EP0861027A1 - Icea und diesbezüglische verfahren - Google Patents

Icea und diesbezüglische verfahren

Info

Publication number
EP0861027A1
EP0861027A1 EP97925659A EP97925659A EP0861027A1 EP 0861027 A1 EP0861027 A1 EP 0861027A1 EP 97925659 A EP97925659 A EP 97925659A EP 97925659 A EP97925659 A EP 97925659A EP 0861027 A1 EP0861027 A1 EP 0861027A1
Authority
EP
European Patent Office
Prior art keywords
seq
icea
protein
isolated
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97925659A
Other languages
English (en)
French (fr)
Other versions
EP0861027A4 (de
Inventor
Geraldine G. Miller
Richard M. Peek, Jr.
Stuart A. Thompson
Martin J. Blaser
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Vanderbilt University
Original Assignee
Vanderbilt University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vanderbilt University filed Critical Vanderbilt University
Publication of EP0861027A1 publication Critical patent/EP0861027A1/de
Publication of EP0861027A4 publication Critical patent/EP0861027A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies

Definitions

  • the invention pertains to the iceA gene of
  • Heli cobacter pyl ori to RNA transcripts of the gene and to the antigenic polypeptides encoded by the genes, as well as methods of using the gene, and polypeptides to diagnose H. pyl ori infection and predisposition to peptic ulceration and other diseases associated with H. pylori infection.
  • Heli cobacter pyl ori infection causes chronic superficial gastritis (1), and may lead to duodenal and gastric ulcer disease, gastric adenocarcinoma, or non-Hodgkms lymphoma of the stomach (2-4) . However, most infected persons remain asymptomatic, with only 10-20% of infected persons developing one of these illnesses (5) .
  • One putative virulence factor elaborated by 40-60% of H. pyl ori isolates is a toxin, encoded by vacA, that induces vacuolation of eukaryotic cells and injury to gastric epithelium (6,7) .
  • pylori constituent is the 120-132 kDa cytotoxm-associated gene A (cagA) product which is present in 60% of strains (8,9) .
  • cagA genotype and cytotoxin expression both are associated with peptic ulcer disease (8,10,11), the majority of persons infected with such strains do not progress to ulceration, suggesting that other H. pyl ori genes also are important m disease pathogenesis.
  • strain-specific virulence determinants Another factor that may limit detection of genes relevant to pathogenesis is that bacterial transcripts expressed during growth m vi tro may not reflect in vivo expression (13) . Because so little is known about the pathogenesis of H. pyl ori , there is a need to identify genes expressed selectively in ulcer-causing strains.
  • the present invention meets this need by demonstrating that adherence to gastric epithelial cells induces the selective expression of a novel H. pyl ori gene, i ceA induced by contact with epithelium) , that is highly correlated with peptic ulcer disease.
  • i ceA exists in two major allelic variants which are not associated with previously described H. pyl ori virulence determinants .
  • a purified IceA protein of Helicobacter pyl ori is provided.
  • the protein is expressed as either an IceA 1 or an IceA 2 variant.
  • a purified polypeptide fragment of the IceA protein is also provided.
  • An antigenic fragment of IceA is provided.
  • An isolated nucleic acid that encodes an IceA protein of H. pyl ori is provided.
  • a nucleic acid that encodes an IceA 1 variant, termed an iceA 1 allele, is provided.
  • a nucleic acid that encodes an IceA 2 variant, termed an iceA 2 allele, is also provided. Fragments of the iceA gene are provided.
  • a method of detecting the presence of an antibody against H. pylori in a sample comprises the following steps: a) contacting the sample with a purified IceA protein of H. pyl ori or a H. pylori- specific fragment thereof; and b) detecting the binding of the antibody in the sample to the protein or fragment, the detection of binding indicating the presence in the sample of antibodies against H. pyl ori .
  • the presence of the antibodies against H. pyl ori is correlated with current or previous infection with H. pylori in the subject from whom the sample is obtained.
  • a method of detecting the presence of an antibody against an ulcerative Helicobacter pylori strain in a sample comprises the following steps: a) contacting the sample with a purified IceA protein from an ulcerative Helicobacter pylori strain or an ulcerative Heli cobacter pylori strain-specific /
  • FIG. IA depicts the preparation of RAP RT-PCR templates as described in the Examples.
  • RAP RT-PCR identifies a strain-specific product induced by adherence to AGS cells.
  • Figure IB shows RAP PCR and RAP RT-PCR of DNA and RNA from strains J178 and J166.
  • PCR was performed using the same random primer and either genomic DNA, RNA that had not been reverse transcribed, or cDNA as template.
  • Broth broth-grown bacteria not exposed to AGS cells; Non, non-adherent bacteria in AGS cell supernatant; Adh, bacteria adherent to AGS cells.
  • Lane 1 molecular size markers; Lanes 2-3, DNA from strains J178 and J166, respectively; Lanes 4-6 and 10-12, RNA from strains J178 and J166, respectively, that had not been reverse transcribed; Lanes 7-9 and 13-15, RNA from strains J178 and J166, respectively, that had been reverse transcribed prior to PCR.
  • Figure 2 shows the nucleotide and deduced ammo acid sequences of pRMPlOO from a genomic library of 60190 and alignment of regions corresponding to cysE, iceA and M .
  • Potential ribosome binding sites (RBS) are overlined and putative promoter elements are boxed [-35 sequences in bold boxes, -10 sequences in standard boxes] .
  • the primers (ser-1, meth-3) used to amplify the i ceA region from clinical strains are underlined at positions 1-23 (5'-3') and 975-952 (5'-3 T ) of 60190 sequence, respectively.
  • the primers (178-1, 178-2) used for PCR amplification to classify i ceA alleles from 40 clinical strains are underlined at positions 659-680 (5'-3') and 776-756 (5'-3') of J178 sequence, respectively.
  • Figure 3A shows a dendogram demonstrating relatedness of i ceA alleles among 8 H. pylori strains and showing that i ceA allelic variation exists among H. pylori clinical isolates.
  • PCR products were sequenced and progressive, pairwise alignments of ⁇ ceA-homologous DNA regions were performed. Scores that reflect the similarities of iceA sequences relative to that of strain 60190 are shown at right (37) .
  • Strains J166, J101, and J128 were isolated from patients with duodenal ulcer disease; strains J195, J262, J178, and J174 were isolated from patients with gastritis only. The clinical status of the source patient for reference strain 60190 is unknown.
  • Figure 3B shows a representative PCR on genomic DNA from clinical H. pyl ori isolates using iceA 2 primers 178-1 and 178-2 derived from J178 iceA sequence ( Figure 2) showing that i ceA allelic variation exists among H. pylori clinical isolates.
  • iceA 1 strains (lanes 2-6) demonstrated no amplification products
  • i ceA 2 strains (lanes 7-11) consisted of a single product of the predicted size.
  • Lane 1 molecular size markers.
  • Figure 4 shows that i ceA 1 RNA is expressed following adherence.
  • IceA Protein and Fragments A purified IceA protein of Helicobacter pylori is provided.
  • the protein is expressed as either an IceA 1 variant (also referred to as "IceA 1") or an IceA 2 variant (also referred to as "IceA 2”) .
  • the IceA protein can be defined by any one or more of the typically used parameters. Examples of these parameters include, but are not limited to molecular weight (calculated or empirically determined) , isoelectric focusing point, specific epitope (s) , complete amino acid sequence, sequence of a specific region (e.g., N-terminus) of the amino acid sequence.
  • the IceA protein can be encoded by any coding sequence, including those provided herein.
  • the IceA 1 variant has two isoforms, an approximately 21 kDa calculated molecular weight isoform, and an approximately 15 kDa calculated molecular weight isoform. Both isoforms of the IceA 1 variant are encoded by a single open reading frame (ORF) having two alternative start codons.
  • the IceA 1 variant can be defined by its variant-specific N-terminal sequence.
  • the variant-specific N-termmal sequence can be the amino acid sequence encoded, for example, by nucleotides 25-81 of SEQ ID NO:l.
  • Examples of IceA 1 variants and coding sequences are shown in SEQ ID Nos: 1-5, 63 and 101.
  • SEQ ID NO: 5 shows a partial sequence of an IceA 1-encodmg nucleic acid.
  • the IceA 2 variant has an approximately 7 kDa calculated molecular weight.
  • the IceA 2 variant can be defined by its variant-specific N-terminal sequence.
  • the variant-specific N-terminal sequence can be ammo acid sequences encoded, for example, by nucleotides 163-195 of SEQ ID NO: 6. Examples of IceA 2 variants are shown in SEQ ID Nos: 6-10.
  • SEQ ID NO: 10 shows a partial sequence of an IceA 2-encodmg nucleic acid.
  • purified refers to a protein (polypeptide, peptide, etc.) that is sufficiently free of contaminants or cell components with which it normally occurs to distinguish it from the contaminants or other components of its natural environment.
  • the purified protein need not be homogeneous, but must be sufficiently free of contaminants to be useful in a clinical or research setting, for example, in an assay for detecting antibodies to the protein.
  • the invention also enables the purification of IceA homologs from other H. pylori strains.
  • an antibody raised agamst the exemplary protein can be used routinely to screen preparations of other H. pylori strains for homologous proteins that react with the IceA- specific antibody.
  • An IceA protein having the N-termmal sequence of ammo acids encoded by nucleotides 25-81 of SEQ ID N0:1 or ammo acids encoded by nucleotides 163 - 195 of SEQ ID NO: 6, can be routinely identified in and obtained from other organisms usmg the methods taught herein and others known in the art.
  • the conserved DNA encoding a conserved amino acid sequence can be used to probe genomic DNA or DNA libraries of an organism to predictably obtain the iceA gene for that organism.
  • the gene can then be cloned and expressed as the IceA protein, and purified according to any of a number of routine, predictable methods.
  • An example of the routine protein purification methods available in the art can be found in Pei et al. (45) .
  • IceA protein of H. pylori having the amino acid sequence defined in the Sequence Listing as SEQ ID NO: 2 is provided. This is the amino acid sequence for an IceA 1 variant from strain 60190 (ATCC Accession No. 49503), a reference strain that causes ulcer disease.
  • An example of an IceA protein of H. pylori having the amino acid sequence defined in the Sequence Listing as SEQ ID NO: 101 is provided. This is the amino acid sequence for an IceA 1 variant of strain J166, a clinical isolate that causes ulcer disease.
  • SEQ ID NO: 101 is the polypeptide encoded by a sequence of strain J166 i ceA 1 obtained after subcloning the gene in E. coli .
  • a further example of an IceA protein of H. pylori having the amino acid sequence defined in the Sequence Listing as SEQ ID NO: 103 is provided.
  • SEQ ID NO: 103 is the polypeptide that encoded by a sequence of strain J166 iceA 1 obtained by PCR and sequencing of the genomic iceA gene.
  • IceA protein of H. pylori having the amino acid sequence encoded by the nucleotide sequence defined in the Sequence Listing as SEQ ID NO: 3 is provided. This is the amino acid sequence for an IceA 1 variant of strain A101, a clinical isolate that causes ulcer disease. The nucleotide sequence of this iceA 1 variant has not been verified on both sequences.
  • IceA protein of H. pylori having the amino acid sequence encoded by the nucleotide sequence defined in the Sequence Listing as SEQ ID NO: 5 is provided. This is the amino acid sequence for an IceA 1 variant of strain J128, a clinical isolate that causes ulcer disease. The nucleotide sequence of this i ceA 1 variant has not been verified on both sequences.
  • IceA protein of H. pylori having the amino acid sequence defined in the Sequence Listing as SEQ ID NO: 7 is provided. This is the amino acid sequence for an IceA 2 variant expressed by strain J178, which causes gastritis, but not ulceration.
  • IceA protein of H. pylori having the amino acid sequence encoded by the nucleotide sequence defined in the Sequence Listing as SEQ ID NO: 8 is provided. This is the amino acid sequence for an IceA 2 variant expressed by strain J174, which causes gastritis, but not ulceration. The nucleotide sequence of this i ceA 2 variant has not been verified on both sequences.
  • An example of an IceA protein of H. pylori having the amino acid sequence encoded by the nucleotide sequence defined in the Sequence Listing as SEQ ID NO: 9 is provided. This is the amino acid sequence for an IceA 2 variant expressed by strain J195, which causes gastritis, but not ulceration. The nucleotide sequence of this i ceA 2 variant has not been verified on both sequences.
  • An example of an IceA protein of H. pylori having the amino acid sequence encoded by the nucleotide sequence defined in the Sequence Listing as SEQ ID NO: 10 is provided. This is the amino acid sequence for an IceA 2 variant expressed by strain J262, which causes gastritis, but not ulceration. The nucleotide sequence of this i ceA 2 variant has not been verified on both sequences.
  • the H. pyl ori IceA protein can comprise a sequence of amino acids selected from the group consisting of the sequences defined in the Sequence Listing as SEQ ID Nos: 64-100. These SEQ ID NOS give amino acid sequences for a variant-specific conserved region of the 60190 strain of H. pyl ori , which produces IceA variant 1. The proteins comprising these specific sequences will by definition be IceA 1. The methods used to select these conserved specific regions of IceA 1 are routine and can be used to identify other IceA 1 variants form other sources .
  • the H. pyl ori IceA protein can comprise a sequence of amino acids that are selected from the group consisting of the polypeptides and peptides encoded sequences defined in the Sequence Listing as SEQ ID NOS: 6 and 8-10 that are for specific, conserved region(s) of the J178-like strains of H. pylori , which express the IceA variant 2. These proteins will by definition be IceA 2 proteins. The methods used to select conserved specific regions of IceA 2 are routine and can be used to identify other IceA 2 variants form other sources.
  • a purified polypeptide fragment of the IceA protein is also provided.
  • fragment as used herein regarding IceA, means a molecule of at least 5 contiguous ammo acids of IceA that has at least one function shared by IceA or a region thereof. These functions can include antigenicity; epithelial cell binding; DNA binding (as in transcription factors) ; RNA binding (as in regulating RNA stability or degradation, thereby affecting the half-life of specific mRNAs and the amount of protein that can be translated from them); protease activity or proteolysis; and toxin activity.
  • the IceA fragment can be specific for Helicobacter pylori .
  • an ammo acid sequence protein, polypeptide, peptide, etc.
  • An IceA fragment can be protein specific (i.e., found m IceA from any source, but not in other proteins) , species-specific (e.g., found m the IceA of H. pyl ori , but not of other species), or variant-specific (i.e., found in an IceA 1 variant, but not in an IceA 2 variant) .
  • An antigenic fragment of IceA is provided.
  • the IceA fragment can be from an IceA from any source.
  • An antigenic fragment has an ammo acid sequence of at least about 5 consecutive amino acids of an IceA ammo acid sequence and binds an antibody.
  • An antigenic fragment can be selected by applying the routine technique of epitope mapping to IceA to determine the regions of the proteins that contain epitopes reactive with serum antibodies or are capable of eliciting an immune response in an animal. Once the epitope is selected, an antigenic polypeptide containing the epitope can be synthesized directly, or produced recombinantly by cloning nucleic acids encoding the polypeptide in an expression system, according to the standard methods.
  • an antigenic fragment of the antigen can be isolated from the whole antigen or a larger fragment by chemical or mechanical disruption. Fragments can also be randomly chosen from a known IceA sequence and synthesized. The purified fragments thus obtained can be tested to determine their antigenicity and specificity by routine methods.
  • H. pylori-specific IceA fragment having an amino acid sequence selected from the group consisting of the unique sequences defined in the Sequence Listing as SEQ ID NO: 2, SEQ ID NO: 7 and SEQ ID NO: 101 and specific fragments thereof is also provided.
  • Modifications to any of the above proteins or fragments can be made, while preserving the specificity and activity (function) of the native protein or fragment thereof.
  • "native" describes a protein that occurs in nature.
  • the modifications contemplated herein can be conservative amino acid substitutions, for example, the substitution of a basic amino acid for a different basic amino acid.
  • Modifications can also include creation of fusion proteins with epitope tags or known recombinant proteins or genes encoding them created by subcloning into commercial or non-commercial vectors (e.g., polyhistidine tags, flag tags, myc tag, glutathione-S-transferase [GST] fusion protein, xylE fusion reporter construct) .
  • the novel pathogenesis-associated IceA protein a method of using it as a toxin is also provided.
  • the protein can be administered directly to a tumor (e.g., gastric carcinoma) or population of cells (e.g., T cells), or it can be expressed in the tumor or other cell after delivery of an iceA sequence encoding the protein or an active fragment.
  • the tumor cell or other cell can, thus, be killed when the IceA protein or fragment is expressed.
  • the purified antigenic polypeptides can be tested to determine their immunogenicity and specificity. Briefly, various concentrations of a putative immunogenic specific fragment are prepared and administered to an animal and the immunological response (e.g., the production of antibodies or cell mediated immunity) of an animal to each concentration is determined.
  • the amounts of antigen administered depend on the subject, e.g. a human, a guinea pig, or a gnotobiotic piglet, the condition of the subject, the size of the subject, etc. Thereafter an animal so inoculated with the antigen can be exposed to the bacterium to determine the vaccine effect of the specific antigenic fragment.
  • the specificity of the fragment can be ascertained by testing sera, other fluids or lymphocytes from the inoculated animal for cross reactivity with other closely related bacteria.
  • isolated nucleic acid that encodes an IceA protein of H. pyl ori is provided.
  • the iceA gene of H. pylori is provided.
  • isolated means a nucleic acid is separated from at least some of other components of the naturally occurring organism, for example, the cell structural components and/or other genes. The isolation of the nucleic acids can therefore be accomplished by techniques such as cell lysis followed by phenol plus chloroform extraction, followed by ethanol precipitation of the nucleic acids (20) .
  • the isolated nucleic acids are necessarily totally free of non-nucleic acid components, but that the isolated nucleic acids are isolated to a degree of purification to be useful in a clinical, diagnostic, experimental, or other procedure such as gel electrophoresis, Southern or dot blot hybridization, or PCR.
  • procedures which may be used to isolate the nucleic acids prior to their use in other procedures. These include, but are not limited to, lysis of the cell followed by gel filtration or anion exchange chromatography, binding DNA to silica in the form of glass beads, filters or diatoms in the presence of high concentration of chaotropic salts, or ethanol precipitation of the nucleic acids.
  • the nucleic acids of the present invention can include positive and negative strand RNA as well as DNA and is meant to include genomic and subgenomic nucleic acids found in the naturally occurring organism.
  • the nucleic acids contemplated by the present invention include double stranded and single stranded DNA of the genome, complementary positive stranded cRNA and mRNA, and complementary cDNA produced therefrom and any nucleic acid which can selectively or specifically hybridize to the isolated nucleic acids provided herein.
  • the RNA transcript of a H. pylori i ceA 1 gene may act as a ribozyme.
  • An isolated nucleic acid that encodes an IceA protein of H. pyl ori is species-specific (i.e., does not encode the IceA of other species and does not occur in other species) .
  • the nucleic acid can also be variant-specific (i.e., encodes an IceA 1 variant, but not in an IceA 2 variant) .
  • Examples of the nucleic acids contemplated herein include the nucleic acids that encode each of the IceA proteins or fragments thereof described herein.
  • a nucleic acid that encodes an IceA 1 variant is termed an i ceA 1 allele.
  • i ceA 1 alleles are provided in the Sequence Listing as SEQ ID NOS: 1,3-5, 63 and 102.
  • SEQ ID NO: 5 is a partial sequence.
  • SEQ ID NO: 102 was obtained by PCR of genomic i ceA 1, followed by sequencing.
  • Examples of nucleic acids encoding the IceA 1 variant-specific N-termmal sequences can be nucleotides 25-81 of SEQ ID N0:1.
  • Other examples of iceA 1 allele- specific nucleic acids are shown in SEQ ID NOS: 11-48. Any other allele-specific fragments can be routinely obtained and their structure (sequence) determined by routine means .
  • a nucleic acid that encodes an IceA 2 variant is termed an i ceA 2 allele.
  • i ceA 2 alleles are provided in the Sequence Listing as SEQ ID NOS : 6 and 8-10
  • Sequence ID NO: 11 is a partial sequence.
  • variant-specific nucleic acids can be nucleotides 163 - 195 of SEQ ID NO: 6.
  • Other examples of iceA 2 allele- specific nucleic acids are shown m SEQ ID NOS: 49-62. Any other i ceA 2 allele-specific fragments can be routinely determined using the same methods as used herein.
  • Sequence variability among iceA 1 alleles ranged from about 88% identity down to about 73% identity. That is, for the alleles sequenced, the most divergent share about 73% nucleotide identity. The closest i ceA 2 allele shares only about 44% identity with 60190 iceA 1. Among the i ceA 2 alleles, the most divergent sequences share about 78% identity.
  • the iceA gene can be distinguished from other nucleic acids, because of its conserved genomic location. Particularly, i ceA is flanked upstream by a sequence having strong homology to a serine methyltransferase
  • IceA-encoding nucleic acids can be isolated from an organism in which it is normally found (e.g., H. pyl ori ) , using any of the routine techniques.
  • a genomic D ⁇ A or cD ⁇ A library can be constructed and screened for the presence of the nucleic acid of interest using one of the present i ceA nucleic acids as a probe.
  • Methods of constructing and screening such libraries are well known in the art and kits for performing the construction and screening steps are commercially available (for example, Stratagene Cloning Systems, La Jolla, CA) .
  • the nucleic acid can be directly cloned into an appropriate vector, or if necessary, be modified to facilitate the subsequent cloning steps.
  • modification steps are routine, an example of which is the addition of oligonucleotide linkers which contain restriction sites to the termini of the nucleic acid.
  • General methods are set forth in Sambrook et al. (20) .
  • IceA-encoding nucleic acids can also be synthesized.
  • a method of obtaining a DNA molecule encoding a specific IceA is to synthesize a recombinant DNA molecule which encodes the IceA.
  • oligonucleotide synthesis procedures are routine in the art and oligonucleotides coding for a particular protein region are readily obtainable through automated DNA synthesis.
  • a nucleic acid for one strand of a double- stranded molecule can be synthesized and hybridized to its complementary strand.
  • Double-stranded molecules coding for relatively large proteins can readily be synthesized by first constructing several different double-stranded molecules that code for particular regions of the protein, followed by ligating these DNA molecules together.
  • Cunningham, et al . (38) have constructed a synthetic gene encoding the human growth hormone by first constructing overlapping and complementary synthetic oligonucleotides and ligating these fragments together. See also, Ferretti, et al.
  • IceA fragments can then be expressed in vi vo or in vi tro .
  • nucleic acid encoding a particular IceA of interest or a region of that nucleic acid, is constructed, modified, or isolated, that nucleic acid can then be cloned into an appropriate vector, which can direct the in vi vo or in vi tro synthesis of that wild-type and/or modified IceA.
  • the vector is contemplated to have the necessary functional elements that direct and regulate transcription of the inserted gene, or hybrid gene.
  • These functional elements include, but are not limited to, a promoter, regions upstream or downstream of the promoter, such as enhancers that may regulate the transcriptional activity of the promoter, an origin of replication, appropriate restriction sites to facilitate cloning of inserts adjacent to the promoter, antibiotic resistance genes or other markers which can serve to select for cells containing the vector or the vector containing the insert, RNA splice junctions, a transcription termination region, or any other region which may serve to facilitate the expression of the inserted gene or hybrid gene. (See generally, Sambrook et al . (20) ) .
  • the i ceA or iceA fragment can be in a vector and the vector can be in a host for expressing the nucleic acid.
  • an isolated fragment of the iceA gene is also provided.
  • the fragment can be obtained using any of the methods applicable to the full gene.
  • the fragment can be a gene-specific fragment (i.e., found in iceA, but not in other genes), a species-specific fragment (e.g., found in the i ceA gene of H. pylori , but not in the i ceA gene of other species), or a variant-specific fragment (i.e., found m one variant, but not in the other variant) .
  • Nucleic acids that are gene-specific, species- specific or allele-specific fragments of the iceA gene can encode protein-specific, species-specific or variant- specific fragments of IceA.
  • fragments of an iceA gene are provided in SEQ ID NOS: 11-62.
  • Fragments specific for the i ceA 1 allele are provided in SEQ ID NOS: 11-48.
  • Fragments specific for the i ceA 2 allele are provided m SEQ ID NOS: 49-62.
  • i ceA gene fragments can be primers for PCR or probes, which can be species-specific, gene- specific or allele-specific.
  • i ceA fragments can encode antigenic or immunogenic fragments of IceA that can be used in diagnostic methods or as a vaccine component.
  • i ceA fragments can encode fragments of IceA having DNA binding, RNA binding, transcription activation, proteolysis, etc. as described above, or in other uses that may become apparent.
  • an isolated nucleic acid of at least 10 nucleotides that specifically hybridizes with the nucleic acid of any SEQ ID NOS: 1, 3,4, 5, 6, 8-10 and 63 under selected conditions is provided.
  • the conditions can be polymerase chain reaction conditions and the hybridizing nucleic acid can be primer consisting of a specific fragment of the reference sequence or a nearly identical nucleic acid that hybridizes only to the exemplified i ceA gene or a H. pyl ori homolog thereof.
  • the mvention provides an isolated nucleic acid that specifically hybridizes with the i ceA gene shown m the sequence set forth as SEQ ID Nos : 1, 3, 4, 5, 6, 63 and SEQ ID NO: 102 under the conditions of about 16 hrs at about 65°C, about 5x SSC, about 0.1% SDS, about 2x Denhardt's solution, about 150 ⁇ g/ml salmon sperm DNA with washing at about 65°C, 30 mm, 2x, in about O.lx SSPE/o.1% SDS.
  • hybridizing nucleic acid can be a probe that hybridizes only to the exemplified IceA gene or a homolog thereof.
  • the hybridizing nucleic acid can be a naturally occurring homolog of the exemplified IceA genes.
  • the hybridizing nucleic acid can also include insubstantial base substitutions that do not prevent hybridization under the stated conditions or affect the function of the encoded protein, the way the protein accomplishes that function (e.g., its secondary structure or the ultimate result of the protein's activity.
  • the means for determining these parameters are well known.
  • the term "selectively hybridizes" excludes the occasional randomly hybridizing nucleic acids as well as nucleic acids that encode other known homologs of the present proteins.
  • the selectively hybridizing nucleic acids of the invention can have at least 70%, 73%, 78%, 80%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% complementarity with the segment and strand of the sequence to which it hybridizes.
  • the nucleic acids can be at least 10, 18, 20, 25, 50, 100, 150, 200, 300, 500, 550, 750, 900, 950, or 1000 nucleotides in length, depending on whether the nucleic acid is to be used as a primer, probe or for protein expression.
  • the nucleic acid can be an alternative coding sequence for the protein, or can be used as a probe or primer for detecting the presence H pyl ori or obtaining i ceA. If used as primers, the invention provides compositions including at least two nucleic acids which selectively hybridize with different regions so as to amplify a desired region. Depending on the length of the probe or primer, it can range between
  • the degree of complementarity between the hybridizing nucleic acid (probe or primer) and the sequence to which it hybridizes [H. pylori DNA from a sample) should be at least enough to exclude hybridization with a nucleic acid from a related bacterium.
  • the invention provides examples of these nucleic acids of H. pylori , so that the degree of complementarity required to distinguish selectively hybridizing from nonselectively hybridizing nucleic acids under stringent conditions can be clearly determined for each nucleic acid. It should also be clear that the hybridizing nucleic acids of the invention will not P
  • washing conditions refers to the washing conditions used in a hybridization protocol.
  • the washing conditions should be a combination of temperature and salt concentration chosen so that the denaturation temperature is approximately 5-20°C below the calculated T m of the hybrid under study.
  • the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to the probe or protein coding nucleic acid of interest and then washed under conditions of different stringencies. For example, the i ceA PCR fragment described below is used as a specific radiolabeled probe for H.
  • a method of detecting the presence of an antibody against H. pylori in a sample comprises the following steps: a) contacting the sample with a purified IceA protein of H. pyl ori or a H. pylori- specific fragment thereof; and b) detecting the binding of the antibody in the sample to the protein or fragment, the detection of binding indicating the presence in the sample of antibodies agamst H. pylori .
  • the presence of the antibodies against H. pylori is correlated with current or previous infection with H. pylori in the subject from whom the sample is obtained.
  • the term "antibody agamst H. pyl ori" means an antibody elicited in a subject by exposure to H. pylori .
  • a method of diagnosing H. pylori infection in a subject by detecting in a sample from the subject the presence of an H. pyl ori- specific antigen is also contemplated.
  • the presence of the H. pylori-antigen is correlated with H. pyl ori infection m the subject from whom the sample is obtained.
  • the antigen can be IceA or an antigenic fragment thereof.
  • the sample can be a fluid sample comprising any body fluid which would contain IceA, a H. pyl ori cell containing the antigen or an antibody agamst H. pyl ori , such as blood, plasma, serum, saliva, gastric juice, sputum, mucus, urine and stool.
  • Tissue samples can include gastric or duodenal tissue.
  • contactmg refers to the numerous contacting protocols and binding detection protocols are routinely practiced in the art. These include, but are not limited to the examples described below.
  • Immunoassays such as immunofluorescence assays (IFA) , enzyme linked immunosorbent assays (ELISA) and immunoblotting can be readily adapted to accomplish the detection of the antigen.
  • An ELISA method effective for the detection of the antigen can, for example, be as follows: (1) bind the antibody to a substrate; (2) contact the bound antibody with a fluid or tissue sample containing the antigen; (3) contact the above with a secondary antibody bound to a detectable moiety (e.g., horseradish peroxidase enzyme or alkaline phosphatase enzyme); (4) contact the above with the substrate for the enzyme; (5) contact the above with a color reagent; (6) observe color change.
  • the above method can be readily modified to detect antibody as well as antigen.
  • MAbs monoclonal antibodies
  • a substrate e.g. an ELISA 96-well plate
  • a labeled (enzyme-linked, fluorescent, radioactive, etc.) monoclonal antibody is then reacted with the previously reacted antigen-serum antibody complex.
  • the amount of inhibition of monoclonal antibody binding is measured relative to a control (no patient serum antibody) .
  • the degree of monoclonal antibody inhibition is a very specific test for a particular variety or strain since it is based on monoclonal antibody binding specificity.
  • MAbs can also be used for detection directly in cells by IFA.
  • a micro-agglutination test can also be used to detect the presence of the IceA-possessing H. pylori strain in a subject. Briefly, latex beads (or red blood cells) are coated with the antigen and mixed with a sample from the subject, such that antibodies in the tissue or body fluids that are specifically reactive with the antigen crosslink with the antigen, causing agglutination. The agglutinated antigen-antibody complexes form a precipitate, visible with the naked eye or by spectrophotometer. In a modification of the above test, antibodies specifically reactive with the antigen can be bound to the beads and antigen in the tissue or body fluid thereby detected.
  • the antibody can be bound to a substrate and reacted with the antigen. Thereafter, a secondary labeled antibody is bound to epitopes not recognized by the first antibody and the secondary antibody is detected. Since the present invention provides IceA antigen for the detection of H. pyl ori or previous H. pylori infection, other serological methods such as flow cytometry and immunoprecipitation can also be used as detection methods.
  • detectable moiety will allow visual detection of a precipitate or a color change, visual detection by microscopy, or automated detection by spectrometry, radiometric measurement or the like.
  • detectable moieties include fluorescein and rhodamine (for fluorescence microscopy), horseradish peroxidase (for either light or electron microscopy and biochemical detection), biotin-streptavidin (for light or electron 2 6
  • alkaline phosphatase for biochemical detection by color change
  • radioisotopes for radiography
  • the above method usmg a purified IceA protein selected from the group consisting of the proteins defined in the Sequence Listing as SEQ ID NOS:2, 7 and 101 is specifically provided.
  • a method of detecting the presence of an antibody agamst an ulcerative Helicobacter pyl ori strain m a sample comprises the following steps: a) contacting the sample with a purified IceA protein from an ulcerative HelicoJbacter pylori strain or an ulcerative Heli cobacter pyl ori strain-specific fragment thereof; and b) detecting the binding of the antibody m the sample to the protein or fragment, the detection of binding indicating the presence in the sample of antibodies agamst an ulcerative Heli cobacter pylori strain.
  • the presence of the antibodies against an ulcerative Helicobacter pylori strain is correlated with current or previous infection with an ulcerative H. pyl ori strain in the subject from whom the sample is obtained.
  • a method of detecting ulcerative strains of H. Pylori wherem the purified IceA protein from an ulcerative Heli cobacter pyl ori strain is selected from the group consisting of the proteins defined in the Sequence Listing as SEQ ID NOs:2, 101 and 103 is specifically provided. These are examples of the IceA 1 variant. Others can be used as well.
  • a method of detecting the presence of an antibody agamst an ulcerative Helicobacter pylori strain in a sample using an IceA fragment selected from the group consisting of the fragments defined in the Sequence Listing as SEQ ID NO: 64-100 is specifically provided. These are examples fragments of the IceA 1 variant.
  • a method of detecting Helicobacter pyl ori infection in a subject comprising detecting the presence of a nucleic acid encoding IceA in a specimen from the subject, the presence of the nucleic acid indicating infection with Heli cobacter pyl ori .
  • a method for detecting the presence of a H. pylori-specific nucleic acid in a sample comprising detecting m the sample a nucleic acid specific for the iceA gene of H. pyl ori or an H. pyl o ⁇ - specific fragment thereof. The detection of the nucleic acid is correlated with the presence of H. pylori in the subject from whom the sample is obtained.
  • the present invention also provides a method of determining predisposition to gastric carcinoma in a subject.
  • the method can be accomplished according to the methods set forth herein for the detection of IceA 1 variant-specific H. pyl ori strains or for the detection of antibodies specific to IceA 1 variant.
  • the presence of the antigens or specific antibodies indicates a predisposition of the subject to gastric carcinoma.
  • the methods described herein for detecting nucleic acids specific for IceA-expressing strains can also be used.
  • a method of comparing gene expression in H. pyl ori strains having different clinical consequences comprises the steps of a) isolating RNA from the Helicobacter pylori strains, b) reverse transcribing RNA from the strains to cDNA using a random primer, c) amplifying the cDNA to produce amplification products and d) comparing the amplification products of one strain with the amplification products of another strain, the amplification products of a strain being correlated with gene expression in the strain.
  • the method of comparing gene expression in H. pyl ori strains having different clinical consequences further comprising the step of providing a selected stimulus to the strains being compared prior to the RNA isolation step is also provided.
  • Stimuli relevant to induction of virulence gene expression in H. pyl ori include adherence to gastric epithelial cells, exposure to acid pH, exposure to agents such as omeprazole, or experimental conditions that simulate gastric motility or osmolarity.
  • a mutant Helicobacter pylori in which the product of the i ceA gene is nonfunctional is provided.
  • the mutant can either not express IceA or express a non-functioning IceA antigen.
  • the mutant H. pylori strain is obtained by making an msertional mutation m the coding sequence for the IceA antigen. Briefly, Campy l obac ter coli kanamycin resistance gene (49) is inserted mto a unique restriction site of a plasmid that contains the i ceA open reading frame. To inactivate the i ceA gene of H. pyl ori , the km construct, which is unable to replicate in H. pylori , is introduced directly mto H.
  • Transformants are selected on blood agar plates containing kanamycin (40 ⁇ g/ml) and the mutants are characterized by Southern hybridizations for kanamycin insertion m the iceA gene.
  • the i ceA genes of other H. pyl ori strains can be mutagenized to produce a mutant of the invention. Since the present invention provides the nucleic acid encoding IceA, other methods of mutating the coding sequence of the IceA can be used to obtain other mutant strains as contemplated herein. Additional isogenic mutants can be prepared, for example, by inserting a nucleic acid in the i ceA gene or deleting a portion of the JceA gene so as to render the gene non-functional or produced in such low amounts that the organism is non-ulcerative.
  • the present invention permits the making of specific point mutations having the desired effect.
  • the deletion, insertion or substitution mutations can be made in the gene sequence in either the regulatory or coding region to prevent transcription or to render the transcribed product nonfunctional.
  • Non-isogenic mutants are also within the scope of the invention.
  • a live attenuated H. pyl ori that is an i ceA ' recA ' or an iceA ' vacA " mutant according to the present invention.
  • An IceA ' recA ' mutant strain, an i ceA ' vacA ' strain or an IceA ' vac A ' recA ' mutant strain is constructed, for example, by insertion mutation of the i ceA and vacA and recA genes, according to the methods taught herein for i ceA, as taught in U.S. Patent No. 5,434,253 for recA, and as taught in U.S. Application Serial No. 08/200,232 for vacA.
  • Any of the well known methods of mutating a gene can be used in the present invention to generate H. pylori mutant strains. The strains can be tested as provided for immunogenicity.
  • a deletion in iceA is created by deleting a fragment of i ceA and religating the i ceA clone.
  • This mutant is cloned into suicide vector pILL570.
  • the sacB gene of Bacill us subtili s can also be cloned into the suicide vector to provide a conditionally lethal phenotype.
  • This construct can be transformed mto H. pylori by electroporation, and transformants selected by spectinomycin resistance.
  • the merodiploid strain which contains the suicide vector and the mutated version of the i ceA gene are exposed to sucrose to directly select for organisms that have undergone a second recombination, resulting in the loss of the vector.
  • the IceA protein, antigenic fragments thereof or mutant H. pylori of this invention can be used in the construction of a vaccine.
  • the invention provides an immunogenic amount of the IceA, immunogenic IceA fragment or mutant H. pylori in a pharmaceutically acceptable carrier.
  • the vaccine can be the purified protein, the protein on an intact H. pyl ori , or the protein expressed in E. coli or other host.
  • the vaccine can then be used in a method of preventing peptic ulceration or other complications of H. pyl ori infection (including atrophic gastritis and malignant neoplasms of the stomach) .
  • a method of immunizing a subject agamst infection by H. pylori comprises administering to the subject an immunogenic amount of mutant H. pyl ori in a carrier for the mutant.
  • Immunogenic amounts of the antigen can be determined using standard procedures. Briefly, various concentrations of a putative specific immunoreactive epitope are prepared, administered to an animal and the immunological response (e.g., the production of antibodies) of an animal to each concentration is determined.
  • the pharmaceutically acceptable carrier m the vaccine of the instant invention can comprise salme or other suitable carriers (48) .
  • An adjuvant can also be a part of the carrier of the vaccine, in which case it can be selected by standard criteria based on the antigen used, the mode of administration and the subject (48) .
  • Methods of administration can be by oral or sublmgual means, or by injection, depending on the particular vaccine used and the subject to whom it is administered.
  • the vaccine can be used as a prophylactic or a therapeutic modality.
  • the mvention provides methods of preventing or treating H. pylori infection and the associated diseases by administering the vaccine to a subject.
  • mice models can be used to test vaccine strains for immunogenicity and protective response (Marchetti et al . (41) and Tompkms and Falkow(42 ⁇ ) .
  • a well-established model is that of gnotobiotic piglets, in which the mutant strain is first fed to the piglets. After a suitable interval, the clearance of the vaccine strain is evaluated. Next, this piglet is challenged with the wild-type strain and the presence or absence of infection is ascertained (Eaton et al. (43) and Eaton et al . (44)) .
  • the testing of it to determine immunogenicity and protective ability is routine.
  • a purified monoclonal antibody that specifically binds the IceA or antigenic fragment is provided.
  • a purified monoclonal antibody that specifically binds the IceA 1 variant or antigenic fragment is also provided.
  • a purified monoclonal antibody that specifically binds the IceA 2 variant or antigenic fragment is also provided.
  • the antibody can specifically bind a unique epitope of the antigen or it can also bind epitopes of other organisms.
  • the term "bind” means the well understood antigen/antibody binding as well as other nonrandom association with an antigen.
  • Specifically bind as used herein describes an antibody or other ligand that does not cross react substantially with any antigen other than the one specified, in this case, the IceA antigen or its IceA 1 or IceA 2 variants.
  • Antibodies can be made as described in Harlow and Lane (46) . Briefly, purified IceA or an immunogenic fragment thereof can be injected into an animal in an amount and in intervals sufficient to elicit an immune response. Polyclonal antibodies can be purified directly, or spleen cells from the animal can be fused with an immortal cell line and screened for monoclonal antibody secretion. Thus, purified monospecific polyclonal antibodies that specifically bind the antigen are within the scope of the present invention.
  • a ligand that specifically binds the antigen is also contemplated.
  • the ligand can be a fragment of an antibody or a smaller molecule designed to bind an epitope of the antigen.
  • the antibody or ligand can be bound to a substrate or labeled with a detectable moiety or both bound and labeled.
  • the detectable moieties contemplated within the compositions of the present invention include those listed above in the description of the diagnostic methods, including fluorescent, enzymatic and radioactive markers .
  • compositions of the present invention are provided.
  • an amount of ligand (e.g., antibody or antibody fragment) specifically reactive with the IceA of H. pyl ori sufficient to bind the antigen in the subject and improve the subject's clinical condition is administered to the subject.
  • the ligand can be a purified monoclonal antibody specifically reactive with the antigen, a purified polyclonal antibody derived from a nonhuman animal, or other reagent having specific reactivity with the antigen.
  • cytotoxic moieties can be conjugated to the ligand/antibody by standard methods. Examples of cytotoxic moieties include ricin A chain, diphtheria toxin and radioactive isotopes.
  • Another method of treating peptic ulcers in a subject comprises administering to the subject an amount of a ligand/antagonist for a receptor for the IceA antigen of H. pylori sufficient to react with the receptor and prevent the binding of the IceA antigens to the receptor.
  • An antagonist for the receptor is thus contemplated.
  • the treatment method can include administering to the subject an amount of an analogue of a receptor for the antigen to result in competitive binding of the antigen, thus inhibiting binding of the antigen to its wild type receptor.
  • the receptor is localized on cells present in the mucosa (e.g., gastroduodenal mucosa), such as epithelial cells, inflammatory cells, or endothelial cells.
  • IceA is shown to be associated with gastric carcinoma
  • the above treatment methods are applicable to the treatment or prevention of gastric carcinoma.
  • H. pyl ori strains and cell lines used for adherence H. pyl ori strains and cell lines used for adherence.
  • H. pyl ori strains J166 and J178 were clinical isolates that produced a functional vacuolating cytotoxin and were cagA * . These strains were isolated from persons with peptic ulcer disease and gastritis, respectively. Each strain was grown in Brucella broth with 5% fetal bovine serum (FBS; Gibco, BRL) for 48 hours, harvested by centrifugation (2000 x g) , and resuspended in RPMI 1640 with 10% FBS. An aliquot was removed for control broth-grown cells and incubated at 37°C 5% C0 7 for one hour ( Figure IA) .
  • FBS fetal bovine serum
  • the remaining bacteria were co-cultured with AGS cells (lOVwell, ATCC CRL 1739, a human gastric adenocarcinoma epithelial cell line) grown in RPMI 1640 with 10% FBS. After 60 minutes, the supernatant containing non-adherent bacteria was removed and centrifuged at 2000 x g (nonadherent) and the monolayer of AGS cells and adherent H. pylori was trypsinized. Following detachment of the eukaryotic cells and bacteria, trypsin was neutralized by addition of FBS 36
  • RNA from broth-grown, nonadherent, and adherent H. pylori was isolated using the guanidinium thiocyanate-phenol chloroform method (18) and treated with DNase (1 unit/ ⁇ g) .
  • RNA (400 ng) was reverse transcribed to cDNA (19) using random primer 14307 (12) (5'ggttgggtgagaattgcacg) .
  • PCR then was performed using 14307 as both the 3' and 5' primers and as template either genomic DNA (20) (positive control) , RNA that had not been reverse transcribed (negative control), or cDNA.
  • PCRs included 40 ng template in 50 ⁇ l with 3 mM MgCl 2 , 0.16 ⁇ M primer for 4 cycles [94°C, 5 min; 40°C, 5 min; 72°C, 5 min] followed by 30 cycles [94°C, 1 min; 55°C, 1 min; 72°C, 2 min] and a 10 minute extension at 72°C. Amplification products were examined by gel electrophoresis and ethidium bromide staining.
  • a genomic ⁇ ZAPII library from H. pyl ori reference strain 60190 (21) was screened with the 32 P-labelled 900 bp PCR product identified by RAP RT-PCR in H. pylori clinical isolate J166 (20) . Positive plaques were purified, cloned into pBluescript (Stratagene, La Jolla, CA) , and plasmids containing the cloned DNA inserts were excised by coinfection with helper phage as detailed previously (22) . Plasmids were isolated and nucleotide sequence determined unambiguously on both strands using multiple primers and both automated (23) and manual (24) techniques. For PCR product sequencing, bands were excised from agarose gels, subcloned mto pT7Blue (Novagen, Madison, WI) and sequenced using multiple primers and automated techniques.
  • Nucleotide sequences were compiled and analyzed using a BLAST search of the GenBank-EMBL databases and GCG Pileup program (23) . Predicted ammo acid sequences were compared using BLASTP search of the non-redundant protein database (comprised of SWISS-PROT, PIR, Genpept and Brookhaven protein data bank) maintained by the National Center for Biotechnology Information on January 18, 1996.
  • H. pyl ori isolates were obtained from patients at the Nashville DVA Medical Center Gastroenterology Clinic during upper endoscopy as described (25) . Patients with peptic ulcer disease who were ingesting NSAID medications were excluded.
  • gastric biopsies were placed immediately in normal salme at 4°C and coarsely homogenized in 250 ⁇ l normal saline using a tissue grinder (Micro Kontes, Vineland NJ) . 50 ⁇ l was plated onto Trypticase soy agar with 5% sheep blood (BBL) and incubated for 96 hours under microaerobic conditions, as described previously (25) .
  • Genomic DNA was extracted (20) from H. pylori isolates and used as template for PCR.
  • i ceA-spanning PCR primers ser-1 and meth-3 were designed based on genomic sequence of the H. pylori cysE homolog and K . Hpyl , respectively ( Figure 2) and used to amplify genomic DNA from 6 clinical H. pyl ori strains.
  • PCRs included 50 ng genomic DNA, 0.5 ⁇ M primers, 1.0 mM MgCl 2/ in 50 ⁇ l buffer as described (19) . Reactions were amplified for 35 cycles [94°C, 1'; 65°C, 1'; 72°C, 2'] and 1 cycle 72°C, 7' .
  • i ceA 2 primers (178-1, 178-2, Figure 2) were designed based on i ceA sequence from H. pyl ori strain J178. Reactions were amplified for 30 cycles [94°C, 1'; 54°C, 1'; 72°C, 1'] and 1 cycle 72°C, 7' .
  • PCRs for cagA, vacA ml mid-region allele, and vacA si signal sequence allele were performed using genomic DNA as template, as previously described (19,26) .
  • Functional cytotoxin activity was determined by an in vi tro HeLa cell assay (26) .
  • RNA DNA (2 ⁇ g) and RNA (5 ⁇ g) were prepared from strains J166 and J178 grown in broth alone or following co-culture with AGS cells ( Figure IA) . Nucleic acids were denatured, applied to a nylon membrane by slot blotter and hybridized sequentially with the following 32 P-labelled PCR-generated cDNA probes: i ceA 1 from strain 60190 (nucleotide positions 264 to 801, [ Figure 2]), i ceA 2 from strain J178 (nucleotide positions 1 to 941, [ Figure 2]), cysE from 60190 (nucleotide positions 53 to 434, accession #U43917) , M.Hpyl from 60190 (nucleotide positions 1311 to 1987, accession #U43917), and 16S rRNA from 60190 [522 bp product amplified using H.
  • RNA samples were prepared as described above, electrophoresed in denaturing agarose gels and transferred to nylon. Nylon blots were hybridized, washed and exposed for 24-48 hours before development, as described (20) .
  • RAP RT-PCR identified a strain-specific cDNA product induced by adherence to AGS cells.
  • RAP RT-PCR random arbitrarily-primed reverse transcriptase-PCR
  • the 900 bp PCR product from J166 was subcloned and the DNA sequence was determined (SEQ ID NO: 102) .
  • Primers specific for i ceA were used to PCR-amplify genomic DNA from 40 H. pyl ori clinical isolates, and the cag ⁇ + tox + reference strain 60190. Amplification patterns differed among strains, indicating genomic variation in iceA (not shown) .
  • pyl ori gene i ceA, which may possess sequence diversity.
  • the i ceA sequence from strain 60190 is deposited as follows: GenBank accession numbers; i ceA, cysE, K . Hpyl #U43917.
  • iceA is flanked by highly conserved genes.
  • genomic sequence of i ceA and flanking genes we screened a genomic ⁇ ZAPII library from reference strain 60190 (21) with the 900 bp RAP RT-PCR J166 product.
  • Strain 60190 was chosen as the source of the genomic clone because genomic DNA from this strain and the prototype ulcer strain J166 gave identical PCR patterns with iceA primers.
  • pRMPlOO Figure 2
  • three open reading frames were identified. Upstream of the iceA ORF, we identified the 3' terminus of a gene not previously described in H.
  • Hpyl extends from nucleotide 900 to 975 and 866 to 941 for strains 60190 and J178, respectively.
  • a potential 384 bp iceA ORF from 60190 was initiated by a canonical ATG codon at position 508 ( Figure 2) and a potential ribosome binding site (AGCA) ended 13 bp upstream.
  • iceA encoded a predicted protein of 127 amino acid residues with a calculated molecular weight of 14.7 kDa, with no significant homology to any previously reported bacterial proteins.
  • An alternative translation initiation codon in the same frame is TTG at nucleotide 355 and its subsequent ammo acid sequence is shaded in Figure 2.
  • the potential iceA ORFs from 60190 genomic D ⁇ A and the i ceA sequence of the J166 RAP RT-PCR product showed 86.1% nucleotide identity, confirming the sequence relatedness first suggested by PCR.
  • a potential ORF within J178 i ceA commences at nucleotide 357 and ends at nucleotide 536.
  • TTG initiation codons were present upstream of the putative ATG translation start site at position 508 codon within the same open reading frame. Although the use of TTG as an initiation codon has been described in other bacteria (30) , it has not been observed previously m H. pylori . In addition, several GTG codons which could encode initiating methionine residues were present downstream of the ATG at position 508. It is currently unknown which of these codons represents the translational start site. It is also possible that both translational start codons are used. There are examples of proteins that have two or more translation initiation sites, and the resultant proteins differ in their function. This apparently is more common in viruses and eukaryotic cells than in prokaryotes.
  • bFGF protein basic fibroblast growth factor
  • PCR primers which spanned i ceA were designed.
  • i ceA was amplified from genomic DNA of the gastritis strain J178, and sequence analysis showed a homologous ORF ( Figure 2) .
  • the i ceA sequences in 60190 and J178 shared only 39.9% nucleotide identity, confirming that substantial allelic variation of i ceA exists.
  • the longest possible ORF in J178 DNA predicts a protein of 57 amino acids.
  • the i ceA alleles present in strains 60190 and J178 were designated 1 and 2, respectively, and their diversity contrasted markedly with the nearly complete sequence conservation of the flanking genes, cysE and M. Hpyl ( Figure 2) .
  • i ceA allelic variation is associated with peptic ulcer disease.
  • t Duodenal ulcer (DU) disease defined as a circumscribed break in the mucosa with diameter of at least 1cm, with apparent depth and covered by an exudate noted on either current or prior endoscopy. Patients with duodenal ulcer disease who were ingesting NSAID medications were excluded.
  • RNA from both prototype strains J166 and J178
  • allele-specific cDNA probes for hybridization in slot blot ( Figure 4) and Northern analyses.
  • DNA (2 ⁇ g) and RNA (5 ⁇ g) was prepared from strains J166 and J178 grown in broth alone or following co-culture with AGS cells (adh) (as described in Figure 1) , denatured, and applied to a nylon membrane.
  • the membrane was hybridized sequentially with the following 32 P-labelled PCR-generated cDNA probes: i ceA 1 from strain 60190, iceA 2 from strain J178, cysE from 60190, M.Hpyl from 60190, and 16S rRNA from 60190.
  • i ceA expression was markedly up-regulated in ulcer-strain J166 only following adherence; iceA expression was not detected in gastritis-strain J178 under any condition.
  • iceA 1 cDNA probe generated from strain 60190 on slot blots iceA expression in J166 was found to be significantly up-regulated by adherence to AGS cells in comparison to broth-growth alone, but there was no hybridization to RNA from strain J178 following broth-growth or adherence.
  • genomic DNA from each strain was probed on the same blot and demonstrated strong hybridization signals. When the blot was stripped and rehybridized using a probe for the J178 i ceA 2 allele, there was no detectable i ceA expression in 8558
  • RNA from either broth-grown or adherent cells of either strain Northern analysis using an iceA 1 probe confirmed the substantial up-regulation of J166 iceA following adherence and a transcript size of 350-550 bp.
  • probes for the conserved flanking genes cysE and K . Hpyl were used, no expression was found in either H. pyl ori strain under either growth condition, in both slot-blot ( Figure 4) and Northern analyses.
  • i ceA alleles are not correlated with known H. pylori virulence determinants. Since i ceA 1 was associated with peptic ulcer disease, we examined the relationship between i ceA alleles and other markers of H. pyl ori virulence (Table 1) . There were no significant correlations between iceA alleles and cagA genotype, vacA mid-region or signal sequence alleles, or in vi tro cytotoxin activity (toxigenicity), indicating independence of iceA 1 from previously described H. pylori virulence markers.
  • i ceA predicts that it is a virulence " gene.
  • H. pyl ori binding to gastric mucosal cells is an obligate, early event in the establishment of chronic infection (16,17) . Transition of H. pylori from spiral to coccoid forms occurs following adherence, suggesting that the bacteria receive stimuli from eukaryotic cells that may modulate gene expression (15) .
  • Attachment of H. pyl ori to AGS cells is characterized by effacement of the eukaryotic cell microvilli, pedestal formation, cytoskeletal rearrangement, and phosphorylation of host cell proteins (15) .
  • EPEC enteropathogenic E. coli
  • S . typhimuri um S . typhimuri um
  • Yersinia pseudotuberculosi s 31-34
  • a property common to each of these mucosal pathogens is that interaction with mammalian cells induces bacterial gene expression critical to pathogenesis.
  • contact with gastric epithelial cells in vi vo and in vi tro is one paradigm for induction of virulence genes.
  • iceA exists in two major allelic variants, but only the iceA 1 allele was up-regulated following adherence with gastric epithelium. This finding was consistent, regardless of the techniques (RAP RT-PCR, RNA slot blots, Northern analysis) or the probes ⁇ i ceA 1, i ceA 2) used to detect iceA expression.
  • the i ceA 1 allele was present in a minority of strains examined (25% in our population) which is provocative, considering that only a small percentage (10-20%) of H.
  • pyl ori-infected persons develop clinical or pathologic sequelae (peptic ulcer disease or gastric cancer) (5) .
  • Toxigenicity and cagA genotype are strain-specific traits found more commonly in ulcer-derived H.
  • pyl ori strains however, these traits also are present in the majority of H. pylori strains derived from persons who remain asymptomatic. These data contrast with the presence of i ceA 1 in a minority of strains. Further, i ceA alleles were not correlated with presence of cagA, vacA signal sequence or mid-region alleles, or in vi tro cytotoxin activity. These findings suggest evolutionary divergence in a subset of strains with increased virulence.
  • iceA 1 genotype was highly associated with peptic ulcer disease. All strains possessing the i ceA 1 allele were isolated from patients with ulceration in contrast to only 27% of strains with the i ceA 2 allele, suggesting that infection with iceA 1 strains may significantly increase the risk for subsequent ulcer development.
  • Treatment of H. pyl ori is complex, involving regimens with multiple dosing schedules and toxicities, and patient compliance often is suboptimal.
  • the identification of H. pylori-infected persons who are at increased risk for developing clinical complications should enable physicians to focus therapeutic efforts. Further, delineating the means by which particular H. pylori clinical isolates lead to injury will contribute to the overall understanding of chronic mucosal infectious processes .
  • a Campylobacter coli kanamycin resistance gene (Labigne-Roussel et al . Gene transfer from Escheri chia coli to Campylobacter species. Development of shuttle vectors for genetic analysis of Campyl obacter jej uni . J. Bacteriol . 169:5320-5323, 1987) is inserted into a unique restriction site of a plasmid that contains the i ceA open reading frame.
  • the km constructs that is unable to replicate in H.
  • pyl ori is introduced directly into H. pylori by electroporation, as described previously (47) .
  • Transformants are selected on blood agar plates containing kanamycin (40 ⁇ g/ml) and the mutants are characterized by Southern hybridizations for kanamycin insertion in the iceA gene.
  • IceA Expression Several attempts have been made to subclone the cDNA for iceA 1 into several vectors for expression as a fusion protein in order to prepare purified protein for ELISAs, making antibodies, etc.
  • a commercial vector pGEX2
  • pGEX2 was used, which includes the gene encoding glutahione-S-transferase upstream of sequence encoding amino acids that result in a thrombin cleavage site, followed by a restriction enzyme cloning cassette.
  • the cDNA for the 21 kDa form of iceA 1 was cloned into this vector, the 50 kDa fusion protein was purified on glutahione agarose, dialyzed the glutathione out, then cleaved the fusion protein with thrombin. This resulted in two bands on SDS-PAGE, one of 29 kDa corresponding to GST and a second band of about 21 kDa which appears to be IceA 1.
  • the potentially interesting finding is that the first several times this was attempted, only a very faint low molecular weight band was obtained when the fusion protein was cleaved with thrombin and no band at 21 kDa.
  • protease inhibitors were included at all stages of the purification. There may proteases derived from the E. coli that are cleaving IceA or IceA itself could be a protease that is autocatalytic. The latter would be quite interesting since it is relevant to the protein's function.
  • MOLECULE TYPE DNA (genomic) ( ix ) FEATURE :
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
  • TAATAGCGAC AAAAGCTTTG ATACATTCAG CTAGTGGGGG GGTGTTGCTG TTTTTTTGGC 249
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • GCGGTACTAC CAAACGATCA TTGTCTCACA TAGGATTGAT TGGTTGGTTT TAGGATTATT 180
  • MOLECULE TYPE DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: TTTGATAAAG GGCAAACTCT 20
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (geno ⁇ uc)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • xi SEQUENCE DESCRIPTION: SEQ ID NO:29: CTAGGAAATT CTATTGATAG 20
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 51: TAAAAGAACC TACTAGAAAA 20
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • xi SEQUENCE DESCRIPTION: SEQ ID NO: 58: ACCTACTAGA AAATAGGGTA 20
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • MOLECULE TYPE DNA (genomic)
  • TATTATTCTT TCTATGAGGG GGAGGCTGAA TATGATGGTT GTGTGGGCTG TTATCAATAT 780

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Oncology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP97925659A 1996-05-20 1997-05-20 IceA GEN UND DIESBEZÜGLICHE VERFAHREN Withdrawn EP0861027A4 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US08/650,528 US5780278A (en) 1996-05-20 1996-05-20 IceA gene and related methods
US650528 1996-05-20
PCT/US1997/008558 WO1997043901A1 (en) 1996-05-20 1997-05-20 IceA GENE AND RELATED METHODS

Publications (2)

Publication Number Publication Date
EP0861027A1 true EP0861027A1 (de) 1998-09-02
EP0861027A4 EP0861027A4 (de) 2001-12-19

Family

ID=24609299

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97925659A Withdrawn EP0861027A4 (de) 1996-05-20 1997-05-20 IceA GEN UND DIESBEZÜGLICHE VERFAHREN

Country Status (6)

Country Link
US (3) US5780278A (de)
EP (1) EP0861027A4 (de)
JP (1) JPH11511032A (de)
AU (1) AU736089B2 (de)
CA (1) CA2227171A1 (de)
WO (1) WO1997043901A1 (de)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1029082A2 (de) * 1997-11-06 2000-08-23 Innogenetics N.V. Nachweis und typisierung des icea gens von helicobacter pylori
US6309817B1 (en) * 1998-09-30 2001-10-30 Boston Medical Center Corporation Identification of virulence determinants activators in prokaryotic pathogens
TWI237695B (en) * 1999-12-14 2005-08-11 Joy Biomedical Corp Helicobacter pylori antigens in blood
EP1276904B1 (de) * 2000-03-22 2013-08-28 Life Technologies Corporation Verfahren zur verwendung von halbleiter-nanokristallen bei nukleinsäure-assays auf bead-basis
GB0008787D0 (en) * 2000-04-10 2000-05-31 Norsk Naeringsmiddelforskning A method of cell detection
EP1400593A4 (de) * 2001-06-06 2005-04-06 Takeda Pharmaceutical Neuer promotor

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5563039A (en) * 1995-03-31 1996-10-08 Tularik, Inc. TNF receptor-associated intracellular signaling proteins and methods of use
SK165197A3 (en) * 1995-06-07 1999-01-11 Astra Ab Nucleic acid and amino acid sequences relating to helicobacter pylori for diagnostics and therapeutics

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
No further relevant documents disclosed *
PROGRAM OF THE ANNUAL MEETING OF THE AMERICAN GASTROENTEROLOGICAL ASSOCIATION, April 1996, vol. 110, no. 4, page 118 *
See also references of WO9743901A1 *

Also Published As

Publication number Publication date
JPH11511032A (ja) 1999-09-28
AU3073397A (en) 1997-12-09
EP0861027A4 (de) 2001-12-19
WO1997043901A9 (en) 2001-06-21
US6107464A (en) 2000-08-22
US6004354A (en) 1999-12-21
WO1997043901A1 (en) 1997-11-27
CA2227171A1 (en) 1997-11-27
US5780278A (en) 1998-07-14
AU736089B2 (en) 2001-07-26

Similar Documents

Publication Publication Date Title
US5527678A (en) CagB and CagC genes of helicobacter pylori and related compositions
Seong Kim et al. Molecular cloning and characterization of the Helicobacter pylori fliD gene, an essential factor in flagellar structure and motility
JP2006166919A (ja) 空胞形成毒素欠損Ｈ．ｐｙｌｏｒｉおよび関連する方法
WO1994009023A1 (en) THE tagA GENE AND METHODS FOR DETECTING PREDISPOSITION TO PEPTIC ULCERATION
CZ96697A3 (en) Isolated nucleic acid encoding heliobacter pylori antigen, vector in which it is comprised, purified antigenic preparation being encoded thereby, detection method of the heliobacter pylori strain presence, method of determining pre-diathesis for peptic ulcer, method of determining pre-diathesis for stomach carcinoma, heliobacter pylori mutant and heliobacter pylori strain
US20060018920A1 (en) Lawsonia derived gene and related OmpH polypeptides, peptides and proteins and their uses
AU736089B2 (en) IceA gene and related methods
US20060159707A1 (en) Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
AU771376B2 (en) Lawsonia derived gene and related FlgE polypeptides, peptides and proteins and their uses
CA2372095A1 (en) Lawsonia derived gene and related sodc polypeptides, peptides and proteins and their uses
NZ515363A (en) Lawsonia derived gene and related hemolysin polypeptides, peptides and proteins and their uses
US6296855B1 (en) 17-KDA Brucella abortus antigen, recombinant polypeptides, nucleic acids coding for the same and use thereof in diagnostic and prophylactic methods and kits
WO1997003359A1 (en) Helicobacter clpb
WO1998006853A1 (en) Treatment and prevention of helicobacter infection
AU703075C (en) The tagA gene and methods for detecting predisposition to peptic ulceration and gastric carcinoma
JP2000210093A (ja) ＧｉｄＡ１
AU780980B2 (en) Novel therapeutic compositions for treating infection by lawsonia SPP

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980219

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 980219;LT PAYMENT 980219;LV PAYMENT 980219;RO PAYMENT 980219;SI PAYMENT 980219

A4 Supplementary search report drawn up and despatched

Effective date: 20011106

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20030207

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050204