EP0862620A1 - Gene de la tyrosine kinase et produit genique associe - Google Patents

Gene de la tyrosine kinase et produit genique associe

Info

Publication number
EP0862620A1
EP0862620A1 EP96936414A EP96936414A EP0862620A1 EP 0862620 A1 EP0862620 A1 EP 0862620A1 EP 96936414 A EP96936414 A EP 96936414A EP 96936414 A EP96936414 A EP 96936414A EP 0862620 A1 EP0862620 A1 EP 0862620A1
Authority
EP
European Patent Office
Prior art keywords
polynucleotide
polypeptide
seq
leu
tnkl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96936414A
Other languages
German (de)
English (en)
Inventor
Curt I. Civin
Donald Small
Gerard T. Hoehn
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Johns Hopkins University
Original Assignee
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Johns Hopkins University filed Critical Johns Hopkins University
Publication of EP0862620A1 publication Critical patent/EP0862620A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention has been identified as a tyrosine kinase gene, sometimes hereafter referred to as "Tnkl” and splice variant gene "Tnkl ⁇ .”. The invention also relates to inhibiting the action of such polypeptides.
  • HSC lymphohematopoietic stem cells
  • CD38 antigen is expressed on most CD34+ cells, but the 1-10% of CD34+ cells lacking CD38 antigen expression (CD34+/CD38 cells) , also lack expression antigens characterizing mature blood cell ("lineage antigens") (Terstappen, et al., Blood, 77:1218-1226 (1991)).
  • CD34+/Lin/CD38- cells can be replated in vi tro, and give rise to myeloid and lymphoid colonies in long-term culture assays (Huang, S. and Terstappen, W. M. M. , Nature, 360:867-870 (1992); Huang, S. and Terstappen, W. M. M., Blood 83:1515-1526 (1994)).
  • this CD34+/Lin7CD38- cell population is an enriched population of early progenitors and likely HSC.
  • CD34+ cells obtained from umbilical cord blood contain a larger fraction of CD34+/Lin" /CD38 " cells as compared to adult bone marrow (Cardoso A. A.
  • cord blood contains higher numbers of cells with high proliferative potency in in vivo hematopoietic assays (Broxmeyer, H. E., et al. , PNAS, USA, 89:4109-4113 (1992)); Lu, L., et al., Blood, 81:41-48 (1993); Cardoso, A. A., et al., PNAS, USA, 90:8707-8711 (1993)).
  • Tyrosine kinases are a large, and rapidly growing family of protein ⁇ important in regulating cell growth and differentiation (Fantl, . J., et al., Annu. Rev. Biochem., 62: 453-481 (1993)).
  • Receptor tyrosine kinases contain an extracellular ligand-binding domain, a transmembrane domain, and a highly conserved catalytic kinase domain. Binding of ligand to receptor initiates a cascade of signals, culminating in a biological response. Early events include receptor dimerization, autophosphorylation on tyrosine residue( ⁇ ), and subsequent activation of catalytic activity (Ullrich, A. and Schlessinger, J.
  • non-receptor tyrosine kinases including members of the src and Jak families are involved further downstream, in intracellular signalling pathways. These non-receptor tyrosine kinases also contain the conserved catalytic kinase domain, and often contain domains that mediate protein: rotein interactions, such as SH2 and SH3 domains (Bolen, (1993); Musacchio, A., et al., FEBS Letters, 307:55- 61 (1992); Schlessinger, J. , Curr. Opin. Genet. Devel., 4:25- 30 (1994)).
  • a variety of receptor and non-receptor tyrosine kinases are important in the survival, proliferation and differentiation of hematopoietic cells.
  • the c- fms and c-Jit receptor tyrosine kinases have been shown to be required for the survival, proliferation and differentiation of monocytic cells and early hematopoietic progenitor cells, respectively (Sherr, C. J., Blood, 75:1-12 (1990); Chabot, B., et al., Nature, 335:88-89 (1988); Geissler, E. N. , et al., Cell, 55: 185-192 (1988)).
  • the non-receptor tyrosine kinase pp56 lck a src family member, is specifically expressed in T lymphocytes and is critical for their maturation (Amrein, K. E., et al., Proc. Nat. Aca. Sci. USA, 89:3343- 3346 (1992)), activation (Glaichenhaus, N. , et al., Cell, 64:511-520 (1991)), and IL-2 secretion (Karnitz, L., et al. , Mol. Cell. Biol., 12:4521-4530 (1992)).
  • pp56T' rt mediates signals derived by CD4 and CD8 receptors (Veilette, A., et al., Nature, 338:257-259 (1989)) .
  • the gene (SEQ ID N0:1, as shown in Figure 1) and gene product (SEQ ID N0:2, as shown in Figure 1) (and the splice variant gene (SEQ ID NO:3) and its gene product (SEQ ID NO:4) of the present invention have been putatively identified as the Tnkl gene and gene product (and the Tnkl ⁇ and gene product) as a result of homology to known tyrosine kinases.
  • novel mature polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • the polypeptides of the present invention are of human origin.
  • nucleic acid molecules encoding a polypeptide of the present invention including mRNAs, DNAs, cDNAs, genomic DNAs a ⁇ well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.
  • a proces ⁇ for producing such polypeptides by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and sub ⁇ equent recovery of said protein.
  • a process for utilizing such polypeptides, or polynucleotide encoding such polypeptides for therapeutic purposes for example, to suppress the transforming activity of certain genes by acting in a regulatory role, to regulate changes in the survival, proliferation and differentiation status of cells.
  • Preferred cells are hematopoietic stem and progenitor cells for bone marrow transplantation and support for cancer therapy.
  • antibodies against such gene and gene product (or to the splice variant gene) which may be employed, for example in labeled form, as markers.
  • Tnkl and Tnkl ⁇ agonists which elicit biological responses similar to native Tnkl and Tnkl ⁇ .
  • nucleic acid probe ⁇ comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.
  • diagnostic assays for detecting diseases or susceptibility to disease ⁇ related to mutation ⁇ in the nucleic acid sequences encoding a polypeptide of the present invention are provided.
  • FIG. 1 Polynucleotide (SEQ ID N0:1) and predicted amino acid sequence (SEQ ID NO:2) of Tnkl cDNA.
  • the conserved ATP binding motif present in all tyrosine kinases (GxGxxG) is underlined.
  • the conserved kinase region initially amplified from CD34+/Lin-/CD38- umbilical cord blood cDNA is shown in bold face type.
  • the double-underline indicates the putative SH3 domain.
  • Asterisks (*) denote potential SH3 binding motifs of the consensu ⁇ (P-x-x-P) .
  • the triangle ( ⁇ ) indicates a potential phosphotyrosine binding site for a recently described domain which recognizes the motif (N-x-x-Y) (Kavanaugh, W. M., et al., Science, 268:1177- 1180 (1995)).
  • the numbers on the left denote the DNA sequence; the numbers on the right refer to the amino acid sequence.
  • the Tnkl ⁇ splice variant cDNA (SEQ ID NO:3) and predicted amino acid sequence (SEQ ID NO:4) are the same as for Tnkl which are shown in Figure 1, except that nucleotide ⁇ 1359-1374 of SEQ ID NO:l are ab ⁇ ent, and corre ⁇ ponding amino acids 412-416 of SEQ ID NO:2 are absent.
  • FIG. 1 Alignment of the predicted Tnkl amino acid sequence with Ack. Homology begins at the NH2-terminus of both Tnkl (AA 27) and Ack (AA 83) and continues uninterrupted for 413 amino acids. This region includes the kinase domain (AA 123-372) and the putative SH3 domain (AA 396-441) . Homologous regions in the proline-rich domain (AA 530-556) and near the COOH-terminus (AA 638-664) are also shown. (+) indicate similar amino acids. The dashes in the sequence represent gaps to maximize alignment.
  • FIG. 3 Diagram of the structure of the Tnkl protein. The numbers refer to the amino acid sequence.
  • PTK350 refers to the original 210 bp PCR product amplified from CD34+/Lin- /CD38- umbilical cord blood cDNA. 1273 and 1623 refer to the region amplified in RT-PCR experiments.
  • the asteri ⁇ k ⁇ (*) denote the position of potential binding sites for SH3 domain ⁇ ; the triangle ( ⁇ ) refers to the po ⁇ ition of a potential binding site for a newly described pho ⁇ photyrosine binding domain.
  • the ⁇ olid line underneath denotes regions of homology to Ack.
  • p21 BD indicates a putative p21 binding domain.
  • nucleic acid (polynucleotide) sequence which encodes for the mature polypeptide having the deduced amino acid sequence of Figure l or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 69924 on October 5, 1995 with the ATCC 12301 Parklawn Drive, Rockville, MD 20852.
  • the gene of the present invention was isolated using degenerate PCR to clone tyrosine kinase genes from an enriched population of human umbilical cord blood hematopoietic stem/progenitor cell ⁇ .
  • the ⁇ equence of the complete Tnkl coding region predicts a 72 kD protein. Compari ⁇ on of Tnkl to ⁇ equence ⁇ in protein databa ⁇ e ⁇ reveal ⁇ that it i ⁇ mo ⁇ t homologous to Ack, an intracellular tyrosine kinase.
  • Tnkl consists of an N-terminal kinase domain, a putative SH3 domain immediately C-terminal to the kinase domain, and a proline-rich C-terminal region. Homology between Tnkl and Ack diverges immediately following the SH3 domain. In Ack, this region is required for binding to the GTP-bound form of p21cdc42Hs (Manser et al., Nature. 363:364-367 (1993)). Analysis of Tnkl mRNA expression demonstrate ⁇ that Tnkl i ⁇ expressed in all cord blood, bone marrow and adult blood subpopulation ⁇ , as well as in most of the leukemia cell lines examined (16 of 20) .
  • Hybridization to fetal multi-tissue Northern blots detected several different Tnkl transcripts in all 4 fetal tissues examined. In contrast, a single 3.0 Kb Tnk transcript was detected in only 5 of 16 adult tissues examined (colon, prostate, and ovary, ⁇ mall intestine, and testis) .
  • Tnkl Fluorescence in si tu hybridization (FISH) analysis of metaphase chromosomes localized the Tnkl gene to the short arm of chromosome 17 (17pl3.1), near the p53 locus.
  • FISH Fluorescence in si tu hybridization
  • Tnkl i ⁇ just N-terminal to, and in frame with, a region of high homology Tnkl share ⁇ with another tyrosine kinase gene, Ack (Manser, E. et al., Nature, 363, 364-367 (1993)) .
  • Ack tyrosine kinase gene
  • this homologous region is al ⁇ o near the N-terminu ⁇ .
  • the Tnkl open reading frame terminate ⁇ at nt 2115, encoding a 666 amino acid protein with a molecular weight of about 72kD.
  • the Tnkl kinase domain contains all 12 conserved structural domains present in the tyrosine kinase family, including the ATP binding site (GxGxxG, aa 123-128) and the highly conserved tyrosine kinase domains (VHRDLAA and SDVWSFG) (Hanks, S.K. et al. , Science, 241, 42-52 (1988)). Tnkl has a methionine residue in this latter conserved motif, instead of the second conserved serine residue.
  • the tyrosine kinases Ack and Fak (Manser, E. et al., Nature, 363, 364-367 (1993); Whitney, G.S., et al.
  • kinase domain of Tnkl is near the N-terminu ⁇ (AA 123-372) .
  • N-x-x-Y AA 74-77
  • This region may serve as a possible binding site for a recently described phosphotyro ⁇ ine binding domain (Kavanaugh, W.M. et al., Science, 268, 1177-1180 (1995)).
  • C-terminal to the kinase domain of Tnkl are several proline-rich areas, including P-x- x-P motifs (around AA' ⁇ 345 and 535), which may serve as binding site ⁇ for SH3 domain ⁇ of other ⁇ ignal tran ⁇ duction proteins (Cohen, G.B. et al., Cell, 80, 237-248 (1995); Alexandropoulo ⁇ , K. et al., Proc. Nat. Acad. Sci. USA, 92, 3110-3114 (1995)).
  • there is a region (AA 396- 431) which is highly homologous to the SH3 domain of Ack (Manser, E. et al., Nature, 363, 364-367 (1993)).
  • Tnkl is 60% homologous to Ack (45% identical, 60% conserved) , over a 413 amino acid span (AA 28-441 of Tnkl) including the entire kinase domain (AA123-372, 43% identical, 57% conserved) and the putative SH3 domain (AA 396-441, 44% identical, 56% conserved) (Figure 2) .
  • the structure of the predicted Tnkl polypeptide i ⁇ similar to Ack in that it contains an N-terminal kinase domain, followed by an SH3 domain and a proline-rich C- terminal region ( Figure 3) .
  • Tnkl mRNA is present in total mononuclear cells, CD34+/Lin- cells and CD34- cells from umbilical cord blood and bone marrow. In addition, adult blood mononuclear cell and granulocytes both express Tnkl mRNA.
  • Tnkl is a rare transcript
  • RT-PCR was used to investigate Tnkl expression in these cells lines.
  • a cDNA was synthe ⁇ ized from Poly(A) RNA (approximately -1 ⁇ g) from 20 different human leukemia cell line ⁇ , amplified with Tnkl specific primers, electrophoresed and then probed with an internal Tnkl specific oligonucleotide. Of the 20 lines examined, 16 expres ⁇ ed detectable Tnkl mRNA. Thu ⁇ , Tnkl may be expre ⁇ sed ubiquitously during hematopoiesis.
  • Tnkl In contrast, only 5 of the 16 adult tis ⁇ ues expres ⁇ ed detectable Tnkl.
  • a single 3.0 Kb transcript is found only in adult prostate, ovary, small intestine, testis and colon. Tnkl transcript ⁇ are not found in adult lung, liver, kidney or brain. Thu ⁇ , Tnkl mRNA expre ⁇ ion appears to be higher in fetal tissues than in adult tissues.
  • the Tnkl gene was localized on human chromosome 17 via fluorescence in si tu hybridization (FISH) analysis on metaphase chromosomes from human lymphocytes. All 30 metaphase cells analyzed had at least 1 paired signal (involving both chromatids of a ⁇ ingle chromosome) . Of 46 paired signals, all were located on the p-arm of an E-group chromosome.
  • FPG Fluorescence plus Giemsa, Bhatt, B. et al., Nucl. Acids Res., 16, 3951-3961 (1988)
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA include ⁇ cDNA, genomic DNA, and ⁇ ynthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single ⁇ tranded may be the coding ⁇ trand or non-coding (anti-sense) strand.
  • the coding ⁇ equence which encode ⁇ the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure l and/or for the mature polypeptide encoded by the deposited cDNA may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence,- the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompas ⁇ e ⁇ a polynucleotide which include ⁇ only coding sequence for the polypeptide a ⁇ well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variant ⁇ of the hereinabove described polynucleotides, such as ⁇ plice variant
  • Tnklc- which encode for fragments, analog ⁇ and derivative ⁇ of the polypeptide having the deduced amino acid ⁇ equence of
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 and/or the ⁇ ame mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 and/or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variant ⁇ include deletion variants, substitution variants and addition or insertion variants, such as the polypeptide of SEQ ID NO:4.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 and/or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a sub ⁇ titution, deletion or addition of one or more nucleotide ⁇ , which does not sub ⁇ tantially alter the function of the encoded polypeptide.
  • the Tnkl ⁇ polypeptide ha ⁇ been shown by testing to have the ⁇ ame or ⁇ ub ⁇ tantially the ⁇ ame function as the Tnkl polypeptide.
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons) .
  • Fragments of the full length gene of the present invention may be used as a hybridization probe for a cDNA library to isolate the full length cDNA and to isolate other cDNAs which have a high ⁇ equence ⁇ imilarity to the gene or ⁇ imilar biological activity.
  • Probes of this type preferably have at least 15 ba ⁇ e ⁇ and may contain, for example, at least 30 base ⁇ or 50 or more bases.
  • the probe may also be u ⁇ ed to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promotor regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotide ⁇ having a ⁇ equence complementary to that of the gene of the present invention are used to ⁇ creen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • the present invention further relate ⁇ to polynucleotide ⁇ which hybridize to the hereinabove-de ⁇ cribed sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95% identity between the sequence ⁇ .
  • the present invention particularly relates to polynucleotide ⁇ which hybridize under ⁇ tringent condition ⁇ to the hereinabove-described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polypeptide ⁇ which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of Figure l and/or the depo ⁇ ited cDNA(s) .
  • the polynucleotide may have at least 20 bases, preferably at least 30 bases, and more preferably at least 50 ba ⁇ es which hybridize to a polynucleotide of the pre ⁇ ent invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity.
  • such polynucleotides may be employed as probes for the polynucleotide of, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
  • the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at lea ⁇ t a 95% identity to a polynucleotide which encode ⁇ the polypeptide of Figure l a ⁇ well a ⁇ fragment ⁇ thereof, which fragment ⁇ have at lea ⁇ t 15 ba ⁇ es and preferably at least 30 base ⁇ or at lea ⁇ t 50 base ⁇ and to polypeptides encoded by such polynucleotides .
  • the deposit (s) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure.
  • the deposit is an E. coli bacterial strain DH5 ⁇ harboring a plasmid (pTnkl) that contains the full- length 2,790 bp Tnkl cDNA.
  • the Tnkl cDNA has been cloned into the EcoRI ⁇ ite of pBlue ⁇ cript KS(-) (Stratagene, La Jolla, Ca) .
  • the present invention further relates to a polypeptide which has the deduced amino acid sequence of Figure 1 and/or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of ⁇ uch polypeptide.
  • fragment when referring to the polypeptide of Figure 1 and/or that encoded by the deposited cDNA, mean ⁇ a polypeptide which retain ⁇ e ⁇ entially the same biological function or activity as ⁇ uch polypeptide. Thu ⁇ , an analog include ⁇ a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the pre ⁇ ent invention may be a recombinant polypeptide, a natural polypeptide or a ⁇ ynthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 and/or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid re ⁇ idue ⁇ are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid re ⁇ idue ⁇ include ⁇ a ⁇ ubstituent group, or (iii) one in which the mature polypeptide is fused with another compound, ⁇ uch as a compound to increa ⁇ e the half-life of the polypeptide (for example, polyethylene glycol) , or (iv) one in which the additional amino acid ⁇ are fu ⁇ ed to the mature polypeptide for purification of the mature polypeptide.
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings
  • polypeptide ⁇ and polynucleotide ⁇ of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotide ⁇ could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.
  • polypeptides of the present invention include the polypeptide of Figure 1 (in particular the mature polypeptide) as well as polypeptides which have at lea ⁇ t 70% similarity (preferably at least 70% identity) to the polypeptide of Figure 1 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of Figure 1 and still more preferably at least 95% similarity (still more preferably at least 95% identity) to the polypeptide of Figure 1 and also include portions of ⁇ uch polypeptide ⁇ with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • similarity between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid sub ⁇ titute ⁇ of one polypeptide to the sequence of a second polypeptide.
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis,- therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragment ⁇ or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.
  • the pre ⁇ ent invention al ⁇ o relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant technique ⁇ .
  • Ho ⁇ t cells are genetically engineered (transduced or tran ⁇ formed or tran ⁇ fected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered ho ⁇ t cell ⁇ can be cultured in conventional nutrient media modified a ⁇ appropriate for activating promoters, selecting transformant ⁇ or amplifying the genes of the present invention.
  • the culture conditions, ⁇ uch a ⁇ temperature, pH and the like, are tho ⁇ e previously used with the host cell ⁇ elected for expre ⁇ ion, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotide ⁇ of the present invention may be employed for producing polypeptide ⁇ by recombinant technique ⁇ . Thu ⁇ , for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequence ⁇ , e.g. , derivatives of SV40; bacterial plasmids,- phage DNA,- baculovirus; yeast plasmids; vectors derived from combination ⁇ of pla ⁇ mids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA ⁇ equence in the expression vector is operatively linked to an appropriate expres ⁇ ion control sequence(s) (promoter) to direct mRNA synthe ⁇ i ⁇ .
  • promoter an appropriate expres ⁇ ion control sequence(s) (promoter) to direct mRNA synthe ⁇ i ⁇ .
  • a ⁇ repre ⁇ entative example ⁇ of ⁇ uch promoter ⁇ there may be mentioned: LTR or SV40 promoter, the E. coli . lac or Trp, the phage lambda P L promoter and other promoter ⁇ known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resi ⁇ tance in E. coli .
  • the vector containing the appropriate DNA ⁇ equence a ⁇ hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli , Streptomyces, Salmonella typhimurium
  • fungal cell ⁇ such as yeast
  • insect cells such as Drosophila S2 and Spodoptera Sf9
  • animal cells such as CHO, COS or Bowes melanoma,- adenoviru ⁇ e ⁇ ,- plant cell ⁇ , etc.
  • the present invention al ⁇ o include ⁇ recombinant con ⁇ tructs compri ⁇ ing one or more of the sequences as broadly described above.
  • the construct ⁇ comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been in ⁇ erted, in a forward or rever ⁇ e orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • suitable vectors and promoters are known to those of skill in the art, and are commercially available.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, p ⁇ iX174, pBlue ⁇ cript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); pTRC99a, pKK223- 3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, PSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable marker ⁇ .
  • Two appropriate vector ⁇ are pKK232-8 and pCM7.
  • Particular named bacterial promoter ⁇ include lad, lacZ, T3, T7, gpt, lambda P R , P L and Trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the pre ⁇ ent invention relate ⁇ to ho ⁇ t cell ⁇ containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the ho ⁇ t cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)) .
  • the construct ⁇ in host cells can be u ⁇ ed in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthe ⁇ izer ⁇ .
  • Mature protein ⁇ can be expre ⁇ ed in mammalian cell ⁇ , yea ⁇ t, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such protein ⁇ using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al. , Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. , (1989) , the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increa ⁇ e it ⁇ transcription. Examples include the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expre ⁇ ion vector ⁇ will include origin ⁇ of replication and selectable markers permitting tran ⁇ formation of the host cell, e.g., the ampicillin resi ⁇ tance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expre ⁇ ed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operon ⁇ encoding glycolytic enzyme ⁇ ⁇ uch as 3-phosphoglycerate kinase (PGK) , ⁇ -factor, acid phosphata ⁇ e, or heat ⁇ hock proteins, among others.
  • the heterologous structural sequence is as ⁇ embled in appropriate pha ⁇ e with translation initiation and termination ⁇ equences.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristic ⁇ , e.g., ⁇ tabilization or simplified purification of expressed recombinant product.
  • Useful expres ⁇ ion vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signal ⁇ in operable reading pha ⁇ e with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic ho ⁇ t ⁇ for tran ⁇ formation include E. coli , Bacillus subtilis, Salmonella typhimurium and variou ⁇ species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017) .
  • cloning vector pBR322 ATCC 37017
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA) .
  • pBR322 "backbone" ⁇ ections are combined with an appropriate promoter and the structural ⁇ equence to be expre ⁇ ed.
  • the selected promoter is induced by appropriate mean ⁇ (e.g., temperature ⁇ hift or chemical induction) and cells are cultured for an additional period.
  • appropriate mean ⁇ e.g., temperature ⁇ hift or chemical induction
  • Cell ⁇ are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cell ⁇ employed in expre ⁇ ion of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those ⁇ killed in the art.
  • mammalian cell culture ⁇ ystems can also be employed to expres ⁇ recombinant protein.
  • Example ⁇ of mammalian expre ⁇ ion ⁇ y ⁇ tem ⁇ include the COS-7 lines of monkey kidney fibrobla ⁇ t ⁇ , de ⁇ cribed by Gluzman, Cell, 23:175 (1981) , and other cell lines capable of expres ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell line ⁇ .
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and al ⁇ o any nece ⁇ ary ribo ⁇ ome binding ⁇ ite ⁇ , polyadenylation ⁇ ite, ⁇ plice donor and acceptor sites, transcriptional termination sequence ⁇ , and 5' flanking nontran ⁇ cribed ⁇ equences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture) .
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may al ⁇ o include an initial methionine amino acid re ⁇ idue.
  • Tnkl may be ⁇ ignalled, directly or via intermediate protein ⁇ , by the intracellular portion of a cell membrane receptor (after ligand bound to the receptor) directly or indirectly,- the receptor or intermediate protein may bind Tnkl and perhap ⁇ enzymatically activate Tnkl, for example, by phosphorylation of Tnkl. Activated Tnkl may then bind to some other protein in the cascade until eventually a transcription factor is involved and caused to effect expres ⁇ ion of ⁇ ome gene. Expre ⁇ ion of these genes may effect the cells' survival, proliferation and/or differentiation.
  • Tnkl and Tnkl ⁇ are each thought to function ⁇ imilarly to Ack, by binding to a ras- like protein in a pathway controlling cell proliferation.
  • Such pathway ⁇ are important in the biology of both cancer cells and lymphohematopoietic stem and progenitor cells, among other cell types.
  • either of the Tnkl or Tnkl ⁇ gene ⁇ may be employed to control the growth of cancer cells by cau ⁇ ing cancer cells to cea ⁇ e proliferating and die, and ⁇ timulating lymphohematopoietic ⁇ tem and progenitor ⁇ urvival and proliferation.
  • Tnkl or Tnkl ⁇ may also be employed to transiently cause stem and progenitor cells to pause in self-cycling, for example, while the patient with cancer receives chemotherapy or radiotherapy which may then more selectively kill cancer cells but not the normal stem and progenitor cells.
  • Tnkl or Tnkl ⁇ may also be employed to affect differentiation, ⁇ timulation or inhibition of certain cells.
  • Tnkl or Tnkl ⁇ may be employed to regulate the GTPase activity of a p21 ras-like protein by binding thereto, and therefore, suppress its transforming activity.
  • the gene and gene products of the present invention may also be employed to regulate signaling pathways during fetal development.
  • Tnkl or Tnkl ⁇ may also be employed to stimulate proliferation and differentiation of hematopoietic stem and/or progenitor cells for bone marrow transplantation or peripheral blood stem/progenitor cell tran ⁇ plantation.
  • polynucleotides and polypeptide ⁇ of the pre ⁇ ent invention may also be employed as research reagent ⁇ and materials for di ⁇ covery of treatment ⁇ and diagno ⁇ tic ⁇ to human disease.
  • Thi ⁇ invention provides a method for identification of the cell membrane receptor which functions to regulate Tnkl or Tnkl ⁇ activity, and a ligand which interact ⁇ with this receptor and to identify potential intermediate proteins.
  • Tnkl potentially functions in a signal transduction pathway downstream of events occurring on the cell surface.
  • immunoprecipitation followed by Western blotting, could be performed. This may show the interaction of two known proteins, usually shown using antibodies to both.
  • immunoprecipitation with Jak3 antibodies resulted in the co-immunoprecipitation of the IL-4 receptor, demonstrating that Jak3 associates with the IL-4 receptor (Rolling et al. , Oncogene, 10:1757-17611).
  • the protein(s) binding to Tnkl or Tnkl ⁇ can then be purified, partially ⁇ equenced, then cloned.
  • Tnkl can be cloned in-frame with a vector containing only the GAL4 binding domain, resulting in a GAL4-Tnkl fusion protein.
  • a cDNA library is then constructed in a vector containing only the GAL4 activation domain. These are then co-transformed into the appropriate yea ⁇ t strain ⁇ .
  • Po ⁇ itive clones i.e., clones that code for proteins that interact with Tnkl, are identified by growth in selective medium and blue/white screening.
  • the ligand may be identified by expres ⁇ ion cloning, as was done with the cloning of the FH3/FLK2 ligand (Lyman et al., Cell, 75:1157-1167). In this method, the extracellular domain of the receptor was fused to the Fc portion of the IgG and expressed as a fusion protein in 293 cells. Cell lines were a ⁇ sayed for their ability to bind to the Flt3/Fc fusion protein.
  • the method for determining whether a ligand can bind to the receptor which regulates Tnkl or Tnkl ⁇ function comprises transfecting a cell population (one pre ⁇ umed not to contain the receptor) with the appropriate vector expre ⁇ sing this receptor, ⁇ uch that the cell will now expres ⁇ thi ⁇ receptor.
  • a ⁇ uitable response sy ⁇ tem i ⁇ obtained by tran ⁇ fection of the DNA into a suitable host containing the desired second me ⁇ enger pathway ⁇ including cAMP, ion channel ⁇ , pho ⁇ phoinositide kinase, or calcium response.
  • Such a transfection sy ⁇ tem provide ⁇ a re ⁇ pon ⁇ e ⁇ ystem to analyze the activity of various ligands exposed to the cell.
  • Ligands chosen could be identified through a rational approach by taking known ligands that interact with similar types of receptors or u ⁇ ing ⁇ mall molecules, cell supernatants or extracts or natural products.
  • This invention provides a method of screening compounds to identify those which enhance (agonist ⁇ ) interaction of Tnkl or Tnkl ⁇ to it ⁇ receptor.
  • a mammalian cell or membrane preparation expressing a Tnkl or Tnkl ⁇ receptor is incubated with labeled Tnkl or Tnkl ⁇ in the presence of the compound.
  • the ability of the compound to enhance thi ⁇ interaction could then be measured.
  • the response of Tnkl after interaction of the compound to the receptor can be compared and measured in the presence and absence of the compound.
  • the present invention also relates to an a ⁇ ay for identifying potential antagonists against Tnkl or Tnkl ⁇ .
  • An example of such an assay combines Tnkl or Tnkl ⁇ and a potential antagoni ⁇ t with membrane-bound Tnkl or Tnkl ⁇ receptor ⁇ or recombinant Tnkl or Tnkl ⁇ receptor ⁇ under appropriate condition ⁇ for a competitive inhibition assay.
  • Tnkl or Tnkl ⁇ may be labeled, such as by radio activity, such that the number of Tnkl or Tnkl ⁇ molecule ⁇ bound to the receptor can determine the effectivene ⁇ of the potential antagonist.
  • Tnkl gene and gene product (or Tnkl ⁇ and its gene product) of the present invention act intracellularly. Accordingly, the only practical mode of administration of the Tnkl gene (or Tnkl ⁇ gene) is via gene therapy, hereinafter described, where it then acts to produce the Tnkl protein (or Tnkl ⁇ ) intracellularly.
  • Tnkl (or Tnkl ⁇ ) may be administered to a patient in an amount ⁇ ufficient to produce the Tnkl protein (or the Tnkl ⁇ protein) at level ⁇ that prevent, retard or reduce the severity of a disorder or its clinical manifestation ⁇ which i ⁇ related to an underexpre ⁇ ion of Tnkl protein (or Tnkl ⁇ protein) .
  • Tnkl is admini ⁇ tered in an amount and over a period of time with a frequency and duration sufficient to yield a "therapeutically effective" amount, i.e., an amount sufficient to produce Tnkl protein at levels that reduce the ⁇ everity of the disorder ⁇ or their manifestation ⁇ which are related to an underexpre ⁇ sion of the Tnkl protein (or Tnkl ⁇ protein) .
  • the pharmaceutical administrations should provide a quantity of the Tnkl (or the Tnkl ⁇ ) sufficient to effectively treat the patient.
  • Tnkl polypeptide or Tnkl ⁇
  • agonists which are polypeptides may be employed in accordance with the present invention by expression of such polypeptide ⁇ in vivo, which i ⁇ often referred to a ⁇ "gene therapy.”
  • cell ⁇ from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cell ⁇ then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • cell ⁇ may be engineered by the u ⁇ e of a retroviral pla ⁇ mid vector containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expres ⁇ ion of a polypeptide in vivo by, for example, procedure ⁇ known in the art.
  • a packaging cell i ⁇ tran ⁇ duced with a retroviral pla ⁇ mid vector containing RNA encoding a polypeptide of the pre ⁇ ent invention such that the packaging cell now produces infectious viral particle ⁇ containing the gene of intere ⁇ t.
  • These producer cells may be admini ⁇ tered to a patient for engineering cells in vivo and expre ⁇ ion of the polypeptide in vivo.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruse ⁇ such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector include ⁇ one or more promoters.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques. Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and 3-actin promoter ⁇ ) .
  • CMV human cytomegalovirus
  • viral promoter ⁇ which may be employed include, but are not limited to, adenoviru ⁇ promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to tho ⁇ e ⁇ killed in the art from the teachings contained herein.
  • Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter,- or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoter ⁇ , ⁇ uch a ⁇ the MMT promoter, the metallothionein promoter,- heat shock promoters; the albumin promoter,- the ApoAI promoter,- human globin promoters,- viral thymidine kina ⁇ e promoter ⁇ , ⁇ uch a ⁇ the Herpes Simplex thymidine kina ⁇ e promoter; retroviral LTRs (including the modified retroviral LTR ⁇ hereinabove described) ,- the ⁇ -actin promoter,- and human growth hormone promoters.
  • the promoter also may
  • the retroviral pla ⁇ mid vector i ⁇ employed to tran ⁇ duce packaging cell line ⁇ to form producer cell lines.
  • Example ⁇ of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, -2 , ⁇ -AM, PA12, T19-14X, VT-19-17-H2, CHE , GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy. Vol. l, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such mean ⁇ include, but are not limited to, electroporation, the u ⁇ e of lipo ⁇ ome ⁇ , and CaP0 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particle ⁇ which include the nucleic acid ⁇ equence( ⁇ ) encoding the polypeptide ⁇ .
  • retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vi tro or in vivo.
  • the transduced eukaryotic cells will expres ⁇ the nucleic acid sequence (s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic ⁇ tem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibrobla ⁇ ts, myoblast ⁇ , keratinocyte ⁇ , endothelial cells, and bronchial epithelial cell ⁇ .
  • Thi ⁇ invention is also related to the use of the Tnkl gene (or the Tnkl ⁇ gene) of the present invention as a diagnostic. Detection of a mutated form of the gene will allow a diagnosis of a disease or a susceptibility to a disea ⁇ e, for example cancer, which re ⁇ ult ⁇ from overexpre ⁇ sion or underexpression of Tnkl (or Tnkl ⁇ ) , or abnormal function of mutated Tnkl.
  • Nucleic acids for diagnosis may be obtained from a patient's cells, including but not limited to blood, urine, saliva, tis ⁇ ue biopsy and autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by u ⁇ ing PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analy ⁇ i ⁇ .
  • RNA or cDNA may also be u ⁇ ed for the ⁇ ame purpose.
  • PCR primers complementary to the nucleic acid encoding Tnkl can be used to identify and analyze mutations.
  • deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled anti ⁇ en ⁇ e DNA ⁇ equence ⁇ . Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.
  • Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method.
  • cloned DNA segments may be employed as probe ⁇ to detect ⁇ pecific DNA ⁇ egments.
  • the sensitivity of this method is greatly enhanced when combined with PCR.
  • a sequencing primer is used with double-stranded PCR product or a ⁇ ingle- ⁇ tranded template molecule generated by a modified PCR.
  • the ⁇ equence determination i ⁇ performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.
  • DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragment ⁇ in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high re ⁇ olution gel electrophore ⁇ i ⁇ .
  • DNA fragments of different ⁇ equence ⁇ may be di ⁇ tingui ⁇ hed on denaturing formamide gradient gel ⁇ in which the mobilitie ⁇ of different DNA fragment ⁇ are retarded in the gel at different po ⁇ ition ⁇ according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985) ) .
  • Sequence changes at specific locations may also be revealed by nuclease protection a ⁇ say ⁇ , ⁇ uch a ⁇ RNa ⁇ e and SI protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the u ⁇ e of re ⁇ triction enzyme ⁇ , (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the u ⁇ e of re ⁇ triction enzyme ⁇ , (e.g., Restriction Fragment Length Polymorphisms (RFLP) ) and Southern blotting of genomic DNA.
  • RFLP Restriction Fragment Length Polymorphisms
  • mutations can also be detected by in si tu analysis.
  • the polypeptides, their fragments or other derivatives, or analog ⁇ thereof, or cells expres ⁇ ing them can be u ⁇ ed a ⁇ an immunogen to produce antibodie ⁇ thereto.
  • the ⁇ e antibodie ⁇ can be, for example, polyclonal or monoclonal antibodie ⁇ .
  • the present invention al ⁇ o includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expres ⁇ ion library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodie ⁇ can then be u ⁇ ed to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provide ⁇ antibodie ⁇ produced by continuou ⁇ cell line culture ⁇ can be u ⁇ ed.
  • Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Antibodies specific to the Tnkl gene and protein may be employed as markers for cells which express the protein.
  • Human Bone Marrow or Cord Blood Cell ⁇ Normal human bone marrow wa ⁇ collected from the po ⁇ terior iliac cre ⁇ t of con ⁇ enting healthy adults under an Institutional Review Board approved protocol. Umbilical cord blood was obtained from post-delivery placenta in the Johns Hopkin ⁇ Ho ⁇ pital. CD34+/Lin- and other hematopoietic cell ⁇ ub ⁇ et ⁇ were prepared by immunomagnetic micro ⁇ phere ⁇ eparation as previou ⁇ ly de ⁇ cribed (Gore, S.D., et al. , Exp. Hetnatol., 23:413-421 (1995)) .
  • CD38- cell ⁇ For preparation of CD38- cell ⁇ , CD34+/Lin- cells, isolated as above, were incubated for an additional 30 minutes at 4°C in the presence of CD38 coated immunomagnetic microspheres, at 20 microspheres per cell. CD38- and CD38+ cell fractions were then separated on the magnetic particle concentrator (Dynal, Lake Succes ⁇ , NY) . Blood was drawn from 2 consenting, healthy adult donors, and mononuclear cell and granulocyte subpopulations were separated by density gradient centrifugation (Mono-Poly Resolving Medium, ICN, Aurora, OH) .
  • RNA Isolation Total RNA wa ⁇ prepared from purified marrow, cord blood, and peripheral blood cell fraction ⁇ , u ⁇ ing the method of Chomczyn ⁇ ki, P. & and Sacchi, N. , Anal. Biochem., 162:156-159 (1987)) .
  • total RNA wa ⁇ treated with DNase (Gibco BRL, Gaithersburg, MD) , phenol:chloroform extracted, ethanol precipitated and resu ⁇ pended in sterile DEPC-treated dH,0.
  • PolyA RNA was purified from leukemic cell lines by the Ribosep mRNA kit (Becton Dickinson, Bedford, MA) .
  • RNA from CD34+/Lin-/CD38- umbilical cord cells (approximately 1.2 x 10 J cell ⁇ ) was treated with DNase, phenol:chloroform extracted, ethanol precipitated and resuspended in DEPC-treated H 2 0.
  • DNase- treated RNA was reverse transcribed using random primers and MMLV reverse transcriptase (Gibco BRL) at 37°C.
  • sequences of the primers were a ⁇ follows.- PTK1: 5' CCCGCGGCCGCTNCAT(T/C) (A/C)GNGA(T/C) (T/OTNGCNGC 3' (SEQ ID NO:5); PTK2: 5'CCCGTCGACCC(A/G)TAN(C/G) (T/A)CCANAC(A/G)TC 3' (SEQ ID N0:6). Degenerate PCR wa ⁇ carried out at 94°C for 1 min. 37°C for 1.5 min., 72°C for 2 min for 35 cycle ⁇ with 10 min. extension at 72°C following the last cycle.
  • PCR products were separated by agaro ⁇ e gel electrophoresis, and appropriate sized products (-234 bp) were eluted using GeneClean (BIO 101, Vista, CA) . Products were digested with NotI and Sail, ligated into pBluescript KS (Stratagene, La Jolla, CA) and transformed into competent E. coli DH5 ⁇ .
  • DNA Sequencing Dideoxy sequencing was performed on plasmid DNA using Sequenase (USB, Cleveland, OH) and resolved on 8% polyacrylamide gels. To quickly eliminate repetitive clones, sequencing gels containing only T-lane ⁇ , were run. Alternatively, double- ⁇ tranded pla ⁇ mid DNA wa ⁇ ⁇ equenced on an automated fluorescent DNA ⁇ equencer in the John ⁇ Hopkin ⁇ Univer ⁇ ity School of Medicine Genetics Core facility. DNA sequences were compared to known sequence ⁇ in Genbank, using the BlastN program from National Center for Biotechnology Information (NIH, Bethe ⁇ da, MD) .
  • NIH National Center for Biotechnology Information
  • 5' and 3' RACE. were performed es ⁇ entially a ⁇ de ⁇ cribed in (Frohman, M.A. , Meth. Enzym. , 218, 340-356 (1993)). Briefly, for 5' RACE, K562 mRNA was reverse- transcribed with Tnkl specific primer B 5' ATCCGAGGC AGACGAGAAGG 3' (SEQ ID NO:7) at 37°C for 2 h with MMLV, diluted to 2 ml in Tri ⁇ -EDTA (TE) buffer, and primers were removed u ⁇ ing a Centricon-100 spin filter (Amicon, Beverly, MA) and washed once in 0.2x TE.
  • TdT terminal nucleotidyl transferase
  • fir ⁇ t round PCR product ⁇ were diluted 1:20 in TE, and 5 ⁇ l was used as templated with Tnkl specific primer D 5' ACCAGGTGTAGGGGATAG 3' (SEQ ID NO:11) and RACE primer #2 for PCR, as above except the initial 2 min. annealing step and 45 min. extension step were eliminated.
  • Products were cloned into the TA vector (Invitrogen, San Diego, CA) , and colonie ⁇ containing 5' Tnkl ⁇ equence ⁇ were identified by hybridizing with internal Tnkl specific primer A 5' CCATCAAGGTGGCTGACTTC 3' (SEQ ID NO:12).
  • K562 mRNA was reverse transcribed with oligo- (dT) using Super ⁇ cript II (Gibco BRL) at 42°C for 2 h and then diluted to 1 ml in TE.
  • Products were diluted 1:20 and 5 ⁇ l of this used as template for second round of PCR using 25 pmol of RACE primer #2 and Tnk specific prier Forward 1 5' CTGGTGTGCCCCAGAGAG 3' (SEQ ID NO:13) , as de ⁇ cribed for 5'-RACE.
  • 3'-RACE products were cloned into the TA vector and transformants containing 3 ' Tnkl sequence ⁇ were identified using an internal Tnkl specific oligonucleotide (Tnk Primer C) .
  • Reverse-Tran ⁇ criptase PCR For expres ⁇ ion ⁇ tudie ⁇ using RT-PCR, total RNA (u ⁇ ually 1-5 ⁇ g) or mRNA (1 ⁇ g) wa ⁇ rever ⁇ e-tran ⁇ cribed to cDNA using random hexamer primers and MMLV-RT at 37°C for 2 hours. An aliquot of this reaction (3 ⁇ l) was amplified with Tnkl specific primers, Tnkl 1623 5' GAGCGAATTCACAGAACTGACTCCAGACTCCTGG 3' (SEQ ID NO:14) at 94°C for 1 min, 55°C for 1 min., 72°C for 1 min., for 35 cycles.
  • Example 2 Chromosome-mapping with DNA hybrid panel. From the cDNA sequence of Tnkl, 2 different primer pairs were made that amplified over an intron on genomic DNA. From the 5'-part of the cDNA, the primer ⁇ were Tnkl 224, 5' GCACTT CGACTTTGTAAAGCCTGAG 3' (SEQ ID NO:16) and Tnkl, 5' TTTTCAG AGCTTCGGACAGTCTG 3' (SEQ ID NO:17) .
  • the primer ⁇ were Tnkl 1270, 5' CATGTTGTGTGAGGGATGCCAC 3' (SEQ ID NO:18) and Tnkl 1392, 5' TGAAGGTGCGACCATTCTGG 3' (SEQ ID NO:19) .
  • the ⁇ e primers were used to amplify DNA from the NIGMS Hybrid DNA PANEL #2 (Drwinga et al. , Genomics, 16:311-314 (1993); Duboi ⁇ and Naylor, Genomics, 16:315-319 (1993)) , which has nearly all the human chromosomes completely separated in hybrids with mou ⁇ e or hamster cell ⁇ .
  • PCR was run separately with the 2 primer-pairs at 94°C for l min, 63°C for 1 min, and 72°C for 1 min for 35 cycles. PCR products were electrophoresed on a 1.0% agarose gel, transferred to nylon filters (Nytran, Schleicher & Schuell) , and hybridized with an 32 P end-labeled internal oligonucleotide.
  • a genomic Tnkl gene isolated from a human Pl genomic DNA library (Human Fore ⁇ kin Fibrobla ⁇ t Pl LIBRARY #1, Du Pont Merck Pharmaceutical Co., St. Loui ⁇ , MO) by PCR using Tnkl specific primers.
  • a method utilized is generating a fusion protein to glutathione-S-transfera ⁇ e(GST) (Smith, D.B. and John ⁇ on, K.S., Gene, 67:31-40 (1988); ⁇ ee also Au ⁇ ubel, F.M. , et al., Current Protocol ⁇ in Molecular Biology, Vol. 2, Chapter 16.7.1-16.7.8 (1993)) .
  • the cloning vectors contain the neces ⁇ ary control elements required for efficient tran ⁇ cription and tran ⁇ lation, including an inducible promoter and multiple termination codon ⁇ .
  • Production of GST-fusion proteins is under the control of the E. coli lacZ promoter, and thus is inducible with IPTG.
  • GST fusion proteins can be purified from bacterial lysates by affinity chromatography using glutathione-agarose beads.
  • Two peptides were ⁇ ynthesized from amino acids u ⁇ ing a peptide ⁇ ynthe ⁇ izer in ⁇ trument ( ⁇ tandard procedure ⁇ ) .
  • Two different anti ⁇ era were rai ⁇ ed by immunizing 2 rabbit ⁇ with 2 different Tnkl ⁇ ynthetic peptide ⁇ (LPATCPVHRGTPARGDQHPG for the fir ⁇ t rabbit and IDGDRKKANLWDAP for the ⁇ econd rabbit) , each conjugated to Keyhole Limpet Hemocyanin (KLH) .
  • Both antibodie ⁇ recognize the appropriate peptide and the fu ⁇ ion protein.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • CTGCCTCGGA CGTGTGGATG TTTGGGGTGA CGCTGTGGGA GATGTTCTCC GGGGGCGAGG 1080
  • CTGGAGGCCT CTTGTCCGAT CCTGAGTTGC AGAGGAAGAT TATGGAAATG GAGCTGAGTG 1920
  • Val Tyr Ly ⁇ lie Leu Gly Gly Phe Ala Pro Glu Hi ⁇ Ly ⁇ Glu Pro
  • Arg lie Leu Glu His Tyr Gin Trp Asp Leu Ser Ala Ala Ser Arg
  • MOLECULE TYPE CDNA
  • Xi SEQUENCE DESCRIPTION: SEQ ID NO:3:
  • CTGCCTCGGA CGTGTGGATG TTTGGGGTGA CGCTGTGGGA GATGTTCTCC GGGGGCGAGG 1080
  • MOLECULE TYPE Oligonucleotide
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:8: AGACGAGAAG GCTCCGTG 18
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:9: GATGGATCCT GCAGAAGCT 19
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 10: GATGGATCCT GCAGAAGC 18
  • MOLECULE TYPE Oligonucleotide
  • Xi SEQUENCE DESCRIPTION: SEQ ID NO:12: CCATCAAGGT GGCTGACTTC 20
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:13: CTGGTGTGCC CCAGAGAG 18
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 14: GAGCGAATTC ACAGAACTGA CTCCAGACTC CTGG 34
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:16: GCACTTCGAC TTTGTAAAGC CTGAG 25 (2) INFORMATION FOR SEQ ID NO:17:
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:17: TTTTCAGAGC TTCGGACAGT CTG 23
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:18: CATGTTGTGT GAGGGATGCC AC 22
  • MOLECULE TYPE Oligonucleotide
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:19: TGAAGGTGCG ACCATTCTGG 20

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention porte sur un polypeptide intracellulaire humain du type tyrosine kinase et l'ADN (ARN) codant pour lui, et sur son procédé de production par des techniques de recombinaison. Elle porte également sur des méthodes d'utilisation dudit polypeptide pour supprimer l'activité transformatrice de certains gènes en jouant un rôle régulateur sur les modifications des états de prolifération et de différenciation de cellules et notamment de cellules souches hématopoïétiques utilisées pour les transplantation de moelle épinière et comme auxiliaires dans la thérapie du cancer. L'invention porte en outre sur des essais diagnostiques servant à identifier les mutations dans les séquences nucléoditiques codant pour le susdit polypeptide en vue de la détection de maladies telles que par exemple le cancer.
EP96936414A 1995-10-12 1996-10-11 Gene de la tyrosine kinase et produit genique associe Withdrawn EP0862620A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US528695P 1995-10-12 1995-10-12
US5286P 1995-10-12
PCT/US1996/016359 WO1997013846A1 (fr) 1995-10-12 1996-10-11 Gene de la tyrosine kinase et produit genique associe

Publications (1)

Publication Number Publication Date
EP0862620A1 true EP0862620A1 (fr) 1998-09-09

Family

ID=21715139

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96936414A Withdrawn EP0862620A1 (fr) 1995-10-12 1996-10-11 Gene de la tyrosine kinase et produit genique associe

Country Status (3)

Country Link
EP (1) EP0862620A1 (fr)
AU (1) AU7442396A (fr)
WO (1) WO1997013846A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102004026045A1 (de) * 2004-05-25 2005-12-22 Universität Ulm Inhibitor für den nukleären Transkriptionsfaktor kappa B(NFxb)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5444149A (en) * 1992-05-11 1995-08-22 Duke University Methods and compositions useful in the recognition, binding and expression of ribonucleic acids involved in cell growth, neoplasia and immunoregulation

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9713846A1 *

Also Published As

Publication number Publication date
WO1997013846A1 (fr) 1997-04-17
AU7442396A (en) 1997-04-30

Similar Documents

Publication Publication Date Title
DE69534402T2 (de) Apoptose-proteasen 3 und 4, ähnlich dem umwandlungsenzym für interleukin-1beta
WO1996039419A1 (fr) Genes et proteines specifiques du colon
EP0894130B1 (fr) Modulateurs du facteur associe au recepteur de tnf (traf), leur preparation et leur utilisation
WO1995024414A1 (fr) Facteur-10 de croissance du fibroblaste
US20080159986A1 (en) Modulators of the functions of receptors of the tnf/ngf receptor family and other proteins
WO1996028546A1 (fr) Recepteur humain du facteur de necrose tumorale
AU7644394A (en) Nucleotide sequences for novel protein tyrosine phosphatases
US6913891B1 (en) Human myeloid terminal differentiation response gene
WO1997002280A1 (fr) Genes et proteines specifiques au sein
WO1998024895A1 (fr) Recepteur appartenant a la famille de recepteurs tnf/ngf
WO1996000297A1 (fr) PROTEASE-1 ET 2 D'APOPTOSE DE TYPE ENZYME DE CONVERSION D'INTERLEUKINE-1 $g(b)
CA2235785A1 (fr) Serine/threonine proteine kinase (h-sgk2)
EP0862620A1 (fr) Gene de la tyrosine kinase et produit genique associe
JPH10201487A (ja) 哺乳動物のｆｉｎ−１核酸および蛋白質配列およびその使用
EP0894856A1 (fr) Variante d'épissure de sMAD3 humaine
US7655438B2 (en) Method for preparing recombinant heterocarpine
US5998599A (en) Growth arrest gene compositions and methods
US7745579B1 (en) Inhibitor of NF-KB activation
JPH10201489A (ja) ｈＲＡＤ５４
WO1999025822A1 (fr) Gene exostosine-4
WO1996015222A1 (fr) MutT2 HUMAIN
EP0819168A1 (fr) Recepteur humain du facteur de necrose tumorale
AU2313401A (en) Novel human myeloid terminal differentiation response gene
EP0894137A1 (fr) Nouveau gene de reponse a la differenciation terminale myeloide d'origine humaine
AU3508001A (en) Modulators of TNF receptor associated factor (TRAF), their preparation and use

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980502

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): CH DE FR GB IT LI NL

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 19981113

RIN1 Information on inventor provided before grant (corrected)

Inventor name: HOEHN, GERARD, T.

Inventor name: SMALL, DONALD

Inventor name: CIVIN, CURT, I.