungi.
  • Transformation refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion, for example, direct uptake, transduction, f-mating or electroporation.
  • the exogenous polynucleotide may be maintained as a non-integrated vector, for example, a plasmid, or alternatively, may be integrated into the host genome.
  • genomic is meant a collection or library of DNA molecules which are derived from restriction fragments that have been cloned in vectors. This may include all or part of the genetic material of an organism.
  • cDNA is meant a complementary DNA sequence that hybridizes to a complementary strand of DNA.
  • purified and isolated is meant, when referring to a polypeptide or nucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type.
  • the term “purified” as used herein preferably means at least 75% by weight, more preferably at least 85% by weight, more preferably still at least 95% by weight, and most preferably at least 98% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000, can be present).
  • the appropriate coding sequence can be expressed in a variety of different expression systems; for example those used with mammalian cells, baculoviruses, bacteria, and yeast.
  • a mammalian promoter is any DNA sequence capable of binding mammalian RNA polymerase and initiating the downstream (3') transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiating region, which is usually placed proximal to the 5' end of the coding sequence, and a TATA box, usually located 25-30 base pairs (bp) upstream of the transcription initiation site. The TATA box is thought to direct RNA polymerase II to begin RNA synthesis at the correct site.
  • a mammalian promoter will also contain an upstream promoter element, usually located within 100 to 200 bp upstream of the TATA box.
  • An upstream promoter element determines the rate at which transcription is initiated and can act in either orientation [Sambrook et al. (1989) "Expression of Cloned Genes in Mammalian Cells.” In Molecular Cloning: A Laboratory Manual. 2nd ed. ⁇
  • Mammalian viral genes are often highly expressed and have a broad host range; therefore sequences encoding mammalian viral genes provide particularly useful promoter sequences. Examples include the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP) , and herpes simplex virus promoter.
  • sequences derived from non-viral genes, such as the murine metallotheionein gene also provide useful promoter sequences. Expression may be either constitutive or regulated (inducible) , depending on the promoter can be induced with glucocorticoid in hormone-responsive cells.
  • Enhancer element is a regulatory DNA sequence that can stimulate transcription up to 1000-fold when linked to homologous or heterologous promoters, with synthesis beginning at the normal RNA start site. Enhancers are also active when they are placed upstream or downstream from the transcription initiation site, in either normal or flipped orientation, or at a distance of more than 1000 nucleotides from the promoter [Maniatis et al. (1987) Science 236:1237: Alberts et al. (1989) Molecular Biology of the Cell. 2nd ed.]. Enhancer elements derived from viruses may be particularly useful, because they usually have a broader host range.
  • Examples include the SV40 early gene enhancer [Dijkema et al (1985) EMBO J. 4:7611 and the enhancer/promoters derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus [Gorman et al. (1982b) Proc. Natl. Acad. Sci. 79:67771 and from human cytomegalovirus [Boshart et al. (1985) Cell 41:5211. Additionally, some enhancers are regulatable and become active only in the presence of an inducer, such as a hormone or metal ion [Sassone-Corsi and Borelli (1986) Trends Genet. 2:215; Maniatis et al. (1987) Science 236:1237].
  • an inducer such as a hormone or metal ion
  • a DNA molecule may be expressed intracellularly in mammalian cells.
  • a promoter sequence may be directly linked with the DNA molecule, in which case the first amino acid at the N- terminus of the recombinant protein will always be a methionine, which is encoded by the ATG start codon. If desired, the N-terminus may be cleaved from the protein by in vitro incubation with cyanogen bromide.
  • foreign proteins can also be secreted from the cell into the growth media by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provides for secretion of the foreign protein in mammalian cells.
  • a leader sequence fragment that provides for secretion of the foreign protein in mammalian cells.
  • processing sites encoded between the leader fragment and the foreign gene that can be cleaved either in vivo or in vitro.
  • the leader sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the secretion of the protein from the cell.
  • the adenovirus triparite leader is an example of a leader sequence that provides for secretion of a foreign protein in mammalian cells.
  • transcription termination and polyadenylation sequences recognized by mammalian cells are regulatory regions located 3' to the translation stop codon and thus, together with the promoter elements, flank the coding sequence.
  • the 3' terminus of the mature mRNA is formed by site-specific post-transcriptional cleavage and polya ⁇ denylation [Birnstiel et al. (1985) Cell 41:349; Proudfoot and Whitelaw (1988) "Termination and 3' end processing of eukaryotic RNA. In Transcription and splicing (ed. B.D. Hames and D.M. Glover) ; Proudfoot (1989) Trends Biochem. Sci. 14:105] .
  • transcription terminater/polyadenylation signals include those derived from SV40 [Sambrook et al (1989) "Expression of cloned genes in cultured mammalian cells.” In Molecular Cloning: A Laboratory Manual] . 22
  • introns also called intervening sequences
  • splicing signals also called splice donor and acceptor sites
  • Introns are intervening noncoding sequences within a coding sequence that contain splice donor and acceptor sites. They are removed by a process called "splicing," following polyadenylation of the primary transcript [Nevins (1983) Annu. Rev. Biochem. 52:441; Green (1986) Annu. Rev. Genet. 20:671: Padgett et al. (1986) Annu. Rev. Biochem. 55:1119; Krainer and Maniatis (1988) "RNA splicing.” In Transcription and splicing (ed. B.D. Hames and D.M. Glover) ] .
  • the above described components comprising a promoter, polyadenylation signal, and transcription termination sequence are put together into expression constructs.
  • Enhancers, introns with functional splice donor and acceptor sites, and leader sequences may also be included in an expression construct, if desired.
  • Expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as mammalian cells or bacteria.
  • Mammalian replication systems include those derived from animal viruses, which require trans-acting factors to replicate.
  • plasmids containing the replication systems of papovaviruses such as SV40 [Gluz an (1981) Cell 2:175] or polyomavirus, replicate to extremely high copy number in the presence of the appropriate viral T antigen.
  • mammalian replicons include those derived from bovine papillo avirus and Epstein-Barr virus.
  • the replicon may have two replication systems, thus allowing it to be maintained, for example, in mammalian cells for expression and in a procaryotic host for cloning and amplification.
  • mammalian-bacteria shuttle vectors include pMT2 [Kaufman et al. (1989) Mol. Cell. Biol. 9:946 and pHEBO [Shimizu et al. (1986) Mol. Cell. Biol. 6:10741.
  • the transformation procedure used depends upon the host to be transformed.
  • Methods for introduction of heterologous polynucleotides into mammalian cells include dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei.
  • Mammalian cell lines available as hosts for expression are known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC) , including but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS) , human hepatocellular carcinoma cells (e.g., Hep G2) , and a number of other cell lines.
  • ATCC American Type Culture Collection
  • the polynucleotide encoding the protein can also be inserted into a suitable insect expression vector, and is operably linked to the control elements within that vector.
  • Vector construction employs techniques which are known in the art.
  • the components of the expression system include a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a convenient restriction site for insertion of the heterologous gene or genes to be expressed; a wild type baculovirus with a sequence homologous to the baculovirus- specific fragment in the transfer vector (this allows for the homologous recombination of the heterologous gene in to the baculovirus genome) ; and appropriate insect host cells and growth media.
  • a transfer vector usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a convenient restriction site for insertion of the heterologous gene or genes to be expressed
  • a wild type baculovirus with a sequence homologous to the baculovirus- specific fragment in the transfer vector this allows for the homologous recombination of the heterologous gene in to the baculovirus genome
  • the transfer vector, the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome are allowed to recombine.
  • the packaged recombinant virus is expressed and recombinant plaques are identified and purified.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia. Invitrogen, San Diego CA ("MaxBac” kit) . These techniques are generally known to those skilled in the art and fully described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987) (hereinafter "Summers and Smith”) .
  • transplacement construct Prior to inserting the DNA sequence encoding the protein into the baculovirus genome, the above described components, comprising a promoter, leader (if desired), coding sequence of interest, and transcription termination sequence, are usually assembled into an intermediate transplacement construct (transfer vector) .
  • This construct may contain a single gene and operably linked regulatory elements; multiple genes, each with its owned set of operably linked regulatory elements; or multiple genes, regulated by the same set of regulatory elements.
  • Intermediate transplacement constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as a bacterium.
  • the replicon will have a replication system, thus allowing it to be maintained in a suitable host for cloning and amplification.
  • pAc373 the most commonly used transfer vector for introducing foreign genes into AcNPV.
  • Many other vectors known to those of skill in the art, have also been designed. These include, for example, pVL985 (which alters the polyhedrin start codon from ATG to ATT, and which introduces a BamHI cloning site 32 basepairs downstream from the ATT; see Luckow and Summers, Virology (1989) 7:31.
  • the plasmid usually also contains the polyhedrin polyadenylation signal (Miller et al. (1988) Ann. Rev. Microbiol. , 4_2: 177) and a procaryotic ampicillin-resistance (amp) gene and origin of replication for selection and propagation in E_ ⁇ coli.
  • Baculovirus transfer vectors usually contain a baculovirus promoter.
  • a baculovirus promoter is any DNA sequence capable of binding a baculovirus RNA polymerase and initiating the downstream (5' to 3') transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a baculovirus transfer vector may also have a second domain called an enhancer, which, if present, is usually distal to the structural gene. Expression may be either regulated or constitutive.
  • Structural genes abundantly transcribed at late times in a viral infection cycle, provide particularly useful promoter sequences. Examples include sequences derived from the gene encoding the viral polyhedron protein, Friesen et al. , (1986) "The Regulation of Baculovirus Gene Expression,” in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler) ; EPO Publ. Nos. 127 839 and 155 476; and the gene encoding the plO protein, Vlak et al., (1988) , J. Gen. Virol. 69:765.
  • DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene (Carbonell et al. (1988) Gene. 7_3:409) .
  • the signals for mammalian cell posttranslational modifications such as signal peptide cleavage, proteolytic cleavage, and phosphorylation
  • the signals required for secretion and nuclear accumulation also appear to be conserved between the invertebrate cells and vertebrate cells
  • leaders of non- insect origin such as those derived from genes encoding human ⁇ -interferon, Maeda et al., (1985), Nature 315:592; human gastrin-releasing peptide, Lebacq-Verheyden et al., (1988), Molec.
  • a recombinant polypeptide or polyprotein may be expressed intracellularly or, if it is expressed with the proper regulatory sequences, it can be secreted.
  • Good intracellular expression of nonfused foreign proteins usually requires heterologous genes that ideally have a short leader sequence containing suitable translation initiation signals preceding an ATG start signal. If desired, methionine at the N-terminus may be cleaved from the mature protein by in vitro incubation with cyanogen bromide.
  • recombinant polyproteins or proteins which are not naturally secreted can be secreted from the insect cell by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provides for secretion of the foreign protein in insects.
  • the leader sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the translocation of the protein into the endoplasmic reticulum.
  • an insect cell host is co-transformed with the heterologous DNA of the transfer vector and the genomic DNA of wild type baculovirus usually by co-transfection.
  • the promoter and transcription termination sequence of the construct will usually comprise a 2-5kb section of the baculovirus genome.
  • the insertion can be into a gene such as the polyhedrin gene, by homologous double crossover recombination; insertion can also be into a restriction enzyme site engineered into the desired baculovirus gene. Miller et al. , (1989) , Bioessavs 4_:91.
  • the DNA sequence, when cloned in place of the polyhedrin gene in the expression vector, is flanked both 5' and 3' by polyhedrin-specific sequences and is positioned downstream of the polyhedrin promoter.
  • the newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus. Homologous recombination occurs at low frequency (between about 1% and about 5%); thus, the majority of the virus produced after cotransfection is still wild-type virus. Therefore, a method is necessary to identify recombinant viruses.
  • An advantage of the expression system is a visual screen allowing recombinant viruses to be distinguished.
  • the polyhedrin protein which is produced by the native virus, is produced at very high levels in the nuclei of infected cells at late times after viral infection. Accumulated polyhedrin protein forms occlusion bodies that also contain embedded particles.
  • occlusion bodies up to 15 ⁇ m in size, are highly refractile, giving them a bright shiny appearance that is readily visualized under the light microscope.
  • Cells infected with recombinant viruses lack occlusion bodies.
  • the transfection supernatant is plaqued onto a monolayer of insect cells by techniques known to those skilled in the art. Namely, the plaques are screened under the light microscope for the presence (indicative of wild-type virus) or absence (indicative of recombinant virus) of occlusion bodies.
  • Recombinant baculovirus expression vectors have been developed for infection into several insect cells.
  • recombinant baculoviruses have been developed for, inter alia: Aedes aegypti , Autographa californica, Bombvx mori, Drosophila melanogaster, Spod ⁇ ptera frugjperda. and Trichoplusia ni (PCT Pub. No. WO 89/046699; Carbonell et al., (1985) J. Virol. 56:153; Wright (1986) Nature 321:718; Smith et al., (1983) Mol. Cell. Biol. 2:2156; and see generally, Fraser, et al. (1989) in Vitro Cell. Dev. Biol.
  • Cells and cell culture media are commercially available for both direct and fusion expression of heterologous polypeptides in a baculovirus/expression system; cell culture technology is generally known to those skilled in the art. See, e.g. , Summers and Smith supra.
  • the modified insect cells may then be grown in an appropriate nutrient medium, which allows for stable maintenance of the plasmid(s) present in the modified insect host.
  • the expression product gene is under inducible control, the host may be grown to high density, and expression induced.
  • the product will be continuously expressed into the medium and the nutrient medium must be continuously circulated, while removing the product of interest and augmenting depleted nutrients.
  • the product may be purified by such techniques as chromatography, e.g., HPLC, affinity chromatography, ion exchange chromatography, etc.; electrophoresis; density gradient centrifugation; solvent extraction, or the like.
  • the product may be further purified, as required, so as to remove substantially any insect proteins which are also secreted in the medium or result from lysis of insect cells, so as to provide a product which is at least substantially free of host debris, e.g., proteins, lipids and polysaccharides.
  • host debris e.g., proteins, lipids and polysaccharides.
  • recombinant host cells derived from the transformants are incubated under conditions which allow expression of the recombinant protein encoding sequence. These conditions will vary, dependent upon the host cell selected. However, the conditions are readily ascertainable to those of ordinary skill in the art, based upon what is known in the art.
  • a bacterial promoter is any DNA sequence capable of binding bacterial RNA polymerase and initiating the downstream (3") transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a bacterial promoter may also have a second domain called an operator, that may overlap an adjacent RNA polymerase binding site at which RNA synthesis begins. The operator permits negative regulated (inducible) transcription, as a gene repressor protein may bind the operator and thereby inhibit transcription of a specific gene.
  • Constitutive expression may occur in the absence of negative regulatory elements, such as the operator.
  • positive regulation may be achieved by a gene activator protein binding sequence, which, if present is usually proximal (5') to the RNA polymerase binding sequence.
  • An example of a gene activator protein is the catabolite activator protein (CAP) , which helps initiate transcription of the lac operon in Escherichia coli (E . coli) [Raibaud et al . (1984) Annu. Rev. Genet. 18: 173] .
  • Regulated expression may therefore be either positive or negative, thereby either enhancing or reducing transcription.
  • Sequences encoding metabolic pathway enzymes provide particularly useful promoter sequences. Examples include promoter sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) [Chang et aj.. (1977) Nature 198:1056] , and maltose. Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (trp.) [Goeddel et a_l. (1980) Nuc. Acids Res. 2:4057; Yelverton et al. (1981) Nucl. Acids Res. 9:731; U.S. Patent No. 4,738,921; EPO Publ. Nos. 036 776 and 121 775].
  • sugar metabolizing enzymes such as galactose, lactose (lac) [Chang et aj.. (1977) Nature 198:1056]
  • maltose additional examples include promoter sequences derived from bios
  • synthetic promoters which do not occur in nature also function as bacterial promoters.
  • transcription activation sequences of one bacterial or bacteriophage promoter may be joined with the operon sequences of another bacterial or bacteriophage promoter, creating a synthetic hybrid promoter [U.S. Patent No. 4,551,433].
  • the tac promoter is a hybrid trp-lac promoter comprised of both trp promoter and lac operon sequences that is regulated by the lac repressor [Amann et a_l. (1983) Gene 25:167; de Boer et a_l. (1983) Proc. Natl. Acad. Sci. 8.0:21].
  • a bacterial promoter can include naturally occurring promoters of non- bacterial origin that have the ability to bind bacterial RNA polymerase and initiate transcription.
  • a naturally occurring promoter of non-bacterial origin can also be coupled with a compatible RNA polymerase to produce high levels of expression of some genes in prokaryotes.
  • the bacteriophase T7 RNA polymerase/promoter system is an example of a coupled promoter system [Studier et ajL. (1986) J. Mol. Biol. 189:11 ; Tabor et al. (1985) Proc Natl. Acad. Sci. 22:1074].
  • a hybrid promoter can also be comprised of a bacteriophage promoter and an E_j_ coli operator region (EPO Publ. No. 267 851) .
  • an efficient ribosome binding site is also useful for the expression of foreign genes in prokaryotes.
  • the ribosome binding site is called the Shine-Dalgarno (SD) sequence and includes an initiation codon (ATG) and a sequence 3-9 nucleotides in length located 3-11 nucleotides upstream of the initiation codon [Shine et ai. (1975) Nature 254: 341.
  • SD sequence is thought to promote binding of mRNA to the ribosome by the pairing of bases between the SD sequence and the 3' and of E. coli 16S rRNA [Steitz et a_l.
  • a DNA molecule may be expressed intracellularly.
  • a promoter sequence may be directly linked with the DNA molecule, in which case the first amino acid at the N-terminus will always be a methionine, which is encoded by the ATG start codon. If desired, methionine at the N-terminus may be cleaved from the protein by Q vitro incubation with cyanogen bromide or by either in vivo on in vitro incubation with a bacterial methionine N-terminal peptidase (EPO Publ. No. 219 237) .
  • Fusion proteins provide an alternative to direct expression. Usually, a DNA sequence encoding the N-terminal portion of an endogenous bacterial protein, or other stable protein, is fused to the 5' end of heterologous coding sequences. Upon expression, this construct will provide a fusion of the two amino acid sequences.
  • the bacteriophage lambda cell gene can be linked at the 5' terminus of a foreign gene and expressed in bacteria.
  • the resulting fusion protein preferably retains a site for a processing enzyme (factor Xa) to cleave the bacteriophage protein from the foreign gene [Nagai et al. (1984) Nature 309:810] . Fusion proteins can also be made with sequences from the lacZ [Jia et al.
  • the DNA sequence at the junction of the two amino acid sequences may or may not encode a cleavable site.
  • a ubiquitin fusion protein is made with the ubiquitin region that preferably retains a site for a processing enzyme (e.g. ubiquitin specific processing- protease) to cleave the ubiquitin from the foreign protein.
  • a processing enzyme e.g. ubiquitin specific processing- protease
  • foreign proteins can also be secreted from the cell by creating chimeric DNA molecules that encode a fusion protein comprised of a signal peptide sequence fragment that provides for secretion of the foreign protein in bacteria [U.S. Patent No. 4,336,336].
  • the signal sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the secretion of the protein from the cell.
  • the protein is either secreted into the growth media (gram-positive bacteria) or into the periplasmic space, located between the inner and outer membrane of the cell (gram-negative bacteria) .
  • processing sites which can be cleaved either in vivo or in vitro encoded between the signal peptide fragment and the foreign gene.
  • DNA encoding suitable signal sequences can be derived from genes for secreted bacterial proteins, such as the E. coli outer membrane protein gene (o pA) [Masui et aL. (1983) , in: Experimental Manipulation of Gene Expression; Ghrayeb et al. (1984) EMBO J. 2 : 2437] and the E. coli alkaline phosphatase signal sequence fphoA) [Oka et ai. (1985) Proc. Natl. Acad. Sci. 22:7212].
  • the signal sequence of the alpha-amylase gene from various Bacillus strains can be used to secrete heterologous proteins from B. subtilis [Palva et a_l. (1982) Proc. Natl. Acad. Sci. USA 29:5582; EPO Publ. No. 244 042].
  • transcription termination sequences recognized by bacteria are regulatory regions located 3' to the translation stop codon, and thus together with the promoter flank the coding sequence. These sequences direct the transcription of an mRNA which can be translated into the polypeptide encoded by the DNA. Transcription termination sequences frequently include DNA sequences of about 50 nucleotides capable of forming stem loop structures that aid in terminating transcription. Examples include transcription termination sequences derived from genes with strong promoters, such as the trp gene in E. coli as well as other biosynthetic genes.
  • expression constructs are often maintained in a replicon, such as an extrachromoso al element (e.g., plasmids) capable of stable maintenance in a host, such as bacteria.
  • a replicon such as an extrachromoso al element (e.g., plasmids) capable of stable maintenance in a host, such as bacteria.
  • the replicon will have a replication system, thus allowing it to be maintained in a procaryotic host either for expression or for cloning and amplification.
  • a replicon may be either a high or low copy number plasmid.
  • a high copy number plasmid will generally have a copy number ranging from about 5 to about 200, and usually about 10 to about 150.
  • a host containing a high copy number plasmid will preferably contain at least about 10, and more preferably at least about 20 plasmids. Either a high or low copy number vector may be selected, depending upon the effect of the vector and the foreign protein on the host.
  • the expression constructs can be integrated into the bacterial genome with an integrating vector.
  • Integrating vectors usually contain at least one sequence homologous to the bacterial chromosome that allows the vector to integrate. Integrations appear to result from recombinations between homologous DNA in the vector and the bacterial chromosome.
  • integrating vectors constructed with DNA from various Bacillus strains integrate into the Bacillus chromosome (EPO Publ. No. 127 328). Integrating vectors may also be comprised of bacteriophage or transposon sequences.
  • extrachromosomal and integrating expression constructs may contain selectable markers to allow for the selection of bacterial strains that have been transformed.
  • Selectable markers can be expressed in the bacterial host and may include genes which render bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin (neomycin), and tetracycline [Davies et al. (1978) Annu. Rev.Microbiol. 22:469].
  • Selectable markers may also include biosynthetic genes, such as those in the histidine, tryptophan, and leucine biosynthetic pathways.
  • Transformation vectors are usually comprised of a selectable market that is either maintained in a replicon or developed into an integrating vector, as described above.
  • Expression and transformation vectors have been developed for transformation into many bacteria.
  • expression vectors have been developed for, inter alia, the following bacteria: Bacillus subtilis [Palva et al. (1982) Proc. Natl. Acad. Sci. USA 7_9:5582; EPO Publ. Nos. 036 259 and 063 953; PCT Publ. No. WO 84/04541], Escherichia coli [Shimatake et aL. (1981) Nature 292: 128; Amann et a_l. (1985) Gene 0:183; Studier et ai. (1986) J. Mol. Biol.
  • Methods of introducing exogenous DNA into bacterial hosts are well-known in the art, and usually include either the transformation of bacteria treated with CaCl or other agents, such as divalent cations and DMSO.
  • DNA can also be introduced into bacterial cells by electroporation. Transformation procedures usually vary with the bacterial species to be transformed. See e.g., [Masson et al. (1989) FEMS Microbiol. Lett. 60.:273; Palva et aL. (1982) Proc. Natl. Acad. Sci. USA 79:5582; EPO Publ. Nos. 036 259 and 063 953; PCT Publ. No. WO 84/04541, Bacillus], [Miller et ai.
  • a yeast promoter is any DNA sequence capable of binding yeast RNA polymerase and initiating the downstream (3') transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site (the "TATA Box") and a transcription initiation site.
  • a yeast promoter may also have a second domain called an upstream activator sequence (UAS) , which, if present, is usually distal to the structural gene.
  • the UAS permits regulated (inducible) expression. Constitutive expression occurs in the absence of a UAS. Regulated expression may be either positive or negative, thereby either enhancing or reducing transcription.
  • Yeast is a fermenting organism with an active metabolic pathway, therefore sequences encoding enzymes in the metabolic pathway provide particularly useful promoter sequences. Examples include alcohol dehydrogenase (ADH) (EPO Publ. No. 284 044), enolase, glucokinase, glucose-6- phosphate isomerase, glyceraldehyde-3-phosphate- dehydrogenase (GAP or GAPDH) , hexokinase, phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate kinase (PyK) (EPO Publ. No. 329 203).
  • the yeast PH05 gene encoding acid phosphatase, also provides useful promoter sequences [Myanohara et ai. (1983) Proc. Natl. Acad. Sci. USA 20:1] •
  • synthetic promoters which do not occur in nature also function as yeast promoters.
  • UAS sequences of one yeast promoter may be joined with the transcription activation region of another yeast promoter, creating a synthetic hybrid promoter.
  • hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region (U.S. Patent Nos. 4,876,197 and 4,880,734) .
  • Other examples of hybrid promoters include promoters which consist of the regulatory sequences of either the ADH2.
  • GAL4 GAL10, OR PHQ5 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK (EPO Publ. No. 164 556) .
  • a yeast promoter can include naturally occurring promoters of non-yeast origin that have the ability to bind yeast RNA polymerase and initiate transcription. Examples of such promoters include, inter alia. [Cohen et ai. (1980) Proc. Natl. Acad. Sci. USA 22:1078; Henikoff et ai- (1981) Nature 283:835; Hollenberg et al. (1981) Curr. Topics Microbiol. Immunol. 96:119; Hollenberg et ai. (1979) "The Expression of Bacterial Antibiotic Resistance Genes i the Yeast Saccharomyces cerevisiae," in: Plasmids of Medical. Environmental and Commercial Importance (eds. K>N> Timmis and A. Puhler) ; Mercerau-Puigalon et ai. (1980) Gene 11:163; Panthier et al. (1980) Curr. Genet. 2:109:1.
  • a DNA molecule may be expressed intracellularly in yeast.
  • a promoter sequence may be directly linked with the DNA molecule, in which case the first amino acid at the N- terminus of the recombinant protein will always be a methionine, which is encoded by the ATG start codon. If desired, methionine at the N-terminus may be cleaved from the protein by in vitro incubation with cyanogen bromide.
  • Fusion proteins provide an alternative for yeast expression systems, as well as in mammalian, baculovirus, and bacterial expression systems.
  • a DNA sequence encoding the N- terminal portion of an endogenous yeast protein, or other stable protein is fused to the 5' end of heterologous coding sequences.
  • this construct will provide a fusion of the two amino acid sequences.
  • the yeast or human superoxide dismutase (SOD) gene can be linked at the 5' terminus of a foreign gene and expressed in yeast.
  • the DNA sequence at the junction of the two amino acid sequences may or may not encode a cleavable site. See e.g., EPO Publ. No. 196 056.
  • a ubiquitin fusion protein is made with the ubiquitin region that preferably retains a site for a processing enzyme (e.g. ubiquitin-specific processing protease) to cleave the ubiquitin from the foreign protein.
  • a processing enzyme e.g. ubiquitin-specific processing protease
  • native foreign protein can be isolated (see, e.g., PCT Publ. No. WO 88/024066).
  • foreign proteins can also be secreted from the cell into the growth media by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provide for secretion in yeast of the foreign protein.
  • a leader sequence fragment that provide for secretion in yeast of the foreign protein.
  • processing sites encoded between the leader fragment and the foreign gene that can be cleaved either in vivo or in vitro.
  • the leader sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the secretion of the protein from the cell.
  • DNA encoding suitable signal sequences can be derived from genes for secreted yeast proteins, such as the yeast invertase gene (EPO Publ. No. 012 873; JPO Publ. No. 62,096,086) and the A-factor gene (U.S. Patent No. 4,588,684).
  • yeast invertase gene EPO Publ. No. 012 873; JPO Publ. No. 62,096,086) and the A-factor gene (U.S. Patent No. 4,588,684).
  • leaders of non-yeast origin such as an interferon leader, exist that also provide for secretion in yeast (EPO Publ. No. 060 057) .
  • a preferred class of secretion leaders are those that employ a fragment of the yeast alpha-factor gene, which contains both a "pre" signal sequence, and a "pro” region.
  • the types of alpha-factor fragments that can be employed include the full-length pre-pro alpha factor leader (about 83 amino acid residues) as well as truncated alpha-factor leaders (usually about 25 to about 50 amino acid residues) (U.S. Patent Nos. 4,546,083 and 4,870,008; EPO Publ. No. 324 274).
  • Additional leaders employing an alpha-factor leader fragment that provides for secretion include hybrid alpha-factor leaders made with a presequence of a first yeast, but a pro-region from a second yeast alphafactor.
  • transcription termination sequences recognized by yeast are regulatory regions located 3' to the translation stop codon, and thus together with the promoter flank the coding sequence. These sequences direct the transcription of an mRNA which can be translated into the polypeptide encoded by the DNA. Examples of transcription terminator sequence and other yeast-recognized termination sequences, such as those coding for glycolytic enzymes.
  • Expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as yeast or bacteria.
  • the replicon may have two replication systems, thus allowing it to be maintained, for example, in yeast for expression and in a procaryotic host for cloning and amplification.
  • yeast- bacteria shuttle vectors include YEp24 [Botstein et al. (1979) Gene 8:17-241. pCl/1 [Brake et al. (1984) Proc. Natl.
  • a replicon may be either a high or low copy number plasmid.
  • a high copy number plasmid will generally have a copy number ranging from about 5 to about 200, and usually about 10 to about 150.
  • a host containing a high copy number plasmid will preferably have at least about 10, and more preferably at least about 20. Enter a high or low copy number vector may be selected, depending upon the effect of the vector and the foreign protein on the host. See e.g., Brake et al., supra.
  • the expression constructs can be integrated into the yeast genome with an integrating vector.
  • Integrating vectors usually contain at least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contain two homologous sequences flanking the expression construct. Integrations appear to result from recombinations between homologous DNA in the vector and the yeast chromosome [Orr-Weaver et ai. (1983) Methods in Enzv ol. 101:228-245].
  • An integrating vector may be directed to a specific locus in yeast by selecting the appropriate homologous sequence for inclusion in the vector. See Orr-Weaver et ai. , supra.
  • One or more expression construct may integrate, possibly affecting levels of recombinant protein produced [Rine et al. (1983) Proc. Natl. Acad. Sci. USA 80:6750].
  • the chromosomal sequences included in the vector can occur either as a single segment in the vector, which results in the integration of the entire vector, or two segments homologous to adjacent segments in the chromosome and flanking the expression construct in the vector, which can result in the stable integration of only the expression construct.
  • extrachromosomal and integrating expression constructs may contain selectable markers to allow for the selection of yeast strains that have been transformed.
  • Selectable markers may include biosynthetic genes that can be expressed in the yeast host, such as ADE2. HIS_4, LEU2.
  • TRP1. and ALG7 , and the G418 resistance gene which confer resistance in yeast cells to tunicamycin and G418, respectively.
  • a suitable selectable marker may also provide yeast with the ability to grow in the presence of toxic compounds, such as metal.
  • CUP1 allows yeast to grow in the presence of copper ions [Butt et ai. (1987) Microbiol. Rev. 51:351] .
  • Transformation vectors are usually comprised of a selectable marker that is either maintained in a replicon or developed into an integrating vector, as described above.
  • Expression and transformation vectors have been developed for transformation into many yeasts.
  • expression vectors have been developed for, inter alia, the following yeasts:Candida albicans [Kurtz, et al- (1986) Mol. Cell. Biol. 6:1421 , Candida maltose [Kunze, et al. (1985) J.
  • Methods of introducing exogenous DNA into yeast hosts are well-known in the art, and usually include either the transformation of spheroplasts or of intact yeast cells treated with alkali cations. Transformation procedures usually vary with the yeast species to be transformed. See e.g., rKurtz et al. (1986) Mol. Cell. Biol. 6:142; Kunze et al. (1985) J. Basic Microbiol. 25:141; Candida]; [Gleeson et al. (1986) J. Gen. Microbiol. 132:3459; Roggenkamp et al. (1986) Mol. Gen. Genet. 202:302 Hansenula]; [Das et al. (1984) J. Bacteriol.
  • the 5' Xbal site corresponds to the site in pJM17 and the 3' Hindlll site was created by the PCR procedure.
  • the amplified Xbal-Hindlll fragment was subcloned in pEMBL 19 vector (Dente et al . (1983) NAR 11: 1645-1655) , generating the pEMBL19-CT vector which was used for site-directed mutagenesis (Zoller et al . (1982) NAR 10:6487) .
  • Site-directed mutagenesis was performed according to the method of Zoller (see above) on single-stranded DNA of pEMBL19-CT plasmid.
  • V GGCATACAGTAGCCATCCAGA 3' (oligoCT-S106) mutates the codon for Prol06 to a Ser codon.
  • the mutated Xbal-Hindlll fragment containing the S106 mutation was subcloned under the control of CT promoter into pGEM-3 vector (Promega, Madison, USA), generating the pGEM/CT-S106 vector.
  • V . cholerae 0395-NT strains were transformed with pGEM/CT-Sl06 plasmid by electroporation (Sambrook et al . (1989) Molecular cloning - A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) .
  • the mutant protein was purified from the culture supernatant of V . cholerae strain and purified.
  • CM-Sepharose column (Pharmacia LKB, Uppsala, Sweden) .
  • the column was eluted first with 20 mM sodium phosphate buffer, pH 7.5, and then with 40 mM sodium phosphate buffer, pH 7.5.
  • the morphological change caused by CT on Yl adrenal cells was used to detect the toxic activity of the CT-S106 mutant.
  • 25 ⁇ l of medium nutrient mixture Ham's F-10 supplemented with 2mM glutamine, 50mg gentamycin, 1.5% horse serum
  • CT is therefore toxic at concentrations of lOpg/well and greater, and non-toxic at concentrations of 5pg/well and below;
  • CT-S106 is toxic at concentrations of 0.6 ⁇ g/well and greater, and non-toxic at 0.3 ⁇ g/well and below. This represents a 30,000x reduction in toxicity.
  • New Zealand adult rabbits (ca. 2.5 kg) were used for the assay.
  • the rabbits were starved for 24 hrs before the experiment.
  • the rabbits were anaesthetised and fixed on the operation table.
  • the abdomen of the rabbit was opened with a scalpel and the intestine was extracted.
  • the caecum was located, and 20-30 cm away from this tract of intestine (towards the stomach) 12-14 loops were made (each 5-6 cm in length) up to the approximate end of the intestine proximal to the stomach.
  • toxin 750 100 10 1 0.5 liquid in the 1.6 0.1 0.0 0.0 0.0 loop (ml/cm)
  • CT-S106 The mucosal immunogenicity of CT-S106 and its adjuvanticity was tested using the protocol of Douce et al . (PNAS 92, 1644-1648 (1995)). Five mice were immunised intranasally with l ⁇ g CT or CT-S106 and lO ⁇ g Fragment C of tetanus toxin.
  • 100xLD 50 was used instead of 10xLD 50 .
  • CT-specific antibodies were measured using a GMl capture ELISA (Douce et al . ) . Plates were coated overnight at 4°C with lOO ⁇ l/well of 1.5 ⁇ g/ml GMl ganglioside solution (Sigma Chemical Co. , St. Louis, USA) . Plates were washed three times with PBS/T (PBS + 0.05% Tween 20) . 200 ⁇ l/well of 1% BSA were added and the plates were incubated for 1 hour at 37°C. lOO ⁇ l/well of CT were added and incubated overnight at 4°C. Dilutions of serum from each mouse (1:50 dilution and eight subsequent 1:5 dilutions) were added to the wells. ' The plates were then incubated for 2 hours at 37°C, washed as described above, and incubated with anti-mouse immunoglobulin G conjugated to alkaline phosphatase (Sigma) .
  • GMl capture ELISA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP97902552A 1996-02-16 1997-02-17 Immunogene entoxifizierte mutanten des choleratoxins Withdrawn EP0880361A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9603314.7A GB9603314D0 (en) 1996-02-16 1996-02-16 Immunogenic detoxified mutant toxins
GB9603314 1996-02-16
PCT/IB1997/000183 WO1997029771A1 (en) 1996-02-16 1997-02-17 Immunogenic detoxified mutants of cholera toxin

Publications (1)

Publication Number Publication Date
EP0880361A1 true EP0880361A1 (de) 1998-12-02

Family

ID=10788903

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97902552A Withdrawn EP0880361A1 (de) 1996-02-16 1997-02-17 Immunogene entoxifizierte mutanten des choleratoxins

Country Status (5)

Country Link
EP (1) EP0880361A1 (de)
JP (1) JP2000506002A (de)
CA (1) CA2244800A1 (de)
GB (1) GB9603314D0 (de)
WO (1) WO1997029771A1 (de)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001034193A1 (en) 1999-10-26 2001-05-17 Chiron Corporation Plant lectins as mucosal adjuvants

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998045324A1 (en) * 1997-04-04 1998-10-15 The Uab Research Foundation Use of cholera toxin mutants as mucosal adjuvants
US6086901A (en) * 1997-12-16 2000-07-11 Chiron Corporation Use of microparticles combined with submicron oil-in-water emulsions
US7393630B2 (en) 1997-12-16 2008-07-01 Novartis Vaccines And Diagnostics, Inc. Use of microparticles combined with submicron oil-in-water emulsions
MXPA01003228A (es) * 1998-09-30 2003-06-24 American Cyanamid Co Holotoxina de colera mutante como un coadyuvante.
US7384640B1 (en) 1999-09-30 2008-06-10 Wyeth Holdings Corporation Mutant cholera holotoxin as an adjuvant
EP1404368B1 (de) 2001-06-07 2009-12-09 Wyeth Holdings Corporation Mutantenformen von cholera holotoxin als adjuvans
EP1404279A4 (de) 2001-06-07 2007-08-08 Wyeth Corp Mutationsformen von cholera holotoxin als adjuvans
US20110223197A1 (en) 2005-10-18 2011-09-15 Novartis Vaccines And Diagnostics Inc. Mucosal and Systemic Immunization with Alphavirus Replicon Particles

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL101715A (en) * 1991-05-02 2005-06-19 Amgen Inc Recombinant dna-derived cholera toxin subunit analogs
IT1253009B (it) * 1991-12-31 1995-07-10 Sclavo Ricerca S R L Mutanti immunogenici detossificati della tossina colerica e della tossina lt, loro preparazione ed uso per la preparazione di vaccini
GB9513371D0 (en) * 1995-06-30 1995-09-06 Biocine Spa Immunogenic detoxified mutant toxins
GB9326174D0 (en) * 1993-12-22 1994-02-23 Biocine Sclavo Mucosal adjuvant

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9729771A1 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001034193A1 (en) 1999-10-26 2001-05-17 Chiron Corporation Plant lectins as mucosal adjuvants

Also Published As

Publication number Publication date
GB9603314D0 (en) 1996-04-17
WO1997029771A1 (en) 1997-08-21
CA2244800A1 (en) 1997-08-21
JP2000506002A (ja) 2000-05-23

Similar Documents

Publication Publication Date Title
EP1484404B1 (de) Immunogene, nichtgiftige Mutanten des Choleratoxins und des Toxins-LT, ihre Herstellung und ihre Verwendung zur Herstellung von Impfstoffen
CA2268758C (en) Immunogenic detoxified mutant e. coli lt-a toxin
EP0632727B1 (de) Konjugate aus hitzeshockproteinen und oligo- oder polysacchariden
US7115730B1 (en) Immunogenic detoxified mutant E. coli LT-A-toxin
US7872114B2 (en) Immunogenic detoxified mutants of cholera toxin
EP0967279B1 (de) Helicobacter pylori Cytotoxin verwendbar in Impfstoffe und Diagnostik
US7070791B2 (en) Detection of antibodies against Chlamydia trachomatis pgp3 antigen in patient sera by enzyme-linked immunoassay
EP0880361A1 (de) Immunogene entoxifizierte mutanten des choleratoxins
US20020044939A1 (en) Immunogenic detoxified mutants of cholera toxin
WO1993019185A1 (en) Recombinant antigen containing in its sequence a heterologous immunostimulatory domain-use as a vaccine
WO1998059065A1 (en) Novel method of dna transfer into cells

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980903

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20010105

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20021119