EP0807169A2 - Kinase, welche mit der phosphatidylinisitolkinase des zellzykluskontrollpunktes verwandt ist und verfahren - Google Patents

Kinase, welche mit der phosphatidylinisitolkinase des zellzykluskontrollpunktes verwandt ist und verfahren

Info

Publication number
EP0807169A2
EP0807169A2 EP96945181A EP96945181A EP0807169A2 EP 0807169 A2 EP0807169 A2 EP 0807169A2 EP 96945181 A EP96945181 A EP 96945181A EP 96945181 A EP96945181 A EP 96945181A EP 0807169 A2 EP0807169 A2 EP 0807169A2
Authority
EP
European Patent Office
Prior art keywords
leu
ser
glu
lys
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96945181A
Other languages
English (en)
French (fr)
Other versions
EP0807169A3 (de
Inventor
Merl F. Hoekstra
Doug A. Holtzman
Kathleen S. Keegan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Icos Corp
Original Assignee
Icos Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Icos Corp filed Critical Icos Corp
Priority claimed from PCT/US1996/019337 external-priority patent/WO1997018323A2/en
Publication of EP0807169A2 publication Critical patent/EP0807169A2/de
Publication of EP0807169A3 publication Critical patent/EP0807169A3/de
Withdrawn legal-status Critical Current

Links

Definitions

  • the present invention generally relates to genes encoding cell-cycle checkpoint phosphatidylinositol kinase (P ⁇ K)-related genes and proteins essential to
  • the checkpoint kinases play a role in the surveillance of DNA damage that occurs as a result of replication errors, DNA mismatches, radiation treatment, or chemotherapeutic drugs. These kinases are required in regulatory pathways that lead to cell cycle arrest following DNA damage, giving the cell notice and time to correct lesions prior to the initiation of DNA replication. More particularly, the invention relates to a novel human PIK-related kinase, Mammalian Cell Cycle Surveillance 1 (MCCS1), polynucleotides encoding the PIK-related kinase, and methods for assaying and modulating the enzymatic activity of the kinase and related kinases.
  • MCCS1 Mammalian Cell Cycle Surveillance 1
  • the process of eukaryotic cell growth and division is the somatic or mitotic cell cycle which consists of four phases, the G, phase, the S phase, the G 2 phase, and the M phase.
  • the G,, S, and G 2 phases are collectively referred to as interphase of the cell cycle.
  • the cell cycle is structurally and functionally conserved in its basic process and mode of regulation across all eukaryotic species.
  • G (gap) phase, biosynthetic activities of the cell progress at a high rate.
  • the S (synthesis) phase begins when DNA synthesis starts and ends when the DNA content of the nucleus of the cell has been replicated and two identical sets of chromosomes are formed.
  • the cell then enters the G 2 (gap) phase which continues until mitosis starts.
  • mitosis the chromosomes pair and separate and two new nuclei fo ⁇ n, and in cytokinesis the cell itself splits into two daughter cells each receiving one nucleus containing one of the two sets of chromosomes. Mitosis and cytokinesis together form the M (mitosis) phase of the cell cycle.
  • Cytokines terminates the M phase and marks the beginning of interphase of the next cell cycle.
  • the sequence in which the events in the cell cycle proceed is tightly regulated such that the initiation of one cell cycle event is dependent on the completion of the prior cell cycle event. This allows fidelity in the duplication and segregation of genetic material from one generation of cells to the next.
  • cell cycle checkpoints refers to the proteins, signals, processes, and feedback controls that integrate discontinuous events during cellular replication, in order to maintain essential dependencies within the cell cycle.
  • the present invention specifically relates to the cell cycle checkpoint that ensures that mitosis is delayed until the completion of DNA synthesis and/or the accurate repair of DNA damage occurs.
  • rad3+ Cells having mutations in rad3+ fail to either sense or appropriately respond to DNA damage and subsequently lose viability more rapidly than wild type cells after exposure to clastogenic agents or events (e.g. , IR, DNA damaging agents, and mutations affecting chromosomal integrity). See Weinert et al. , GENES & DEVELOPMENT, 8: 652-665 (1994) and Al-Khodairy et al. , EMBO J . , 11(4): 1343- 1350 (1992).
  • This sensitivity to IR can be caused by defects in checkpoint responses or defects in direct DNA repair reactions.
  • the product of the rad3 + gene is an approximately 270 kD protein that falls into a growing family of high molecular weight PIK-related kinases. See Hunter, Cell, 83: 1-4 (1995) for a discussion of this family of kinases.
  • the primary structures of the catalytic domains found in members of this gene family are closely related to well characterized phosphatidylinositol kinases. This structural relationship initially suggested that these PIK-related kinases might be capable of phosphorylating lipids.
  • PIK-related kinases When the substrate specificity of the PIK-related kinases is examined, however, these enzymes appear to function as protein kinases and have yet to be demonstrated to phosphorylate phosphatidylinositides. Hartley et al. , Cell, 82: 849856 (1995) reports that purified preparations highly active in protein kinase assays failed to show lipid kinase activity. Additional PIK-related kinases identified include: the TEL1 gene product from S. cerevisiae which affects telomere length [Greenwell et al.
  • Ataxia-Telangiectasia Mutated (ATM) gene was recently described in Savitsky et al , Science, 268: 1749-1753 (1995) and the partial cDNA encodes a protein with amino acid similarity to the rad3+ gene.
  • Savitsky et al. Human Molecular Genetics, 4(11)..-2025-2032 (1995) describes isolation of a cDNA encoding full length ATM.
  • the increased radiosensitivity of rad3+ yeast mutants and of mammalian cells lacking functional ATM suggests that these proteins may comprise a family of checkpoint proteins.
  • WAF1 is a member of an expanding class of cell cycle regulators termed cyclin-dependent kinase inhibitory proteins. The activities of cyclin-dependent kinases control transit through the cell cycle.
  • Transcriptional activation of WAF1 thus provides a direct link between DNA damage-dependent induction of p53 and the inhibition of kinases essential for cell cycle progression. See Elledge and Harper, Current Opinion in Cell Biology, 6: 847-852 (1994). Mutations in the p53 gene are one of the most common genetic alterations in human cancers. For example, Baker et al. . Science, 244:217-221 (1989) reports that approximately 70% of human colorectal carcinomas contain deletions or mutant copies of the p53 gene. In addition, Fearon et al.
  • the present invention contemplates, for example, that inhibition of the G2 checkpoint in tumor cells should lead to a state in which tumor cells are incapable of repairing DNA damage therefore sensitizing the tumor cells to DNA damaging agents.
  • treatment of tumors with a G2 checkpoint-specific inhibitor followed by radiation or chemotherapy should increase the efficacy of cell killing and thereby decrease the required doses of toxic
  • the present invention provides novel human PIK-related kinases essential for a cell cycle checkpoint that responds in the G2 phase of the cell cycle to both damaged and unreplicated DNA.
  • the present invention provides purified and isolated polynucleotides (e.g.
  • the MCCSl -like PIK-related kinases exhibit about 40% , about 45 % , or about 50% amino acid identity to the MCCSl kinase domain (MCCSl ⁇ amino acids 2083 to 2410 of SEQ ID NO: 31 or MCCS 1/3 amino acids 2152 to 2480 of SEQ
  • Polynucleotides contemplated by the invention include genomic DNAs, RNAs, cDNAs and wholly or partially chemically synthesized DNAs.
  • Preferred polynucleotides of the invention comprise the MCCSl ⁇ DNA sequence set out in SEQ ID NO: 30, the partial MCCS1/3 DNA sequence set out in SEQ ID NO: 3, the full length MCCS 1 3 DNA sequence set out in SEQ ID NO: 32, and DNA sequences which hybridize to the noncoding strands thereof under stringent conditions or which would hybridize but for the redundancy of the genetic code.
  • Exemplary stringent hybridization conditions are as follows: hybridization at 65 °C in 3X SSC, 20mM NaPO 4 pH 6.8 and washing at 65 'C in 0.2X SSC. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC nucleotide base content of the sequences to be hybridized. Formulas standard in the art are appropriate for determining exact hybridization conditions. See Sambrook et al , 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). The MCCSl ⁇ DNA of SEQ ID NO: 30 was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn
  • the DNA sequence information provided by the present invention makes possible the identification and isolation of DNAs encoding related molecules by well-known techniques such as DNA/DNA hybridization as described above and polymerase chain reaction (PCR) cloning.
  • PCR polymerase chain reaction
  • knowledge of the sequence of a cDNA encoding MCCS l makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences encoding the kinase and expression control regulatory sequences such as promoters, operators and the like.
  • DNA/DNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of the PIK-related kinase; non- human species enzymes homologous to the PIK-related kinase; and other structurally related proteins sharing one or more of the enzymatic activities, or abilities to interact with members or regulators, of the cell cycle checkpoint pathway in which MCCSl participates.
  • Polynucleotides of the invention when detectably labelled are also useful in hybridization assays to detect the capacity of cells to synthesize MCCSl .
  • the DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout” strategies [see, Capecchi, Science, 244: 1288-1292 (1989)], of rodents that fail to express functional MCCSl or that express a variant of MCCSl . Such rodents are useful as models for studying the activities of MCCSl and MCCSl modulators in vivo.
  • Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in the MCCSl locus that underlies a disease state or states. Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of MCCSl by those cells which ordinarily express the same.
  • the invention also provides autonomously repbcating recombinant constructions such as plasmid and viral DNA vectors incorporating polynucleotides of the invention, especially vectors in which the polynucleotides are functionally linked to an endogenous or heterologous expression control DNA sequence and a transcription terminator.
  • host cells especially unicellular host cells such as procaryotic and eukaryotic cells, are stably transformed or transfected with DNAs of the invention in a manner allowing expression of the PIK-related kinase therein.
  • Host cells of the invention are conspicuously useful in methods for the large scale production of MCCSl wherein the cells are grown in a suitable culture medium and the desired enzymes are isolated from the cells or from the medium in which the cells are grown.
  • MCCSl products having part or all of the amino acid sequence set out in SEQ ID NO: 31 , SEQ ID NO: 4, or SEQ ID NO: 33 are contemplated.
  • Use of mammalian host cells is expected to provide for such post-translational modifications (e.g. , myristoylation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention.
  • the enzyme products of the invention may be full length polypeptides, fragments or variants.
  • Variants comprise
  • MCCSl products wherein one or more of the specified (i.e. , naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss of the kinase activity specific to MCCSl ; or (2) with disablement of the kinase activity specific to MCCSl ; or (3) with disablement of the ability to interact with members or regulators of the cell cycle checkpoint pathway.
  • Substrates of MCCSl and proteins which interact with MCCSl may be identified by various assays.
  • Substrates of MCCSl may be identified by incorporating test compounds in assays for kinase activity.
  • MCCSl kinase is resuspended in kinase buffer and incubated either in the presence or absence of the test compound (e.g. , casein, histone HI , or appropriate substrate peptide).
  • Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate to the test compound is indicative that the test compound is a substrate of the kinase.
  • Interacting proteins may be identified by the following assays.
  • a first assay contemplated by the invention is a two-hybrid screen.
  • the two-hybrid system was developed in yeast [Chien et al. , Proc. Natl. Acad. Sci. USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene.
  • a polynucleotide encoding a protein that interacts with MCCSl is isolated by: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and either the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative MCCS 1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not inco ⁇ orated in the first fusion; detecting binding of an MCCSl interacting protein to MCCSl in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell.
  • Presently preferred for use in the assay are
  • Other assays for identifying proteins that interact with MCCSl may involve immobilizing MCCSl or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCSl .
  • Another type of assay for identifying MCCSl interacting proteins involves immobilizing MCCSl or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCSl with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the fluorescent agent.
  • the putative interacting protein may be immobilized and MCCS l may be labelled in the assay.
  • antibody products e.g. , monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like
  • binding proteins such as those identified in the assays above
  • Binding proteins can be developed using isolated natural or recombinant enzymes. The binding proteins are useful, in turn, for purifying recombinant and naturally occurring enzymes and identifying cells producing such enzymes.
  • Specifically illistrating monoclonal antibodies of the invention are the monoclonal antibodies produced by hybridoma cell lines 224C and 224F which were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 on November 7, 1996 and assigned ATCC Accession Nos. HB
  • Assays for the detection and quantification of proteins in cells and in fluids may involve a single antibody substance or multiple antibody substances in a "sandwich” assay format.
  • the binding proteins are also manifestly useful in modulating (i.e. , blocking, inhibiting, or stimulating) enzyme/ substrate or enzyme/ regulator interactions.
  • Anti-idiotypic antibodies specific for PIK-related kinase binding proteins are also contemplated.
  • the invention contemplates that mutations in the MCCSl gene that result in loss of normal function of the MCCSl gene product underlie human disease states in which failure of the G 2 cell cycle checkpoint is involved. Gene therapy to restore MCCSl activity would thus be indicated in treating those disease states (for example, testicular cancer). Delivery of a functional MCCSl gene to appropriate cells is effected in vivo or ex vivo by use of viral vectors (e.g. , adenovirus, adeno- associated virus, or a retrovirus) or ex vivo by use of physical DNA transfer methods (e.g. , liposomes or chemical treatments).
  • viral vectors e.g. , adenovirus, adeno- associated virus, or a retrovirus
  • physical DNA transfer methods e.g. , liposomes or chemical treatments.
  • Antisense nucleic acids preferably 10 to 20 base pair oligonucleotides
  • MCCSl expression control sequences or MCCSl RNA are introduced into cells (e.g. , by a viral vector or colloidal dispersion system such as a liposome).
  • the antisense nucleic acid binds to the MCCSl target sequence in the cell and prevents transcription or translation of the target sequence.
  • Phosphothioate and methylphosphate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention.
  • the antisense oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' end.
  • an agent which inhibits the transcription or the enzymatic activity of MCCSl and thus the G 2 cell cycle checkpoint may be used to render cancerous cells more sensitive to chemotherapy or radiation therapy.
  • the therapeutic value of such an agent lies in the fact that current radiation therapy or chemotherapy in most cases does nothing to overcome the ability of the p53 mutant cancerous cell to sense and correct the DNA damage imposed as a result of the treatment. As a result, a cancer cell can simply repair the DNA damage.
  • Modulating agents of the invention may therefore be chemotherapy and radiation adjuvants or may be directly active as chemotherapeutic drugs themselves.
  • Agents that modulate MCCSl kinase activity may be identified by incubating a test compound with MCCSl immunopurified from cells naturally expressing the PIK-related kinase, with MCCS l obtained from recombinant procaryotic or eukaryotic host cells expressing the enzyme, or with purified MCCSl , and then determining the effect of the test compound on MCCSl activity.
  • the activity of the PIK-related kinase can be measured by determining the moles of 32 P-phosphate transferred by the kinase from gamma- 32 P-ATP to either itself (autophosphorylation) or to an exogenous substrate such as a lipid or protein.
  • the amount of phosphate inco ⁇ orated into the substrate is measured by scintillation counting or autoradiography.
  • An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCSl kinase.
  • a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCSl kinase.
  • agents that modulate both MCCSl and ATM or modulate one of the enzymes are also contemplated.
  • Agents which modulate MCCSl are screened in a kinase assay as described above in which ATM is the phosphorylating enzyme.
  • a MCCSl -specific antibody linked to agarose beads is incubated with a cell lysate prepared from host cells expressing the kinase. The beads are washed to remove proteins binding nonspecifically to the beads and the beads are then resuspended in kinase buffer. The reaction is initiated by the addition of gamma- 2 P-ATP and an appropriate exogenous substrate such as lipid or peptide.
  • the activity of the kinase is measured by determining the moles of 32 P- phosphate transferred either to the kinase itself or the added substrate.
  • the host cells lack endogenous MCCSl and/or ATM kinase activity.
  • the selectivity of a compound that modulates the kinase activity of MCCSl can be evaluated by comparing its activity on MCCSl to its activity on other known PIK- related kinases.
  • the combination of the recombinant MCCSl products of the invention with other recombinant PIK-related kinase products in a series of independent assays provides a system for developing selective modulators of MCCSl .
  • combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.
  • an assay for identifying modulators of MCCSl kinase activity involves incubating an MCCSl kinase preparation in kinase buffer with gamma- 32 P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCSl kinase.
  • a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS 1 kinase.
  • assays for identifying compounds that modulate interaction of MCCS 1 with other proteins may involve: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA sequence encoding part or all of a protein that interacts with MCCSl and the DNA binding domain or activating domain of the transcription factor which is not inco ⁇ orated in the first fusion; evaluating the effect of a test compound on the interaction between MCCSl and the interacting protein by detecting binding of the interacting protein to MCCSl in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported
  • a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
  • Another type of assay for identifying compounds that modulate the interaction between MCCSl and an interacting protein involves immobilizing MCCS 1 or a natural MCCSl interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCSl interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCSl interaction with the protein.
  • Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCSl and an interacting protein involves immobilizing MCCSl or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized
  • MCCS 1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the flourescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound.
  • the MCCSl interacting protein may be immobilized and MCCSl may be labelled in the assay.
  • the present invention further provides a cell-based complementation assay for identifying compounds which modulate the activity of MCCSl or ATM.
  • the assay involves complementation of a phenotypic trait associated with a genetic alteration in the cell.
  • esrl-1 results in cellular sensitivity to DNA damage in yeast cells [Kato et al , Nuc. Acids. Res. , 22(15): 3104-3112 (1994)].
  • esrl-1 cells fail to either sense or appropriately response to DNA damage after exposure to DNA damaging agents such as ionizing radiation or clastogenic agents.
  • the phenotypic trait of the genetically altered cell is complemented by transforming and expressing MCCSl or ATM in the cell.
  • the transformed cells are exposed to DNA damaging treatment (e.g. ionizing radiation) in the presence and absence of a test compound and sensitivity of the cells to DNA damage is measured.
  • DNA damaging treatment e.g. ionizing radiation
  • Agents that affect the cell sensitivity to DNA damaging activity of MCCS l and/or ATM are identified as modulators.
  • Modulators of MCCS l may affect its kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway.
  • MCCSl modulators may be formulated in compositions comprising pharmaceutically acceptable carriers. Such compositions may additionally include chemotherapeutic agents. Dosage amounts indicated would be sufficient to result in modulation of MCCSl activity in vivo.
  • Selective modulators may include, for example, polypeptides or peptides which specifically bind to MCCSl or MCCSl nucleic acid, oligonucleotides which specifically bind to the PIK-related kinase or PIK-related kinase nucleic acid, and/or other non-peptide compounds (e.g.
  • presently preferred regions of the PIK-related kinases which are targets for the development of selective modulators include, for example, the following four regions: the MCCSl ⁇ amino terminal effector domain (amino acids 1 to 1081 of SEQ ID NO: 31), the MCCS 1/3 a ino terminal effector domain (amino acids 1 to 1150 of SEQ ID NO: 33), the MCCSl ⁇ rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS1/3 rad3+ domain (amino acids 1 151 to 2151 of SEQ ID NO: 33), the MCCS l ⁇ PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS 1/3 PIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).
  • Example 1 details the isolation of cDNAs encoding MCCSl kinases.
  • Example 2 describes mapping of the human MCCSl gene to human chromosome 3. The recombinant expression of MCCSl in E. coli and insect cells is respectively described in Examples 3 and 4.
  • Example 4 also presents assays for measuring MCCSl kinase activity.
  • Example 5 describes the production of MCCS 1 -specific polyclonal and monoclonal antibodies.
  • Example 6 reports the immunoprecipitation of MCCS 1 kinase associated activity from mouse testes.
  • Example 7 examines the expression of MCCS 1 mRNA in various human tissues and cancer cell lines.
  • Example 8 describes analyses of MCCSl mRNA and protein expression in mouse testes.
  • Example 9 describes analyses of MCCSl protein expression in meiotic cells. Assays for substrates and interacting proteins of MCCSl are described in Example 10.
  • Example 1 1 describes modulators and assays for modulators of the kinase activity of MCCS 1.
  • Example 12 describes the cell-based complementation assay for identifying modulators of MCCS 1 and/or ATM and
  • Example 13 describes the kinase activity of ATM.
  • Example 1 cDNAs encoding the PIK-related kinase MCCSl were isolated by a series of PCR reactions.
  • PCR amplifications were performed on cDNA preparations from rat T-cells, human peripheral blood mononuclear cells (PBMC), and S. cerevisiae genomic DNA.
  • Five oligonucleotide pairs were used (oDH15a/oDH16, oDH15b/oDH16, oDH17a/oDH16, oDH15a/oDH17b, and oDH15b/oDH17b) for the primary amplifications.
  • the sequences of the oligonucleotide primers included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions.
  • oDH17a (SEQ ID NO: 8) 5' GCA GAC GGA TCC AAR TTY
  • yeast genomic DNA From the primary amplifications of yeast genomic DNA, rat T-cell cDNA, and human PBMC cDNA, only a single reaction with yeast genomic DNA (oDH17a/oDH16) gave a visible amplification product, resulting in a product that was the expected size for the region of the S. cerevisiae MECl gene between these primers. Further analysis of the oDH17a/oDH16 amplifications that utilized rat T- cell and PBMC cDNA was therefore performed. To remove oligonucleotides and "primer dimers" that might interfere with subsequent PCR, primary reactions were purified prior to reamplification.
  • a "nested" PCR strategy was employed, and amplifications were repeated with primer pairs oDH18a/oDH16 and oDH18b/oDH16 under reaction conditions described above with cycle times of denaturation of 94°C for 1 minute, annealing at 55 C for 1 minute, and elongation at 72' C for 30 seconds for 30 cycles.
  • the sequences of the oDH18a and oDH18b oligonucleotide primers included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions.
  • the approximately 90 bp product from the oDH18a/oDH16 reamplification of the human PMBC cDNA primary reaction was gel purified and subcloned into the pBluescript SK ⁇ + cloning vector (Stratagene, La Jolla, California) and sequenced.
  • This PCR fragment was then used as a probe to screen a plasmid library containing macrophage cDNA using the following hybridization conditions: incubation of nitrocellulose filters with radiolabelled probes in 3X SSC, 5X Denhardt's, 0.1 % sarcosyl, 20mM NaPO 4 pH 6.8, 100 ug/ml single stranded salmon spe ⁇ n DNA, for 18 to 24 hours at 65 °C. Washes were done 3 times in 0.2X SSC,
  • Clone 517 (ATCC 69950) contained a 2.8 kbp insert and its DNA and deduced amino acid sequence are set out in SEQ ID NOs: 3 and 4, respectively.
  • the clone contained an open reading frame encoding an amino terminal truncated protein product of 870 amino acids which were 39% identical to the COOH-terminus of rad3+ .
  • the protein product of the cDNA insert was named MCCS 1/3.
  • the sequence of clone 517 was used to design the oligonucleotides, mo3 5'-CTACAGAGCCAAGGAG-3' (SEQ ID NO: 13) and mo6 5'- TCGAGCTATGCTACTAGTGGGC-3' (SEQ ID NO: 14), which were used to generate a probe using a gel purified EcoRI fragment derived from clone 517 as a template.
  • the PCR conditions were as follows: 50 ng DNA fragment, IX PCR buffer (Perkin-Elmer Cetus), 1.5mM MgCl 2 , 200/ ⁇ M dATP, dGTP, and TTP, l M dCTP, 50 ⁇ Ci ⁇ 32 P-dCTP, lOng/ml each oligonucleotide, 1U AmpliTaq (Perkin-Elmer Cetus).
  • IX PCR buffer Perkin-Elmer Cetus
  • MgCl 2 200/ ⁇ M dATP, dGTP, and TTP
  • l M dCTP 50 ⁇ Ci ⁇ 32 P-dCTP
  • lOng/ml each oligonucleotide
  • 1U AmpliTaq Perkin-Elmer Cetus
  • HT2 contained a 4.7 Kb insert (corresponding to nucleotide 2974 of SEQ ID NO: 30 and extending further downstream than SEQ ID NO: 1) and HT9 contained a 5485 bp insert (corresponding to nucleotides 2152 to 7624 of SEQ ID NO:
  • nucleotide sequence analysis revealed that in the region common to both cDNA clones there was a single base pair insertion of a T at nucleotide 3233 in HT9. This nucleotide insertion causes the predicted amino acid reading frame to shift and then terminate and is believed to be an error introduced by reverse transcriptase in clone HT9.
  • a human fetal brain cDNA library (Stratagene #93206), a human heart cDNA library (Stratagene # 936207), and a human aorta cDNA library (Clontech Laboratories #HL1 136a, Palo Alto, California).
  • HT9-l 5'-CCTAGTCCAGTAAAACTTGC-3' SEQ ID NO: 15
  • oHT9-4 S'-TTTGCGGCCCTTCCAATATC-S' SEQ ID NO: 16
  • HFB2 included a cDNA 4.5 Kb insert which included approximately 2300 bp of additional sequence.
  • the HFB2 insert corresponds to nucleotides 1 to 3194 of SEQ ID NO: 30.
  • a composite cDNA encoding MCCSl ⁇ was constructed from clones HFB2, HT9 and HT2.
  • the three clones were joined together by digesting HFB2 with the restriction enzymes Kpnl and Sail to generate a fragment to comprise the 5 ' end of the composite clone, digesting HT9 with Kpnl and NotI to generate a fragment to comprise the 3' end of the composite clone, and then ligating isolated fragments to the vector pBS SK " (Stratagene) that had been digested with Sail and NotI.
  • the region of the HT9 fragment containing the one nucleotide insertion was replaced with an EcoRV fragment containing nucleotides 3174 to 5282 of clone HT2.
  • the final plasmid containing a 7621 bp insert was named pBSHFB2HT2-27 (ATCC 69951).
  • the DNA and deduced amino acid sequence of the insert are presented in SEQ ID NOs: 1 and 2, respectively.
  • the coding domain of the cDNA initiates with an ATG at nucleotide 333 and ends with a termination codon at nucleotide 7560 predicting a coding sequence of 2409 amino acids and protein of 265 kD.
  • the protein product of the cDNA insert was named MCCSl ⁇ .
  • Subsequent sequence analysis of the insert in plasmid pBSHFB2HT2-27 revealed sequencing errors in SEQ ID NO: 1.
  • Corrected DNA and deduced amino acid sequences of the insert are set out in SEQ ID NOs: 23 and 24, respectively. Even further sequence anaysis of insert in plasmid pBSHFB2HT2-27 revealed sequencing error in SEQ ID NO: 23. At nucleotide position 6317 (SEQ ID NO: 23) a "G" was erroneously included and between positions 6338 and 6339 the sequence was missing an "A” . The corrected sequences of MCCSl ⁇ are provided in SEQ ID NOs: 30 and 31.
  • the MCCS 1/3 clone 517 amino acid sequence corresponds to MCCSl ⁇ amino acids 161 1 to 2410 of SEQ ID NO: 31.
  • the seventy amino acid deletion in MCCSl ⁇ i.e. , where the seventy amino acids would be inserted to generate a product identical to MCCS 1/3
  • cDNA clone pBSHFB2HT2-27 was apparently generated from alternatively spliced mRNA.
  • the carboxyl terminal domains containing the kinase domains are identical in MCCSl ⁇ (amino acids 2083 to 2410 of SEQ ID NO: 31) and MCCS1 / 3 clone (amino acids 543 to 870 of SEQ ID NO: 4).
  • a composite clone containing the complete coding sequence of MCCS 1 / 3 (with the seventy amino acid insert) is presented in SEQ ID NO: 32.
  • the amino acid sequence deduced from the clone is presented in SEQ ID NO: 33.
  • This clone is constructed by replacing the sequence between the BSTXI site, which cleaves after nucleotide 3229, and the NotI site in the polylinker sequence at the 3' end of pBSHFB2HT2-27 (SEQ ID NO: 1) with the sequence contained in HT2 between the BstXI site and the NotI site at the 3' end of HT2.
  • this clone contains sequences that are identical to MCCSl ⁇ nucleotides 1 to 5159 of SEQ ID NO: 1 (encoding amino acids 1 to 1609 of SEQ ID NO: 2) linked to sequences that are identical to clone 517 nucleotides 1 to 2610 of SEQ ID NO: 3 (encoding amino acids 1 to 870 of SEQ ID NO: 4).
  • subsequent sequence analysis revealed errors in nucleotides 1 to 5159 of SEQ ID NO: 1.
  • Corrected MCCS I ⁇ DNA and deduced amino acid sequences that include the same corrections that appear in MCCSl ⁇ SEQ ID NOs: 23 and 24 are set out in SEQ ID NOs: 25 and 26.
  • the SEQ ID NO: 25 clone represents a cDNA encoding a full length MCCS 1/3 kinase. Further sequences for MCCS1/3 including corrections of errors identified in resequencing the MCCSl ⁇ clone are presented in SEQ ID NOs: 32 and 33.
  • the MCCSl products can be divided into three regions based on similarity to other PIK-related kinases: an amino terminal domain (MCCS let amino acids 1 to 1081 of SEQ ID NO: 31 and MCCS 1/3 amino acids 1 to 1150 of SEQ ID NO: 33), a region with similarity to rad3+ (MCCS let amino acids 1082 to 2082 of SEQ ID NO: 31 and MCSS 1/3 amino acids 1151 to 2151 of SEQ ID NO: 33) and a
  • PIK domain (MCCSl ⁇ amino acids 2083 to 2410 of SEQ ID NO: 31 and MCCS1/3 amino acids 2152 to 2480 of SEQ ID NO: 33) including a kinase domain.
  • the amino terminal region and rad3+ region are regulatory domains that modulate the kinase activity of the enzyme and are involved in interactions with associated proteins. Results of comparisons of the nucleotide and amino acid sequence of
  • MCCS let and MCCSl ,3 to the sequences of other PIK-related and non-PIK-related kinases are shown in Table 1.
  • Table 1 the 3' end of MCCS let (nucleotides 6579 to 7562 of SEQ ID NO: 30 encoding the kinase domain), the 3' end of MCCS 1/3 (nucleotides 1627 to 2379 of SEQ ID NO: 32 encoding the kinase domain), the rad3+ domain of MCCS let (nucleotides 3576 to 6578 of SEQ ID NO: 30), and the rad3+ domain of MCCS 1/3 (clone 517 nucleotides 1 to 1626 of SEQ ID NO: 3) were compared to the analogous region in human ATM [Savitsky et al , supra], human DNA-PK [Huntley et al , Cell, 82: 849-856 (1995)], human FRAP [Brown et al , supra
  • Percent identity of nucleotides is shown in the top line, percent identity of amino acids is shown in the middle line, and percent similarity of amino acids (i.e. , including identical amino acids and conservative variations in amino acids) is shown in the bottom line for each kinase in Table 1.
  • Conservative variation as used herein denotes biologically similar residues. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like.
  • ND indicates a value was not determined either because the nucleotide sequence encoding the kinase (i.e. , rad3+) was not publically available or because the kinase (i.e. , FRAP, pi 10/3, or PKA) lacks the particular domain being compared.
  • Human PKA 39 16 39 Example 2 The MCCSl gene was mapped to chromosome 3 by a PCR-based assay. Human/rodent somatic cell hybrids containing various human chromosome panels available from the NIGMS Human Genetic Mutant Cell Repository [Drwinga et al , Genomics, 16: 31 1-314 (1993)] were used as templates.
  • oligonucleotide primers oDH23 SEQ ID NO: 12
  • oDH26 5' TGGTTTCTGAGAACATTCCCTGA 3' SEQ ID NO: 19
  • the primers generate 237 bp PCR products.
  • PCR conditions consisted of 50 ng genomic DNA, 0.5 ⁇ g of each primer, 200 ⁇ M dNTPs, 1.5mM MgCl 2 , IX PCR buffer (Perkin Elmer-Cetus), and 1 unit of Amplitaq polymerase (Perkin-Elmer Cetus) in a 25 ⁇ l reaction volume.
  • the samples were denatured for 4 minutes and then cycled 35 times with denaturing, annealing, and extension times of 45 seconds, 30 seconds, and 45 seconds, respectively, in a Model 480 Cetus Thermocycler. Five ⁇ l of the resulting PCR product was electrophoresed on a 3 % agarose gel and stained with ethidium bromide.
  • DNA corresponding to the human/rodent chromosome 3 hybrid yielded a positive amplification product.
  • amplification reaction In a second set of amplification reactions, the same oligonucleotide primers were used to sublocalize the MCCS l gene to a specific region on chromosome 3.
  • the templates for these amplifications consisted of DNA samples from patients with chromosome 3 truncations [Leach et al. , Genomics, 24: 549-556 (1994)]. Amplifications were performed as described in the foregoing paragraph. The pattern of positive amplification products narrowed the localization to the interval between q21 and q25.1.
  • Polynucleotides encoding carboxyl terminal portions of the PIK-related kinase MCCS 1/3 were expressed by recombinant techniques in E. coli.
  • E. coli expression plasmids were constructed that expressed either the COOH-terminal 423 or 571 amino acid residues of the kinase in the Pinpoint fusion protein expression/purification system (Promega, Madison, Wisconsin).
  • DNA sequences encoding the COOH-terminal portion of the kinase were fused in frame to the COOH-terminus of a 13 kD peptide derived from the transcarboxylase complex from propionibacterium shermanii. This region undergoes biotination in E. coli, and thus provides a means for monitoring expression and purification of the fusion proteins. Expression was driven from the tac promoter in pinpoint Xa3.
  • Fusion protein expression was induced with O. lmM IPTG and confirmed using streptavidin alkaline phosphatase in a pseudo-Western format as described by the manufacturer.
  • Example 4 Recombinant versions of MCCSl may also expressed in yeast or in
  • SF9 insect cells using a baculovirus expression system.
  • the FRAP kinase has been expressed, purified and is enzymatically active after expression in the baculovirus system [Brown et al. , supra] .
  • the coding region of MCCSl is fused at the amino terminus to a heterologous peptide sequence, such as the FLAG tag MDYKDDDDK (SEQ ID NO:
  • Infected insect cells are incubated for 48 hours and lysed in lysis buffer (25mM 2-glycerolphosphate, 50mM sodium phosphate pH 7.2, 0.5 % Triton-X 100, 2mM EDTA, 2mM EGTA, 25 mM sodium fluoride, lOO ⁇ M sodium vanadate, ImM PMSF, l ⁇ g/ l leupeptin, l ⁇ g/ l pepstatin, ImM benzamidine, and 2mM DTT).
  • lysis buffer 25mM 2-glycerolphosphate, 50mM sodium phosphate pH 7.2, 0.5 % Triton-X 100, 2mM EDTA, 2mM EGTA, 25 mM sodium fluoride, lOO ⁇ M sodium vanadate, ImM PMSF, l ⁇ g/ l leupeptin, l ⁇ g/ l pepstatin, ImM benzamidine, and 2mM DTT.
  • Expressed FLAG fusion proteins are
  • ATR appears to encode the same or a closely related protein to MCCS 1 based on a comparison of amino acid sequences between ATR and MCCS 1.
  • the DNA and deduced amino acid sequences of ATR are presented in SEQ ID NOs:
  • ATR includes an additional 98 amino acid residues at the N-terminus.
  • SEQ ID NO: 32 there is a conservative base change from "A” in MCCS1 / 3 to "T” in ATR and at nucleotide position 4176, there is an additional conservative base change from "C” in MCCS1/3 to "T” in ATR.
  • the FLAG tag was fused at the amino-terminus of a truncated ATR molecule which lacked the first sixty-six ATR amino acids.
  • the FLAG tag was a d d ed b y P C R a s fo l l o w s .
  • HFB24 (5'-CGGGATCCGCCATGGACTACAAGGACGATGACAAGATGTTGCTTGATTTC-3 ).
  • HFB24 (5'CTTAAGCCGCATGAGCACACCGTC-3') were used in the following PCR reaction: lOOng of pcDNAATR (obtained from Antony M. Carr) as template; IX PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCl 2 , 200 ⁇ M each of dATP, dGTP, dCTP, and TTP, 10 ng/ ⁇ l of each primer; 1U AmpliTaq (Perkin- Elmer Cetus).
  • the reaction was denatured at 94 °C for 4 minutes followed by 30 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 72°C for 30 seconds.
  • the resulting approximately 800 bp PCR product was digested with BamHI and Nhel and was ligated to the lOkb fragment of the mammalian ATR expression plasmid, pcDNAATR digested with BamHI and BstXI along with the remainder of the ATR coding sequences contained on a 2.5 kb BstXI to Nhel fragment. Sequence analysis confirmed the addition of the FLAG tag.
  • the insert contained within this plasmid was then used to construct a baculovirus expression plasmid that would express the FLAG tagged ATR truncate.
  • the 5' end of ATR contained on a BamHI to BstXI fragment and the 3' end of ATR contained on a BstXI to Sail fragment derived from pBTM ATR were ligated to the baculovirus expression vector, pFB (Gibco/BRL) that had been digested with BamHI and Sail.
  • This plasmid was designated pFMBCCS/3FLAG.
  • the full coding region of ATR was fused at the amino terminus to the six h i stidine tag by PCR. Oligonucleotides MC CS ⁇ hi s
  • ATR ATR PCR conditions were as follows: 100 ng of PstA 12ATR (obtained from Antony M. Carr) was used as template; IX PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCl 2 , 200 ⁇ M each of dATP, dGTP, dCTP, and TTP, 10 ng/ ⁇ l of each primer; 1U AmpliTaq (Perkine-Elmer Cetus). The reaction was denatured at 94 °C for 4 minutes followed by 25 cycles of 94°C for 30 seconds, 60°C for 30 seconds and
  • the approximately 800 bp PCR product was digested with BamHI and MscI and ligated to two other fragments: a lOkb fragment from pcDNAATR digested with BamHI and BstXI and an approximately 3 kb MscI to BstXI fragment containing the remainder of the ATR coding sequence.
  • the addition of the six histidine tag was verified by sequence analysis.
  • the resulting plasmid encoding a six-histidine tagged full length ATR molecule was designated pcDNA ⁇ his ATR.
  • the resulting plasmid designated pFB/HisX6MCCS-l plasmid was transformed into the E.coli strain, DH5ct (Gibco/BRL) for screening of recombinants.
  • This plasmid was purified by using the Promega "Wizard" mini-prep kit, then transformed into E. coli ctSF9 cells (Invitrogen) using the Cellfectin protocol described by Gibco/BRL.
  • the SF9 cell pellet and baculovirus produced by the transfected cells were harvested.
  • the virus was stored at 4°C in Grace's Complete media containing 10% FBS, Pennicillin-Streptomycin, and Gentamicin. This viral prep was used to make a high liter (P2) virus stock.
  • the P2 virus stock was used to infect a 50 ml culture of SF9 cells. The cells were collected
  • the cell pellet was stored at -20°C for 24 hours before lysis.
  • the cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 8.0; 500 mM NaCl; 1 % NP40; 100 ⁇ m PMSF).
  • lysis buffer 50 mM Tris, pH 8.0; 500 mM NaCl; 1 % NP40; 100 ⁇ m PMSF.
  • Expression of ATR was confirmed by immunoblot using the polyclonal antibody anti-AgDH2 as a probe.
  • the FBHisX ⁇ ATR baculovirus produced an approximately 300 kDa protein that was immunoreactive with anti-AgDH2 antibodies and comigrated with a protein in a mouse testes cell extract.
  • the P2 virus stock was also used to infect a 2 liter culture of SF9 cells.
  • the cells were collected 48 hours after infection, centrifuged at low speed to pellet the cells without lysis and stored at -20°C.
  • a cell pellet from 150 is of this culture was lysed in 7.5 ml of lysis buffer (50mM NaPO, pH7.2; 0.5 % NP-40; lOmM imidazole, 25mM NaF, 100 ⁇ M Na 3 VO 4 ; 0.5mM AEBSF; 1 ⁇ g/ml leupeptin; l ⁇ g/ml pepstatin A) and incubated on ice for 15 minutes. The lysate was then centrifuged for 30 minutes at 10,000 x g.
  • lysis buffer 50mM NaPO, pH7.2; 0.5 % NP-40; lOmM imidazole, 25mM NaF, 100 ⁇ M Na 3 VO 4 ; 0.5mM AEBSF; 1 ⁇ g/ml le
  • the sample was loaded at a flow rate of 0.25 ml/minute, washed 5 ml of Buffer A and then eluted in 10 ml of a gradient of 50 to 500 mM imidazole in Buffer A.
  • One half ml fractions were collected and was assayed for kinase activity as follows. Five ⁇ l of each fraction was incubated in kinase buffer, 10 ⁇ Ci 32 P ⁇ ATP, 10 ⁇ M ATP, and 5 ⁇ g of substrate PHAS-1 (Stratagene) and incubated at 37 °C for 20 minutes. The reaction was then spotted onto phosphocellulose spin columns and centrifuged at
  • MCCS1 encoding plasmid DNA was transformed into an esrl-1 diploid yeast strain (Mata leu2-l his4-4 canl ura3 cyh2 ade6ade2 esrl-1/MATa Ieu2-27his4 trpl met2 ade2 esrl-1), and cells were grown to mid-log phase in either galactose or glucose containing medium. Cells were pelleted, washed and all steps performed at 4°C. Cell pastes were resuspended in buffer (20 mM Tris at pH 8.0, 300 mM NaCl,
  • the column was eluted stepwise with 8 ml of 10 mM, 50 mM, 100 mM, and 250 mM imidazole in buffer. Fractions were collected and Western analysis was performed using 15 ⁇ l of each elution peak. Kinase activity was measured as described above.
  • pGEX 1 -MEC and pGEX3- MEC Two different bacterial expression plasmids, pGEX 1 -MEC and pGEX3- MEC, were constructed for the recombinant production of portions of the MCCSl polypeptide as fusions to the COOH-terminus of glutathione S-transferase (GST).
  • pGEXl-MEC contains an EcoRI fragment encoding amino acid residues 566 to 870 of SEQ ID NO: 4 fused to GST in the pGEXl vector (Pharmacia Biotech, Milwaukee, Wisconsin);
  • pGEX3-MEC contains an Eco Rl fragment encoding amino acid residues 118 to 567 of SEQ ID NO: 4 fused to GST in the pGEX3 vector (Pharmacia Biotech). Induction of the pGEX tac promoter with 0.
  • AgDH-2 and AgDH- 3 extracts were centrifuged through a 35 % sucrose solution containing 0.1M NaCl, 0.01M Tris pH7.5, and O.OOIM EDTA (STE). Pellets were then washed twice and resuspended in STE.
  • AgDH-2 and AgDH-3 were further purified using preparative SDS polyacrylamide gel electrophoresis and electroelution of each antigen from gel slices.
  • Primary immunization of female New Zealand White rabbits was with 200 ⁇ g of each antigen mixed with complete Freund's adjuvant injected at multiple sites subcutaneously.
  • Subsequent immunizations were with 100 ⁇ g antigen mixed with incomplete Freund's adjuvant at approximately 21 day intervals, and test bleeds were taken after immunizations 3, 4 and 5.
  • Western blot analysis of extracts of human testis tissue demonstrates antibody reactivity against an approximately 270 kD protein in immune but not preimmune antisera.
  • the MCCSl -specific antibodies were purified as follows. Inclusion body preparations of AgDH-2 and AgDH-3 were coupled to cyanogen bromide (CNBr)-activated Sepharose (Pharmacia, Alameda, CA). Two mg of antigen were solubilized in 1 % SDS (4.5 ml final volume) and dialyzed overnight against Coupling Buffer (0. IM NaHCO 3 /0.1 % SDS). 0.5 ml of 5M NaCl were added to each antigen preparation prior to incubation with the CNBr Sepharose. 0.4 gm of freeze-dried
  • CNBr Sepharose (per antigen) were resuspended in 1 mM HCl and washed in a scintered glass funnel with 250 ml 1 mM HCl added in several aliquots over 15 minutes. The HCl-washed CNBr Sepharose was then removed to a 15 ml snap cap tube and washed twice with 5 ml of Coupling Buffer. Dialyzed antigen preps were added to the washed Sepharose and then incubated at room temperature for 1.5 hours on a slowly rotating wheel.
  • the Sepharose was washed once with 5 ml of Coupling Buffer, once with 10 ml of 0.1M Tris pH8.0, and then incubated in 10 ml 0.1M Tris 8.0 for 2 hours at room temperature to block any remaining reactive groups on the resin. Coupling efficiency was 60-80% as judged by SDS-PAGE analysis.
  • the antigen columns were then washed with 15 ml of 6M Guanidine HCl (to remove uncoupled antigen), 25 ml of Buffer A (50mM Tris pH 7.4), 15 ml of Buffer B (4.5M MgCl 2 /lmg/ml BSA/50mM Tris 7.4), and then 50 ml of Buffer A.
  • Antipeptide antibodies were generated against the human ATM protein by coupling a 15-amino-acid peptide (residues 1359-1373) to Keyhole Limpet Hemocyanin-using EDC as described by the manufacturer (Pierce), followed by injection of the coupled immunogen into rabbits.
  • the antibodies were first precipitated from the serum (#6076) with an equal volume of saturated ammonium chloride followed by resuspension and dialysis against PBS.
  • Affinity purification was carried out using a peptide column prepared by coupling the antigenic peptide to CNBr-activated Sepharose (Pharmacia) as described by the manufacturer. The antibodies were then bound to the peptide column and washed with 2 m KC1-PBS. Elution was carried out with 20 ml S m Nal (in 1 mM sodium thiosulfate), which was dialyzed immediately against PBS.
  • mice Female Balb/c mice were immunized with 50 ug AgDH-2 or AgDH-3. Additional mice were immunized with 25 to 50 ug AgDH-2 or AgDH-3 that had been combined with an equal molar ratio of mAb 61F3B, a monoclonal antibody with specific reactivity to GST. A third group of mice were immunized with SDS polyacrylamide gel slices containing
  • the cell suspension was filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 ml serum free RPMI.
  • Thymocytes taken from three naive Balb/c mice were prepared in this manner.
  • NS-1 myeloma cells kept in log phase in RPMI with 11 % fetal bovine serum (FBS) (Hyclone Laboratories, Inc. , Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described in the foregoing paragraph.
  • FBS fetal bovine serum
  • each cell suspension was brought to a final volume of 10 ml in serum free RPMI, and 10 ⁇ l was diluted 10: 100. Twenty ⁇ l of each dilution was removed, mixed with 20 ⁇ l 0.4% trypan blue stain in 0.85 % saline (Gibco), loaded onto a hemacytometer and counted.
  • the pellet was resuspended in 200 ml RPMI containing 15 % FBS, 100 ⁇ M sodium hypoxanthine, 0.4 ⁇ M aminopterin, 16 ⁇ M thymidine (HAT) (Gibco), 25 units/ml IL-6 (Mallinckrodt, Folcrost, Pennsylvania), and 1.5 x
  • IO 6 thymocytes/ml The suspension was dispensed into ten 96-well flat bottom tissue culture plates at 200 ⁇ l/well. Cells in plates were fed 3 to 4 times between fusing and screening by aspirating approximately half the medium from each well with an 18 G needle and replenishing plating medium described above except containing 10 units/ml IL-6 and lacking thymocytes.
  • PBST horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, PA) diluted 1 : 10,000 in PBST was added. Plates were incubated as above, washed 4 times with PBST and 100 ⁇ l substrate consisting of 100 ⁇ g/ml of tetramethylbenzidine and 0.15 ⁇ l/ml H 2 O 2 in lOO M sodium acetate, pH 5.5, was added. The color reaction was stopped in 5-10 minutes with the addition of 50 ⁇ l of 15 % H 2 SO 4 . A 490 was read on a plate reader.
  • the primary antibody (well supernatant) was diluted in the above block solution and incubated for one hour at room temperature, washed four times in block minus milk, incubated in goat anti-mouse IgG (H+L) HRP (BioRad #170-6516), washed again in block solution minus milk, transfered to NEN Renaissance ECL reagent and developed for 5 minutes.
  • Immunoprecipitation was performed as follows. Fifty ⁇ l of hybridoma supernatant was incubated for one hour on ice with 300 ⁇ g of testes cell lysate prepared as described in Example 6. Thirty ⁇ l of a 50% slurry of protein A agarose (Pierce, Rockford, IL), prebound to a rabbit anti-mouse bridging antibody (5 ⁇ g/reaction) (Pierce) was added and incubated at 4°C with rocking. The immune complexes were washed three times in lysis buffer and the antigen/antibody complex eluted by boiling in SDS sample buffer (2% SDS, 20 mM Tris pH 6.8, 20% glycerol,
  • Example 6 The four hybridoma cell lines were designated 224B, 224C (ATCC HB 12233), 224F (ATCC HB 12234) and 224G. All four monoclonal antibodies recognized MCCS l by immunoblot and immunoprecipitation.
  • MCCSl associated protein kinase activity was immunoprecipitated using the MCCSl -specific polyclonal antibodies described in Example 5.
  • Extracts were made from fresh testes tissue isolated from Balb/c mice. Minced testes were homogenized on ice with 10-15 strokes of a tight fitting dounce homogenizer in Lysis Buffer (50 mM NaPO4, pH 7.2; 0.5 % TritonX-100; 2 mM EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM phenylmethylsulfonyl fluoride [PMSF]; 1 ⁇ g/ml leupeptin; 1 ⁇ g/ml pepstatin A; 2 mM
  • Lysis Buffer 50 mM NaPO4, pH 7.2; 0.5 % TritonX-100; 2 mM EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM phenylmethylsulfonyl fluoride [PMSF]; 1 ⁇ g/
  • Lysis buffer one time with 1 ml Kinase Buffer (25 mM Hepes pH 7.7; 50 mM KCl; 10 mM MgCl 2 ; 0.1 % NP-40; 2 % glycerol; 1 mM DTT), and then incubated in 20 ul Kinase Buffer with 10 ⁇ Ci ATP [50 Ci/mmol]) for 20 minutes at 37° C.
  • the kinase reactions were stopped with 20 ⁇ l 2X SDS sample buffer and heated to 100° C prior to separation on 6% polyacrylamide gels. Gels were fixed in 20% methanol/7% Acetic acid, and then dried onto Whatman 3MM paper prior to autoradiography.
  • the expression pattern of MCCSl in various human tissues was examined by Northern blot hybridization.
  • Nylon membranes containing 2 ⁇ g of size-fractionated poly A + RNA from a variety of human tissue sources were obtained from Clontech Laboratories, Inc. , and the hybridization protocol supplied by the manufacturer was followed precisely, except that the final wash was performed at 55 ° C, rather than 50° C, to minimize the possibility of cross-hybridization to related sequences.
  • the 32 P- labelled DNA hybridization probe used was generated by PCR. A DNA encoding the COOH- terminal 30% of MCCS l ⁇ was used as a template to amplify a 1.3 kb fragment in the presence of 32 P-dCTP using primers 279-3 5 'TGGATGATGACAGCTGTGTC 3 '
  • Results of the Northern blots show that MCCSl is expressed as an approximately 9 kb mRNA in a wide variety of human tissues.
  • Testis tissue contains the highest level of MCCSl mRNA, though the transcript is also expressed in small intestine, ovary, prostate, thymus, spleen, heart, peripheral blood lymphocytes, colon, brain, placenta, skeletal muscle, kidney and pancreas.
  • RNA blot contained RNA from the cell lines HL-60 (promyelocytic leukemia), HeLa (cervical carcinoma), K-562 (chronic myelogenous leukemia), MOLT-4
  • Northern blot analysis was performed as directed by the manufacturer with hybridization being carried out at 65 °C using a 2.0kb Kpnl-Sall fragment of the MCCSl partial clone HFB2. Expression was observed in the HL-60, HeLa, K-562, Raji, SW480, and
  • G361 cell lines with the highest level of expression occurring in the G361 cell line. Detectable but low levels of expression were observed in the MOLT-4 and A549 cell lines.
  • Example 8 The expression of MCCSl mRNA and protein in normal and irradiated mouse testes and in mouse embryos was examined by in situ hybridization, immunostaining and/or immunoblotting. In situ Hybridization
  • hybridization buffer with a final concentration of 50% formamide, 0.3 M NaCl, 20 mM Tris pH 7.5, 10% dextran sulfate, IX Denhardt's solution, 100 mM dithiothreitol (DTT) and 5 mM EDTA, and 20 ⁇ l of the solution was applied to each section and covered with a sterile, RNase-free 22 x 22 cover slip.
  • the mRNA in both the section and the probe solution was denatured by heating the slides to 85 ° C for 10 minutes in an oven. Hybridization was carried out overnight (12-16 hours) at 50° C.
  • the sections were blocked for 30 minutes at room temperature in a solution of 5 % normal sheep serum (Harlan Bioproducts for Science, Indianapolis, IN) and 0.3 % Triton X- 100 (Sigma) in Buffer 1 with gentle stirring, after which 150 ⁇ l/section of sheep ctDigoxigenin-gold conjugate (Goldmark Biologicals, Philipburg, Pa) was applied to the tissues and incubated for 2 hours at room temperature.
  • the slides were then washed three times for 5 minutes in Buffer 1 , five times for 3 minutes in sterile deionized water, the excess liquid blotted off the slide and 2 drops each of silver enhancing and initiating solution (Goldmark Biologicals) applied to each section.
  • the chemical reaction was allowed to proceed for 23 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in
  • Testis tissue from normal male Balb/c mice was sectioned at 6 ⁇ thickness, picked up on Superfrost Plus ® (VWR Scientific) slides and allowed to air- dry at room temperature overnight. Sections were stored at -70° C if not immediately used. The sections were fixed in cold (4° C) acetone for 10 minutes at room temperature; once the slides were removed from the acetone the reagent was allowed to evaporate from the sections. Each tissue section was blocked with 150 ⁇ l of a solution of 30% normal rat serum (Harlan Bioproducts), 5 % normal goat serum (Vector Laboratories) and 1 % bovine serum albumin (BSA) (Sigma) in IX TBS for 30 minutes at room temperature.
  • BSA bovine serum albumin
  • the solution was gently blotted from the sections and anti-AgDH-3 and anti-AgDH-2 polyclonal antibodies and preimmune sera from the same rabbits were diluted 1 :50 and 1 : 100 in the blocking solution and 100 ⁇ l applied to each tissue section and incubated for 30 minutes at 37 ° C.
  • the antibody solution was blotted gently from the sections and unbound antibody removed from the sections by washing the slides 3 times for 5 minutes each in IX TBS.
  • the excess TBS was blotted from the slide and 100 ⁇ l of the biotinylated goat anti-rabbit antibody contained in the Elite Rabbit IgG Vectastain ABC kit (Vector), prepared according to the product insert, were applied to each section and incubated for 15 minutes at 37° C. After incubation, the slides were washed 2 times in IX TBS for 5 minutes in each wash. Next, 100 ⁇ l of streptavidin-gold conjugate (Goldmark Biologicals) diluted 1 : 100 in a solution containing 5 % normal rat serum and 1 % BSA was applied to each section and incubated for 1 hour at room temperature.
  • streptavidin-gold conjugate Goldmark Biologicals
  • the slides were then washed 3 times in IX TBS for 5 minutes each wash, and 100 ⁇ l of 1 % glutaraldehyde (Sigma) in TBS buffer was applied to the slides for 5 minutes at room temperature.
  • the slides were then washed 3 times for 5 minutes each in TBS, then 4 times in sterile deionized water for 3 minutes each. The excess liquid was blotted from each slide and 2 drops each of silver enhancing and initiating solution
  • MCCSl plays an important role in meiotic cell division.
  • Meiosis is a specialized form of cell division that produces germ cells in higher eukaryotes. There are two major characteristics of meiosis that distinguish it from mitosis. Whereas mitotic cell division results in genetically identical cells containing two of each chromosome, meiotic cell division results in cells containing one of each chromosome.
  • Pachytene spermatocytes, round, and condensing spermatids were prepared from decapsulated testes of adult mice by sequential dissociation with collagenase and trypsin-DNase 1. The cells were separated into discrete populations by sedimentation velocity at unit gravity in 2-4% BSA gradients in Enriched Krebs
  • the pachytene spermatocyte and round spermatid populations were each at least 85 % pure, while the condensing spermatid population was about 40-50% pure (contaminated primarily with enucleated residual bodies and some round spermatids).
  • Sperm were obtained from the cauda epididymides. Purified populations of spermatogenic cells were dissolved directly in SDS-sample buffer containing 40 mM DTT, heated to 100 ° C for 5 minutes, and the amount of protein in each sample determined by the Amido-Black procedure.
  • MCCSl protein levels were barely detectable lower in the condensing spermatid population, and this may reflect the presence of round spermatids in the preparation (see above).
  • Example 10 Substrates of MCCSl and proteins that interact with MCCSl (for example, members of the cell cycle checkpoint pathway and proteins that localize MCCSl in cells) may be identified by various assays. A. Identification of Substrates
  • Substrates of MCCS l may be identified by inco ⁇ orating test compounds in assays for kinase activity.
  • MCCSl kinase is resuspended in 20 ⁇ l kinase buffer (25mM Hepes pH7.4, 25mM KCl, lOmM MgC12, ImM DTT, 2 % glycerol, 0.1 % NP40, 0.5mM ATP, 10 uCI gamma 32 P-ATP) and incubated for 30 minutes, either in the presence or absence of 4 ⁇ g test compound (e.g. , casein, histone HI , or appropriate substrate peptide).
  • 4 ⁇ g test compound e.g. , casein, histone HI , or appropriate substrate peptide.
  • Reactions are separated on 12 % PAGE gels and dried onto Whatman paper prior to autoradiography. Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate indicates that the test compound is a substrate of the kinase.
  • the protein PHAS-1 has been identified as an in vitro substrate of ATR (Example 4).
  • PHAS-I is a heat and acid-stable protein that phosphorylated at several sites in vivo in response to insulin and growth factors.
  • PHAS-1 binds to the mRNA cap binding factor, EIF-4E, and prevents translation of capped mRNAs.
  • Phosphorylation of PHAS-1 at a specific serine residue results in dissociation of PHAS-1 form EIF-4E and thus releasing the inhibition of translation of capped mRNAs. This mechanism allows for a rapid synthesis of protein in response to a particular stimulus.
  • PHAS-1 may be phosphorylated by several protein kinases in vivo including a protein kinase that is sensitive to rapamycin. Since the rapamycin- sensitive protein kinase, FRAP, is related to ATR, it would be reasonable to assume that there might be an overlap in substrate specificity between FRAP and ATR and that PHAS-1 is a substrate for both of these protein kinases in vitro.
  • FRAP protein kinase that is sensitive to rapamycin.
  • ATR rapamycin- sensitive protein kinase
  • ATR that was immunoprecipitated from a mouse testes cell extract or His- tagged ATR purified from baculovirus-infected SF9 cells was incubated with 10 ⁇ g PHAS-1 (Stratagene) in kinase buffer (25 mM Hepes pH 7.4, 25 mM KCl , 10 mM MgCl 2 , 1 mM DTT, 0.1 % NP-40), 10 ⁇ M ATP and 10 ⁇ Ci 32 P ATP for 20 minutes at 37 C C.
  • kinase buffer 25 mM Hepes pH 7.4, 25 mM KCl , 10 mM MgCl 2 , 1 mM DTT, 0.1 % NP-40
  • GEESQFEMDIRR SEQ ID NO: 42
  • These peptides are tested in the same kinase reaction to determine which peptide(s) is (are) phosphorylated by ATR.
  • the peptide(s) are then used as substrate for ATR or MCCSl in assays such as described in Example 11 to identify modulators.
  • Interacting proteins may be identified by the following assays.
  • a first assay contemplated by the invention is a two-hybrid screen.
  • the two-hybrid system was developed in yeast [Chien et al. , Proc. Natl. Acad. Sci. USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene.
  • a polynucleotide encoding a protein that interacts with MCCS l is isolated by: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and either the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative MCCSl binding proteins and the DNA binding domain or activating domain of the transcription factor which is not inco ⁇ orated in the first fusion; detecting binding of an MCCSl interacting protein to MCCSl in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell.
  • a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
  • Other assays for identifying proteins that interact with MCCSl may involve immobilizing MCCSl or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCSl .
  • Another type of assay for identifying MCCSl interacting proteins involves immobilizing MCCSl or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCSl with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the florescent agent.
  • the putative interacting protein may be immobilized and MCCSl may be labelled in the assay.
  • Modulators of MCCSl include MCCSl variants and other molecules.
  • the modulators may affect MCCSl kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway.
  • Presently preferred regions of MCCSl which are targets for mutation or the development of selective modulators include the following four regions: the MCCS 1 et amino terminal effector domain (amino acids 1 to 1081 of SEQ ID NO: 31), the MCCS 1/3 amino terminal effector domain (amino acids 1 to 1150 of SEQ ID NO: 33), the MCCSlct rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS1/3 rad3+ domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCSlct PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS1/3 PIK domain (amino acids 2152 to 2480
  • MCCSl variants having mutations in the kinase domain may be useful as a radiosensitizing agents. Mutations specifically contemplated by the invention are, replacement of the MCCS let aspartic acid at amino acid 2241 , the asparagine at 2246, and the aspartic acid at 2260 of SEQ ID NO: 31 with alanine or methionine, and the corresponding mutations in MCCS 1/3. Analogous mutations in the rad3+ gene resulted in yeast hypersensitive to radiation. In addition, mutations in the kinase domain of ATM are found in patients with AT, a disease that causes radiation sensitivity.
  • an assay for identifying modulators of MCCSl kinase activity involves incubating an MCCSl kinase preparation in kinase buffer with gamma- 3 P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. For example, 2 ⁇ l of the 50 mM imidazole elution pool is added to kinase buffer. (See Example 6.) The reactions are incubated at 37°C for 20 min and samples are analyzed by SDS-PAGE prior to autoradiography or Western analysis.
  • test compound is an activator of said MCCSl kinase.
  • a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCSl kinase.
  • assays for identifying compounds that modulate interaction of MCCS 1 with other proteins may involve: transforming or transferring appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCSl and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA sequence encoding part or all of a protein that interacts with MCCSl and the DNA binding domain or activating domain of the transcription factor which is not inco ⁇ orated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS 1 and the interacting protein by detecting binding of the interacting protein to MCCSl in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene
  • Another type of assay for identifying compounds that modulate the interaction between MCCSl and an interacting protein involves immobilizing MCCSl or a natural MCCSl interacting protein, detectably labelling the nonim mobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCSl interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCSl interaction with the protein.
  • Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCSl and an interacting protein involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCSl with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the florescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound.
  • the MCCSl interacting protein may be immobilized and MCCSl may be labelled in the assay.
  • host cells for example, esrl-1 yeast cells
  • MCCSl -encoding DNA as is described in Example 4.
  • the esrl-1 yeast strain is normally sensitive to treatment with ultraviolet (UV) light, but esrl-1 yeast cells expressing MCCSl or ATR are no longer sensitive to treatment with UV light.
  • the transformed yeast cells are exposed to test compounds and the effect of the test compounds on UV sensitivity of the transformed host cell is determined.
  • Test compounds that are inhibitors of MCCSl or ATR activity restore UV sensitivity to the MCCSl transformed esrl-1 cells.
  • esrl-1 tell double mutant yeast cells are used as host cells instead of esrl-1 yeast cells.
  • the TEL1 gene is homologous to ATM and the TEL1 mutation is described in Morrow, et al , Cell,
  • the invention also specifically contemplates that the esrl-1 or esrl-1 tell double mutant yeast host cells may be transformed with ATM-encoding
  • the assays include clastogenic agents or events instead of treatment with UV light (e.g. , IR, hydroxyurea, or DNA damaging agents).
  • clastogenic agents or events instead of treatment with UV light (e.g. , IR, hydroxyurea, or DNA damaging agents).
  • Appropriate host cells for use in such embodiments would be those that are sensitive to the alternative clastogenic agents or events.
  • Another type of complementation assay involves the use of mammalian host cells such as cell lines derived from cells of AT patients. As described above for yeast cells, the mammalian cells are transfected with DNA encoding MCCS l , ATR, or ATM and then exposed to test compounds. Test compounds that are inhibitors of MCCSl , ATR, or ATM activity will restore the phenotype of the untransformed host cell (e.g. , sensitivity to IR).
  • mammalian host cells such as cell lines derived from cells of AT patients. As described above for yeast cells, the mammalian cells are transfected with DNA encoding MCCS l , ATR, or ATM and then exposed to test compounds. Test compounds that are inhibitors of MCCSl , ATR, or ATM activity will restore the phenotype of the untransformed host cell (e.g. , sensitivity to IR).
  • the above assays can be used to identify compounds that inhibit activity of MCCSl , ATR, and ATM or compounds that inhibit activity of only one of the enzymes.
  • the yeast or mammalian host cells are transformed with DNA encoding chimeric polypeptides including various combinations of MCCSl and ATM domains.
  • MCCSl and ATM show structural similarities, and chimeric polypeptides which comprise portions of MCCSl and ATM are useful in elucidating active sites and binding domains of both MCCSl and ATM.
  • Polynucleotides encoding the chimeras can be prepared by standard molecular biology techniques known to the skilled worker and as exemplified herein.
  • the chimeric polypeptides are expressed in host cells and modulators of the chimeras can be identified by the assays disclosed herein.
  • MCCSl and ATM are both involved in meiosis I checkpoints. Since MCCSl is demonstrated herein to have kinase activity, assays were performed to determine if ATM possessed kinase activity. To determine the kinase activity of
  • MRC-5 fibroblasts ATCC #171 -CCL
  • polyclonal antisera 6076.
  • MRC-5 cells are human lung embryonal diploid fibroblasts. MRC-5 cells were obtained from the ATCC at passage 19 and maintained in Minimal Essential Medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 mg/ml streptomycin, and 100 mM MEM non-essential amino acids. Media and media supplements were obtained through Gibco Life Technologies. Cell lines were maintained in a water- saturated 37 C C incubator with 5 % C.
  • MRC-5 cell extracts were prepared by lysis of a 10cm plate of log- phase cells in 0.5 ml of Lysis Buffer I (50 M NaPO 4 , pH 7.2; 0.5 % TritonX-100;
  • Preclearing was done by adding 10 ⁇ g purified rabbit IgG (Zymed) and 30 ⁇ l Protein A Agarose slurry (Pierce) followed by incubation at 4°C for 60 minutes while rocking. To the precleared lysates, 10 ⁇ g of affinity purified 6076 antisera (or 10 ⁇ g 6076 pre-blocked with 0.04 mg P45 peptide for 30 min.) was added and incubated on ice for 60 minutes. Immunoprecipitates were collected by addition of 30 ⁇ l Protein A agarose slurry and incubated with rocking at 4°C for 30 minutes followed by four washes in Lysis Buffer I.
  • Kinase reactions were carried out by washing the immunoprecipitations once with kinase buffer (25 ⁇ M Hepes pH 7.7; 50 mM KCl; 10 mM MgCl 2 ; 0.1 % NP-40; 2 % glycerol; 1 mM DTT), followed by incubation in 20 ⁇ l of Kinase Buffer containing 10 ⁇ M ATP + 10 ⁇ Ci ⁇ 32 P-ATP [50 Ci/mmol] for 20 minutes at 37°C. Reactions were stopped by the addition of 20 ⁇ l 2X SDS sample buffer and boiled for 5 minutes prior to separation on 6% SDS polyacrylamide gels.
  • kinase buffer 25 ⁇ M Hepes pH 7.7; 50 mM KCl; 10 mM MgCl 2 ; 0.1 % NP-40; 2 % glycerol; 1 mM DTT
  • the gels were dried and exposed to x-ray film (Kodak, XAR-5) at -80°C overnight.
  • 10 cm plates of log-phase MRC-5 cells were washed once with PBS then incubated in Dulbeco's Modified Eagle Medium (minus methionine) containing 2 % dialyzed fetal bovine serum for 30 minutes.
  • Cells were labeled by adding 200 ⁇ Ci 35 S-methionine (1000 Ci/mmol TRAN 35 S-LABEL, ICN Radiochemicals) for 2 hours. Labeled cells were then washed once with PBS and frozen at -80°C prior to immunoprecipitation.
  • the incubation of the immunoprecipitated complexes in kinase buffer produced a phosphorylated product with a molecular weight of approximately 350,000 that co-migrated with ATM in polyacrylamide gels.
  • ATR and ATM thus appear to be able to self-phosphorylate or associate with a protein kinase.
  • Corl is a component of axial/lateral elements of synapsing chromosomes [Dobson et al , J. Cell Sci. , 107:2749-2760 (1994)]. Corl chromosomal staining appears when the axial elements begin to form between the sister chromatids of each homolog in leptonema of meiotic prophase, prior to the initiation of synapsis.
  • homologous bivalents synapse As homologous bivalents synapse, the axial elements from the two homologs align and a central element forms between them, completing the structure called the synaptonemal complex (SC).
  • SC synaptonemal complex
  • both proteins were seen at pairing forks; however, the location and behavior of the two proteins differed markedly.
  • ATR was present in small amounts and transiently at discrete foci along the asynapsed (unpaired) axes. As homologs synapse, ATR disappeared from these locations.
  • ATR foci were detected at similar locations on the two axial elements. In nuclei where an entire autosome fails to find its homologous pairing partner, ATR foci were detected along the entire lengths of these asynapsed axis. In males, where the X chromosome has no homolog, ATR foci were localized along the unpaired axis.
  • ATR The involvement of ATR appears to be transient during early meiotic prophase while the role of ATM appears to be more prolonged. However, both ATR and ATM coordinate the various events of meiotic prophase by performing similar checkpoint functions.
  • GCA CCA AAA CAG ACT GAG GAA ATT AAA CAT GTG GAC ATG AAC CAA AAG 1217 Ala Pro Lys Gin Thr Glu Glu He Lys His Val Asp Met Asn Gin Lys 280 285 290 295
  • AAG CTT CTA GAA TTG TGC AAT AAA CCG GTG GAA ATT CTT GCT TCT CTT 6545 Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu He Leu Ala Ser Leu 2060 2065 2070
  • TGT AGG AAC TTG AAA GCC ACT TCT CAA CAT GAA TGT TCA TCT TCT CAA 1776 Cys Arg Asn Leu Lys Ala Thr Ser Gin His Glu Cys Ser Ser Ser Gin 580 585 590

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP96945181A 1995-11-16 1996-11-18 Zellzyklus-regulierte, phosphatidylinsositol-(pik-) abhängige kontrollkinasen, für diese kodierende gene und methoden zur überprüfung und modulation der enzymatischen aktivität Withdrawn EP0807169A3 (de)

Applications Claiming Priority (9)

Application Number Priority Date Filing Date Title
US7312 1987-01-27
US607312 1990-10-31
US55866695A 1995-11-16 1995-11-16
US558666 1995-11-16
US73129696A 1996-02-27 1996-02-27
US60731296A 1996-02-27 1996-02-27
US72530496A 1996-10-21 1996-10-21
US725304 1996-10-21
PCT/US1996/019337 WO1997018323A2 (en) 1995-11-16 1996-11-18 Cell-cycle checkpoint phosphatidylinositol- (pik-) related kinases, genes coding therefor and methods for assaying and modulating enzymatic activity

Publications (2)

Publication Number Publication Date
EP0807169A2 true EP0807169A2 (de) 1997-11-19
EP0807169A3 EP0807169A3 (de) 1998-03-11

Family

ID=27504800

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96945181A Withdrawn EP0807169A3 (de) 1995-11-16 1996-11-18 Zellzyklus-regulierte, phosphatidylinsositol-(pik-) abhängige kontrollkinasen, für diese kodierende gene und methoden zur überprüfung und modulation der enzymatischen aktivität

Country Status (1)

Country Link
EP (1) EP0807169A3 (de)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9718323A3 *

Also Published As

Publication number Publication date
EP0807169A3 (de) 1998-03-11

Similar Documents

Publication Publication Date Title
EP0690876B1 (de) Proteinkinase
AU1461197A (en) Cell cycle checkpoint pik-related kinase materials and methods
US5882910A (en) Lipid kinase
EP0694044B1 (de) Verfahren und produkt für die regulation des reaktionsvermögens von zellen auf äussere signale
US6218136B1 (en) Methods of the identification of pharmaceutically active compounds
AU717466B2 (en) Integrin-linked kinase, its inhibitors and methods of medical treatment using these inhibitors, gene therapy and pseudo-substrate inhibitors
US6297356B1 (en) Telomere repeat binding factors and diagnostic and therapeutic use thereof
US20040170995A1 (en) Isolated nucleic acid molecules encoding a novel human signal transducing kinase-mapkap-2; encoded proteins, cells transformed therewith and uses thereof
US5674748A (en) Human cyclin-dependent kinase-like proteins and methods of using the same
CA2270911A1 (en) Mammalian chk1 effector cell-cycle checkpoint protein kinase materials and methods
US5830699A (en) SOK-1 and methods of use
EP1263939B1 (de) 18477, eine menschliche proteinkinase und deren verwendung
US20070172493A1 (en) 12832, a novel human kinase-like molecule and uses thereof
CA2210650A1 (en) Cell cycle checkpoint pik-related kinase materials and methods
US5510461A (en) pp: A newly identified CD45-associated protein
US5627064A (en) Protein kinases
SK111597A3 (en) Cell-cycle checkpoint phosphatidylinositol- (pik-) related kinases, genes coding therefor and methods for assaying and modulating enzymatic activity
US5840536A (en) Growth factor receptor-binding insulin receptor
AU2005201060B2 (en) Phosphatidylinositol 3-kinase P110 Delta Catalytic Subunit
AU697340C (en) Method and product for regulating cell responsiveness to external signals
MXPA99004132A (en) Mammalian chk1 effector cell-cycle checkpoint protein kinase materials and methods
AU1882602A (en) Phosphatidylinositol 3-kinase P110 delta catalytic subunit

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19970818

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Withdrawal date: 19990520