EP0865489A1 - Oligonucleotides antisens modifies specifiques de vegf - Google Patents

Oligonucleotides antisens modifies specifiques de vegf

Info

Publication number
EP0865489A1
EP0865489A1 EP96943587A EP96943587A EP0865489A1 EP 0865489 A1 EP0865489 A1 EP 0865489A1 EP 96943587 A EP96943587 A EP 96943587A EP 96943587 A EP96943587 A EP 96943587A EP 0865489 A1 EP0865489 A1 EP 0865489A1
Authority
EP
European Patent Office
Prior art keywords
seq
oligonucleotide
vegf
oligonucleotides
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96943587A
Other languages
German (de)
English (en)
Inventor
Gregory S. Robinson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Aceragen Inc
Original Assignee
Hybridon Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/569,926 external-priority patent/US5641756A/en
Application filed by Hybridon Inc filed Critical Hybridon Inc
Publication of EP0865489A1 publication Critical patent/EP0865489A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification

Definitions

  • This invention relates to vascular endothelial growth factor. More specifically, this invention relates to oligonucleotides specific for vascular endothelial growth factor nucleic acid and useful treatment of disorders that are associated with neovascularization and angiogenesis .
  • Neovascular diseases of the retina such as diabetic retinopathy, retinopathy of prematurity, and age-related macular degeneration are a major cause of blindness in the United States and the world, yet the biochemical events responsible for these processes have not been fully elucidated.
  • Diabetic retinopathy is the leading cause of blindness among working age adults (20-64) in the United States (Foster in Harrison 's Principles of Internal Medicine (Isselbacher et al . , eds.) McGraw-Hill, Inc., New York (1994) pp. 1994-1995) .
  • the retinal vessels undergo changes that result in not only leaky vessels but also vessel drop out resulting in retinal hypoxia.
  • panretinal laser photocoagulation PRP
  • panretinal laser photocoagulation a treatment for proliferative diabetic retinopathy
  • complications can occur from panretinal laser photocoagulation such as foveal burns, hemorrhaging, retinal detachment, and choroidal vessel growth.
  • other untoward effects of this treatment are decreased peripheral vision, decreased night vision, and changes in color perception (Am. J. Ophthalmol. (1976) 81:383-
  • ROP Retinopathy of prematurity
  • Age related macular degeneration is one of the leading causes of blindness in older adults in the United States, and may account for up to 30% of all bilateral blindness among Caucasian Americans (Anonymous (1994) Prevent Blindness America ) .
  • This disease is characterized by loss of central vision, usually in both eyes, due to damage to retinal pigment epithelial cells which provide physiological support to the light sensitive photoreceptor cells of the retina. In most cases there is currently no effective treatment. In approximately 20% of exudative cases that are diagnosed early, laser treatment can prevent further loss of vision; however, this effect is temporary (Bressler et al . , Principles and Practices of Ophthalmology (eds. Albert and Jakobiac), W.B.
  • Ocular neovascularization is also the underlying pathology in sickle cell retinopathy, neovascular glaucoma, retinal vein occlusion, and other hypoxic diseases .
  • These eye diseases as well as other pathological states associated with neovascularization appear to have hypoxia as a common factor (Knighton et al . (1983) Science 221:1283-1285; Folkman et al . (1987) Science 235:442-446; Klagsbrun et al. (1991) Ann. Rev. Physiol. 53:217-239; Miller et al . ( 1 93 ) Principles and Practice of Ophthalmology, W.B.
  • retinal neovascularization has been hypothesized to be the result of a "vasoformative factor" which is released by the retina in response to hypoxia (Michaelson (1948) Trans. Ophthalmol. Soc. U. K. 68:137-
  • VEGF/VPF Vascular endothelial growth factor/vascular permeability factor
  • VEGF in normal tissues is relatively low.
  • VEGF appears to play a principle role in many pathological states and processes related to neovascularization. Regulation of VEGF expression in tissues affected by the various conditions described above could therefore be key in treatment or preventative therapies associated with hypoxia.
  • antisense oligonucleotides New chemotherapeutic agents termed "antisense oligonucleotides" have been developed which are capable of modulating cellular and foreign gene expression (see, Zamecnik et al . (1978) Proc. Natl. Acad. Sci. (USA) 75:280-284) . Without being limited to any theory or mechanism, it is generally believed that the activity of antisense oligonucleotides depends on the binding of the oligonucleotide to the target nucleic acid (e.g.
  • VEGF-specific antisense oligonucleotides have been developed (Uchida et al . (1995) Antisense Res. &
  • the present invention provides novel synthetic oligonucleotides specific nucleotides 58 to 90 of the VEGF gene which can reduce the hypoxia-induced expression of VEGF mRNA and protein. This information has been exploited to develop the present invention which includes VEGF- specific oligonucleotides, pharmaceutical formulation, and methods of reducing the expression of VEGF mRNA and protein.
  • the invention provides a synthetic oligonucleotide complementary to a nucleic acid specific for human vascular endothelial growth factor.
  • This oligonucleotide has a nucleic acid sequence set forth in the Sequence Listing as SEQ ID NOS:2-16.
  • synthetic oligonucleotide refers to chemically synthesized polymers of nucleotides covalently attached via at least one 5' to 3' internucleotide linkage. In some embodiments, these oligonucleotides contain at least one deoxyribonucleotide, ribonucleotide, or both deoxyribonucleotides and ribonucleotides . In another embodiment, the synthetic oligonucleotides used in the methods of the invention are from about 15 to about 30 nucleotides in length. In preferred embodiments, these oligonucleotides contain from about 16 to 29 nucleotides .
  • oligonucleotide sequence that is complementary to a genomic region or an RNA molecule transcribed therefrom is intended to mean an oligonucleotide that binds to the nucleic acid sequence under physiological conditions, e.g., by Watson-Crick base pairing (interaction between oligonucleotide and single-stranded nucleic acid) or by Hoogsteen base pairing (interaction between oligonucleotide and double-stranded nucleic acid) or by any other means including in the case of a oligonucleotide binding to RNA, causing pseudoknot formation. Binding by Watson-Crick or Hoogsteen base pairing under physiological conditions is measured as a practical matter by observing interference with the function of the nucleic acid sequence.
  • the synthetic oligonucleotide of the invention are modified in a number of ways without compromising their ability to hybridize to nucleotide sequences contained within the mRNA for VEGF.
  • modified oligonucleotide describes an oligonucleotide in which at least two of its nucleotides are covalently linked via a synthetic linkage, i.e., a linkage other than a phosphodiester linkage between the 5 ' end of one nucleotide and the 3 ' end of another nucleotide in which the 5 ' nucleotide phosphate has been replaced with any number of chemical groups.
  • At least one internucleotide linkage of the oligonucleotide is an alkylphosphonate, phosphorothioate, phosphorodithioate, phosphate ester, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, and/or carboxymethyl ester.
  • modified oligonucleotide also encompasses oligonucleotides having at least one nucleotide with a modified base and/or sugar, such as a 2 ' -O-substituted ribonucleotide.
  • 2 ' -O-substituted means substitution of the 2 ' position of the pentose moiety with an -O- lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an -O-aryl or allyl group having 2 - 6 carbon atoms, wherein such alkyl, aryl or allyl group may be unsubstituted or may be substituted, e.g.
  • the oligonucleotides of the invention include four or five ribonucleotides 2 ' -O-alkylated at their 5 ' terminus (i.e.
  • the nucleotides of the synthetic oligonucleotides are linked by a or at least one phosphorothioate internucleotide linkage.
  • the phosphorothioate linkages may be mixed R ⁇ and S p enantiomers, or they may be stereoregular or substantially stereoregular in either R p or S p form (see Iyer et al .
  • the invention provides a method of inhibiting VEGF expression.
  • nucleic acid specific for VEGF is contacted with an oligonucleotide of the invention.
  • nucleic acid encompasses a genomic region or an RNA molecule transcribed therefrom.
  • the nucleic acid is mRNA.
  • oligonucleotides used in accordance with this invention depends on the hybridization of the oligonucleotide to the target nucleic acid (e.g. to at least a portion of a genomic region, gene or mRNA transcript thereof) , thus disrupting the function of the target.
  • target nucleic acid e.g. to at least a portion of a genomic region, gene or mRNA transcript thereof
  • a preferred oligonucleotide used in accordance with the invention is capable of forming a stable duplex (or triplex in the Hoogsteen pairing mechanism) with the target nucleic acid; activate RNase H thereby causing effective destruction of the target RNA molecule, and in addition is capable of resisting nucleolytic degradation (e.g. endonuclease and exonuclease activity) in vivo .
  • nucleolytic degradation e.g. endonuclease and exonuclease activity
  • a pharmaceutical composition comprising at least one synthetic oligonucleotide of claim 1 in a physiologically acceptable carrier.
  • compositions capable of inhibiting neovascularization and thus are useful in the methods of the invention.
  • compositions include a synthetic oligonucleotide of the present invention which specifically inhibits the expression of vascular endothelial growth factor and a physiologically and/or pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient (s) .
  • physiologically acceptable refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
  • Another aspect of the invention is assessment of the role of VEGF in neovascularization and angiogenesis associated with disease states.
  • FIG. 1 is a schematic representation of the regions of the VEGF cDNA sequence that are targeted by oligonucleotides of the invention
  • FIG. 2 is a graphic representation of ELISA results demonstrating the ability of oligonucleotides H3-I and H3-J to inhibit VEGF expression induced by cobalt chloride;
  • FIG. 3 is a graphic representation of ELISA results demonstrating the ability of oligonucleotides H3-D H3-E, H3-F to inhibit VEGF expression induced by cobalt chloride;
  • FIG. 4 is a graphic representation of ELISA results demonstrating the ability of oligonucleotides H3-G and H3-H to inhibit VEGF expression induced by cobalt chloride;
  • FIG. 5 is a graphic representation of ELISA results demonstrating the ability of oligonucleotides H3 and H3-I to inhibit VEGF expression induced by cobalt chloride in M21 human me1anoma cells in vitr ;
  • H3-K all 2 ' -O- methylated phosphorothioate ribonucleotides
  • H3-L five 5' 2 ' -O-alkylated phosphorothioate ribonucleotides, the remainder, phosphorothioate deoxyribonucleotides
  • H3-M five 3 1 ' -O-alkylated phosphorothioate ribonucleotides, the remainder, phosphorothioate deoxyribonucleotides
  • H3-N five 3 ' 2 ' -O-alkylated phosphorothioate ribonucleotides, five 5 1 2 ' -O-alkylated phosphorothioate ribonucleotides, and the remainder,
  • the present invention provides synthetic antisense oligonucleotides specific for VEGF nucleic acid which are useful in treating diseases and disorders associated with neovascularization and angiogenesis, including retinal neovascularization.
  • Antisense oligonucleotide technology provides a novel approach to the inhibition of gene expression (see generally, Agrawal (1992) Trends in Biotech. 10:152-158; Wagner (1994) Nature 372:333-335; and Stein et al . (1993) Science 261:1004-1012) .
  • antisense oligonucleotide By binding to the complementary nucleic acid sequence (the sense strand) , antisense oligonucleotide are able to inhibit splicing and translation of RNA. In this way, antisense oligonucleotides are able to inhibit protein expression.
  • Antisense oligonucleotides have also been shown to bind to genomic DNA, forming a triplex, and inhibit transcription.
  • VEGF coding region is comprised of eight axons (Tischer et al (1994) I Biol Chem 266:11947-11954) Three VEGF transcripts, 121, 165, and 189 ammo acids long, have been observed, suggesting that an alternative splicing mechanism is involved (Leung et al .
  • the oligonucleotides of the invention are directed to any portion of the VEGF nucleic acid sequence that effectively acts as a target for inhibiting VEGF expression.
  • the sequence of the gene encoding VEGF has been reported mice (Claffey et al . , ibid. ) and for humans (Tischer et al . , ibid. ) . These targeted regions of the VEGF gene include any portions of the known exons . In addition, exon-intron boundaries are potentially useful targets for antisense inhibition of VEGF expression. One useful targeted region is around bases 58 to 90.
  • the nucleotide sequences of some representative, non-limiting oligonucleotides specific for human VEGF have SEQ ID NOS:2-16.
  • the oligonucleotides of the invention are composed of ribonucleotides, deoxyribonucleotides, or a combination of both, with the 5 ' end of one nucleotide and the 3 ' end of another nucleotide being covalently linked. These oligonucleotides are at least 14 nucleotides in length, but are preferably 15 to 30 nucleotides long, with 16 to 29mers being the most common.
  • oligonucleotides can be prepared by the art recognized methods such as phosphoramidate or H-phosphonate chemistry which can be carried out manually or by an automated synthesizer as described in Uhlmann et al . ( Chem. Rev. (1990) 90:534-583) and Agra al ( Trends Biotechn ⁇ l. ( 1992) 10 :152-158) .
  • the oligonucleotides of the invention may also be modified in a number of ways without compromising their ability to hybridize to VEGF mRNA.
  • the oligonucleotides may contain at least one or a combination of other than phosphodiester internucleotide linkages between the 5 ' end of one nucleotide and the 3 ' end of another nucleotide in which the 5 ' nucleotide phosphodiester linkage has been replaced with any number of chemical groups .
  • Examples of such chemical groups include alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters.
  • US Patent No. 5,149,797 describes traditional chimeric oligonucleotides having a phosphorothioate core region interposed between methylphosphonate or phosphoramidate flanking regions.
  • No. (47508-559) filed on August 9, 1995 discloses "inverted" chimeric oligonucleotides comprising one or more nonionic oligonucleotide region (e.g. alkylphosphonate and/or phosphoramidate and/or phosphotriester internucleoside linkage) flanked by one or more region of oligonucleotide phosphorothioate.
  • oligonucleotides with modified internucleotide linkages can be prepared according to known methods (see, e.g., Goodchild (1990) Bioconjugate Chem. 2:165-187; Agrawal et al . ,
  • the phosphorothioate linkages may be mixed Rp and Sp enantiomers, or they may be stereoregular or substantially stereoregular in either Rp or Sp form (see Iyer et al . (1995) Tetrahedron Asymmetry 6:1051-1054) .
  • Oligonucleotides with phosphorothioate linkages can be prepared using methods well known in the field such as phosphoramidite (see, e.g., Agrawal et al . (1988) Proc. Natl. Acad. Sci. (USA ) 85:7079-7083) . or by H- phosphonate (see, e.g., Froehler (1986) Tetrahedron Lett. 27:5575-5578) chemistry.
  • the synthetic methods described in Bergot et al . J. Clwomatog. (1992) 559:35-42) can also be used.
  • Oligonucleotides which are self-stabilized are also considered to be modified oligonucleotides useful in the methods of the invention (Tang et al . (1993) Nucleic Acids Res. 20:2729-2735) . These oligonucleotides comprise two regions: a target hybridizing region; and a self-complementary region having an oligonucleotide sequence complementary to a nucleic acid sequence that is within the self- stabilized oligonucleotide.
  • modifications include those which are internal or at the end(s) of the oligonucleotide molecule and include additions to the molecule of the internucleoside phosphate linkages, such as cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the genome.
  • cholesteryl or diamine compounds with varying numbers of carbon residues between the amino groups and terminal ribose, deoxyribose and phosphate modifications which cleave, or crosslink to the opposite chains or to associated enzymes or other proteins which bind to the genome.
  • modified oligonucleotides include oligonucleotides with a modified base and/or sugar such as arabinose instead of ribose, or a 3 ' , 5 ' - substituted oligonucleotide having a sugar which, at both its 3 ' and 5 ' positions is attached to a chemical group other than a hydroxyl group (at its 3' position) and other than a phosphate group (at its 5 ' position) .
  • modifications to sugars include modifications to the 2 ' position of the ribose moiety which include but are not limited to 2 ' -O-substituted with an -O- lower alkyl group containing 1-6 saturated or unsaturated carbon atoms, or with an -O-aryl, or allyl group having 2-6 carbon atoms wherein such -O-alkyl, aryl or allyl group may be unsubstituted or may be substituted, (e.g., with halo, hydroxy, trifluoromethyl cyano, nitro acyl acyloxy, alkoxy, carboxy, carbalkoxyl, or amino groups) , or with an amino, or halo group.
  • Application Serial No. (47508-559) discloses an "inverted" hybrid oligonucleotide which includes an oligonucleotide comprising a 2 ' -O-substituted (or 2' OH, unsubstituted) RNA region which is in between two oligodeoxyribonucleotide regions, a structure that "inverted relative to the "traditional" hybrid oligonucleotides .
  • Nonlimiting examples of particularly useful oligonucleotides of the invention have 2 ' -O-alkylated ribonucleotides at their 3 ' , 5 1 , or 3 ' and 5' termini, with at least four or five contiguous nucleotides being so modified.
  • Non-limiting examples of 2 ' -O-alkylated groups include 2 '-0-methyl, 2 '-0-ethyl, 2 ' -O- propyl, and 2 ' -O-butyls .
  • modified oligonucleotides are capped with a nuclease resistance-conferring bulky substituent at their 3 ' and/or 5 1 end(s) , or have a substitution in one nonbridging oxygen per nucleotide.
  • Such modifications can be at some or all of the internucleoside linkages, as well as at either or both ends of the oligonucleotide and/or in the interior of the molecule.
  • H-Z2 90-62 GGCTCCAATGCACCCAAGACAGCAGAAAG 11
  • H-Z3 90-62 GGCTCCAATGCACCCAAGACAGCAGAAAG 11
  • H-Z6 90-62 GGCTCCAATGCACCCAAGACAGCAGAAAG 11
  • H-Z9 90-62 GGCTCCAATGCACCCAAGACAGCAGAAAG 11
  • H-3D1 80-63 CACCCAAGACAGCAGAAA 12
  • H-3D9 80-63 CACCCAAGACAGCAGAAA 12
  • H-3D10 80-63 CACCCAAGACAGCAGAAA 12
  • H-3E1 80-64 CACCCAAGACAGCAGAA 13
  • H-3E9 80-64 CACCCAAGACAGCAGAA 13
  • H-3E10 80-64 CACCCAAGACAGCAGAA 13
  • H-3F9 80-65 CACCCAAGACAGCAGA 14 H-3F10 80-65 CACCCAAGACAGCAGA 14
  • nucleotides bolded in the oligonucleotides above are 2 ' -0-alkylated, and all of the nucleotides are linked via non- phosphodiester internucleotide linkages such as phosphorothioates .
  • nucleotides can be covalently linked using art-recognized techniques such as phosphoramidate, H-phosphonate chemistry, or methylphosphoramidate chemistry (see, e.g., Uhlmann et al. (1990) Chem. Rev. 90:543-584; Agrawal et al . (1987) Tetrahedron. Lett. 28 : (31) : 3539-3542 ) ; Caruthers et al. (1987) Meth. Enzy mol. 154:287-313; U.S. Patent
  • Oligomeric phosphorothioate analogs can be prepared using methods well known in the field such as methoxyphosphoramidite (see, e.g.,
  • the synthetic antisense oligonucleotides of the invention in the form of a therapeutic formulation are useful in treating diseases, and disorders, and conditions associated with angiogenesis and neovascularization including, but not limited to, retinal neovascularization, tumor growth, and wound healing.
  • a therapeutic amount of a synthetic oligonucleotide of the invention and effective in inhibiting the expression of vascular endothelial growth factor is administered to a cell.
  • This cell may be part of a cell culture, a neovascularized tissue culture, or may be part or the whole body of an animal such as a human or other mammal .
  • Administration may be bolus, intermittent, or continuous, depending on the condition and response, as determined by those with skill in the art.
  • the oligonucleotide is administered locally (e.g., intraocularly or interlesionally) and/or systemically.
  • local administration refers to delivery to a defined area or region of the body, while the term “systemic administration is meant to encompass delivery to the whole organism by oral ingestion, or by intramuscular, intravenous, subcutaneous, or intraperitoneal injection.
  • ROP retinopathy of prematurity
  • diabetic retinopathy diabetic retinopathy
  • age- related macular degeneration sickle cell retinopathy
  • neovascular glaucoma retinal vein occlusion
  • retinal vein occlusion retinal vein occlusion
  • the synthetic oligonucleotides of the invention may be used as part of a pharmaceutical composition when combined with a physiologically and/or pharmaceutically acceptable carrier.
  • a physiologically and/or pharmaceutically acceptable carrier The characteristics of the carrier will depend on the route of administration.
  • Such a composition may contain, in addition to the synthetic oligonucleotide and carrier, diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
  • the pharmaceutical composition of the invention may also contain other active factors and/or agents which enhance inhibition of VEGF expression or which will reduce neovascularization.
  • combinations of synthetic oligonucleotides, each of which is directed to different regions of the VEGF mRNA may be used in the pharmaceutical compositions of the invention.
  • the pharmaceutical composition of the invention may further contain nucleotide analogs such as azidothymidine, dideoxycytidine, dideosyinosine, and the like.
  • nucleotide analogs such as azidothymidine, dideoxycytidine, dideosyinosine, and the like.
  • additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with the synthetic oligonucleotide of the invention, or to minimize side-effects caused by the synthetic oligonucleotide of the invention.
  • the synthetic oligonucleotide of the invention may be included in formulations of a particular anti-VEGF or anti-neovascularization factor and/or agent to minimize side effects of the anti-VEGF factor and/or agent.
  • the pharmaceutical composition of the invention may be in the form of a liposome in which the synthetic oligonucleotides of the invention is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which are in aqueous solution.
  • Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like.
  • One particularly useful lipid carrier is lipofectin. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No.
  • the pharmaceutical composition of the invention may further include compounds such as cyclodextrins and the like which enhance delivery of oligonucleotides into cells, as described by Zhao et al . (in press) , or slow release polymers.
  • the term "therapeutically effective amount” means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, i.e., healing of chronic conditions characterized by neovascularization or a reduction m neovascularization, itself, or m an increase m rate of healing of such conditions
  • a meaningful patient benefit i.e., healing of chronic conditions characterized by neovascularization or a reduction m neovascularization, itself, or m an increase m rate of healing of such conditions
  • the term refers to that ingredient alone
  • the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered combination, serially or simultaneously
  • a therapeutically effective amount of one, two, or more of the synthetic oligonucleotides of the invention is administered to a subject afflicted with a disease or disorder related to neovascularization, or to a tissue which has been neovascularized
  • the synthetic oligonucleotide of the invention may be administered in accordance with the method of the invention either alone of in combination with other known therapies for neovascularization
  • the synthetic oligonucleotide of the invention may be administered either simultaneously w th the other treatment (s) , or sequentially If administered sequentially, the attending physician will decide on the appropriate sequence of administering the synthetic oligonucleotide of the invention m combination with the other therapy
  • Administration of the synthetic oligonucleotide of the invention used m the pharmaceutical composition or to practice the method of the present invention can be carried out in a variety of conventional ways, such as intraocular, oral ingestion, inhalation, or cutaneous, subcutaneous, intramuscular, or intravenous injection.
  • the synthetic oligonucleotide When a therapeutically effective amount of synthetic oligonucleotide of the invention is administered orally, the synthetic oligonucleotide will be in the form of a tablet, capsule, powder, solution or elixir.
  • the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
  • the tablet, capsule, and powder contain from about 5 to 95% synthetic oligonucleotide and preferably from about 25 to 90% synthetic oligonucleotide.
  • a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, sesame oil, or synthetic oils may be added.
  • the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
  • the pharmaceutical composition When administered in liquid form, contains from about 0.5 to 90% by weight of the synthetic oligonucleotide and preferably from about 1 to 50% synthetic oligonucleotide.
  • the synthetic oligonucleotide of the invention When a therapeutically effective amount of synthetic oligonucleotide of the invention is administered by intravenous, subcutaneous, intramuscular, intraocular, or intraperitoneal injection, the synthetic oligonucleotide will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • parenterally acceptable solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
  • a preferred pharmaceutical composition for intravenous, subcutaneous, intramuscular, intraperitoneal, or intraocular injection should contain, in addition to the synthetic oligonucleotide, an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
  • an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, Lactated Ringer's Injection, or other vehicle as known in the art.
  • the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
  • the amount of synthetic oligonucleotide in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patent has undergone. Ultimately, the attending physician will decide the amount of synthetic oligonucleotide with which to treat each individual patient. Initially, the attending physician will administer low doses of the synthetic oligonucleotide and observe the patient's response. Larger doses of synthetic oligonucleotide may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further. It is contemplated that the various pharmaceutical compositions used to practice the method of the present invention should contain about 10 ⁇ g to about 20 mg of synthetic oligonucleotide per kg body or organ weight.
  • the duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient . Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
  • Proliferative retinopathy can reach a threshold in a matter of days as seen in ROP, some cases of diabetic retinopathy, and neovascular glaucoma. Premature infants are at risk for neovascularization around what would be 35 weeks gestation, a few weeks after birth, and will remain at risk for a short period of time until the retina becomes vascularized. Diabetic retinopathy can be acute but may also smolder in the proliferative phase for considerably longer. Diabetic retinopathy will eventually become quiescent as the vasoproliferative signal diminishes with neovascularization or destruction of the retina.
  • Intravitreal injections of oligonucleotides against VEGF can be an effective means of inhibiting retinal neovascularization in an acute situation.
  • systemic delivery intraperitoneal, intramuscular, subcutaneous, intravenous either with carriers such as saline, slow release polymers, or liposomes should be considered.
  • oligonucleotides may be preferable. Since the disease process concerns vessels which are abnormal and leaky, the problem of passage through the blood brain barrier may not be a problem. Therefore, systemic delivery may prove efficacious.
  • the frequency of injections is from continuous infusion to once a month, depending on the disease process and the biological half life of the oligonucleotides.
  • antisense oligonucleotides specific for VEGF are useful in determining the role of this cytokine in processes where neovascularization is involved.
  • this technology is useful in in vitro systems which mimic blood vessel formation and permeability, and in in vivo system models of neovascularization, such as the murine model described below.
  • Oligonucleotides of the invention are also useful in a method of reducing the expression of VEGF.
  • the target VEGF expression can be in vitro or in any cell which expresses VEGF.
  • nucleic acid specific for VEGF is contacted with an oligonucleotide of the invention such that transcription of the nucleic acid to mRNA and/or protein is reduced or inhibited.
  • That oligonucleotides of the invention can inhibit VEGF expression at the protein level can be demonstrated using an ELISA which specifically detects human VEGF and a VEGF-expressing cell line such as a human glioblastoma (e.g., U373 ATCC Ac. no. HTB17 , American Type Culture Collection, Rockville, MD) or a human melanoma (e.g., SK-MEL- 2, ATCC Ac. no. HTB68, American Type Culture Collection, Rockville, MD; or M21) .
  • a human glioblastoma e.g., U373 ATCC Ac. no. HTB17 , American Type Culture Collection, Rockville, MD
  • a human melanoma e.g., SK-MEL- 2, ATCC Ac. no. HTB68, American Type Culture Collection, Rockville, MD; or M21
  • FIGS. 2, 3, and 4 a human glioblastoma cell line U373 and a human melanoma cell lme M21 were treated with VEGF- specific oligonucleotides of the invention, these cells stop expressing VEGF a sequence-specific manner, as shown m FIGS. 2, 3, and 4, and in FIG. 5, respectively.
  • FIG 6 demonstrates that modification of the oligonucleotides does not reduce their inhibitory activity.
  • Oligonucleotides of the invention also reduced VEGF mRNA expression, as demonstrated by the Northern analyses described in EXAMPLE 4 below
  • VEGF ' s role in tumor formation in vivo can be demonstrated using an athymic mouse injected with as an animal model. M21 cells are known to generate palpable tumors in mice m about 1 to 1.5 weeks. Alternately, a U373 cell line which has been passed through an athymic mouse the presence of Engelbreth Holm Swarm (EMS) tumor matrix (Matrigel 7 *, Collaborative Research, Waltham, MA) may be used.
  • EMS Engelbreth Holm Swarm
  • mice When mice are injected with VEGF-specific oligonucleotides of the invention, there will be a reduction in tumor weight and volume if VEGF expression is reduced by oligonucleotides or pharmaceutical formulations of the invention.
  • VEGF plays a role m retinal neovascularization
  • VEGF vascular endothelial growth factor
  • Three independent experiments were performed using antisense oligonucleotides specific for VEGF (JG-3 (SEQ ID NO: 17), JG-4, (SEQ ID NO:18) , and Vm (SEQ ID NO: 19) , and a corresponding sense oligonucleotide (V2 (SEQ ID NO:20) .
  • These oligonucleotides were designed using the known nucleic sequence of murine VEGF (Claffee et al . (1992) J. Biol. Chem. 267:16317-16322) .
  • the sequence of the Vm oligonucleotide is targeted to the sequence surrounding the translational TGA stop site (TGA) .
  • the sequence of JG-4 is targeted to the sequence 5 ' to and containing the ATG of the translational start site of the murine VEGF molecule.
  • the sequence of JG-3 is targeted to the 5' untranslated region, and the V2 sense sequence is targeted to the sequence surrounding the translational start site (ATG) .
  • Human VEGF cDNA is transcribed in vitro using an in vitro eucaryotic transcription kit (Stratagene, La Jolla, CA) .
  • the RNA is labelled with 32 P using T-4 polynucleotide kinase as described by (Sambrook et al . ( 1989 ) Molecular Cloning; a Laboratory Manual , Cold
  • RNA-DNA duplexes RNA-DNA duplexes
  • RNase H an enzyme which cleaves RNA-DNA duplexes
  • Cleavage patterns are analyzed on a 6% polyacrylamide urea gel. The specific location of the cleaved fragments is determined using a human VEGF sequence ladder (Sequenase Kit, United States Biochemical, Cleveland, OH) .
  • Oligonucleotides having sequences complementary to VEGF nucleic acid determined as described above were synthesized on a Pharmacia Gene Assembler series synthesizer using the phosphoramidite procedure (see, e.g., Uhlmann et al. ( Chem. Rev. (1990) 90:534-583; Agrawal (1992) Trends in Biotech. 10:152-158; Agrawal et al. (1995) Curr. Opin. Biotechnol. 6:12-19) . Following assembly and deprotection, oligonucleotides were ethanol precipitated twice, dried, and suspended in phosphate-buffered saline (PBS) at the desired concentration.
  • PBS phosphate-buffered saline
  • oligonucleotide purity was tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation was determined using the Luminous Amebocyte Assay (Bang (1953) Biol. Bull. (Woods Hole, MA) 105:361-362) .
  • DME glucose
  • 2 mM glutamate Mediatech, Washington, DC
  • penicillin/streptomycin 100 IU/MI/100 mcg/ml, Mediatech, Washington, DC
  • the cells were cultured at 37°C under 10% C0 2 .
  • the cells were plated in 96 well tissue culture dishes (Costar Corp., Cambridge, MA) and maintained as above.
  • the cells were placed under anoxic conditions for 18-20 hours using an anaerobic chamber (BBL Gas Pak, Cockeysville, MD) or in the presence of 250 ⁇ M CoCl 2 .
  • U373 glioblastoma cells were plated in a 96 well tissue culture dish and treated overnight with varying concentrations of antisense oligonucleotides against human VEGF in the presence of 5 ⁇ g/ml lipofectin. The cells were refed after 7 to 12 hours with fresh media and allowed to recover for 5 to 7 hours. The dishes were placed under hypoxic conditions for 18 to 20 hours using an anaerobic chamber (Gas Pac,
  • Cockeysville, MD Cockeysville, MD
  • 250 ⁇ M CoCl 2 Cells maintained under normoxic conditions served as uninduced controls .
  • the media was analyzed using the antigen capture ELISA assay described below (approximately 24 hours post treatment) .
  • the culture medium from the cells described in EXAMPLE 2 was analyzed for VEGF protein as follows. 96-well plates (Maxizorb ELISA Nunc A/S, Camstrup, Denmark) were treated overnight at 4°C with 100 ⁇ l/well of the capture antibody, a monoclonal antibody against human VEGF (R&D Systems, Minneapolis, MN, 2.5 ⁇ g/ml in IX PBS) . The wells were washed three times with lx PBS/0.05% Tween-20 (United States Biochemical, Cleveland, OH) using a plate washer (Dynatech, Gurnsey Channel Islands) .
  • Non-specific binding sites in the wells were blocked by adding 2% normal human serum (200 ⁇ l) and incubating the plate at 37°C for 2 hours. This blocking solution was removed and 200 ⁇ l conditioned medium containing human VEGF added to each well and incubated at 37°C for 2 to 3 hours or overnight at 4°C. The plates were washed as described above. 100 ⁇ l of the primary antibody (618/619, 2 ⁇ g/ml in normal human serum) was added to each well and incubated at 37°C for 1 to 2 hours. The primary antibody was an affinity purified rabbit anti- human VEGF polyclonal) . The plates were washed as described above.
  • Northern blotting was performed according to the methods of Sambrook et al . ( Molecular Cloning: Laboratory Manual , Cold Spring Harbor Laboratory Press, NY) (1989) Vol. 1, pp. 7.38) or Arcellana-Panlilio et al . ( Meth. Enz.
  • RNA expression was reduced in the presence of VEGF-specific oligonucleotides of the invention, and is not significantly affected by the presence of control sense oligonucleotide.
  • U373 glioblastoma cells were treated with 0.5 ⁇ M antisense phosphorothioate oligodeoxynucleotide (H-3, SEQ ID NO : 1 ) or control (H3-sense phosphorothioate oligonucleotide; SEQ ID NO: 21) for 7 hours in the presence of 5 ⁇ g/ ⁇ l
  • Lipofectin (Gibco-BRL, Gaithersburg, MD) . 1 x 10 6 oligonucleotide-treated cells were mixed with 250 ⁇ l Matrigel 1 * (Collaborative Research, Waltham, MA; 10-12 mg/ml) and injected subcutaneously into 6-8 week old athymic mice (about 20 g) (Charles River Laboratories, Wilmington, MA) on both the left and right sides. These cells respond to hypoxia and express increased levels of VEGF. The mice were maintained ad libitum and sacrificed 8 days post injection. The skin was dissected to expose the Matrigel pellet. Gross photography of the surrounding blood vessels was performed with a Zeiss Macroscope. The Matrigel plugs were removed and fixed in formalin for paraffin embedding and histological analysis. Tissue sections were stained with hematoxylin and eosin for quantitation of blood vessel growth into the Matrigel plug.
  • Matrigel plugs combined with U373 glioblastoma cells contained visible hemhorraging . In addition, the capillary bed surrounding the plug was more dense and the blood vessels were more tortuous. Athymic mice injected with Matrigel plugs combined with antisense oligonucleotide- treated cells generated less angiogenesis than the mice injected with Matrigel plugs and either untreated cells or cells pretreated with the control oligonucleotide. Matrigel plugs containing antisense treated cells also had less visible hemhorraging. The results suggest that antisense oligonucleotide treatment inhibit VEGF- induced angiogenesis.
  • Athymic mice 6 week old athymic mice (about 20 g) are purchased from Charles River Laboratories.
  • Human melanoma M21 cells or human glioblastoma U373 cells which have been passaged through athymic mice in the presence of Matrigel are injected subcutaneously (2-20 x IO 6 ) into the flank of athymic mice. Palpable tumors are generated in 1- 2 weeks .
  • Subcutaneous antisense or sense control oligonucleotide injections begin one day following the injection of the tumor cells. The concentration of oligonucleotide is determined and ranges between 5 and 50 mg/kg. Animals are then injected over a period of three weeks. They are then sacrificed and the tumors removed. Tumors are analyzed initially for weight and volume. In addition, analysis includes sectioning and staining for VEGF/VPF protein using an anti- human
  • VEGF/VPF monoclonal antibody R&D Systems, Minneapolis, MN
  • VEGF/VPF RNA using in situ hybridization techniques. Mice injected with antisense oligonucleotides of the invention are expected to have smaller tumors than those injected with vehicle or the control.
  • JG-3 (SEQ ID NO: 17)
  • JG-4 (SEQ ID NO:18)
  • Vm (SEQ ID NO: 19)
  • V2 (SEQ ID NO:20)
  • mice Seven day postnatal mice (P7, C57bl/6J, (Children's Hospital Breeding Facilities, Boston, MA) were exposed to 5 days of hyperoxic conditions (75 +/- 2%) oxygen in a sealed incubator connected to a Bird 3-M oxygen blender (flow rate: 1.5 liters/minute; Bird, Palm Springs, CA) .
  • the oxygen concentration was monitored by means of an oxygen analyzer (Beckman, Model D2, Irvine, CA) .
  • the mice were returned to room air. Maximal retinal neovascularization was observed 5 days after return to room air (P17) .
  • P21 the level of retinal neovascularization was just beginning to regress.
  • antisense oligonucleotides were injected into the vitreous with a Hamilton syringe and a 33 gauge needle (Hamilton Company, Reno, NV) .
  • the animals were anesthetized for the procedure with Avertin ip.
  • the mice were given a single injection of antisense oligonucleotides (or sense or non-sense controls) at P12 achieving a final concentration of approximately 30-50 ⁇ M.
  • the animals were sacrificed at P17 with tribromoethanol ip (0.1 ml/g body weight) and cervical dislocation.
  • the eyes were enucleated, fixed in 4% paraformaldehyde, and embedded in paraffin. Serial sections of the whole eyes were cut sagittally, through the cornea, and parallel to the optic nerve. The sections were stained with hematoxylin and periodic acid-Schiff (PAS) stain. The extent of neovascularization in the treated eyes was determined by counting endothelial cell nuclei extending past the internal limiting membrane into the vitreous. Nuclei from new vessels and vessel profiles could be distinguished from other structures in the retina and counted in cross-section with light microscopy. Additional eyes were sectioned and examined by in situ hybridization to a VEGF probe.
  • PAS periodic acid-Schiff
  • mice were perfused with a 50 mg/ml solution of high molecular weight fluorescein-dextran (Sigma Chemical Company, St. Louis, MO) in 4% paraformaldehyde.
  • the eyes were enucleated, fixed in paraformaldehyde, and flat- mounted with glycerol-gelati .
  • the flat-mounted retinas were viewed and photographed by fluorescence microscopy using an Olympus BX60 fluorescence microscope (Olympus America Corp., Bellingham, MA) .
  • MOLECULE TYPE cDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA/RNA
  • HYPOTHETICAL NO
  • MOLECULE TYPE cDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE YES
  • MOLECULE TYPE cDNA
  • HYPOTHETICAL NO
  • ANTI-SENSE NO

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Endocrinology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des oligonucléotides complémentaires de l'acide nucléique spécifique du VEGF, convenant particulièrement à la réduction de l'expression du VEGF. L'invention concerne également des formulations pharmaceutiques contenant de tels oligonucléotides convenant particulièrement au traitement de divers troubles associés à une néovascularisation et une angiogénèse.
EP96943587A 1995-12-08 1996-12-05 Oligonucleotides antisens modifies specifiques de vegf Withdrawn EP0865489A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US569926 1995-12-08
US08/569,926 US5641756A (en) 1993-07-27 1995-12-08 Modified VEGF oligonucleotides
PCT/US1996/019320 WO1997021808A1 (fr) 1995-12-08 1996-12-05 Oligonucleotides antisens modifies specifiques de vegf

Publications (1)

Publication Number Publication Date
EP0865489A1 true EP0865489A1 (fr) 1998-09-23

Family

ID=24277485

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96943587A Withdrawn EP0865489A1 (fr) 1995-12-08 1996-12-05 Oligonucleotides antisens modifies specifiques de vegf

Country Status (5)

Country Link
EP (1) EP0865489A1 (fr)
JP (1) JP2000501941A (fr)
AU (1) AU1279397A (fr)
CA (1) CA2239991A1 (fr)
WO (1) WO1997021808A1 (fr)

Families Citing this family (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030216335A1 (en) * 2001-11-30 2003-11-20 Jennifer Lockridge Method and reagent for the modulation of female reproductive diseases and conditions
US7087580B2 (en) 1998-04-23 2006-08-08 Genesense Technologies, Inc. Neuropilin antisense oligonucleotide sequences and methods of using same to modulate cell growth
FR2793798A1 (fr) * 1999-05-21 2000-11-24 Inst Nat Sante Rech Med OLIGONUCLEOTIDES ANTISENS DE EF-Ts
CN101053573A (zh) * 2000-01-19 2007-10-17 帕卡什·S·吉尔 针对反义vegf寡核苷酸的方法和组合物
AU2006233188B2 (en) * 2000-01-19 2008-01-24 Parkash S Gill Pharmaceutical compositions and methods of treatment based on VEGF antisense oligonucleotides
US20050148530A1 (en) 2002-02-20 2005-07-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
WO2006006948A2 (fr) 2002-11-14 2006-01-19 Dharmacon, Inc. Methodes et compositions permettant de selectionner des arnsi presentant une fonctionnalite amelioree
US8090542B2 (en) * 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
EP2598639A4 (fr) 2010-07-28 2014-08-13 Alcon Res Ltd Siarn ciblant la vegfa et méthodes de traitement in vivo
WO2012058210A1 (fr) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. INHIBITION FACILITÉE PAR L'INTERFÉRENCE D'ARN DE L'EXPRESSION D'UN GÈNE AU MOYEN D'ACIDES NUCLÉIQUES INTERFÉRENTS COURTS (siNA)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5641756A (en) * 1993-07-27 1997-06-24 Hybridon, Inc. Modified VEGF oligonucleotides
US6410322B1 (en) * 1993-07-27 2002-06-25 Hybridon Inc Antisense oligonucleotide inhibition of vascular endothelial growth factor expression
US5731294A (en) * 1993-07-27 1998-03-24 Hybridon, Inc. Inhibition of neovasularization using VEGF-specific oligonucleotides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9721808A1 *

Also Published As

Publication number Publication date
CA2239991A1 (fr) 1997-06-19
JP2000501941A (ja) 2000-02-22
WO1997021808A1 (fr) 1997-06-19
AU1279397A (en) 1997-07-03

Similar Documents

Publication Publication Date Title
US5641756A (en) Modified VEGF oligonucleotides
CA2210998C (fr) Inhibition de la neoformation de vaisseaux sanguins au moyen d'oligonucleotides specifiques de vegf
US5639872A (en) Human VEGF-specific oligonucleotides
US6306829B1 (en) Modified VEGF oligonucleotides for treatment of skin disorders
EP1340765A2 (fr) Oligonucleotides chimères et hybrides inversés
WO1997021808A1 (fr) Oligonucleotides antisens modifies specifiques de vegf
US5866699A (en) Oligonucleotides with anti-MDR-1 gene activity
US20050222065A1 (en) Vascular therapeutics
US5969117A (en) Modified protein kinase a-specific oligonucleotide
WO1997011171A9 (fr) Oligonucleotides modifiees specifiques de la proteine kinase a et leurs modes d'utilisation
CA2214431C (fr) Oligonucleotides antisens specifiques du facteur de croissance de l'endothelium vasculaire humain
US5789248A (en) CAPL-specific oligonucleotides and method of inhibiting metastatic cancer
WO1998049287A2 (fr) Oligonucleotides antisens specifiques d'une thymidylate synthase
EP1007656A1 (fr) Oligonucleotides modifies specifiques de la proteine kinase a et methodes d'utilisation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980605

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 19981001

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19990413