EP0832106A2

EP0832106A2 - Compounds having bradykinin antagonistic activity and mu-opioid agonistic activity

Info

Publication number: EP0832106A2
Application number: EP96918098A
Authority: EP
Inventors: John C. Cheronis; Albert Gyorkos; Lyle W. Spruce; Eric T. Whalley
Original assignee: Cortech Inc
Current assignee: Cortech Inc
Priority date: 1995-06-05
Filing date: 1996-06-04
Publication date: 1998-04-01
Also published as: AU6044496A; WO1996039425A2; TW407159B; WO1996039425A3

Abstract

The present invention relates to pharmaceutically effective heterodimers comprising a bradykinin antagonist component covalently linked to a mu-opioid agonist component.

Description

COMPOUNDS HAVING BRADYKININ ANTAGINISTIC ACTIVITY AND MU-OPIOID AGONISTIC ACΗVITY

B CKGROUND OF THE INVENTION

This invention relates to compounds with combined bradykinin receptor antagonist and mu- opioid receptor agonist activities and to methods of using the same.

C-Fiber afferents are known to mediate both the sensation of pain as well as the neurogenic

component of inflammation. These afferent neurons release a variety of neuropeptides in response to specific and non-specific stimuli in both the central nervous system (CNS) as well as in the peripherally innervated tissues. Some of these neuropeptides include: substance-P, neurokinin A,

neurokinin B, calcitonin gene related peptide (CGRP), cholecystokinin (CCK), vasoactive intestinal polypeptide (VIP), and neuropeptide Y, among other neurotransmitters. To add to this complexity, different C-fibers appear to contain different amounts and/or ratios of these neuropeptides depending

on the tissue innervated. All of these peptides have been shown to play contributory roles in the various neurogenic processes that have been implicated in numerous diseases and clinical syndromes.

One apparently common feature among this otherwise diverse group of neurons is that they all have mu-opioid receptors that modulate the release of these neuropeptides as well as afferent C-

fiber activity. Both the endogenous enkephalins as well as other exogenously administered small

molecular weight compounds such as morphine, oxymorphone, fentanyl and their derivatives will inhibit the release of the neuropeptides from peripheral C-fibers by acting as mu-opioid receptor agonists locally (at terminal mu-opioid receptors in the periphery) and in the CNS. This inhibition is independent of both the constellation of peptides contained in the specific C-fiber as well as the stimulus causing their release.

As a result, one important class of compounds considered to have a particularly good profile of activities for the treatment of conditions that are produced by combined humoral and neurogenic

processes are bradykinin antagonist (BKAn)/mu-opioid receptor agonist heterodimers. These

compounds would be expected to attenuate or block both the humoral component of the

inflammatory process as represented by the kinins as well as the neurogenic aspects of inflammation produced by the release of the neuropeptides. In addition, one of the limiting aspects of the use of

existing mu-opioid agonists is their propensity to produce sedation, confusion, and a depressed

respiratory drive, not to mention their potential for the development of addiction and/or tolerance in

the patients being treated with these agents. These undesirable aspects of mu-opioid receptor

agonists are due to their ability to easily penetrate the CNS. BKAn mu-opioid receptor agonist

heterodimers, however, should not penetrate the CNS due to the highly cationic nature of the BKAn.

Consequently, mu-opioid receptor agonist activity should be limited to the periphery and

should result in a substantially reduced side effect/toxicity profile for these types of compounds.

SUMMARY OF THE INVENTION

The present invention provides heterodimeric compounds of the general formula

(BKAn)(X)(Y) where BKAn is a bradykinin antagonist peptide; Y is a mu-opioid receptor agonist

and X is a linking moiety. More specifically, the present invention provides heterodimeric compounds

where the mu-opioid receptor agonist is selected from fentanyl, dihydromorphine and morphine or derivatives or analogs thereof. The present invention also provides heterodimers comprising improved linking moieties as well as improved bradykinin antagonists.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the effect of dihydromorphine (DHM) on paw licking time following formalin injection.

Figure 2 shows the effect of CP-0840 on paw licking time following 10 μl formalin injection.

Figure 3 shows the effect of dihydoπnorphine on the response time of mice exposed to a hot surface.

Figure 4 shows the effect of CP-0840 on the response time of mice exposed to a hot surface.

Figure 5 compares the effect of saline, DHM, CP-0597 and CP-0840 on carrageenan (1%

i.pl.) induced edema in the rat hind paw.

Figure 6 shows the duration of action of CP-0840 in rats.

Figure 7 compares the effect of saline, DHM, CP-0597 and CP-0840 on mustard oil induced neurogenic inflammation in the rat hind paw.

Figure 8 shows the effect of CP-0840 on the hypotensive response to bradykinin.

Figure 9 shows the selectivity of CP-0840.

DETAILED DESCRIPTIONOF THE INVENTION

The present invention provides further embodiments of the heterodimeric compounds

described in this application's progenitors. The invention may be generally described by the formula:

(BKAn)(X)(Y) where the terms BKAn, X and Y are previously defined. According to the present invention, the mu-opioid agonist is selected from fentanyl, dihydromorphine and morphine or derivatives or

analogues thereof.

According to a particular embodiment, Y is

where R, and R₂ are independently selected from

where n = 1 to 20 where n = 1 to 15

where R₃ is (CH₂)_n and R, is C(O); (CH₂)_πC(O); CONH(CH₂)_nC(O) or CONH(CH₂)-CONH(Phe)CH₂C(O), where n = 1 to 4 (where R, or R₂ represents the linker group

X) or H.

In another preferred embodiment, Y is

where Rl and R2 are independently selected from

where n = 1 to 20 where n = 1 to 15 where n = 1 to 4 where n = 1 to 4 where n = 1 to 8

where Ra is -NHCO(CH₂)_n where n = 1 to 4 where n = 1 to 4 and

R₄ is (CH₂)_nC(O) where n = 0 to 4; or CH₂CONH(CH₂)_n C(O), where n = 1 to 4

where R^ is CO(CH₂)_nNH- and where R₃ is (CH₂)_nNHCO- R₄ is -CONH(CH₂)_nCO where n = 1 to 8 and where n = 1 to 4 R, is -CONH(CH₂)_nCO where n = 1 to 4

(where R, or R₂ represents the linker group X) or H. According to another embodiment, Y is

where

R, is a linking group X of the formula CH₂CH₂(Phe)CH₂C(O); R₄ is COCH₂CH₃. Preferred BKAn components include

D-Arg-Arg-Pro-Hyp-Gly-Iglb-Ser-D-Iglb-Oic-Arg (B9430);

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Iglb-Oic-Arg (B9340);

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg (CP-0597);

D-Arg-Arg-Pro-Hyp-Gly-Phe-Ser-D-Tic-NChg-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Iglb-Ser-D-Iglb-Iglb-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-Oic-Arg (HOE-140);

D-Arg-Arg-Pro-Hyp-Gly-Phe-Ser-DHypTE-Oic-Arg; or analogs thereof analogs possessing bradykinin antagonist activity.

In addition, it is contemplated that any of the above peptides may be substituted with L- Arg or L-Lys in the "0" position (i.e., D-Arg). The peptides may also be substituted with D- or L-Lys in the 0 to 6 positions for coupling to Y. Linkage may then be accomplished for example, via the α-amino group of the L-Arg residue, or the α-amino or e-amino group of the D-Lys or L- Lys residue.

Also described herein are the following compounds:

CP-0912

DArg-Arg-Pro_v Gly-Thi-Ser-D-Tic-NChg-Arg

orphine CP-0911

CP-0913

As used herein, the symbol " Λ " indicates a stereoisomeric mixture.

As used herein, abbreviations of the natural amino acids are those accepted in the art

(Biochem J. 126:773 (1972)), and unless prefixed with D- are all of the L- configuration (except

glycine, which is not optically active).

Abbreviations used for unnatural amino acids in Bradykinin analogs are indicated below:

Iglb «-(2-indanyl)glycine)

Hyp rrαn_-4-Hydroxy-Pro

D-HypTE D-hydroxyproline trans thiophenyl ether

Thi β-2-Thienyl-Ala

D-Tic D-( 1 , 2, 3 , 4-tetra hydroisoquinolin-3-yl-carbonyl)

Oic Cis-endo-octahydroindo-2-carbonyl

NChg N-(cyclohexyl)glycine EXAMPLES Example I. 4,5«-Epoxy-6-«-hydroxy-3-O-(12-carboxydodecanoic acid)-7,8-dihydro-17-

methylmorphinan.

To a solution containing 1.8 g (3.32 mmol) of 4,5<*-Epoxy-6-«-hydroxy-3-O-(12-carbo-t-

butoxydodecanoic acid)-7,8-dihydro-17-methylmorphinan in 40 ml of ethanol and 12 ml of water

was added 0.98g (16.09 mmol) of potassium hydroxide. The mixture was heated to reflux for 4

hours. The reaction mixture was diluted with water and washed with methyleήe chloride. The

aqueous phase was acidified with IN aqueous hydrochloric acid and extracted with methylene

chloride. The organic phase was dried over magnesium sulfate. Filtration and removal of solvent

afforded 1.38 g (85.59%) of product as a white solid.

Η NMR (CDC1₃) δ 1.28 (bs, 14H), 1.28-1.48 (m, 5H), 1.60-1.80 (m, 6H), 2.13 (m, IH)

2.28 (t, J= 7.4 Hz, 2H), 2.50 (m, 2H), 2.62 (s, 3H), 2.70 (dd Jl=6.0 Hz, J2=19.4 Hz, IH), 3.01

(d, J=19.1 Hz, IH), 3.02 (m, IH), 3.49 (m, IH), 4.05 (m,3H), 4.60 (d, J=5.5 Hz, IH), 6 .64 (d, J=8.2 Hz, IH), 6.75 (d, J=8.2 Hz, IH).

¹³C NMR (CDCI₃) 6 18.27, 20.88, 25.56, 25.89, 27.36, 29.31, 29.36, 29.47, 35.25, 35.69,

38.84, 40.91, 41.35, 46.78, 59.96, 66.60, 69.55, 89.53, 115.46, 119.31, 123.90, 129.21, 141.51, 146.50, 178.65

Theory 69.15 9.01 .2.78

Found 69.08 $.80 2.53

The intermediate 4,5«-Epoxy-6-«-hydroxy-3-O-(12-carbo-t-butoxy dodecanoic acid)-7,8-

dihydro-17-methylmorphinan was prepared as follows: a) 4,5«-Epoxy-3-O-acetyl-6-«-hydroxy-7,8-didehydro-17-methylmorphinan:

To a solution containing 15.0g (19.77 mmol) of morphine sulfate pentahydrate in 1.2L of

water was added 56.4 g (672.06 mmol) of sodium bicarbonate. After stirring for 10 minutes, 28.0

ml (296.26 mmol) of acetic anhydride was added and stirring continued for 45 minutes. The

reaction mixture was transferred to a separatory funnel and extracted with chloroform (3x). The

organic phase was dried over calcum sulfate. Filtration and removal of solvent afforded 12.9 g (100%) of product as a white solid.

Η NMR (CDC1₃) δ 1.86 - 1.95 (m, IH), 2.07 (dt, Jl=5.1 Hz, J2=12.5 Hz, IH), 2.26-2.42

(m, 2H), 2.30 (s, 3H), 2.44 (s, 3H), 2.58 2.71 (m, 2H), 3.05 (d, J=18.7 Hz, IH) 3.35 (dd, Jl=3.3

Hz, J2=6.0 Hz, IH), 4.15-4.20 (m, IH), 4.92 (d, J=6.6 Hz, IH), 5.28 (dt, Jl=2.6 Hz, J2=10.4 Hz,

IH), 5.72 -5.82 (m, IH), 6.61 (d, J=8.1 Hz, IH), 6.74 (d, J=8.1 Hz, IH).

¹³C NMR (CDCI₃) δ 20.57, 34.97, 40.15, 42.42, 42.82, 46.16, 58.66, 65.66, 92.13,

119.66, 120.88, 127.56, 131.56, 132.07, 132.59, 133.95, 148.56, 168.37.

b) 4,5 <*-Epoxy-6-«-0-acetyl-3-O-( 12-carbo-t-butoxydodecanoicacid)-7,8-didehydro- 17- methylmorphinan:

To a solution containing 2.5g (7.64 mmol) of 4,5«-Epoxy-3-O-acetyl-6-«-hydroxy-7,8-

didehydro-17-methylmorphinan in 40 ml of dimethylformamide under a nitrogen atmosphere was added 0.2 g (8.33 mmol) of sodium hydride. After complete gas evolution, a solution containing

2.7 lg (8.08 mmol) of 12-bromo-dodecanoic acid t-butylester in 8 ml of dimethylformamide was

added. The reaction was heated to 5CTC and maintained for 1 hour 45 minutes while monitoring

by thin layer chromatography. The reaction mixture was diluted with ethyl acetate and washed

with water. The organic phase was dried over magnesium sulfate. Filtration, removal of solvent, and column chromatography of the residue on silica gel with 20% methanol/methylene chloride

afforded 3.79g (85.27%) of product as a viscous oil.

Η NMR (CDCl_j) δ 1.23-1.37 (m,14H), 1.44 (S, 9H), 1.52-1.62 (m, 2H), 1.68-1.90 (m,3H), 2.15 (s, 3H), 2.20 (t, J=7.4 Hz, 2H) 2.25-2.40 (m, 2H), 2.45 (s, 3H), 2.54-2.64 (m, IH),

2.74 (bs, IH) 3.03 (d, J=18.5 Hz, IH), 3.32-3.40 (m,lH), 3.94-4.06 (m, 2H), 5.07 (d, J=6.0 Hz,

IH), 5.15-5.20 (m, IH), 5.44 (dt, Jl=2.4 Hz, J2=10.2 Hz, IH), 5.60-5.65 (m, IH), 6.52 (d, J=8.1

Hz, lH), 6.66 (d, J=8.1 Hz, IH). c) 4,5«-Epoxy-6«-0-acetyl-3-O-(12-carb-t-butoxydodecanoicacid)-7,8-didehydro-17-

methylmorphinan:

A solution containing 3.70g (6.36 mmol) of 4,5«-Epoxy-6«-0-acetyl-3-O-(12-carbo-t-

butoxydodecanoic acid)-7,8-didehydro-17-methylmorphinan in 100 ml of ethanol was charged

with 0.6g of 10% palladium on carbon and pressurred with hydrogen to 40 psig. The flask was

shaken for 24 hours. The reaction mixture was then filtered through a plug of celite and the solvent removed under reduced pressure. Column chromatography of the residue on silica gel

with 20% methanol methylene chloride afforded 3.19g (85.91%) of product.

Η NMR (CDCI₃) δ 1.27 (bs, 14H), 1.44 (s, 9H), 1.38-1.92 (m, 8H), 1.78 (s, 3H), 2.25 (t, J=7.7 Hz, 2H), 2.25-230 (m, 4H), 2.41 (s, 3H), 2.36-2.45 (m, IH), 2.51-2.57 (m, IH), 2.99 (d,

J=18.4 Hz, IH), 3.11 (dd, Jl=2.3 Hz, J2=5.0 Hz, IH), 3.93-4.13 (m, 2H), 4.60 (d, J=5.9 Hz,

IH), 5.29-5.34 (m, IH), 6.59 (d, J= 8.2 Hz, IH), 6.69 (d, J=8.2 Hz, IH).

¹³C NMR (CDCI₃) δ 19.14, 20.11 20.61 25.07, 25.96, 26.04, 28 07, 29.05,

29.25, 29.41, 29.49, 29.62, 35.59, 36.58, 41.44, 41.99, 42.79, 47.11, 59.64, 67.94, 69.69, 79.84,

87.15, 115.33, 118.77, 126.29, 129.56, 141.11, 146.85, 170.56, 173.33. d) 4,5«-Epoxy-6-«-hydroxy-3-O-( 12-carbot-butoxydodecanoic acid)-7,8-dihydro-17-

methylmorphinan:

To a solution containing 3.0g (5.14 mmol) of 4,5«-Epoxy-6-«-0-acetyl-3-O-(12-carbo-t-

butoxy- dodecanoic acid)-7,8-dihydro-17-methylmorphinan in 75 ml of methanol and 9 ml of

water was added 0.92 g (6.66 mmol) of potassium carbonate. After stirring overnight at room

temperature, the reaction was diluted with ethylacetate and washed with water. The organic phase was dried over sodium sulfate. Filtration, removal of solvent, and column chromatography

of the residue on silica gel with 30% methanol/methylene chloride afforded 2.46g (88.33%) of

product.

Η NMR (CDC1₃) δ 1.27 (bs 14H), 1.44 (s, 9H), 1.37-1.83 (m, 8H), 1.90 (dt, J 1=5.0 Hz,

J2= 12.4 Hz, IH), 2.20 (t, J=7.3 Hz, 2H), 2.24-2.31 (m, 3H), 2.36-2.45 (m, IH), 2.41 (s, 3H), 2.53-2.58 (m, 2H) 2.99 (d, J=18.5 Hz, IH), 3.11 (dd, Jl=2.8 Hz, J2=5.5 Hz, IH), 3.98-4.0 (m, 3H), 4.59 (d, J=5.4 Hz, IH) 6.61 (d, J=8.2 Hz, IH), 6.72 (d, J=8.2 Hz, IH)

¹³C NMR (CDCI₃) δ 19.01, 20.05, 25.05, 25.91, 27.16, 28.06, 29.02, 29.22, 29.35, 29.39,

29.46, 35.56, 37.07, 42.40, 41.91, 42.81, 46.83, 59.76, 67.04, 69.50, 79.83, 90.20, 114.81, 119.09, 126.52, 130.17, 140.92, 146.42, 173.33.

Example II Heterodimer of 4,5«-Epoxy-6-«-hydroxy-3-O-(12-carboxy dodecanoic acid)-

7,8-dihydro-17-methylmorphinan and CP-0597

To a solution containing HBT f (10.8 mg, 0.028 mmol) in 1.5 ml of DMF was added CP-

0597 (25mg, 0.014 mmol) in 0.5 ml of DMF. The mixture was stirred at room temperature and

after 0.5 hours half of a solution containing 4,5«-Epoxy-6-«-hydroxy-3-O-(12- carboxydodecanoic acid)-7,8-dihydro-17-methylmoφhinan (13.9 rag, 0.029 mmol), 20 μl DEEA in 0.5 ml DMF was added. After 2.0 hours the remainder of the caiboxylic acid mixture was

added and the mixture allowed to stir for an additional 3.0 hours. The resulting mixture was

diluted with 50 ml of Et₂O and placed at 0°C overnight. The ether was decanted and washed

again with Et₂O. The resulting isolated material was dissolved into CH₃CN/H₂O 7:3 containing

10% AcOH and purified using RP-HPLC (9:1 to 2:3 H ₂O:CH ₃CN + 0.1% TFA over 60 minutes). The five fractions were combined, evaporated and lyophilized to give 12.3 mg of 3-O-

alkylated dihydromorphine and CP-0597 heterodimer as a white powder.

Analysis: The mass spectra was run on a Finnigan Lasermat Mass Analyzer: calculated

(M+H) 1761, found (M+H) 1761.

Amino Acid Analysis: Arg 3.08 (3), Pro 1.44 (1), Hyp 0.88 (1); Gly 0.92 (1), Ser 0.90

(1).

Amino Acid Sequencing: Gave no residues.

Example DI 4,5«-Epoxy-3-hydroxy-6-«-O-(benzyl-3-carboxylic acid) -7,8-didehydro-17- methylmorphinan:

To a solution containing 0.08g (0.18 mmol) of 4,5-«-Epoxy-3-hydroxy-6-«-0-(benzyl-3-

carboxymethyl ester) -7,8-didehydro-17-memylmoφhinan in 5.5 ml of methanol and 2 ml of

water was added 0.03g (0.71 mmol) of lithium hydroxide monohydrate. After stirring at room

temperature overnight, the solvent was removed under reduced pressure. The residue was

dissolved in water and filtered. Purification via RP-HPLC afforded 81.6 mg (84.97%) of product

as a white solid after lyophilization. 'H NMR (CDCI₃) δ 2.05-2.14 (m, IH), 2.43-2.62 (m, 2H), 2.83-2.93 (m, IH), 2.93 (s, 3H), 3.11 (d, J=22 Hz, IH), 3.23 (s, IH), 3.40-3.48 (m, 2H), 4.08 (bs, 2H), 4.73 (d, J=l 1.8 Hz, IH), 4.88 (d, J=l 1.9 Hz, IH), 5.12 (d, J=6.1 Hz, IH), 5.32 (d, J=10.2 Hz, IH), 5.91 (d, J=10.1

Hz, IH), 6.54 (d, J=8.5 Hz, IH), 6.73 (d, J=8.2 Hz, IH), 7.46 (t, J=7.5 Hz, IH), 7.64 (d, J=7.6

Hz, IH), 8.02 (d, J=7.6 Hz, IH), 8.19 (bs, IH).

LRMS calculated for C₂₅H₂₅ N,O₅: 419.17. Found 420 (M+l)

The intermediate 4,5«-Epoxy-3-hydroxy 6-«-O-(benzyl-3-carboxymethyl ester) -7,8-

didehydro-17-methylmorphinan was prepared as follows: a) 4,5-«-Epoxy-3-triphenylmethoxy-6-«-hydroxy-7,8-didehydro-17-methylmoφhinan:

To a mixture containing 24.0g (31.64 mmol) moφhine sulfate pentahydrate, 15.90g

(57.03 mmol) of triphenylmethyl chloride, and 5.50g (16.20 mmol) of tetrabutylammonium hydrogen sulfate in 400 ml of methylene chloride was added 400 ml (136.00 mmol) of 0.34 M

potassium hydroxide. The reaction was allowed to stir vigorously at room temperature

overnight.

The reaction mixture was diluted with methylene chloride and the organic phase separated. The aqueous phase was further extracted with methylene chloride. The combined organic layers were dried over magnesium sulfate. Filtration, removal of solvent, and column chromatography

of the residue on silica gel with 5% methanol/methylene chloride, then 20% methanol/methylene

chloride afforded 14.20g (42.53%) of product as white solid.

Η NMR (CDCI₃) δ 1.57-1.66V. IH), 1.92 (dt, Jl=4.8 Hz, J2=12.4 Hz, IH), 2.10-2.32 (m, 3H), 2.39 (s, 3H), 2.43-2.60 (m, 2H), 2.89 (d, J=18.7 Hz, IH), 3.24 (dd, Jl=3.9 Hz, J2=6.1 Hz, IH), 3.98 (bs, IH), 4.60 (d, J=6.6 Hz, IH), 5.16 (dt, Jl=3.0 Hz, J2=9.9 Hz, IH), 5.45-5.53 (m, IH), 6.17 (d, J=8.3 Hz, IH), 6.35 (d, J=8.2 Hz, IH), 7.20-7.45 (m, 15H).

¹³C NMR (CDC1₃) δ 20.57, 35.51, 40.45, 42.54, 42.99, 46.32, 58.82, 66.18, 90.54,

118.60, 123.61, 127.25, 127.43, 127.79, 129.36, 133.36, 137.76, 144.21, 150.65.

LRMS calculated for C^HαN^: 527.25; found: 528 (M+l) b) 4,5-«-Epoxy-3-triphenylmethoxy-6-«-O-(benzyl-3-carboxymethyl ester)-7,8-

didehydro- 17-methylmoφhinan:

To a solution containing 2.50g (4.74 mmol) of 4,5-«-Epoxy-3-triphenylmethoxy-6-«-

hydroxy-7,8-didehydro-17-methylmoφhinan in 30 ml of dimethylformamide under a nitrogen atmosphere was added 0.13g (5.21 mmol) of sodium hydride and 1.19g (5.21 mmol) of methyl-3-

bromomethylbenzoate. The reaction mixture was heated to 50°C and maintained for 24 hours.

The reaction mixture was diluted with ethylacetate and washed with brine, then water. The

organic phase was dried over magnesium sulfate. Filtration, removal of solvent, and column

chromatography of the residue on silcia gel with a 5%-10% methanol/methylene chloride gradient

afforded 0.19g (6.00%) of product.

Η NMR (CDC1₃) δ 1.50-2.60 (m, 6H), 2.30 (s, 3H), 2.87 (d, J=19.1 Hz, IH), 3.26 (bs, IH), 3.91 (s, 3H), 3.93 (bs, IH), 4.54 (d, J=12.0 Hz, IH), 4.78 (d, J=6.4 Hz, IH), 4.83 (d,

J=l 1.6 Hz, IH), 5.21 (d, J=9.6 Hz, IH), 5.69 (bd, J=9.7 Hz, IH), 6.11 (d, J=8.5 Hz, IH), 6.34

(d, J=8.0 Hz, IH), 7.00-7.47 (m, 18H), 7.55 (d, J=7.6 Hz, IH) 7.95 (d, J=7.6 Hz, IH), 8.03 (bs, IH).

c) 4,5-«-Epoxy-3-hydroxy-6-«-O-(benzyl-3-carboxymethylester)-7,8-didehydro- 17-

methylmoφhinan:

To a solution containing 0.19g (0.28 mmol) of 4,5-«-Epoxy-3-triphenylmethoxy-6-«-O- (benzyl-3-carboxymethyl ester)-7,8-didehydro-17-methylmθφhinan in 8 ml of methanol and 2 ml of methylene chloride was added 0.057g (0.30 mmol) of p-toluenesulfonic acid monohydrate.

After stirring at room temperature for 0.5 hours, the solution was diluted with methylene chloride

and washed with a saturated sodium bicarbonate solution. The organic phase was dried over

magnesium sulfate. Filtration and removal of solvent afforded the desired product which was

utilized in the subsequent step.

Example IV Heterodimer of 4.5-«-Epoxy-3-hydroxy-6-«-O-(benzyI-3-carboxyI acid)-7,8-

didehydro-17-morphinan and CP-0597 (CP-0903)

To a solution containing HBTU (6. lmg, 0.016 mmol) in DMF (0.5 ml) and 20μL of

DIEA was added 8.54g (0.010 mmol) of 4,5«-Epoxy-3-hydroxy-6-«-O-(benzyl)-3-carboxylic

acid-7,8-didehydro-17-methylmoφhinan from Example 3. After 0.5 hours, this mixture is added to a solution of CP-597 (20 mg, 0.011 mmol) in 1.5 ml DMF and this resulting mixture stirred for

4 hours. This mixture was diluted with cold Et₂O, centrifuged and decanted. The resulting material was dissolved into 10% AcOH in H₂O and purified by RP-HPLC (9: 1 to 2:3

H₂O:CH₃CN containing 0.1% TFA over 50 minutes). The desired fractions were combined,

evaporated and lyophilized to give 12.1 mg of 6-O-alkylated moφhine and CP-0597 heterodimer as a white powder.

Mass Spectral Analysis: calculated (M+2) 1695; found (M+2) 1695.

Example V N-phenyI-N-[l-(2-phenethyl)-4-piperidinyl]-9-carboxyl nonamide

To a solution containing 1.50g (3.23 mmol) of N-phenyl-N-[l-(2-phenethyl)-4- piperidinyl]-9-carbomethoxy nonamide in 30 ml of methanol and 10 ml of water was added 0.20g (4.77 mmol) of lithium hydroxide monohydrate under a nitrogen atmosphere. After stirring at

room temperature for 24 hours, the reaction mixture was diluted with methylene chloride and

acidified with IN aqueous hydrochloric acid. The organic phase was separated and dried over

magnesium sulfate. Filtration, removal of solvent, and column chromatography of the residue on

silica gel with 10% methanol methylene chloride afforded 0.85g (58.4%) of product as a white solid.

Η NMR (CDC1₃) δ 1.17-1.30 (m, 6H), 1.42-1.54 (m, 4H), 1.63-1.76 (m, 2H), 1.77-1.95

(m, 4H), 2.13 (t, J=7.4 Hz, 2H), 2.49 (t, J=l 1.7 Hz, 2H), 2.82-2.92 (m, 4H), 3.35 (d, J=10.8 Hz,

2H), 4.65-4.85 (M, IH), 7.05-7.08 (m, 2H), 7.15-7.29 (m, 5H), 7.34-7.41 (m, 3H), 12.16 (bs, IH).

¹³C NMR (CDC1₃) δ 25.06, 25.30, 28.59, 28.88, 28.92, 28.96, 31.60, 34.85, 50.90, 52.11,

58.75, 126.52, 128.55, 128.59, 129.45, 129.99, 138.10, 138.25, 173.17, 177.81.

%C %H %N

Theory 71.76 8.60 5.98

Found 72.05 8.61 5.89

The intermediate N-phenyl-N-[ 1 -(2-phenethyl)-4-piperidinyl]-9-carbomethoxynon__σ_ide

was prepared as follows:

a) N-(phenylamine)- 1 -(2-pheήethyl)piperidine:

A solution containing 5.0g (24.60 mmol) of 1-phenethylpiperidine, 13.60 ml (149.24

mmol) of aniline and 9.80 ml (49.20 mmol) of 5N hydrochloric acid in methanol was stirred at room temperature while 0.92g (14.64 mmol) of sodium cyanoborohydride was added followed by 30g of 3A° molecular sieves. The reaction was allowed to stir at room temperature for 3 days.

The reaction mixture was filtered and the solvent removed under reduced pressure. The residue

was disolved in ether and washed with water. The organic phase was dried over magnesium

sulfate. Filtration, removal of solvent, and column chromatography of the residue on silica gel

with 10% methanol/methylene chloride afforded 4.5 lg (65.38%) of product as pale yellow solid.

'H NMR (CDC1₃) δ 1.42-1.56 (m, 2H), 2.08 (d, J=12.4 Hz, 2H), 2.19 t, J=l 1.2 Hz, 2H),

2.57-2.63 (m, 2H), 2.78-2.84 (m, 2H), 2.93-2.97 (m, 2H), 3.31 (bs, IH), 3.51 (bs, IH), 6.59 (d,

J=7.6 Hz, 2H), 6.67 (t, J=7.3 Hz, IH), 7.13-7.31 (m, 7H).

¹³C NMR (CDCI₃) 6 32.51, 33.84, 49.84, 52.38, 60.55, 113.17, 117.13, 125.97, 128.32,

128.61, 129.24, 140.32, 147.02.

b) N-phenyl-N-[l-(2-phenethyl)-4-piperidinyl]-9-carbomethoxynonamide:

To a solution containing l.Og (3.57 mmol) of 4-(phenylamine)-l-(2-phenethyl)piperidine

in 20 ml of methylene chloride was added 1.2g (5.44 mmol) of the acid chloride of azelaic acid

monomethylester under a nitrogen atmosphere at 0°C. The reaction was allowed to warm to

room temperature overnight. The reaction mixture was diluted with methylene chloride and

washed with a saturated sodium bicarbonate solution. The organic phase was dried over magnesium sulfate. Filtration, removal of solvent, and column chromatography of the residue on

silica gel with 10% methanol/methylene chloride afforded 1.60g (97.06%) of product.

Η NMR (CDCI₃) 6 1.12-1.62\m, 12H), 1.78-1.82 (m, 2H), 1.90 (t, J=7.1 Hz, 2H), 2.16

(t, J=l 1.7 Hz, 2H), 2.18-2.31 (m, 2H), 2.50-2.56 (m, 2H), 2.70-2.76 (M, 2H), 3.00 (bd, J=11.6

Hz, 2H), 3.65 (s, 3H), 4.68 (tt, Jl=4.0 Hz, J2=12.1 Hz, IH), 7.05-7.42 (m, 10H). ¹³C NMR (CDCI₃) δ 24.78, 25.29, 28.83, 28.86, 28.96, 30.53, 33.77, 33.96, 34.84, 51.33, 52.08, 53.05, 60.40, 125.94, 128.18, 128.29, 128.55, 129.19, 130.38, 138.84, 140.18, 172.67.

Example VI Heterodimer of N-phenyl-N-[l-(2-phenethyl)-4-piperidinyl-9-carboxyl

nonamide and CP-0597 (i.e. CP -0719)

This heterodimer of the fentanyl analogue N-phenyl-N-[l-(2-phenethyl)-4-piperidinyl]-9-

carboxyl nomamide and CP-0597 was prepared by a similar coupling procedure as described in

Example 4. The crude material was dissolved up into H₂O/CH₃CN/AcOH (8:2: 1) and purified by

RP-HPLC (9: 1 to 2:3 H ₂O:CH ₃CN containing 0.1% TFA over 60 minutes). The pure fractions

were combined, evaporated and lyophilized to give 14.0 mg of the heterodimer.

Mass Spectral Analysis: calculated (M+l) 1726; found (M+l) 1726. Amino Acid Analysis: Arg

3.1 (3), Pro 0.91 (1), Hyp 1.12 (1), Gly 1.0 (1), Ser 0.98 (1), Thi 0.93 (1).

Example VII N-(4-phenylacetic acid)-N-[l-(2-phenethyl)-4-piperidinyI]propanamide

To a solution containing 1.2 lg (2.96 mmol) of N-(4-phenylacetic acid methyl ester)-N-[-

l-(2-phenethyl)-4-piperidinyl]propanamide in 40 ml of methanol and 10 ml of water was added

0.25g (5.96 mmol) of lithium hydroxide monohydrate under a nitrogen atmosphere. The mixture was heated to 50°C. After 2 hours, the methanol was removed under reduced pressure. The

aqueous residue was purified via RP-HPLC to afford 1.39g (92.34%) of product as a white solid

and TFA salt after lyophilization.

Η NMR (DMSOd₆) δ 0.99 (t, J=7.4 Hz, 3H), 1.75-1.85 (m, 2H), 1.92-2.01 (m, 4H),

2.90-3.04 (m, 4H), 3.15-3.21 (m, 2H), 3.62 (bs, 4H), 4.70-4.88 (m, IH), 7.02 (d, J=8.3 Hz, 2H), 7.16-7.32 (m, 5H), 7.38 (d, J=8.2 Hz, 2H), 12.30 (bs, IH).

¹³C NMR (DMSOd₆) δ 8.72, 26.92. 27.58, 29.60, 40.01, 48.63, 51.16, 57.02, 126.40,

127.89, 128.09, 128.96, 129.96, 134.96, 135.46, 171.06, 172.95.

LRMS calculated for C₂₄H₃₀ N₂O₃ 394.22. Found 395 (M+l).

The intermediate N-(4-phenylaceticacidmethylester)-N-[ 1 -(2-phenethyl)-4-

piperidinyl]propanamide was prepared as follows: a) 4-(4-carbomethoxymethylphenyl amine)- 1 -(2-phenethyl)piperidine: ^'

To a solution containing 5.0g (24.60 mmol) of 1-phenethylpiperidine, 9.92g (49.19 mmol)

of 4-amino-phenylacetic acid methyl ester and 9.8 ml (49.00 mmol) of 5N hydrochloric acid in

methanol in 50 ml of methanol under a nitrogen atmosphere was added 0.92 g (14.64 mmol) of

sodium cyanoborohydride followed by the addition of 30g of 3A° molecular sieves. After stirring

at room temperature for 72 hours, the reaction mixture was filtered through a plug of celite and

the solvent removed under reduced pressure. The residue was dissolved in ether and washed with

water. The organic phase was dried over magnesium sulfate. Filtration, removal of solvent, and column chromatography of the residue on silica gel with 10% methanol/methylene chloride

afforded 1.49g (17.14%) of product.

Η NMR (CDC1₃) δ 1.44-1.58 (m, 2H), 2.05-2.11 (m, 2H), 2.22 (dt, Jl=2.0 Hz, J2=l 1.5

Hz, 2H), 2.59-2.65 (m, 2H), 2.80-2.85 (m, 2H), 2.94-3.00 (m, 2H), 3.22-3.36 (m, IH), 3.50 (s,

2H), 3.67 (s, 3H), 6.55 (d, J=8.6 Hz, 2H), 7.07 (d, J=8.6 Hz, 2H), 7.18-7.35 (m, 6H). b) N-(4-phenylacetic acid metnylester)-N-[l-(2-phenethyl)^4-piperidinyl]propanamide:

To a solution containing 1.45g (4.10 mmol) of 4-(4-carbomethoxymethyl phenylamino)-l-

(2-phenethyl)piperidine in 40 ml of methylene chloride under a nitrogen atmosphere at 0°C, was added 0.55 ml (6.33 mmol) of propionylchloride. The reaction was allowed to warm to room temperature overnight. The mixture was diluted with methylene chloride and washed with water.

The organic phase was dried over magnesium sulfate. Filtration, removal of solvent, and column

chromatography of the residue on silica gel with 10% methanol/methylene chloride afforded 1.28g

(76.23%) of product.

Η NMR (CDCl_j) δ 1.01 (t, J=7.4 Hz, 3H), 1.42 (dq, Jl=3.3 Hz, J2=1.8 Hz, 2H), 1.72- 1.86 (m, 2H), 1.93 (q, J=7.5 Hz, 2H), 2.15 (t, J=10.4 Hz, 2H), 2.50-2.56 (m,2H), 2.70-2.76 (m,

2H), 3.00 (bd, J=11.6 Hz, 2H), 3.65 (s, 2H), 3.74 (s, 3H), 4.69 (tt, Jl=4.1 Hz, J2=12.1 Hz, IH),

7.03 (d, J=8.3 Hz, 2H), 7.13-7.29 (m, 5H), 7.31 (d, J=8.3 Hz, 2H).

¹³C NMR (CDCI₃) δ 9.58, 28.52, 30.56, 33.85, 40.65, 52.09, 52.16, 53.08, 60.48, 125.99,

128.35, 128.60, 130.17, 130.52, 134.23, 137.78, 140.24, 171.45, 173.48. C^NA

%C %H %N

Theory . 73.50 7.89 6.86

Found 73.32 7.81 6.77

Example VIII Heterodimer of N-(4-phenylacetic acid)-N-[l-(2-phenethyI)-4-

piperidinyl]propanamide and CP-0597 (i.e. CP-0872)

This heterodimer of the fentanyl analogue N-(4-phenylacetic acid)-N-[l-(2-phenethyl-4-

piperidinyljpropanamide and CP-0597 was prepared by a similar coupling method as described in

Example IV. The crude heterodimer was dissolved into 10% AcOH/H₂O and purified on RP-

HPLC (9: 1 to 35:65 H ₂O:CH ₃CN containing 0.1% TFA over 30 minutes). Pure fractions were combined, evaporated and lyophilized to give 15.4 mg of the heterodimer, CP-0872, as a white powder.

Mass Spectral Analysis: found 1672

Example IX N-phenyI-N-[l-(2-phenethyl)-4-carboxy-4-piperidinyl]propanamide

To a solution containing 0.50g (1.14 mmol) of 4-phenylamine-l-[2-phenethyl-4-

carboxy]piperidine in 10 ml of methylene chloride and 0.23 ml (1.65 mmol) of triethylamine under a nitrogen atmosphere at 0°C was added 0.16 ml (1.84 mmol) of propionyl chloride. The reaction

was allowed to warm to room termperature overnight. The solvent was removed under reduced

pressure. Column chromatography of the residue on silica gel with 20% methanol/methylene

chloride afforded 0.40 (92.2%) of product.

'H (DMSO d₆) δ 0.92 (t, J=7.50 Hz, 3H), 1.87 (q, J=7.4 Hz, 2H), 1.90-2.10 (m, 2Hj

2.35-2.50 (m, 2H), 2.97-3.04 (m, 2H), 3.19-3.78 (m, 6H), 7.20-7.46 (m, 10H).

¹³C NMR (DMSO d₆) δ 7.63, 27.17, 28.57, 28.85, 47.84, 55.69, 58.38, 125.45, 127.18,

127.49, 128.03, 128.83, 135.03, 137.20, 172.27. LRMS calculated for C^H^N^: 380.21. Found: 381 (M+l).

The intermediate 4-phenyl- c_ino-l-[2-phenethyl-4-carboxy]piperidine was prepared as

follows:

a) 4-phenylamine-4-cyano-l-(2-phenethyl)piperidine:

To a solution containing 14.6g^*(71.82 mmol) of l-(2-phenethyl)-4-piperidine and 6.6 ml

(72.43 mmol) of aniline in 50 ml of glacial acetic acid was added a solution of 5.14g (78.93

mmol) of potassium cyanide in 15 ml of water dropwise while maintaining the reaction temperature below 20°C with an ice bath. After stirring at room temperature for 48 hours, the

reaction mixture was poured into 80g of ice containing 93 ml of concentrated ammonium

hydroxide. The aqueous phase was decanted and the brown oil dissolved in chloroform and

washed with water. The organic phase was dried over potassium carbonate. Filtration and

removal of solvent afforded a brown solid. Recrystallization from isopropanol afforded 7.77g

(35.42%) of product.

Η (CDC1₃) δ 1.94 (dt, Jl=3.7, J2=13.7 Hz, 2H), 2.36 (dt, Jl=2.5 Hz, Ϊ2=13.2 Hz, 2H),

2.48-2.56 (m, 2H), 2.63-2.69 (m, 2H), 2.75-2.82 (m, 2H), 2.87-2.95 (m, 2H), 3.65 (s, IH), 6.90- 6.95 (m, 3H), 7.18-7.35 (m, 2H).

¹³C NMR (CDCI₃) δ 33.75, 36.18, 49.34, 59.87, 117.90, 120.61, 121.02, 126.13, 128.42,

128.64, 129.30, 140.06, 143.28. C₂oH₂₃N₃

%C %H %N

Theory 78.65 7.59 13.76

Found 78.39 7.69 13.74

b) 4-phenylamine- 1 -[2-phenethyl-4-carboxamide]piperidine:

To a mixture containing 5.42g (17.75 mmol) of 4-phenylamine-4-cyano-l-(2-

phenethyl)piperidine in 100 ml of ethanol was added 2.82g (70.50 mmol) of sodium hydroxide

followed by 7.6 ml (74.39 mmol) of 30% aqueous hydrogen peroxide. The reaction mixture was

heated to reflux under a nitrogen atmosphere overnight. The reaction mixture was diluted with

water and extracted with methylene chloride. The organic phase was dried over magnesium

sulfate. Filtration, removal of solvent, and column chromatography of the residue on silica gel with 15% methanol/methylene chloride afforded 2.56 (44.59%) of product.

Η NMR (CDCl_j) δ 1.96 (d, J=13.2 Hz, 2H), 2.12-2.21 (m, 2H), 2.35 (dt, Jl=3.9 Hz,

J2=13.4 Hz, 2H), 2.55-2.61 (m, 2H), 2.75-2.87 (m, 9H), 4.02 (s, IH), 5.42 (d, J=2.3 Hz, IH),

6.64 (d, J=7.6 Hz, 2H), 6.81 (t, J=7.3 Hz, IH), 6.87 (bs, IH), 7.16-7.30 (m, IH).

c) 4-phenylamine- 1 -[2-phenethyl-4-carboxy]piperidine:

A mixture containing 2.55g (7.88 mmol) of 4-phenylamine-l-[2-phenethyl-4-

carboxamide]piperidine and 1.33g (23.70 mmol) of potassium hydroxide in 20^' ml of ethylene

glycol was heated to reflux for 4 hours. The reaction mixture was cooled with an ice bath and 10

ml (40 mmol) of 4N hydrochloric acid in dioxane added, followed by 100 ml of ether. The solid

was filtered and further purified via RP-HPLC to afford 2.5g (72.64%) of product after

lypophilization.

LRMS calculated for 324.18. Found: 325 (M+l)

Example X Heterodimer of N-phenyl-N-[l-(2-phenethyI)-4-carboxy-4-

piperidinyl]propanamide and CP-0597 (i.e. CP-0823)

This heterodimer of the fentanyl derivative N-pheny_-N-[l-(2-phenethyl)-4-carboxy-4-

piperidinyl]propanamide and CP-0597 was prepared by a similar coupling method as described in

Example IV. The crude heterodimer was purifed on RP-HPLC. Pure fraction were combined,

evaporated and lyophilized to give 2.3 mg of heterodimer CP-0823 as a white powder.

Mass Spectral Data: Calculated (M+f) 1654. Found (M+l) 1654.

Example XI Extended 3-Substituted Fentanyl Analogue To a solution of N-phenyl-3-(2-carboxy-ethyl)-N-[l-(2-phenyethyl)-4-

piperidinyljpropanamide (1.25g, 3.00 mmol) and methyl 3-aminophenylacetate (0.74g, 3.67

mmol) in 6 ml of DMF at 0°C was added DIEA (2.13 ml; 12.24 mmol) and HBTU (1.62g, 4.28

mmol). The resulting mixture was allowed to stir overnight, warming to room temperature. The

mixture was diluted with EtOAc and washed with water (3x20 ml) and dried (MgSO₄). The

solution was evaporated and purified on silica gel (EtOAc to 5% MeOH/EtOAc) to give 1.42g

(81 %) of the coupled product as a mixture of cis/trans iomers.

To a solution at 0°C containing 1.40g (2.45 mmol) of the methyl ester in 12 ml of methanol was added a solution of 0.26g (6.1 mmol) of lithium hydroxide monohydrate in 3 ml of

water. The mixture was stirred, warming to room temperature overnight. This solution was

acidified with IN HCl and resulting solid filtered and washed with water. The solid was dried for

48 hours under vacuum to give 1.20g (90.4%) of the desired phenyl acetic acid derivative. This

material was used without further purification in the subsequent coupling step.

To a solution of the fentanyl phenyl acetic acid derivative (0.30g, 0.553 mmol) and ethyl 3-amino propionate -HCl (0.102g, 0.663 mmol) in 5 ml of DMF at 0°C was added DEEA. After

10 minutes, HBTU (0.294g, 0.775 mmol) was added over 5 minutes and the mixture allowed to

warm to room termperature overnight. The resulting mixture was diluted with EtOAc, washed with water (3x20 ml) and dried (MgSO₄). The MgSO₄ was filtered and the solution evaporated to

give the crude product that was purified on silica gel (9:1 EtOAc/MeOH), 0.300g (83%). This

ester was used in the subsequent hydrolysis step.

To a solution containing 290 mg (453 mmol) of previously prepared ester in MeOH ( 8

ml) at 0°C was added a solution of lithium hydroxide monohydrate (46 mg, 1.10 mmol) in 2.0 ml of water. The mixture was allowed to warm to room temperature overnight. The methanol was

evaporated and the resulting residue purified on RP-HPLC to give isomer A and a mixture of A and B. Analytical RP-HPLC Data (90: 10 to 0: 100) H₂O:CH₃CN + 0.1% TFA linear gradient 25

minutes), YMC-AQ-302-5, 150 x 4.6 mm; Isomer A: 11.90 minutes, Isomer B: 12.70 minutes.

Isomer A:

'H NMR (CDCl_j) δ 1.01 (t, J=7.1 Hz, 3H), 1.40-5.65 (m, IH), 1.77-2.20 (m, 3H), 1.93 (q, J=7.4 Hz, 2H), 2.20-2.35 (m, IH), 2.35-2.55 (m, 3H), 2.55-2.70 (m, IH), 2.75-3.10 (m, 4H),

3.10-3.30 (m, IH), 3.30-3.50 (m, 3H), 3.48-3.64 (m, 3H), 4.10 (d, J=10.8 Hz, IH), 4.92 (brs, IH), 6.14 (brs, IH), 6.97 (d, J=7.6 Hz, 2H), 7.11 (d, J=7.2 Hz, 2H), 7.23-7.30 (m, 5H), 7.35-

7.48 (m, 6H), 9.15 (brs, IH), 10.10 (brs, IH).

¹³C NMR (CDCI₃) δ 9.60, 25.72, 27.50, 28.51, 30.51, 33.17, 34.07, 34.77, 36.56, 43.59,

51.92, 57.26, 58.72, 119.63, 121.22, 125.68, 127.47, 128.56, 129.03, 129.35, 129.64, 129.96,

130.20, 135.18, 135.35, 138.53, 171.16, 171.41, 175.35.

Mass Spectral Analysis: Calculated (M+l) 613. Found (M+l) 614.

The intermediate N-phenyl-3-(2-carboxyethyl)-N-[l-(2-phenethyl)-4-

piperidinyljpropanamide was prepared as follows: a) N-phenyl-3-(2-carbomethoxyethyl)-N-[ 1 -(2-phenethyl)-4-piperdinyl]propanamide

To a solution containing 1.50g (4.09 mmol) of 4-(phenylamino)-3-(2-carbomethoxy)-l-(2-

phenethyl)piperidine (prepared according to: Borne, et al. J. Med. Chem. 27:1271 (1984)) in 30

ml of methylene chloride under a nitrogen atmosphere at 0°C was added 0.43 ml (4.9 mmol) of

propionyl chloride. The reaction mixture was allowed to warm to room temperature overnight. The reaction was diluted with methylene chloride and washed with a saturated aqueous sodium bicarbonate solution. The organic layer was dried over magnesium sulfate. Filtration, removal of solvent, and column chromatography of the residue on silica gel with 5% methanol/methylene

chloride afforded 1.64g (94.96%) of product as a mixture of cis/trans isomers.

Η (CDCI₃) δ [1.00 (t, J=7.5 Hz), 1.03 (t, J=7.4 Hz), 3H], 1.40-1.60 (m,2H), 1.71-2.00

(m, 3H), 2.09-2.60 (m, 8H), 2.67-2.76 (m, 2H), 2.98-3.10 (m, 2H), 3.69 (s, 3H), [4.32-4.42 (m), 4.56-4.70 (m), IH], 7.13-7.50 (m, 10H). b) N-phenyl-3-(2-carboxyethyl)-N-[ l-(2-phenethyl)-4-piperidinyl]propanamide:

A solution containing 0.416g (0.99 mmol) of N-phenyl-3-(2-carbomethoxyethyl)-N-[-l-

(2-phenethyl)-4-piperidinyl]propanamide and 0.10g (2.38 mmol) of lithium hydroxide

monohydrate in 20 ml of methanol and 5 ml of water was allowed to stir at room temperature

overnight. The solvent was removed under reduced pressure and the residue purified via RP-

HPLC to afford 0.329g (84.66%) of product as a white solid after lyophilization.

Η NMR (CDCI₃) δ [0.98 (t, J=7.4), 1.00 (t, J=7.4), 3H], 1.49-1.52 (m, IH), 1.80-2.10

(m,3H), 1.98 (q, J=7.4, 2H), 2.10-2.70 (m, 4H), 2.75-2.80 (m, IH), 2.90-3.40 (m, 4H), 3.59 (d, J=11.3, IH), 3.84 (d, J=12.1, IH), [4.5 (bs), 4.85 (bs), IH], 6.95-7.45 (m, 10H).

^I3C NMR (CDCI₃) δ 9.54, 9.60, 25.04, 25.17, 27.38, 28.46, 28.91, 30.11, 30.32, 30.91,

31.11, 35.95, 51.78, 52.80, 55.83, 57.97, 58.79, 127.23, 128.60, 128.65, 128.95, 129.04, 129.51,

130.10, 136.05, 175.22, 175.58, 176.34, 176.84.

LMRS calculated for C_2SH₃₂N₂O₃:408.24. Found 409 (M+l).

Example XII Heterodimer of Extended 3-substituted Fentanyl Analogue (Isomer A) and

CP-0597 (CP-0880) This heterodimer of Isomer A from Example XI and CP-0597 was prepared by a similar coupling procedure as described in Example IV. The crude material was dissolved into 10%

acetic acid/H₂O and purified on RP-HPLC (90:10 to 35:65, H2O:CH₃CN +0.1% TFA over 55

minutes) The desired fractions were combined, evaporated and lyophilized to give 18.4 mg of the

fentanyl-CP-0597 heterodimer CP-0880 as a white powder.

Mass Spectral Analysis: Calculated (M+2) 1889. Found (M+2) 1889.

Example XIII B2 Receptor Antagonist Activity

The compounds were assayed for B2 receptor antagonist activity on guinea pig ileum,

according to the commonly accepted assay methods for bradykinin as described by Trautschold

(Handbook of Experimental Pharmacology, Vol. 25, Springer-Veriag, pp 53-55 (1969)) for inhibition of the myotropic activity of bradykinin.

The inhibition potencies were determined according to the commonly accepted manner, as

described by Schild for antagonists of biologically active compounds (Brit. J. Pharmacol. 2:189

(1947)) and expressed as pA₂ values (Table I).

Example XIV Electrical Stimulation-GPI

The BKAn/mu-opioid receptor agonist heterodimers were evaluated for mu-opiate

receptor activity in vitro using the electrically stimulated guinea pig ileum assay. This assay is

well known in the art. The results are'described in Table I. All heterodimers described in Table I

comprise the BKAn peptide CP-0597 (unless otherwise indicated):

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg or a modified analog thereof, and is linked to the mu-opioid agonist via the linker moiety X

represented by the group Rl or R2.

Table I

3-O-Alkylated Dihydromoφhine Heterodimers:

(all compounds are linked at the N-terminus of CP-0597 (unless otherwise indicated))

3-O-Alkylated Moφhine Heterodimer:

(all compounds are linked at the N-terminus of CP-0597)

CP# Rl R2 mu -logIC₅₀ BK₂, pA₂ (GPI) (GPI)

731 0 H 5.6 7.8

(CH,) 6-O-Alkylated Dihydromoφhine Heterodimers:

(all compounds are linked at the N-terminus of CP-0597)

6-O-Alkylated Moφhine Heterodimers:

Anilino Substituted Fentanyl Heterodimers:

(all compounds are linked at the N-terminus of CP-0597)

CP# Rl R2 mu -loglC_jo BK₂, pA₂ (GPI) (GPA)

718 H <5 8.5

o

719 H 6.1 8.6 o o

847 CH₂OCH₃ 5.5 8.7

o CP# Rl R2 mu -loglCso BK₂, pA₂ (GPI) (GPA)

859 CH₂OCH₃ 5.2 8 o 0

C-3 Substituted Fentanyl Heterodimer:

(all compounds are linked at the N-terminus of CP-0597)

CP# Rl mu -logIC₅₀ BK₂, pA₂ (GPI) (GPI)

881 5.6 7.8

(Isomer B) NH-_\ O

C-4 Substituted Fentanyl Heterodimers:

Phenyl Substituted Fentanyl Heterodimers:

(all compounds are linked at the N-teπninus of CP-0597)

CP# Rl mu -logIC₅₀ BK₂, pA₂ (GPI) (GPI)

872 <5 7.9 o CP# Rl mu -logIC₅₀ BK₂, pA₂ (GPI) (GPI)

873 <5 8.8

O 0

Lysine Scan Series Heterodimers with Substituted Fentanyl Analogues:

(Lysine was introduced in positions 0-1 of CP-0597 and linked to substituted fentanyl analogues:

CP# Lysine Postion Rl R2 mu -logIC₅₀ BK₂, _PA₂ within CP-0597 (GPI) (GPI)

727 Lys(l) H 5.0 7.3

o o

744 Lys(l) o 0 5.2 7.5

/ (trans)k

Lysine Scan Series Heterodimers with 3-O-Alkylated Dihydromoφhine Analogues:

(Lysine was introduced in positions 0-6 of CP-0597 and linked to 3-0-Alkylated Dihydromoφhine Analogues:)

Example XV Isolation and Expression of the Human Mu Receptor Gene

A cDNA library from human brain (caudate /putamen) was obtained from Stratagene. The

mu receptor sequence was selectively amplified from the cDNA library using nested PCR. The first

round PCR used the two primers GTAAGAAACAGCAGGAGCTG and

CAACCTGCTTCCACATACATG and Vent DNA polymerase (New England Biolabs). Twenty-four

rounds of PCR were done using the following conditions: 94°C, 1 minute for denaturation, 60° C,

1 minute for annealing followed by 72 °C, 3 minutes for extension. Excess primers were removed

with a Centricon 30 miniconcentrator. A portion of this first round reaction was used as a template

in a second round of PCR using the following primers GCGAAGCTTCAGTACCATGGACAGCA

and CGCTCTAGAGGAATGGCATGAGACCC. The number of rounds of PCR and the conditions were the same as those used for the first round. The DNA obtained after this second round was

digested with the restriction enzymes Hind IE and Xba I using standard methodology. Cesium

chloride-purified pRc/CMV (Invitrogen) was also digested with Hind HI and Xba I using standard methodology. The products of the two digests were resolved on a 0.7% low melt agarose gel.

Sections of gel containing the human mu receptor DNA (approximately 1.2 kb) and the pRc/CMV DNA (approximately 5.5 kb) were excised from the gel. The gel slices containing these DNAs were heated at 65 °C and aliquots combined in a reaction containing T4 DNA ligase. The reaction was incubated overnight at 15°C. An aliquot of this reaction was used to transform frozen competent E.

coli DH5α cells (GibcoBRL). Transformants containing the human mu receptor DNA were selected

on LB + amp plates. One of the transformants was selected and the sequence of the human mu

receptor DNA insert determined using the Sequenase enzyme (United States Biochemical) according

to the manufacturer's instructions. This sequence was compared to the sequence of Wang et al. FEBS

Letters 338:217 (1994)) as found in the Genbank database (accession number L25119). Three

nucleotide missincoφorations were detected and those that altered the amino acid sequence of the

receptor were corrected using site-directed mutagenesis (Kunkel et al. Methods in Enzymology

154:367 (1987)). Cesium chloride-purified human mu receptor-pRc/CMV plasmid was transfected into CHO-K1 (ATCC) cells using the Lipofectamine reagent (GibcoBRL). Transfectants were

selected with the antibiotic G418 and screened for ³H-DAMGO (Dupont NΕN) binding. One clone,

hmu5, was chosen based upon binding levels, binding kinetics and inhibition patterns as the clone to

be used for all human mu receptor binding assays.

Example XVI Human Mu Receptor Binding

Preparation of human MU clone membrane for binding assay was carried out by scraping cells from plate in ice cold PBS and centrifuging at 500 x g, at 4°C for 10 minutes. The supernatant was

discarded and pellet resuspended in assay buffer consisting of lOmM Tris/HCl, pH 7.4 with 0.32 M

Sucrose and centrifuged for 30 minutes', at 4°C , at 27,000 x g. The supernatant was discarded and

pellet resuspended in fresh assay buffer, and in 1 ml aliquots, frozen at -70°C until needed.

Binding assays were performed by incubating human clone membrane solution (50ug/well in 125 ul final concentration) with ³H-DAMGO (final concentration 5nM) with or without test compounds in assay buffer , at room temperature, for 60 minutes, at a final volume of 315 ul. All test compound

dilutions were done in triplicate. Assays were harvested by quick filtration in a Tomtec Harvester 96,

with ice-cold wash buffer consisting of 50mM Tris/HCl, pH 7.4, onto Wallec printed glassfiber

Filtermat "B", which had been pre-soaked with 0.1% PEI and previously air-dried. Filtermats were

counted in 9.5 mis Wallec Beta-Plate Scint, in Wallec 1450 MicroBeta Counter. Data is shown in Table U.

Example XVII BK Human Receptor Cloning

RNA was isolated from human lung fibroblasts (CCD- 16 LU obtained from the ATCC) using

the method of Ghirgwin et al (Biochemistry 18:5294 (1979)). The RNA was transcribed into cDNA

u s i n g M M 1 V r e v e r s e t r a n s c r i p t a s e , t h e p r i me r

GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT and the procedure of Maniatis (Molecular Cloning Cold Spring Harbor Laboratory (1982)). The human BK2 receptor cDNA was selectively

amplified using nested PCR. The first round PCR used the two primers CTCCGAGGAGGGGTGGG

and CCTGAAAAGCAACTGTCCC and Taq DNA polymerase (Promega). Twenty-five rounds of

PCR were done using the following conditions: 94°C, 1 minute for denaturation, 50°C, 1 minute for annealing followed by 72°C, 3 minutes for extension. Excess primers were removed with a Centricon

30 miniconcentrator. A portion of this first round reaction was used as a template in a second round of PCR using the following primers GCGAAGCTTCGTGAGGACTCCGTGCCC and

CGCTCTAGACAAATTCACAGCCC. The number of rounds of PCR and the conditions were the

same as those used for the first round. The DNA obtained after this second round was digested with the restriction enzymes Hind IH and Xba I using standard methodology. Cesium chloride-purified

pRc CMV (Invitrogen) was also digested with Hind III and Xba I using standard methodology. The

products- of the two digests were resolved on a 1% low melt agarose gel. The human BK2 receptor

DNA (approximately 1.1 kb) and the pRc/CMV DNA (approximately 5.5 kb) were excised from the

gel. The gel slices containing these DNAs were heated at 65°C and aliquots combined in a reaction

containing T4 DNA ligase. The reaction was incubated overnight at 15°C. An aliquot of this reaction

was used to transform frozen competent E. coli DH5α cells (Gibco/BRL). Transformants containing the human BK2 receptor DNA were selected on LB + amp plates. One of the transformants was

selected and the sequence of the human BK2 receptor DNA insert determined using the Sequenase

enzyme (United States Biochemical) according to the manufacturer's instructions. This sequence was

compared to the sequence of Hess et al (Biochemical and Biophysical Research Communications

184:260 (1992)). Two nucleotide missincorporations were detected and those that altered the amino

acid sequence of the receptor were corrected using side-directed mutagenesis (Kunkel et al., Methods

in Enzymology 154:367 (1987)). The human BK2 receptor-pRc/CMV plasmid was transfected into

CHO-Kl (ATCQ cells using the Lipofectamine reagent (Gibco/BRL). Transfectants were selected

with antibiotic G418 and screened for ³H-bradykinin (Dupont NΕN) binding. One clone, S34f, was

chosen based upon binding levels, binding kinetics and inhibition patterns as the clone to be used for

all human BK2 receptor binding assays.

Example XVIII Human BK2 Receptor Binding

Preparation of human BK2 clone membrane for binding assay was carried out by scraping

cells from roller bottles in ice cold PBS and centrifuging at 1000 x g, at 4°C for 15 minutes. The supernatant was discarded and pellet resuspended in Buffer A consisting of 25mM TES(pH 6.8)with 2uM 1,10-Phenanthroline, and centrifuged at 27,000xg for 15 min. this was then repeated. The final pellet was resuspended in Buffer B (Buffer A with 2uM Captopril,140ug/Ml Bacitracin, 0.1%BSA),

and stored in 1 ml aliquots, frozen at -20°C until needed.

Binding assays were performed by incubating human clone membrane solution (Approx.

60ug/well in 125 ul) with ³H-Bradykinin (final concentration 0.3nM) with or without test compounds

in assay buffer (Buffer B with ImM Dithiotreitol), at room temperature, for 45 minutes, at a final

volume of 315 ul. All test compound dilutions were done in triplicate. Assays were harvested by

quick filtration in a Tomtec Harvester 96, with ice-cold wash buffer consisting of lOmM Tris/HCl,

pH 7.5, lOOmM NaCl,.02%BS A, onto Wallec printed glassfiber Filtermat "B", which had been pre- soaked with 0.1% PEI and previously air-dried. Hltermats were counted in 9.5 mis Wallec Beta-Plate

Scint, in Wallec 1450 MicroBeta Counter. Data is shown in Table EL

Table π

BK/Mu Mu Binding BK-2 Binding Heterodimer # Human Clone Human Clone

PIC₅₀

695 NT 8.9

719 6.4 8.9

723 7.6 9.4

725 6.1 NT

726 6.3 NT

744 6.4 NT

745 6.8 NT BK Mu Mu Binding BK-2 Binding Heterodimer # Human Clone Human Clone pic₅₀

754 <5 NT

755 7.8 NT

756 7.9 NT

815 7.5 NT

823 7 NT

831 NT 6.9

832 7.6 NT

836 6.1 8.9

840 7.95 8.9

841 7.9 7.9

844 NT 8.5

847 NT 9.6

849 NT 9.2

850 NT 9.2

851 8.1 7.4

852 7.4 9

853 7.8 7.2

.859 6.8 8.5

861 6.1 NT

862 6.3 9

865 7.2 6.3

872 5.8 ' NT

873 5.4 NT

874 NT 8.3 BK Mu Mu Binding BK-2 Binding Heterodimer # Human Clone Human Clone pIC₅o

875 7.6 8.7

877 7.2 7.9

880 8.1 8.8

881 7.4 8.7

884 7.3 8.7

889 7.1 7.8

890 7.2 6.9

896 8.3 8.7

900 8.6 8.8

902 8.4 9.4

903 8.8 9.3

905 8.3 9.3

906 8.3 9.3

907 8.2 9.0

910 8.6 NT

911 8.5 NT

912 5.2 NT

913 5.4 NT

NT=not tested

In Vivo Studies

The effect of dihydromorhine and the heterodimer CP-0840 are described below, but essentially similar results were observed with fentanyl and its heterodimer, CP-0719.

Example XIX Mouse Formalin Test This test is a classical test for opiate and non-steroidal analgesic compounds. Mice are pretreated s.c. with vehicle or compound 30 minutes before injecting the formalin. lOμl of 5%

formalin was injected into one paw of a mouse. This resulted in a characteristic behavioral response

reflective of pain, characterized by licking the paw. The time spent licking the paw from 0-5min

(early phase response) and 15-30min (late phase response) was measured.

Figures 1 and 2 show the effect of dihydromoφhine and the heterodimer, CP-0840, both of

which produced a dose-dependent inhibition of the first and second phase responses compared to

vehicle control animals. The mean ED_S0's (dose in μmole/kg producing a 50% reduction of the first

and second phase response) for dihydromorhine in the first and second phase were 6.7 and 4.3,

whereas those for CP-0840 were 3.2 and 1.0, respectively. This reflects an increase in potency for CP-0840 compared to dihyromoφhine. It is to be noted in this test that CP-0597 (the BK antagonist) had no significant effect on either phase at doses ranging from 0.3-10 mg/kg s.c.

It was noticed that in all mice given dihydromorhine a typical Straub tail effect (erection and bending of the tail over the back of the animal) was observed, an effect not seen with any of the doses

of CP-0840. This suggests that CP-0840 does not get into the CNS since it is known that the Straub

tail phenomenon is centrally mediated.

Example XX Mouse Hot Plate

This is another classic test for analgesics whose mechanism of action involves spinal (central

nervous system) pathways. Essentially^*, mice were placed on a surface maintained at 55°C and the

time taken for the animal to respond by raising one of the hind paws was recorded. Vehicle or test

compound were given and the mouse placed on the hot plate. Reaction time was recorded at time intervals up to 240 minutes.

Dihydromorhine produced a dose dependent increase in the time spent on the hot plate (Figure 3), whereas CP-0840 had no effect compared to vehicle controls at all doses studied (Figure

4) .

Example XXI Rat Carrageenan Paw Edema

This test is designed to assess the anti-inflammatory effects of compounds as reflected by the

edema component of the response. The volume of the paw was measured before and after injection

of carragenan at lh intervals over a 6h time period using a Ugo Basile Plesthysmometer. Vehicle or

test compounds were injected s.c. 30 min before injecting the carrageenan. Carrageenan (1%) was

injected subplantar into one paw of a rat.

Figure 5 compares the effect of pretreatment of the rats with saline, dihydromorhine, CP-0597

(BK antagonist) and the heterodimer, CP-0840. It can be seen that dihydromorhine had little to no

effect on the edema response. CP-0597, the BK antagonist, produced significant inhibition from 0- 3h, however, the edema respnose recovered at time 5-6h. In contrast, the heterodimer, CP-0840

produced significant inhibition of the edema response at all time points. Careful analysis of the

responses revealed a 2 phase response to carrageenan; an early ,0-3h, and a late, 3-6h phase. The

percentage inhibition of the edema response at times 3 and 6 h for each compound are shown in Table 3. The heterodimer was clearly effective over the whole 6h in contrast to the individual components.

CP-0840 (as does CP-0597) at this dose had a duration of action of greater than 6h in the rat against

blood pressure responses to bradykinin (Figure 6). Therefore, the lack of effect of CP-0597 from

time 4-6 cannot be attributable to its disappearance from the receptors. CP-0840 is showing a clear co-operativity phenomenon possibly reflecting an opiate sensitive component during the second

phase.

Table 3. Percentage inhibition of the carrageenan paw edema produced by dihydromoφhine (DHM),

the BK antagonist CP-0597 and the heterodimer CP-0840 at time 3 and 6 h post carrageenan

compared to saline controls.

DHM CP-0597 CP-0840

3h 0 66.3 56.6

6h 0 0 45.9

Example XXII Mustard Oil-induced neurogenic inflammation in the Rat

Mustard oil was applied to the skin of the rat hind paw. This causes activation of nerve terminals in the skin which release neuropeptides which produce vasodilation and an increase in pernieability of the microvasculature resulting in an increase in paw edema. Evan's blue dye was

injected i.v. at a dose of 30 mg kg. The animal was sacrificed 15 minutes after applying the mustard

oil and the skin from the paw was removed and placed in formamide for 48h. The amount of Evan's

blue dye as ug/lOOmg tissue was calculated spectroflourometrically at 620nM from a standard curve.

Figure 7 compares the effect of dihydromoφhine, CP-0597 and CP-0840 in this model. At the doses used CP-0840 produced a significant inhibition of the edema response compared to saline controls.

Dihydromoφhine and CP-0597 at the doses used were without effect. Example XXIII Rat Blood Pressure

Male rats were anesthetised with urethane, 1.25g/kg, and cannulae were placed in the carotid

artery and femoral vein for the injection and infusion of compounds and in the femoral artery for the

recording of blood pressure. Standard hypotensive responses were obtained to repeated

administration of bradykinin, 80pM. These were repeated in the presence of increasing dose infusions

of CP-0840. The dose of CP-0840 reducing the hypotensive response to bradykinin by 50% (ED50)

was calculated and found to be 0.63 ug/kg/min (Figure 8). The selectivity of CP-0840 was assessed

at a dose of 3ug/kg/min. At this dose hypotensive responses to bradykinin (80pM) were completely

blocked but not those to acetylcholine (lOnM) or substance P (4pM), nor were the hypertensive

responses to norepinephrine (InM) or angiotensin (200pM). CP-0840 can be said to be a selective

antagonist of bradykinin in vivo in the rat blood pressure assay (Figure 9).

Claims

Claim 1. A heterodimer of the formula:

(BKAn)(X)(Y)

where BKAn is a bradykinin antagonist peptide;

Y is a mu-opioid receptor agonist selected from fentanyl, dihydromoφhine and moφhine or analogs thereof; and

X is a linking moiety chemically joining the BKAn and Y components.

Claim 2. The heterodimer of claim 1 wherein Y is

and Rj and R₂ are independently selected from

where n = 1 to 20 where n = 1 to 15

or

where R₃ is (CH₂)_n and R, is C(O); (CH₂)_nC(O); CONH(CH₂)-C(O) or CONH(CH₂)_nCONH(Phe)CH₂C(O) where n = 1 to 4; or H; wherein Ri or R₂ is the linker group X.

Claim 3. The heterodimer of claim 2 wherein Y is

R -i1 i iss aa annndda is H

Claim 4. The heterodimer of claim 3 wherein BKAn is

D-Lys-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg.

Claim 5. The heterodimer of claim 2 wherein Y is

^~b-<

Claim 6. The heterodimer of claim 5 wherein BKAn is

DArg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg.

Claim 7. The heterodimer of claim 1 wherein Y is

and Rj and R₂ are independently selected from n = 1 to 4

where n = 1 to 4 where n = 1 to 8

where Ra is -NHCO(CH₂)„ where n = 1 to 4 where n = 1 to 4 and R₄ is (CH₂)_nC(O) where n = 0 to 4; or CH₂CONH(CH₂)_n C(O) where n = 1 to 4

where R₃ is CO(CH₂)_nNH- and where R₃ is (CH₂)_nNHCO- R₄ is -CONH(CH₂)_nCO where n = 1 to 8 and where n = 1 to 4 R₄ is -CONH(CH₂)_nCO where n = 1 to 4 or H; where R, or R₂ is the linker group X.

Claim 8. The heterodimer of claim 7 wherein Y is

and R, is the A isomer of

Claim 9. The heterodimer of claim 8 wherein BKAn is

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg.

Claim 10. The heterodimer of claim 8 wherein BKAn is

α-Lys-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Phe-Ser-D-Tic-NChg-Arg; α-Lys-Arg-Pro-Hyp-Gly-Phe-Ser-D-Tic-NChg-Arg; ε-Lys-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg; or ε-Lys-Arg-Pro-Hyp-Gly-Phe-Ser-D-Tic-NChg-Arg.

Claim 11. The heterodimer of claim 8 wherein BKAn is

L-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg; or L-Arg-Arg-Pro-Hyp-Gly-Phe-Ser-D-Tic-NChg-Arg.

Claim 12. The heterodimer of claim 7 wherein Y is

R, is H.

Claim 13. The heterodimer of claim 12 wherein BKAn is

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg.

Claim 14. The heterodimer of claim 1 wherein Y is

where

R, is the linking group X of the formula CH₂CH₂(Phe)CH₂C(O); R₂, R₃ and R₅ are H; and R₄ is COCH₂CH₃.

Claim 15. The heterodimer of claim 1 wherein BKAn is

D-Arg-Arg-Pro-Hyp-Gly-Iglb-Ser-D-Iglb-Iglb-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Iglb-Ser-D-Iglb-Oic-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Iglb-Oic-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-NChg-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Phe-Ser-D-Tic-NChg-Arg;

D-Arg-Arg-Pro-Hyp-Gly-Thi-Ser-D-Tic-Oic-Arg; or

D-Arg-Arg-Pro-Hyp-Gly-Phe-Ser-DHypTE-Oic-Arg.

Claim 16. The heterodimer of claim^* 15 wherein the amino residue in the 0 to 6 position of the BKAn is substituted with D- or L-Lys.

Claim 17. The heterodimer of claim 15 wherein D-Arg is substituted with L-Arg or L-Lys.

Claim 18. The heterodimer of claim 15 wherein Ser is substituted with Cys.

Claim 19. A pharmaceutical composition comprising a heterodimer of claim 1 and a pharmaceutically acceptable carrier.

Claim 20. A method of treating pain or inflammation comprising adminstering to a mammal in need of such treatment a heterodimer of claim 1.