CA2210650A1 - Cell cycle checkpoint pik-related kinase materials and methods - Google Patents
Cell cycle checkpoint pik-related kinase materials and methodsInfo
- Publication number
- CA2210650A1 CA2210650A1 CA002210650A CA2210650A CA2210650A1 CA 2210650 A1 CA2210650 A1 CA 2210650A1 CA 002210650 A CA002210650 A CA 002210650A CA 2210650 A CA2210650 A CA 2210650A CA 2210650 A1 CA2210650 A1 CA 2210650A1
- Authority
- CA
- Canada
- Prior art keywords
- leu
- ser
- lys
- glu
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Abstract
The present invention generally relates to genes encoding cell cycle checkpoint phosphatidylinositol kinase (PIK)-related proteins essential to DNA damage responses in cells. These PIK-related kinases are required in regulatory pathways that arrest the cell cycle following DNA damage to allow DNA repair prior to mitosis or initiation of DNA
replication. More particularly, the invention provides a novel human cell cycle checkpoint PIK-related kinase, MCCS1, and polynucleotide sequences encoding the MCSS1. Assays for identifying modulators of MCCS1 useful as, for example, chemotherapy and radiation adjuvants, are also provided by the invention. Further, assays for identifying modulators of the cell cycle checkpoint phosphatidylinositol kinase (PIK)-related protein identified as ATM are provided.
replication. More particularly, the invention provides a novel human cell cycle checkpoint PIK-related kinase, MCCS1, and polynucleotide sequences encoding the MCSS1. Assays for identifying modulators of MCCS1 useful as, for example, chemotherapy and radiation adjuvants, are also provided by the invention. Further, assays for identifying modulators of the cell cycle checkpoint phosphatidylinositol kinase (PIK)-related protein identified as ATM are provided.
Description
CELL CYCLE CHECKPOINT PIK-RELATED KINASE
FIELD OF THE INVENTION
The present invention generally relates to genes encoding cell-cycle checkpoint phosphatidylinositol kinase (PIK)-related genes and proteins essential to DNA damage responses in cells. The checkpoint kinases play a role in the surveillance of DNA damage that occurs as a result of replication errors, DNA
mismatches, radiation treatment, or chemotherapeutic drugs. These kinases are required in regulatory pathways that lead to cell cycle arrest following DNA
damage, giving the cell notice and time to correct lesions prior to the initiation of DNA
replication. More particularly, the invention relates to a novel human PIK-related kinase, Mammalian Cell Cycle Surveillance 1(MCCS 1), polynucleotides encoding the PIK-related kinase, and methods for assaying and modulating the enzymatic activity of the kinase and related kinases.
BACKGROUND
The process of eukaryotic cell growth and division is the somatic or mitotic cell cycle which consists of four phases, the G, phase, the S phase, the G, phase, and the M phase. The G,, S, and G2 phases are collectively referred to as interphase of the cell cycle. The cell cycle is structurally and functionally conserved in its basic process and mode of regulation across all eukaryotic species.
During the G, (gap) phase, biosynthetic activities of the cell progress at a high rate.
The S
(synthesis) phase begins when DNA synthesis starts and ends when the DNA
content of the nucleus of the cell has been replicated and two identical sets of chromosomes are formed. The cell then enters the G2 (gap) phase which continues until mitosis starts. In mitosis, the chromosomes pair and separate and two new nuclei fonn, and in cytokinesis the cell itself splits into two daughter cells each receiving one nucleus containing one of the two sets of chromosomes. Mitosis and cytokinesis together form the M (mitosis) phase of the cell cycle. Cytokinesis terminates the M
phase and marks the beginning of interphase of the next cell cycle. The sequence in which the events in the cell cycle proceed is tightly regulated such that the initiation of one cell cycle event is dependent on the completion of the prior cell cycle event. This allows fidelity in the duplication and segregation of genetic material from one generation of cells to the next.
The term "cell cycle checkpoints" refers to the proteins, signals, processes, and feedback controls that integrate discontinuous events during cellular replication, in order to maintain essential dependencies within the cell cycle. The present invention specifically relates to the cell cycle checkpoint that ensures that mitosis is delayed until the completion of DNA synthesis and/or the accurate repair of DNA damage occurs.
Failure of cell cycle checkpoints predisposes individuals to or directly causes many disease states such as cancer, ataxia telangiectasia, embryo abnormalities, and various immunological defects associated with aberrant B
and T
cell development. The latter are associated with pathological states such as lupus, arthritis and autoimmune diseases. Intense research efforts have therefore focused on identifying cell cycle checkpoints and the proteins essential for the function of the checkpoints.
Genetic analysis in the yeasts Schizosaccharomyces pombe and Saccharomyces cerevisiae has identified a number of genes important for cell cycle arrest and DNA repair responses to ionizing radiation (IR). For a review, see Carr and Hoekstra, Trends in Cell Biology, 5: 32-40 (1995). One such gene, identified in both yeasts, is required for a DNA damage checkpoint which arrests the cell cycle at the G2 phase, as well as a related checkpoint which monitors the completion of DNA synthesis and arrests the cell cycle at the S phase. The gene is named rad3+
in S. pombe [Seaton et al., Gene, 119: 83-89 (1992)], MECI/ESRI in S.
cerevisiae [Kato et al., Nuc. Acids. Res., 22(15) : 3104-3112 (1994)), and is hereinafter referred to as rad3+. Cells having mutations in rad3+ fail to either sense or appropriately respond to DNA damage and subsequently lose viability more rapidly than wild type cells after exposure to clastogenic agents or events (e.g., IR, DNA damaging agents, and mutations affecting chromosomal integrity). See Weinert et al., GENES &
DEVELOPMENT, 8: 652-665 (1994) and Al-Khodairy et al., EMBO J., 11(4) : 1343-1350 (1992). This sensitivity to IR (radiosensitivity) can be caused by defects in checkpoint responses or defects in direct DNA repair reactions.
The product of the rad3+ gene is an approximately 270 kD protein that falls into a growing family of high molecular weight PIK-related kinases. See Hunter, Cell, 83: 1-4 (1995) for a discussion of this family of kinases. The primary structures of the catalytic domains found in members of this gene family are closely related to well characterized phosphatidylinositol kinases. This structural relationship initially suggested that these PIK-related kinases might be capable of phosphorylating lipids. When the substrate specificity of the PIK-related kinases is examined, however, these enzymes appear to function as protein kinases and have yet to be demonstrated to phosphorylate phosphatidylinositides. Hartley et al., Cell, 82:
849856 (1995) reports that purified preparations highly active in protein kinase assays failed to show lipid kinase activity. Additional PIK-related kinases identified include:
the TELI gene product from S. cerevisiae which affects telomere length [Greenwell et al., Cell, 82: 823-829 (1995)], and Mei41 + gene product from Drosophila melanogaster which is important for a G2 checkpoint and meiotic development [Hari et al., Cell, 82: 815-821 (1995)], the DNA-PK gene product from mouse which is important in immunoglobulin rearrangements and processing of DNA double strand breaks, and the FRAP gene product which is important in the G 1/S transition [Brown, E. et al., Nature, 377:441-446 (1995)]. Mutations in the DNA-PK gene can result in the Severe Combined Immunodeficiency Syndrome (SCID) defect (Hartley et al., supra).
In humans, less is known about the molecular components required for checkpoint function. One component of the mammalian checkpoint machinery has been identified through the analysis of the human disease syndrome ataxia-telangiectasia (AT). Patients with AT show a diverse set of clinical symptoms, including predisposition to a variety of tumor types. Fibroblasts from AT
patients are radiosensitive and fail to undergo cell cycle arrest following treatment with IR leading to a phenomenon termed radioresistant DNA synthesis. This is reminiscent of the S.
pombe rad3 defect where cells fail to sense or respond appropriately to DNA
damage.
FIELD OF THE INVENTION
The present invention generally relates to genes encoding cell-cycle checkpoint phosphatidylinositol kinase (PIK)-related genes and proteins essential to DNA damage responses in cells. The checkpoint kinases play a role in the surveillance of DNA damage that occurs as a result of replication errors, DNA
mismatches, radiation treatment, or chemotherapeutic drugs. These kinases are required in regulatory pathways that lead to cell cycle arrest following DNA
damage, giving the cell notice and time to correct lesions prior to the initiation of DNA
replication. More particularly, the invention relates to a novel human PIK-related kinase, Mammalian Cell Cycle Surveillance 1(MCCS 1), polynucleotides encoding the PIK-related kinase, and methods for assaying and modulating the enzymatic activity of the kinase and related kinases.
BACKGROUND
The process of eukaryotic cell growth and division is the somatic or mitotic cell cycle which consists of four phases, the G, phase, the S phase, the G, phase, and the M phase. The G,, S, and G2 phases are collectively referred to as interphase of the cell cycle. The cell cycle is structurally and functionally conserved in its basic process and mode of regulation across all eukaryotic species.
During the G, (gap) phase, biosynthetic activities of the cell progress at a high rate.
The S
(synthesis) phase begins when DNA synthesis starts and ends when the DNA
content of the nucleus of the cell has been replicated and two identical sets of chromosomes are formed. The cell then enters the G2 (gap) phase which continues until mitosis starts. In mitosis, the chromosomes pair and separate and two new nuclei fonn, and in cytokinesis the cell itself splits into two daughter cells each receiving one nucleus containing one of the two sets of chromosomes. Mitosis and cytokinesis together form the M (mitosis) phase of the cell cycle. Cytokinesis terminates the M
phase and marks the beginning of interphase of the next cell cycle. The sequence in which the events in the cell cycle proceed is tightly regulated such that the initiation of one cell cycle event is dependent on the completion of the prior cell cycle event. This allows fidelity in the duplication and segregation of genetic material from one generation of cells to the next.
The term "cell cycle checkpoints" refers to the proteins, signals, processes, and feedback controls that integrate discontinuous events during cellular replication, in order to maintain essential dependencies within the cell cycle. The present invention specifically relates to the cell cycle checkpoint that ensures that mitosis is delayed until the completion of DNA synthesis and/or the accurate repair of DNA damage occurs.
Failure of cell cycle checkpoints predisposes individuals to or directly causes many disease states such as cancer, ataxia telangiectasia, embryo abnormalities, and various immunological defects associated with aberrant B
and T
cell development. The latter are associated with pathological states such as lupus, arthritis and autoimmune diseases. Intense research efforts have therefore focused on identifying cell cycle checkpoints and the proteins essential for the function of the checkpoints.
Genetic analysis in the yeasts Schizosaccharomyces pombe and Saccharomyces cerevisiae has identified a number of genes important for cell cycle arrest and DNA repair responses to ionizing radiation (IR). For a review, see Carr and Hoekstra, Trends in Cell Biology, 5: 32-40 (1995). One such gene, identified in both yeasts, is required for a DNA damage checkpoint which arrests the cell cycle at the G2 phase, as well as a related checkpoint which monitors the completion of DNA synthesis and arrests the cell cycle at the S phase. The gene is named rad3+
in S. pombe [Seaton et al., Gene, 119: 83-89 (1992)], MECI/ESRI in S.
cerevisiae [Kato et al., Nuc. Acids. Res., 22(15) : 3104-3112 (1994)), and is hereinafter referred to as rad3+. Cells having mutations in rad3+ fail to either sense or appropriately respond to DNA damage and subsequently lose viability more rapidly than wild type cells after exposure to clastogenic agents or events (e.g., IR, DNA damaging agents, and mutations affecting chromosomal integrity). See Weinert et al., GENES &
DEVELOPMENT, 8: 652-665 (1994) and Al-Khodairy et al., EMBO J., 11(4) : 1343-1350 (1992). This sensitivity to IR (radiosensitivity) can be caused by defects in checkpoint responses or defects in direct DNA repair reactions.
The product of the rad3+ gene is an approximately 270 kD protein that falls into a growing family of high molecular weight PIK-related kinases. See Hunter, Cell, 83: 1-4 (1995) for a discussion of this family of kinases. The primary structures of the catalytic domains found in members of this gene family are closely related to well characterized phosphatidylinositol kinases. This structural relationship initially suggested that these PIK-related kinases might be capable of phosphorylating lipids. When the substrate specificity of the PIK-related kinases is examined, however, these enzymes appear to function as protein kinases and have yet to be demonstrated to phosphorylate phosphatidylinositides. Hartley et al., Cell, 82:
849856 (1995) reports that purified preparations highly active in protein kinase assays failed to show lipid kinase activity. Additional PIK-related kinases identified include:
the TELI gene product from S. cerevisiae which affects telomere length [Greenwell et al., Cell, 82: 823-829 (1995)], and Mei41 + gene product from Drosophila melanogaster which is important for a G2 checkpoint and meiotic development [Hari et al., Cell, 82: 815-821 (1995)], the DNA-PK gene product from mouse which is important in immunoglobulin rearrangements and processing of DNA double strand breaks, and the FRAP gene product which is important in the G 1/S transition [Brown, E. et al., Nature, 377:441-446 (1995)]. Mutations in the DNA-PK gene can result in the Severe Combined Immunodeficiency Syndrome (SCID) defect (Hartley et al., supra).
In humans, less is known about the molecular components required for checkpoint function. One component of the mammalian checkpoint machinery has been identified through the analysis of the human disease syndrome ataxia-telangiectasia (AT). Patients with AT show a diverse set of clinical symptoms, including predisposition to a variety of tumor types. Fibroblasts from AT
patients are radiosensitive and fail to undergo cell cycle arrest following treatment with IR leading to a phenomenon termed radioresistant DNA synthesis. This is reminiscent of the S.
pombe rad3 defect where cells fail to sense or respond appropriately to DNA
damage.
Interestingly, the locus responsible for AT, the Ataxia-Telangiectasia Mutated (ATM) gene, was recently described in Savitsky et al., Science, 268: 1749-1753 (1995) and the partial cDNA encodes a protein with amino acid similarity to the rad3+
gene.
Savitsky et al., Human Molecular Genetics, 4(11):2025-2032 (1995) describes isolation of a cDNA encoding full length ATM. The increased radiosensitivity of rad3+ yeast mutants and of mammalian cells lacking functional ATM suggests that these proteins may comprise a family of checkpoint proteins.
Kuerbitz et al., Proc. Nail. Acad. Sci. USA, 89: 7492-7495 (1992) establishes that the tumor suppressor p53 is required for a GI checkpoint and cell cycle arrest observed following DNA damage. Irradiation of cells results in increased levels of p53 leading to the transcriptional activation of p53 responsive genes. One such p53-induced target is the product of the WAFI gene (also called p2I, CIP1, and sdil). WAF1 is a member of an expanding class of cell cycle regulators termed cyclin-dependent kinase inhibitory proteins. The activities of cyclin-dependent kinases control transit through the cell cycle. Transcriptional activation of WAFI
thus provides a direct link between DNA damage-dependent induction of p53 and the inhibition of kinases essential for cell cycle progression. See Elledge and Harper, Current Opinion in Cell Biology, 6: 847-852 (1994). Mutations in the p53 gene are one of the most common genetic alterations in human cancers. For example, Baker et al., Science, 244:217-221 (1989) reports that approximately 70% of human colorectal carcinomas contain deletions or mutant copies of the p53 gene. In addition, Fearon et al., Cell, 61: 759-767 (1990) reports that breast, lung, bladder and brain tumors have been associated with loss of chromosome 17p, the region to which the p53 gene localizes.
At present there is relatively little known about the molecular components of the G2 checkpoints in mammalian cells. Caffeine is a chemical entity which abrogates G2 checkpoint control. Russell et al., Cancer Res., 55: 1639-(1995) and Powell et al., Cancer Res., 55: 1643-1648 (1995) report that analysis of cell lines which differ only by the presence or absence of functional p53 demonstrated preferential caffeine-enhanced sensitization to IR in those cells lacking the p53-dependent G 1 checkpoint. Thus, the conversion of potentially lethal damage into lethal damage is greater in cells lacking the GI and G2 checkpoints in comparison to cells containing an intact GI checkpoint.
While certain cells undergo DNA damage-dependent cell cycle arrest, other cells appear to respond to DNA damage by initiating an intrinsic suicide program termed apoptosis or programmed cetl death. The factors determining which process occurs are not fully understood. Recent work has demonstrated an important role for p53 both in the regulation of G1 cell cycle transitions and apoptosis.
Symonds et al., Cell, 78: 703-711 (1994) describe p53-dependent apoptosis as suppressing tumor growth and progression in vivo.
High doses of radiation and chemotherapy are used to treat tumor cells in order to damage DNA so severely that the cells will die. However, even though tumor cells having mutations in the p53 gene are defective in a G 1 checkpoint, they can still repair DNA damaged induced by radiation or chemotherapy. The present invention contemplates, for example, that inhibition of the G2 checkpoint in tumor cells should lead to a state in which tumor cells are incapable of repairing DNA
damage therefore sensitizing the tumor cells to DNA damaging agents. Normal cells, containing intact G 1 and G2 checkpoints, should still be able to repair DNA
damage in the presence of a G2 checkpoint-specific inhibitor. Thus, treatment of tumors with a G2 checkpoint-specific inhibitor followed by radiation or chemotherapy should increase the efficacy of cell killing and thereby decrease the required doses of toxic DNA-damaging agents.
There thus exists a need in the art for identification of the mammalian proteins that are involved in the cell cycle checkpoints in order to develop therapies for the human disease states associated with defective cell cycle checkpoints and for the isolation of the genes encoding those proteins which in themselves may be useful as therapeutics or which would enable the development of therapeutically useful modulators of the proteins encoded by the genes.
SUMMARY OF THE IIWENTION
The present invention provides novel human PIK-related kinases essential for a cell cycle checkpoint that responds in the G2 phase of the cell cycle to both damaged and unreplicated DNA.
gene.
Savitsky et al., Human Molecular Genetics, 4(11):2025-2032 (1995) describes isolation of a cDNA encoding full length ATM. The increased radiosensitivity of rad3+ yeast mutants and of mammalian cells lacking functional ATM suggests that these proteins may comprise a family of checkpoint proteins.
Kuerbitz et al., Proc. Nail. Acad. Sci. USA, 89: 7492-7495 (1992) establishes that the tumor suppressor p53 is required for a GI checkpoint and cell cycle arrest observed following DNA damage. Irradiation of cells results in increased levels of p53 leading to the transcriptional activation of p53 responsive genes. One such p53-induced target is the product of the WAFI gene (also called p2I, CIP1, and sdil). WAF1 is a member of an expanding class of cell cycle regulators termed cyclin-dependent kinase inhibitory proteins. The activities of cyclin-dependent kinases control transit through the cell cycle. Transcriptional activation of WAFI
thus provides a direct link between DNA damage-dependent induction of p53 and the inhibition of kinases essential for cell cycle progression. See Elledge and Harper, Current Opinion in Cell Biology, 6: 847-852 (1994). Mutations in the p53 gene are one of the most common genetic alterations in human cancers. For example, Baker et al., Science, 244:217-221 (1989) reports that approximately 70% of human colorectal carcinomas contain deletions or mutant copies of the p53 gene. In addition, Fearon et al., Cell, 61: 759-767 (1990) reports that breast, lung, bladder and brain tumors have been associated with loss of chromosome 17p, the region to which the p53 gene localizes.
At present there is relatively little known about the molecular components of the G2 checkpoints in mammalian cells. Caffeine is a chemical entity which abrogates G2 checkpoint control. Russell et al., Cancer Res., 55: 1639-(1995) and Powell et al., Cancer Res., 55: 1643-1648 (1995) report that analysis of cell lines which differ only by the presence or absence of functional p53 demonstrated preferential caffeine-enhanced sensitization to IR in those cells lacking the p53-dependent G 1 checkpoint. Thus, the conversion of potentially lethal damage into lethal damage is greater in cells lacking the GI and G2 checkpoints in comparison to cells containing an intact GI checkpoint.
While certain cells undergo DNA damage-dependent cell cycle arrest, other cells appear to respond to DNA damage by initiating an intrinsic suicide program termed apoptosis or programmed cetl death. The factors determining which process occurs are not fully understood. Recent work has demonstrated an important role for p53 both in the regulation of G1 cell cycle transitions and apoptosis.
Symonds et al., Cell, 78: 703-711 (1994) describe p53-dependent apoptosis as suppressing tumor growth and progression in vivo.
High doses of radiation and chemotherapy are used to treat tumor cells in order to damage DNA so severely that the cells will die. However, even though tumor cells having mutations in the p53 gene are defective in a G 1 checkpoint, they can still repair DNA damaged induced by radiation or chemotherapy. The present invention contemplates, for example, that inhibition of the G2 checkpoint in tumor cells should lead to a state in which tumor cells are incapable of repairing DNA
damage therefore sensitizing the tumor cells to DNA damaging agents. Normal cells, containing intact G 1 and G2 checkpoints, should still be able to repair DNA
damage in the presence of a G2 checkpoint-specific inhibitor. Thus, treatment of tumors with a G2 checkpoint-specific inhibitor followed by radiation or chemotherapy should increase the efficacy of cell killing and thereby decrease the required doses of toxic DNA-damaging agents.
There thus exists a need in the art for identification of the mammalian proteins that are involved in the cell cycle checkpoints in order to develop therapies for the human disease states associated with defective cell cycle checkpoints and for the isolation of the genes encoding those proteins which in themselves may be useful as therapeutics or which would enable the development of therapeutically useful modulators of the proteins encoded by the genes.
SUMMARY OF THE IIWENTION
The present invention provides novel human PIK-related kinases essential for a cell cycle checkpoint that responds in the G2 phase of the cell cycle to both damaged and unreplicated DNA.
In one of its aspects, the present invention provides purified and isolated polynucleotides (e. g. , DNAs and RNAs, both coding and non-coding strands thereof) encoding the cell cycle checkpoint PIK-related kinase MCCSI and polynucleotides encoding other cell cycle checkpoint PIK-related kinases that exhibit about 50, about 60, or about 65 % nucleotide identity to the MCCS 1 polynucleotide region encoding the MCCS I kinase domain (MCCS I a nucleotides 6579 to 7562 of SEQ ID NO: 30 or MCCSlO nucleotides 6457 to 7440 of SEQ ID NO: 32).
Alternatively, the MCCS 1-like PIK-related kinases exhibit about 40 %, about 45 %, or about 50% amino acid identity to the MCCS I kinase domain (MCCS I a amino acids 2083 to 2410 of SEQ ID NO: 31 or MCCS1/3 amino acids 2152 to 2480 of SEQ
ID NO: 33). Polynucleotides contemplated by the invention include genomic DNAs, RNAs, cDNAs and wholly or partially chemically synthesized DNAs. Preferred polynucleotides of the invention comprise the MCCSla DNA sequence set out in SEQ ID NO: 30, the partial MCCS 1 a DNA sequence set out in SEQ ID NO: 3, the full length MCCS 10 DNA sequence set out in SEQ ID NO: 32, and DNA sequences which hybridize to the noncoding strands thereof under stringent conditions or which would hybridize but for the redundancy of the genetic code. Exemplary stringent hybridization conditions are as follows: hybridization at 65 C in 3X SSC, 20mM
NaPO4 pH 6.8 and washing at 65 C in 0.2X SSC. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC
nucleotide base content of the sequences to be hybridized. Formulas standard in the art are appropriate for deternlining exact hybridization conditions. See Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). The MCCSIa DNA of SEQ ID NO: 30 was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, on November 3, 1995 as an insert in plasmid pBSHFB/HT2-27 in E. coli DH5a and was assigned ATCC Accession No. 69951.
The MCCS 10 DNA of SEQ ID NO: 32, was deposited with the ATCC on November 7, 1995 as an insert in plasmid 517 in E. coli DH5a and was assigned ATCC
Accession No. 69950.
The DNA sequence information provided by the present invention makes possible the identification and isolation of DNAs encoding related molecules by well-known techniques such as DNA/DNA hybridization as described above and polymerase chain reaction (PCR) cloning. As one series of examples, knowledge of the sequence of a cDNA encoding MCCS 1 makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences encoding the kinase and expression control regulatory sequences such as promoters, operators and the like.
Similarly, knowledge of a partial cDNA sequence encoding MCCS 1 J3 make isolation of a complete cDNA possible. DNA/DNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of the PIK-related kinase; non-human species enzymes homologous to the PIK-related kinase; and other structurally related proteins sharing one or more of the enzymatic activities, or abilities to interact with members or regulators, of the cell cycle checkpoint pathway in which MCCSI
participates. Polynucleotides of the invention when detectably labelled are also useful in hybridization assays to detect the capacity of cells to synthesize MCCS 1.
The DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout" strategies [see, Capecchi, Science, 244: 1288-1292 (1989)], of rodents that fail to express functional MCCSI
or that express a variant of MCCS 1. Such rodents are useful as models for studying the activities of MCCS 1 and MCCS 1 modulators in vivo. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in the MCCSI locus that underlies a disease state or states.
Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of MCCS 1 by those cells which ordinarily express the same.
The invention also provides autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating polynucleotides of the invention, especially vectors in which the polynucleotides are functionally linked to an endogenous or heterologous expression control DNA sequence and a transcription terminator.
According to another aspect of the invention, host cells, especially unicellular host cells such as procaryotic and eukaryotic cells, are stably transformed or transfected with DNAs of the invention in a manner allowing expression of the PIK-related kinase therein. Host cells of the invention are conspicuously useful in methods for the large scale production of MCCS 1 wherein the cells are grown in a suitable culture medium and the desired enzymes are isolated from the cells or from the medium in which the cells are grown.
MCCS 1 products having part or all of the amino acid sequence set out in SEQ ID NO: 31, SEQ ID NO: 4, or SEQ ID NO: 33 are contemplated. Use of mammalian host cells is expected to provide for such post-translational modifications (e. g. , myristoylation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. The enzyme products of the invention may be full length polypeptides, fragments or variants. Variants comprise MCCSI products wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss of the kinase activity specific to MCCS 1; or (2) with disablement of the kinase activity specific to MCCS1; or (3) with disablement of the ability to interact with members or regulators of the cell cycle checkpoint pathway.
Substrates of MCCS 1 and proteins which interact with MCCS I may be identified by various assays.
Substrates of MCCS 1 may be identified by incorporating test compounds in assays for kinase activity. MCCS1 kinase is resuspended in kinase buffer and incubated either in the presence or absence of the test compound (e.g., casein, histone H1, or appropriate substrate peptide). Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate to the test compound is indicative that the test compound is a substrate of the kinase.
Interacting proteins may be identified by the following assays.
A first assay contemplated by the invention is a two-hybrid screen.
The two-hybrid system was developed in yeast [Chien et al., Proc. Natl. Acad.
Sci.
USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene. Specifically, a polynucleotide encoding a protein that interacts with MCCS 1 is isolated by: ttansfotming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA
Alternatively, the MCCS 1-like PIK-related kinases exhibit about 40 %, about 45 %, or about 50% amino acid identity to the MCCS I kinase domain (MCCS I a amino acids 2083 to 2410 of SEQ ID NO: 31 or MCCS1/3 amino acids 2152 to 2480 of SEQ
ID NO: 33). Polynucleotides contemplated by the invention include genomic DNAs, RNAs, cDNAs and wholly or partially chemically synthesized DNAs. Preferred polynucleotides of the invention comprise the MCCSla DNA sequence set out in SEQ ID NO: 30, the partial MCCS 1 a DNA sequence set out in SEQ ID NO: 3, the full length MCCS 10 DNA sequence set out in SEQ ID NO: 32, and DNA sequences which hybridize to the noncoding strands thereof under stringent conditions or which would hybridize but for the redundancy of the genetic code. Exemplary stringent hybridization conditions are as follows: hybridization at 65 C in 3X SSC, 20mM
NaPO4 pH 6.8 and washing at 65 C in 0.2X SSC. It is understood by those of skill in the art that variation in these conditions occurs based on the length and GC
nucleotide base content of the sequences to be hybridized. Formulas standard in the art are appropriate for deternlining exact hybridization conditions. See Sambrook et al., 9.47-9.51 in Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989). The MCCSIa DNA of SEQ ID NO: 30 was deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Maryland 20852, on November 3, 1995 as an insert in plasmid pBSHFB/HT2-27 in E. coli DH5a and was assigned ATCC Accession No. 69951.
The MCCS 10 DNA of SEQ ID NO: 32, was deposited with the ATCC on November 7, 1995 as an insert in plasmid 517 in E. coli DH5a and was assigned ATCC
Accession No. 69950.
The DNA sequence information provided by the present invention makes possible the identification and isolation of DNAs encoding related molecules by well-known techniques such as DNA/DNA hybridization as described above and polymerase chain reaction (PCR) cloning. As one series of examples, knowledge of the sequence of a cDNA encoding MCCS 1 makes possible the isolation by DNA/DNA hybridization of genomic DNA sequences encoding the kinase and expression control regulatory sequences such as promoters, operators and the like.
Similarly, knowledge of a partial cDNA sequence encoding MCCS 1 J3 make isolation of a complete cDNA possible. DNA/DNA hybridization procedures carried out with DNA sequences of the invention under stringent conditions are likewise expected to allow the isolation of DNAs encoding allelic variants of the PIK-related kinase; non-human species enzymes homologous to the PIK-related kinase; and other structurally related proteins sharing one or more of the enzymatic activities, or abilities to interact with members or regulators, of the cell cycle checkpoint pathway in which MCCSI
participates. Polynucleotides of the invention when detectably labelled are also useful in hybridization assays to detect the capacity of cells to synthesize MCCS 1.
The DNA sequence information provided by the present invention also makes possible the development, by homologous recombination or "knockout" strategies [see, Capecchi, Science, 244: 1288-1292 (1989)], of rodents that fail to express functional MCCSI
or that express a variant of MCCS 1. Such rodents are useful as models for studying the activities of MCCS 1 and MCCS 1 modulators in vivo. Polynucleotides of the invention may also be the basis for diagnostic methods useful for identifying a genetic alteration(s) in the MCCSI locus that underlies a disease state or states.
Also made available by the invention are anti-sense polynucleotides relevant to regulating expression of MCCS 1 by those cells which ordinarily express the same.
The invention also provides autonomously replicating recombinant constructions such as plasmid and viral DNA vectors incorporating polynucleotides of the invention, especially vectors in which the polynucleotides are functionally linked to an endogenous or heterologous expression control DNA sequence and a transcription terminator.
According to another aspect of the invention, host cells, especially unicellular host cells such as procaryotic and eukaryotic cells, are stably transformed or transfected with DNAs of the invention in a manner allowing expression of the PIK-related kinase therein. Host cells of the invention are conspicuously useful in methods for the large scale production of MCCS 1 wherein the cells are grown in a suitable culture medium and the desired enzymes are isolated from the cells or from the medium in which the cells are grown.
MCCS 1 products having part or all of the amino acid sequence set out in SEQ ID NO: 31, SEQ ID NO: 4, or SEQ ID NO: 33 are contemplated. Use of mammalian host cells is expected to provide for such post-translational modifications (e. g. , myristoylation, glycosylation, truncation, lipidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the invention. The enzyme products of the invention may be full length polypeptides, fragments or variants. Variants comprise MCCSI products wherein one or more of the specified (i.e., naturally encoded) amino acids is deleted or replaced or wherein one or more nonspecified amino acids are added: (1) without loss of the kinase activity specific to MCCS 1; or (2) with disablement of the kinase activity specific to MCCS1; or (3) with disablement of the ability to interact with members or regulators of the cell cycle checkpoint pathway.
Substrates of MCCS 1 and proteins which interact with MCCS I may be identified by various assays.
Substrates of MCCS 1 may be identified by incorporating test compounds in assays for kinase activity. MCCS1 kinase is resuspended in kinase buffer and incubated either in the presence or absence of the test compound (e.g., casein, histone H1, or appropriate substrate peptide). Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate to the test compound is indicative that the test compound is a substrate of the kinase.
Interacting proteins may be identified by the following assays.
A first assay contemplated by the invention is a two-hybrid screen.
The two-hybrid system was developed in yeast [Chien et al., Proc. Natl. Acad.
Sci.
USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene. Specifically, a polynucleotide encoding a protein that interacts with MCCS 1 is isolated by: ttansfotming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA
binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and either the DNA
binding domain or the activating domain of the transcription factor;
expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative MCCS 1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion;
detecting binding of an MCCS 1 interacting protein to MCCS 1 in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
Other assays for identifying proteins that interact with MCCS1 may involve immobilizing MCCS 1 or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCS 1.
Another type of assay for identifying MCCS 1 interacting proteins involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the fluorescent agent. Alternatively, the putative interacting protein may be immobilized and MCCS I may be labelled in the assay.
Also comprehended by the present invention are antibody products (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins (such as those identified in the assays above) which are specific for the MCCS 1 kinases of the invention. Binding proteins can be developed using isolated natural or recombinant enzymes. The binding proteins are useful, in turn, for purifying recombinant and naturally occurring enzymes and identifying cells producing such enzymes.
Specifically illistrating monoclonal antibodies of the invention are the monoclonal antibodies produced by hybridoma cell lines 224C and 224F which were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 on November 7, 1996 and assigned ATCC Accession Nos. HB
12233 and HB 12234, respectively. Assays for the detection and quantification of proteins in cells and in fluids may involve a single antibody substance or multiple antibody substances in a "sandwich" assay format. The binding proteins are also nianifestly useful in modulating (i.e.,blocking, inhibiting, or stimulating) enzyme/substrate or enzyme/regulator interactions. Anti-idiotypic antibodies specific for PIK-related kinase binding proteins are also contemplated.
The invention contemplates that mutations in the MCCS 1 gene that result in loss of normal function of the MCCS 1 gene product underlie human disease states in which failure of the G2 cell cycle checkpoint is involved. Gene therapy to restore MCCSI activity would thus be indicated in treating those disease states (for example, testicular cancer). Delivery of a functional MCCS 1 gene to appropriate cells is effected in vivo or ex vivo by use of viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus) or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments). For reviews of gene therapy technology see Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific American: 68-84 (1990); and Miller, Nature, 357: 455-460 (1992). Alternatively, it is contemplated that in other human disease states preventing the expression of or inhibiting the activity of MCCS1 will be useful in treating the disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of MCCS1. Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides) capable of specifically binding to MCCS 1 expression control sequences or MCCS 1 RNA are introduced into cells (e. g. , by a viral vector or colloidal dispersion system such as a liposome). The antisense nucleic acid binds to the MCCS 1 target sequence in the cell and prevents transcription or translation of the target sequence. Phosphothioate and methylphosphate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense WO 97/18323 PCT/US96/19337 _ oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' end.
Moreover, for example, if a particular form of cancer results from a mutation in a gene other than MCCS I such as the p53 gene, an agent which inhibits the transcription or the enzymatic activity of MCCS l and thus the G, cell cycle checkpoint may be used to render cancerous cells more sensitive to chemotherapy or radiation therapy. The therapeutic value of such an agent lies in the fact that current radiation therapy or chemotherapy in most cases does nothing to overcome the ability of the p53 mutant cancerous cell to sense and correct the DNA damage imposed as a result of the treatment. As a result, a cancer cell can simply repair the DNA
damage. Modulating agents of the invention may therefore be chemotherapy and radiation adjuvants or may be directly active as chemotherapeutic drugs themselves.
Agents that modulate MCCS I kinase activity may be identified by incubating a test compound with MCCSI immunopurified from cells naturally expressing the PIK-related kinase, with MCCS 1 obtained from recombinant procaryotic or eukaryotic host cells expressing the enzyme, or with purified MCCS 1, and then determining the effect of the test compound on MCCSI activity. The activity of the PIK-related kinase can be measured by determining the moles of 3zP-phosphate transferred by the kinase from gamma-32P-ATP to either itself (autophosphorylation) or to an exogenous substrate such as a lipid or protein.
The amount of phosphate incorporated into the substrate is measured by scintillation counting or autoradiography. An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS1 kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS 1 kinase. In another aspect, agents that modulate both MCCSI and ATM or modulate one of the enzymes are also contemplated. Agents which modulate MCCS 1 are screened in a kinase assay as described above in which ATM is the phosphorylating enzyme.
binding domain or the activating domain of the transcription factor;
expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative MCCS 1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion;
detecting binding of an MCCS 1 interacting protein to MCCS 1 in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
Other assays for identifying proteins that interact with MCCS1 may involve immobilizing MCCS 1 or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCS 1.
Another type of assay for identifying MCCS 1 interacting proteins involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the fluorescent agent. Alternatively, the putative interacting protein may be immobilized and MCCS I may be labelled in the assay.
Also comprehended by the present invention are antibody products (e.g., monoclonal and polyclonal antibodies, single chain antibodies, chimeric antibodies, CDR-grafted antibodies and the like) and other binding proteins (such as those identified in the assays above) which are specific for the MCCS 1 kinases of the invention. Binding proteins can be developed using isolated natural or recombinant enzymes. The binding proteins are useful, in turn, for purifying recombinant and naturally occurring enzymes and identifying cells producing such enzymes.
Specifically illistrating monoclonal antibodies of the invention are the monoclonal antibodies produced by hybridoma cell lines 224C and 224F which were deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD 20852 on November 7, 1996 and assigned ATCC Accession Nos. HB
12233 and HB 12234, respectively. Assays for the detection and quantification of proteins in cells and in fluids may involve a single antibody substance or multiple antibody substances in a "sandwich" assay format. The binding proteins are also nianifestly useful in modulating (i.e.,blocking, inhibiting, or stimulating) enzyme/substrate or enzyme/regulator interactions. Anti-idiotypic antibodies specific for PIK-related kinase binding proteins are also contemplated.
The invention contemplates that mutations in the MCCS 1 gene that result in loss of normal function of the MCCS 1 gene product underlie human disease states in which failure of the G2 cell cycle checkpoint is involved. Gene therapy to restore MCCSI activity would thus be indicated in treating those disease states (for example, testicular cancer). Delivery of a functional MCCS 1 gene to appropriate cells is effected in vivo or ex vivo by use of viral vectors (e.g., adenovirus, adeno-associated virus, or a retrovirus) or ex vivo by use of physical DNA transfer methods (e.g., liposomes or chemical treatments). For reviews of gene therapy technology see Friedmann, Science, 244: 1275-1281 (1989); Verma, Scientific American: 68-84 (1990); and Miller, Nature, 357: 455-460 (1992). Alternatively, it is contemplated that in other human disease states preventing the expression of or inhibiting the activity of MCCS1 will be useful in treating the disease states. It is contemplated that antisense therapy or gene therapy could be applied to negatively regulate the expression of MCCS1. Antisense nucleic acids (preferably 10 to 20 base pair oligonucleotides) capable of specifically binding to MCCS 1 expression control sequences or MCCS 1 RNA are introduced into cells (e. g. , by a viral vector or colloidal dispersion system such as a liposome). The antisense nucleic acid binds to the MCCS 1 target sequence in the cell and prevents transcription or translation of the target sequence. Phosphothioate and methylphosphate antisense oligonucleotides are specifically contemplated for therapeutic use by the invention. The antisense WO 97/18323 PCT/US96/19337 _ oligonucleotides may be further modified by poly-L-lysine, transferrin polylysine, or cholesterol moieties at their 5' end.
Moreover, for example, if a particular form of cancer results from a mutation in a gene other than MCCS I such as the p53 gene, an agent which inhibits the transcription or the enzymatic activity of MCCS l and thus the G, cell cycle checkpoint may be used to render cancerous cells more sensitive to chemotherapy or radiation therapy. The therapeutic value of such an agent lies in the fact that current radiation therapy or chemotherapy in most cases does nothing to overcome the ability of the p53 mutant cancerous cell to sense and correct the DNA damage imposed as a result of the treatment. As a result, a cancer cell can simply repair the DNA
damage. Modulating agents of the invention may therefore be chemotherapy and radiation adjuvants or may be directly active as chemotherapeutic drugs themselves.
Agents that modulate MCCS I kinase activity may be identified by incubating a test compound with MCCSI immunopurified from cells naturally expressing the PIK-related kinase, with MCCS 1 obtained from recombinant procaryotic or eukaryotic host cells expressing the enzyme, or with purified MCCS 1, and then determining the effect of the test compound on MCCSI activity. The activity of the PIK-related kinase can be measured by determining the moles of 3zP-phosphate transferred by the kinase from gamma-32P-ATP to either itself (autophosphorylation) or to an exogenous substrate such as a lipid or protein.
The amount of phosphate incorporated into the substrate is measured by scintillation counting or autoradiography. An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS1 kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS 1 kinase. In another aspect, agents that modulate both MCCSI and ATM or modulate one of the enzymes are also contemplated. Agents which modulate MCCS 1 are screened in a kinase assay as described above in which ATM is the phosphorylating enzyme.
In a presently preferred assay, a MCCSI-specific antibody linked to agarose beads is incubated with a cell lysate prepared from host cells expressing the kinase. The beads are washed to remove proteins binding nonspecifically to the beads and the beads are then resuspended in kinase buffer. The reaction is initiated by the addition of gamma-32P-ATP and an appropriate exogenous substrate such as lipid or peptide. The activity of the kinase is measured by determining the moles of phosphate transferred either to the kinase itself or the added substrate. In a preferred embodiment the host cells lack endogenous MCCS 1 and/or ATM kinase activity.
The selectivity of a compound that modulates the kinase activity of MCCS 1 can be evaluated by comparing its activity on MCCSI to its activity on other known PIK-related kinases. The combination of the recombinant MCCSI products of the invention with other recombinant PIK-related kinase products in a series of independent assays provides a system for developing selective modulators of MCCS 1.
Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.
For example, an assay for identifying modulators of MCCS 1 kinase activity involves incubating an MCCS 1 kinase preparation in kinase buffer with gamma-32P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCSI kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS I kinase.
Moreover, assays for identifying compounds that modulate interaction of MCCS 1 with other proteins may involve: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS I and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA
sequence encoding part or all of a protein that interacts with MCCS1 and the DNA
binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS 1 and the interacting protein by detecting binding of the interacting protein to MCCS I in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence of the modulating compound. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ
reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
Another type of assay for identifying compounds that modulate the interaction between MCCS 1 and an interacting protein involves immobilizing or a natural MCCS 1 interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCS 1 interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCS 1 interaction with the protein.
Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCS I and an interacting protein involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the flourescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound. Alternatively, the MCCS1 interacting protein may be immobilized and MCCSI may be labelled in the assay.
The present invention further provides a cell-based complementation assay for identifying compounds which modulate the activity of MCCS 1 or ATM.
The assay involves complementation of a phenotypic trait associated with a genetic alteration in the cell. For example, the genetic alteration identified as esrl-1 results in cellular sensitivity to DNA damage in yeast cells [Kato et al., Nuc. Acids.
Res., 22(15): 3104-3112 (1994)]. esrl-1 cells fail to either sense or appropriately response to DNA damage after exposure to DNA damaging agents such as ionizing radiation or clastogenic agents. The phenotypic trait of the genetically altered cell is complemented by transforming and expressing MCCS 1 or ATM in the cell. The transformed cells are exposed to DNA damaging treatment (e.g. ionizing radiation) in the presence and absence of a test compound and sensitivity of the cells to DNA
damage is measured. Agents that affect the cell sensitivity to DNA damaging activity of MCCS I and/or ATM are identified as modulators.
Modulators of MCCS 1 may affect its kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway.
MCCS I modulators may be formulated in compositions comprising pharmaceutically acceptable carriers. Such compositions may additionally include chemotherapeutic agents. Dosage amounts indicated would be sufficient to result in modulation of MCCS 1 activity in vivo. Selective modulators may include, for example, polypeptides or peptides which specifically bind to MCCSI or MCCSI nucleic acid, oligonucleotides which specifically bind to the PIK-related kinase or PIK-related kinase nucleic acid, and/or other non-peptide compounds (e.g., isolated or synthetic organic molecules) which specifically react with MCCSI or MCCSI nucleic acid.
Mutant forms of MCCS 1 which affect the enzymatic activity or cellular localization of wild-type MCCSI are also contemplated by the invention. Presently preferred regions of the PIK-related kinases which are targets for the development of selective modulators include, for example, the following four regions: the MCCSIa amino terminal effector domain (amino acids I to 1081 of SEQ ID NO: 31), the MCCS 10 amino terminal effector domain (amino acids I to 1150 of SEQ ID NO: 33), the MCCSIa rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS1(3 rad3+ domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCS 1 PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS1 j3 PIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).
The selectivity of a compound that modulates the kinase activity of MCCS 1 can be evaluated by comparing its activity on MCCSI to its activity on other known PIK-related kinases. The combination of the recombinant MCCSI products of the invention with other recombinant PIK-related kinase products in a series of independent assays provides a system for developing selective modulators of MCCS 1.
Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.
For example, an assay for identifying modulators of MCCS 1 kinase activity involves incubating an MCCS 1 kinase preparation in kinase buffer with gamma-32P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCSI kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCS I kinase.
Moreover, assays for identifying compounds that modulate interaction of MCCS 1 with other proteins may involve: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS I and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA
sequence encoding part or all of a protein that interacts with MCCS1 and the DNA
binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS 1 and the interacting protein by detecting binding of the interacting protein to MCCS I in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence of the modulating compound. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ
reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
Another type of assay for identifying compounds that modulate the interaction between MCCS 1 and an interacting protein involves immobilizing or a natural MCCS 1 interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCS 1 interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCS 1 interaction with the protein.
Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCS I and an interacting protein involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the flourescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound. Alternatively, the MCCS1 interacting protein may be immobilized and MCCSI may be labelled in the assay.
The present invention further provides a cell-based complementation assay for identifying compounds which modulate the activity of MCCS 1 or ATM.
The assay involves complementation of a phenotypic trait associated with a genetic alteration in the cell. For example, the genetic alteration identified as esrl-1 results in cellular sensitivity to DNA damage in yeast cells [Kato et al., Nuc. Acids.
Res., 22(15): 3104-3112 (1994)]. esrl-1 cells fail to either sense or appropriately response to DNA damage after exposure to DNA damaging agents such as ionizing radiation or clastogenic agents. The phenotypic trait of the genetically altered cell is complemented by transforming and expressing MCCS 1 or ATM in the cell. The transformed cells are exposed to DNA damaging treatment (e.g. ionizing radiation) in the presence and absence of a test compound and sensitivity of the cells to DNA
damage is measured. Agents that affect the cell sensitivity to DNA damaging activity of MCCS I and/or ATM are identified as modulators.
Modulators of MCCS 1 may affect its kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway.
MCCS I modulators may be formulated in compositions comprising pharmaceutically acceptable carriers. Such compositions may additionally include chemotherapeutic agents. Dosage amounts indicated would be sufficient to result in modulation of MCCS 1 activity in vivo. Selective modulators may include, for example, polypeptides or peptides which specifically bind to MCCSI or MCCSI nucleic acid, oligonucleotides which specifically bind to the PIK-related kinase or PIK-related kinase nucleic acid, and/or other non-peptide compounds (e.g., isolated or synthetic organic molecules) which specifically react with MCCSI or MCCSI nucleic acid.
Mutant forms of MCCS 1 which affect the enzymatic activity or cellular localization of wild-type MCCSI are also contemplated by the invention. Presently preferred regions of the PIK-related kinases which are targets for the development of selective modulators include, for example, the following four regions: the MCCSIa amino terminal effector domain (amino acids I to 1081 of SEQ ID NO: 31), the MCCS 10 amino terminal effector domain (amino acids I to 1150 of SEQ ID NO: 33), the MCCSIa rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS1(3 rad3+ domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCS 1 PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS1 j3 PIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).
DETAILED DESCRIPTION
The present invention is illustrated by the following examples.
Example 1 details the isolation of cDNAs encoding MCCS 1 kinases. Example 2 describes mapping of the human MCCS1 gene to human chromosome 3. The recombinant expression of MCCS 1 in E. coli and insect cells is respectively described in Examples 3 and 4. Example 4 also presents assays for measuring MCCS I
kinase activity. Example 5 describes the production of MCCS 1-specific polyclonal and monoclonal antibodies. Example 6 reports the immunoprecipitation of MCCS 1 kinase associated activity from mouse testes. Example 7 examines the expression of mRNA in various human tissues and cancer cell lines. Example 8 describes analyses of MCCS I mRNA and protein expression in mouse testes. Example 9 describes analyses of MCCS1 protein expression in meiotic cells. Assays for substrates and interacting proteins of MCCS ] are described in Example 10. Example 11 describes modulators and assays for modulators of the kinase activity of MCCS 1. Example describes the cell-based complementation assay for identifying modulators of and/or ATM and Example 13 describes the kinase activity of ATM.
Example 1 cDNAs encoding the PIK-related kinase MCCSI were isolated by a series of PCR reactions.
An alignment of the amino acid sequences of S. pombe rad3+ (Hari et al., supra) and S. cerevisiae MEC1 (Kato et al., supra) was the basis for design of seven degenerate oligonucleotides that encoded (or were complementary to) the regions of highest homology/lowest degeneracy between the sequences and contained convenient restriction sites to facilitate cloning of amplification products.
The oligonucleotides were then used in a PCR-based assay to isolate a related human sequence.
Initially, PCR amplifications were performed on cDNA preparations from rat T-cells, human peripheral blood mononuclear cells (PBMC), and S.
cerevisiae genomic DNA. Five oligonucleotide pairs were used (oDHl5a/oDHl6, oDH l5b/oDH 16, oDH 17a/oDH 16, oDH 15a/oDH 17b, and oDH 15b/oDH 17b) for the primary amplifications. The sequences of the oligonucleotide priiners included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions.
oDH15a (SEQ ID NO: 5) 5' GCA GAC GGA TCC GGI WCI GAY GGI AAY HTI TAY 3' oDH15b (SEQ ID NO: 6) 5' GCA GAC GGA TCC GGI WCI GAY GGI AAY 3' oDH 16 (SEQ ID NO: 7) 5' GCA GAC GAA TTC RCA RTY RAA RTC IAC RTG 3' oDH 17a (SEQ ID NO: 8) 5' GCA GAC GGA TCC AAR TTY
CCI CCI RTI YTI TAY SAR TGG TT 3' oDH17b (SEQ ID NO: 9) 5' GCA GAC GAA TCC AAC CAY
TSR TAI ARI AYI GGI GGR AAY TT 3' PCR was performed on reaction mixtures of IX PCR buffer (Perkin Elmer Cetus, Emeryville, California), 2-3 M oDH primers, 1.5mM MgCl2, 200,uM dNTPs, and 0.5 l Amplitaq polymerase. The reaction was performed in a Perkin-Elmer Cetus Thermocycler Model 480 under the following conditions: denaturation at 94 C
for 1 minute, annealing at 64 C for 2 minutes, and elongation at 72 C for 1 minute for 3 cycles. The procedure was then repeated using 60 C annealing temperature for 3 cycles, 56 C annealing for 3 cycles, and finished with denaturation at 94' C
for 1 minute, annealing at 54 C(2 minutes, and elongation at 72 C for 1 minute for 30 cycles. PCR products were separated on 2 or 4% Tris Acetate EDTA (TAE) agarose gels, stained with ethidium bromide, and DNA products were visualized by UV
fluorescence.
The present invention is illustrated by the following examples.
Example 1 details the isolation of cDNAs encoding MCCS 1 kinases. Example 2 describes mapping of the human MCCS1 gene to human chromosome 3. The recombinant expression of MCCS 1 in E. coli and insect cells is respectively described in Examples 3 and 4. Example 4 also presents assays for measuring MCCS I
kinase activity. Example 5 describes the production of MCCS 1-specific polyclonal and monoclonal antibodies. Example 6 reports the immunoprecipitation of MCCS 1 kinase associated activity from mouse testes. Example 7 examines the expression of mRNA in various human tissues and cancer cell lines. Example 8 describes analyses of MCCS I mRNA and protein expression in mouse testes. Example 9 describes analyses of MCCS1 protein expression in meiotic cells. Assays for substrates and interacting proteins of MCCS ] are described in Example 10. Example 11 describes modulators and assays for modulators of the kinase activity of MCCS 1. Example describes the cell-based complementation assay for identifying modulators of and/or ATM and Example 13 describes the kinase activity of ATM.
Example 1 cDNAs encoding the PIK-related kinase MCCSI were isolated by a series of PCR reactions.
An alignment of the amino acid sequences of S. pombe rad3+ (Hari et al., supra) and S. cerevisiae MEC1 (Kato et al., supra) was the basis for design of seven degenerate oligonucleotides that encoded (or were complementary to) the regions of highest homology/lowest degeneracy between the sequences and contained convenient restriction sites to facilitate cloning of amplification products.
The oligonucleotides were then used in a PCR-based assay to isolate a related human sequence.
Initially, PCR amplifications were performed on cDNA preparations from rat T-cells, human peripheral blood mononuclear cells (PBMC), and S.
cerevisiae genomic DNA. Five oligonucleotide pairs were used (oDHl5a/oDHl6, oDH l5b/oDH 16, oDH 17a/oDH 16, oDH 15a/oDH 17b, and oDH 15b/oDH 17b) for the primary amplifications. The sequences of the oligonucleotide priiners included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions.
oDH15a (SEQ ID NO: 5) 5' GCA GAC GGA TCC GGI WCI GAY GGI AAY HTI TAY 3' oDH15b (SEQ ID NO: 6) 5' GCA GAC GGA TCC GGI WCI GAY GGI AAY 3' oDH 16 (SEQ ID NO: 7) 5' GCA GAC GAA TTC RCA RTY RAA RTC IAC RTG 3' oDH 17a (SEQ ID NO: 8) 5' GCA GAC GGA TCC AAR TTY
CCI CCI RTI YTI TAY SAR TGG TT 3' oDH17b (SEQ ID NO: 9) 5' GCA GAC GAA TCC AAC CAY
TSR TAI ARI AYI GGI GGR AAY TT 3' PCR was performed on reaction mixtures of IX PCR buffer (Perkin Elmer Cetus, Emeryville, California), 2-3 M oDH primers, 1.5mM MgCl2, 200,uM dNTPs, and 0.5 l Amplitaq polymerase. The reaction was performed in a Perkin-Elmer Cetus Thermocycler Model 480 under the following conditions: denaturation at 94 C
for 1 minute, annealing at 64 C for 2 minutes, and elongation at 72 C for 1 minute for 3 cycles. The procedure was then repeated using 60 C annealing temperature for 3 cycles, 56 C annealing for 3 cycles, and finished with denaturation at 94' C
for 1 minute, annealing at 54 C(2 minutes, and elongation at 72 C for 1 minute for 30 cycles. PCR products were separated on 2 or 4% Tris Acetate EDTA (TAE) agarose gels, stained with ethidium bromide, and DNA products were visualized by UV
fluorescence.
From the primary amplifications of yeast genomic DNA, rat T-cell cDNA, and human PBMC cDNA, only a single reaction with yeast genomic DNA
(oDH17a/oDH16) gave a visible amplification product, resulting in a product that was the expected size for the region of the S. cerevisiae MECI gene between these primers. Further analysis of the oDH17a/oDH16 amplifications that utilized rat T-cell and PBMC cDNA was therefore performed. To remove oligonucleotides and "primer dimers" that might interfere with subsequent PCR, primary reactions were purified prior to reamplification.
A "nested" PCR strategy was employed, and amplifications were repeated with primer pairs oDH18a/oDHl6 and oDH18b/oDH16 under reaction conditions described above with cycle times of denaturation of 94 C for 1 minute, annealing at 55"C for 1 minute, and elongation at 72"C for 30 seconds for 30 cycles.
The sequences of the oDH18a and oDH18b oligonucleotide primers included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions.
oDH18a (SEQ ID NO: 10) 5' GCA GAC GGA TCC YTI GGI YTI GGI GAY CGI CA 3' oDH 18b (SEQ ID NO: 11) 5' GCA GAC GGA TCC YTI GGI YTI GGI GAY AGR CA 3' An approximately 90 base pair (bp) product (the expected size amplification product for these primers) was seen in the reamplifications of the yeast genomic and human PBMC cDNA primary reactions. No 90 bp product was seen in the reamplification of the primary reaction on rat T-cell cDNA and this reaction was not analyzed further.
In addition to the approximately 90 bp product, several other non-specific bands were also present, though significantly fewer than were observed when the primary reactions were reamplified with oDH17a/oDH16. While the approximately 90 bp product was present in both the oDH18a/oDH16 and oDHl8b/oDH16 reamplifications of the yeast genomic DNA primary reactions, only the oDH18a/oDHl6 reaction yielded the appropriate size fragment during reamplification of the human PMBC cDNA primary reaction. This was presumed to reflect codon usage in the human gene (compare primers oDH 18a and oDH l 8b).
The approximately 90 bp product from the oDHI8a/oDH16 reamplification of the human PMBC cDNA primary reaction was gel purified and subcloned into the pBluescript SKII+ cloning vector (Stratagene, La Jolla, California) and sequenced.
Analysis of the sequence encoded by the 90 bp product indicated that the deduced amino acid sequence was similar to both S. cerevisiae MECI and S.
pombe rad3+, but was not identical to either. To identify a larger region of coding sequence and extend the sequence comparison, a non-degenerate oligonucleotide, oDH23 5' GACGCAGAATTCACCAGTCAAAGAATCAAAGAG 3' (SEQ ID NO:
12), was synthesized for use in additional amplification reactions.
Reamplification of the purified PBMC cDNA primary reaction with oDH17a/oDH23 led to the production of an amplification product of 174 bp. This fragment was then purified, subcloned and sequenced as described above. Computer analysis of the conceptual translation product confirmed its relationship (similar but not identical) to MECl and rad3+. This PCR fragment was then used as a probe to screen a plasmid library containing macrophage cDNA using the following hybridization conditions:
incubation of nitrocellulose filters with radiolabelled probes in 3X SSC, 5X
Denhardt's, 0.1 % sarcosyl, 20mM NaPO4 pH 6.8, 100 ug/ml single stranded salmon sperm DNA, for 18 to 24 hours at 65 C. Washes were done 3 times in 0.2X SSC, 0.1 % SDS at 65 C for 30 minutes (with changes of wash buffer). Four positive clones were isolated, and the nucleotide sequence of each was determined.
Computer analysis of the four sequences demonstrated that they were overlapping clones derived from a locus with homology to the rad3+ gene from S. pombe. Clone 517 (ATCC
69950) contained a 2.8 kbp insert and its DNA and deduced amino acid sequence are set out in SEQ ID NOs: 3 and 4, respectively. The clone contained an open reading frame encoding an amino tetminal truncated protein product of 870 amino acids which were 39% identical to the COOH-terminus of rad3+. The protein product of the cDNA insert was named MCCS1O.
The sequence of clone 517 was used to design the oligonucleotides, mo3 5'-CTACAGAGCCAAGGAG-3' (SEQ ID NO: 13) and mo6 5'-TCGAGCTATGCTACTAGTGGGC-3' (SEQ ID NO: 14), which were used to generate a probe using a gel purified EcoRI fragment derived from clone 517 as a template. The PCR conditions were as follows: 50 ng DNA fragment, IX PCR
buffer (Perkin-Elmer Cetus), 1.5mM MgC12, 20014M dATP, dGTP, and TTP, lAM
dCTP, 50 Ci a32P-dCTP, l Ong/ml each oligonucleotide, I U AmpliTaq (Perkin-Elmer Cetus). The reaction was performed in a Perkin-Elmer Cetus Thermocycler Model 480 for an initial denaturing cycle at 94 C for 4 minutes followed by 20 cycles of 94 C for 15 seconds, 60 C for 15 seconds, 72 C for 30 seconds.
Unincorporated nucleotides were removed using a Stratagene Nuc-trap Push Column.
Since Northern blot analyses showed that the expression of the niRNA
corresponding to clone 517 was highest in testis, one million clones from a human testis cDNA library (Stratagene #939202) were screened with the PCR-generated probe and eleven clones were obtained. The two longest clones, HT2 and HT9, were chosen for analysis. HT2 contained a 4.7 Kb insert (corresponding to nucleotide 2974 of SEQ ID NO: 30 and extending further downstream than SEQ ID NO: 1) and HT9 contained a 5485 bp insert (corresponding to nucleotides 2152 to 7624 of SEQ
ID NO: 30). Nucleotide sequence analysis revealed that in the region common to both cDNA clones there was a single base pair insertion of a T at nucieotide 3233 in HT9. This nucleotide insertion causes the predicted amino acid reading frame to shift and then terminate and is believed to be an error introduced by reverse transcriptase in clone HT9.
In order to isolate a clone containing an additional 2.5 Kb, one million clones from each of three additional cDNA libraries were screened: a human fetal brain cDNA library (Stratagene #93206), a human heart cDNA library (Stratagene #
936207), and a human aorta cDNA library (Clontech Laboratories #HL1136a, Palo Alto, California). The sequence of the most 5' region of HT9 was utilized to design and synthesize two oligonucleotides, oHT9-1 5'-CCTAGTCCAGTAA.AACTTGC-3' (SEQ ID NO: 15) and oHT9-4 5'-TTTGCGGCCCTTCCAATATC-3' (SEQ ID NO:
16) which were used to generate a 317 bp PCR probe under conditions described for generating the probe above. While no positive clones were isolated from the heart or aorta cDNA libraries, two positive clones were obtained from the fetal brain library. One of these clones, HFB2, included a cDNA 4.5 Kb insert which included approximately 2300 bp of additional sequence. The HFB2 insert corresponds to nucleotides 1 to 3194 of SEQ ID NO: 30.
A composite cDNA encoding MCCS 1 a was constructed from clones HFB2, HT9 and HT2. The three clones were joined together by digesting HFB2 with the restriction enzymes KpnI and SaII to generate a fragment to comprise the 5' end of the composite clone, digesting HT9 with Kpnl and Noti to generate a fragment to comprise the 3' end of the composite clone, and then ligating isolated fragments to the vector pBS SK- (Stratagene) that had been digested with SaII and NotI. The region of the HT9 fragment containing the one nucleotide insertion was replaced with an EcoRV fragment containing nucleotides 3174 to 5282 of clone HT2. The final plasmid containing a 7621 bp insert was named pBSHFB2HT2-27 (ATCC 69951).
The DNA and deduced amino acid sequence of the insert are presented in SEQ ID
NOs: 1 and 2, respectively. The coding domain of the cDNA initiates with an ATG
at nucleotide 333 and ends with a termination codon at nucleotide 7560 predicting a coding sequence of 2409 amino acids and protein of 265 kD. The protein product of the cDNA insert was named MCCSIa. Subsequent sequence analysis of the insert in plasmid pBSHFB2HT2-27 (ATCC 69951) revealed sequencing errors in SEQ ID
NO: 1. Corrected DNA and deduced amino acid sequences of the insert are set out in SEQ ID NOs: 23 and 24, respectively. Even further sequence anaysis of insert in plasmid pBSHFB2HT2-27 revealed sequencing error in SEQ ID NO: 23. At nucleotide position 6317 (SEQ ID NO: 23) a "G" was erroneously included and between positions 6338 and 6339 the sequence was missing an "A". The corrected sequences of MCCS I a are provided in SEQ ID NOs: 30 and 31.
Comparison of the predicted amino acid sequence of MCCS 1 a with the partial amino acid sequence of MCCS1(3 predicted from clone 517 revealed the presence of a seventy amino acid deletion in the MCCS 1 a product. The MCCS
1(3 clone 517 amino acid sequence corresponds to MCCSIa amino acids 1611 to 2410 of SEQ ID NO: 31. The seventy amino acid deletion in MCCS 1 a(1. e. , where the seventy amino acids would be inserted to generate a product identical to MCCS1O) occurs between amino acids 2065 and 2066 in SEQ ID NO: 31, seventeen amino acids upstream from the kinase domain. Since both clones maintain an open reading frame, cDNA clone pBSHFB2HT2-27 was apparently generated from alternatively spliced mRNA. The carboxyl terminal domains containing the kinase domains are identical in MCCS 1 a(amino acids 2083 to 2410 of SEQ ID NO: 31) and MCCS 1 a clone (amino acids 543 to 870 of SEQ ID NO: 4).
A composite clone containing the complete coding sequence of MCCS 10 (with the seventy amino acid insert) is presented in SEQ ID NO: 32.
The amino acid sequence deduced from the clone is presented in SEQ ID NO: 33. This clone is constructed by replacing the sequence between the BSTXI site, which cleaves after nucleotide 3229, and the NotI site in the polylinker sequence at the 3' end of pBSHFB2HT2-27 (SEQ ID NO: 1) with the sequence contained in HT2 between the BstXl site and the Notl site at the 3' end of HT2. Thus this clone contains sequences that are identical to MCCS 1 a nucleotides 1 to 5159 of SEQ ID NO: 1(encoding amino acids 1 to 1609 of SEQ ID NO: 2) linked to sequences that are identical to clone 517 nucleotides 1 to 2610 of SEQ ID NO: 3 (encoding amino acids 1 to 870 of SEQ ID NO: 4). As noted above, subsequent sequence analysis revealed errors in nucleotides 1 to 5159 of SEQ ID NO: 1. Corrected MCCS 10 DNA and deduced amino acid sequences that include the same corrections that appear in MCCS 1 a SEQ
ID NOs: 23 and 24 are set out in SEQ ID NOs: 25 and 26. The SEQ ID NO: 25 clone represents a cDNA encoding a full length MCCS 1/3 kinase. Further sequences for MCCS10 including corrections of errors identified in resequencing the MCCS1a clone are presented in SEQ ID NOs: 32 and 33.
The MCCS 1 products can be divided into three regions based on sini ilarity to other PIK-related kinases: an amino terminal domain (MCCSIa amino acids 1 to 1081 of SEQ ID NO: 31 and MCCSIO amino acids I to 1150 of SEQ ID
NO: 33), a region with similarity to rad3+ (MCCSIa amino acids 1082 to 2082 of SEQ ID NO: 31 and MCSS 1(3 amino acids 1151 to 2151 of SEQ ID NO: 33) and a PIK domain (MCCSIa amino acids 2083 to 2410 of SEQ ID NO: 31 and MCCS1/3 amino acids 2152 to 2480 of SEQ ID NO: 33) including a kinase domain. The amino terminal region and rad3+ region are regulatory domains that modulate the kinase activity of the enzyme and are involved in interactions with associated proteins.
Results of comparisons of the nucleotide and amino acid sequence of MCCS 1 a and MCCS 1 Q to the sequences of other PIK-related and non-PIK-related kinases are shown in Table 1. Specifically, the 3' end of MCCS 1 a(nucleotides to 7562 of SEQ ID NO: 30 encoding the kinase domain), the 3' end of MCCS1(3 (nucleotides 1627 to 2379 of SEQ ID NO: 32 encoding the kinase domain), the rad3+ domain of MCCS1 (nucleotides 3576 to 6578 of SEQ ID NO: 30), and the rad3+ domain of MCCS1(3 (clone 517 nucleotides 1 to 1626 of SEQ ID NO: 3) were compared to the analogous region in human ATM [Savitsky et al., supra], human DNA-PK [Huntley et al., Cell, 82: 849-856 (1995)], human FRAP [Brown et al., supra], human p110 [Hu et al., Mol. Cell. Biol., 13(12): 7677-7688 (1993)], S. cerevisiae MEC1 [Weinert et al., Genes Dev., 8(6): 652-665 (1994), S. pombe rad3+ [Seaton et al., supra and Hari et al., Cell, 82: 815-821 (1995)] and an cAMP-dependent protein kinase (PKA) [Beebe et al., Mol. Endocrinol., 4(3): 465-475 (1990)]. Percent identity of nucleotides is shown in the top line, percent identity of amino acids is shown in the middle line, and percent similarity of amino acids (i. e. , including identical amino acids and conservative variations in amino acids) is shown in the bottom line for each kinase in Table 1. Conservative variation as used herein denotes biologically similar residues. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like. In the Table, "ND" indicates a value was not determined either because the nucleotide sequence encoding the kinase (i. e. , rad3 +) was not publically available or because the kinase (i. e. , FRAP, p 110,Q, or PKA) lacks the particular domain being compared.
(oDH17a/oDH16) gave a visible amplification product, resulting in a product that was the expected size for the region of the S. cerevisiae MECI gene between these primers. Further analysis of the oDH17a/oDH16 amplifications that utilized rat T-cell and PBMC cDNA was therefore performed. To remove oligonucleotides and "primer dimers" that might interfere with subsequent PCR, primary reactions were purified prior to reamplification.
A "nested" PCR strategy was employed, and amplifications were repeated with primer pairs oDH18a/oDHl6 and oDH18b/oDH16 under reaction conditions described above with cycle times of denaturation of 94 C for 1 minute, annealing at 55"C for 1 minute, and elongation at 72"C for 30 seconds for 30 cycles.
The sequences of the oDH18a and oDH18b oligonucleotide primers included inosines and are set out below in IUPAC nomenclature for degenerate nucleotide positions.
oDH18a (SEQ ID NO: 10) 5' GCA GAC GGA TCC YTI GGI YTI GGI GAY CGI CA 3' oDH 18b (SEQ ID NO: 11) 5' GCA GAC GGA TCC YTI GGI YTI GGI GAY AGR CA 3' An approximately 90 base pair (bp) product (the expected size amplification product for these primers) was seen in the reamplifications of the yeast genomic and human PBMC cDNA primary reactions. No 90 bp product was seen in the reamplification of the primary reaction on rat T-cell cDNA and this reaction was not analyzed further.
In addition to the approximately 90 bp product, several other non-specific bands were also present, though significantly fewer than were observed when the primary reactions were reamplified with oDH17a/oDH16. While the approximately 90 bp product was present in both the oDH18a/oDH16 and oDHl8b/oDH16 reamplifications of the yeast genomic DNA primary reactions, only the oDH18a/oDHl6 reaction yielded the appropriate size fragment during reamplification of the human PMBC cDNA primary reaction. This was presumed to reflect codon usage in the human gene (compare primers oDH 18a and oDH l 8b).
The approximately 90 bp product from the oDHI8a/oDH16 reamplification of the human PMBC cDNA primary reaction was gel purified and subcloned into the pBluescript SKII+ cloning vector (Stratagene, La Jolla, California) and sequenced.
Analysis of the sequence encoded by the 90 bp product indicated that the deduced amino acid sequence was similar to both S. cerevisiae MECI and S.
pombe rad3+, but was not identical to either. To identify a larger region of coding sequence and extend the sequence comparison, a non-degenerate oligonucleotide, oDH23 5' GACGCAGAATTCACCAGTCAAAGAATCAAAGAG 3' (SEQ ID NO:
12), was synthesized for use in additional amplification reactions.
Reamplification of the purified PBMC cDNA primary reaction with oDH17a/oDH23 led to the production of an amplification product of 174 bp. This fragment was then purified, subcloned and sequenced as described above. Computer analysis of the conceptual translation product confirmed its relationship (similar but not identical) to MECl and rad3+. This PCR fragment was then used as a probe to screen a plasmid library containing macrophage cDNA using the following hybridization conditions:
incubation of nitrocellulose filters with radiolabelled probes in 3X SSC, 5X
Denhardt's, 0.1 % sarcosyl, 20mM NaPO4 pH 6.8, 100 ug/ml single stranded salmon sperm DNA, for 18 to 24 hours at 65 C. Washes were done 3 times in 0.2X SSC, 0.1 % SDS at 65 C for 30 minutes (with changes of wash buffer). Four positive clones were isolated, and the nucleotide sequence of each was determined.
Computer analysis of the four sequences demonstrated that they were overlapping clones derived from a locus with homology to the rad3+ gene from S. pombe. Clone 517 (ATCC
69950) contained a 2.8 kbp insert and its DNA and deduced amino acid sequence are set out in SEQ ID NOs: 3 and 4, respectively. The clone contained an open reading frame encoding an amino tetminal truncated protein product of 870 amino acids which were 39% identical to the COOH-terminus of rad3+. The protein product of the cDNA insert was named MCCS1O.
The sequence of clone 517 was used to design the oligonucleotides, mo3 5'-CTACAGAGCCAAGGAG-3' (SEQ ID NO: 13) and mo6 5'-TCGAGCTATGCTACTAGTGGGC-3' (SEQ ID NO: 14), which were used to generate a probe using a gel purified EcoRI fragment derived from clone 517 as a template. The PCR conditions were as follows: 50 ng DNA fragment, IX PCR
buffer (Perkin-Elmer Cetus), 1.5mM MgC12, 20014M dATP, dGTP, and TTP, lAM
dCTP, 50 Ci a32P-dCTP, l Ong/ml each oligonucleotide, I U AmpliTaq (Perkin-Elmer Cetus). The reaction was performed in a Perkin-Elmer Cetus Thermocycler Model 480 for an initial denaturing cycle at 94 C for 4 minutes followed by 20 cycles of 94 C for 15 seconds, 60 C for 15 seconds, 72 C for 30 seconds.
Unincorporated nucleotides were removed using a Stratagene Nuc-trap Push Column.
Since Northern blot analyses showed that the expression of the niRNA
corresponding to clone 517 was highest in testis, one million clones from a human testis cDNA library (Stratagene #939202) were screened with the PCR-generated probe and eleven clones were obtained. The two longest clones, HT2 and HT9, were chosen for analysis. HT2 contained a 4.7 Kb insert (corresponding to nucleotide 2974 of SEQ ID NO: 30 and extending further downstream than SEQ ID NO: 1) and HT9 contained a 5485 bp insert (corresponding to nucleotides 2152 to 7624 of SEQ
ID NO: 30). Nucleotide sequence analysis revealed that in the region common to both cDNA clones there was a single base pair insertion of a T at nucieotide 3233 in HT9. This nucleotide insertion causes the predicted amino acid reading frame to shift and then terminate and is believed to be an error introduced by reverse transcriptase in clone HT9.
In order to isolate a clone containing an additional 2.5 Kb, one million clones from each of three additional cDNA libraries were screened: a human fetal brain cDNA library (Stratagene #93206), a human heart cDNA library (Stratagene #
936207), and a human aorta cDNA library (Clontech Laboratories #HL1136a, Palo Alto, California). The sequence of the most 5' region of HT9 was utilized to design and synthesize two oligonucleotides, oHT9-1 5'-CCTAGTCCAGTAA.AACTTGC-3' (SEQ ID NO: 15) and oHT9-4 5'-TTTGCGGCCCTTCCAATATC-3' (SEQ ID NO:
16) which were used to generate a 317 bp PCR probe under conditions described for generating the probe above. While no positive clones were isolated from the heart or aorta cDNA libraries, two positive clones were obtained from the fetal brain library. One of these clones, HFB2, included a cDNA 4.5 Kb insert which included approximately 2300 bp of additional sequence. The HFB2 insert corresponds to nucleotides 1 to 3194 of SEQ ID NO: 30.
A composite cDNA encoding MCCS 1 a was constructed from clones HFB2, HT9 and HT2. The three clones were joined together by digesting HFB2 with the restriction enzymes KpnI and SaII to generate a fragment to comprise the 5' end of the composite clone, digesting HT9 with Kpnl and Noti to generate a fragment to comprise the 3' end of the composite clone, and then ligating isolated fragments to the vector pBS SK- (Stratagene) that had been digested with SaII and NotI. The region of the HT9 fragment containing the one nucleotide insertion was replaced with an EcoRV fragment containing nucleotides 3174 to 5282 of clone HT2. The final plasmid containing a 7621 bp insert was named pBSHFB2HT2-27 (ATCC 69951).
The DNA and deduced amino acid sequence of the insert are presented in SEQ ID
NOs: 1 and 2, respectively. The coding domain of the cDNA initiates with an ATG
at nucleotide 333 and ends with a termination codon at nucleotide 7560 predicting a coding sequence of 2409 amino acids and protein of 265 kD. The protein product of the cDNA insert was named MCCSIa. Subsequent sequence analysis of the insert in plasmid pBSHFB2HT2-27 (ATCC 69951) revealed sequencing errors in SEQ ID
NO: 1. Corrected DNA and deduced amino acid sequences of the insert are set out in SEQ ID NOs: 23 and 24, respectively. Even further sequence anaysis of insert in plasmid pBSHFB2HT2-27 revealed sequencing error in SEQ ID NO: 23. At nucleotide position 6317 (SEQ ID NO: 23) a "G" was erroneously included and between positions 6338 and 6339 the sequence was missing an "A". The corrected sequences of MCCS I a are provided in SEQ ID NOs: 30 and 31.
Comparison of the predicted amino acid sequence of MCCS 1 a with the partial amino acid sequence of MCCS1(3 predicted from clone 517 revealed the presence of a seventy amino acid deletion in the MCCS 1 a product. The MCCS
1(3 clone 517 amino acid sequence corresponds to MCCSIa amino acids 1611 to 2410 of SEQ ID NO: 31. The seventy amino acid deletion in MCCS 1 a(1. e. , where the seventy amino acids would be inserted to generate a product identical to MCCS1O) occurs between amino acids 2065 and 2066 in SEQ ID NO: 31, seventeen amino acids upstream from the kinase domain. Since both clones maintain an open reading frame, cDNA clone pBSHFB2HT2-27 was apparently generated from alternatively spliced mRNA. The carboxyl terminal domains containing the kinase domains are identical in MCCS 1 a(amino acids 2083 to 2410 of SEQ ID NO: 31) and MCCS 1 a clone (amino acids 543 to 870 of SEQ ID NO: 4).
A composite clone containing the complete coding sequence of MCCS 10 (with the seventy amino acid insert) is presented in SEQ ID NO: 32.
The amino acid sequence deduced from the clone is presented in SEQ ID NO: 33. This clone is constructed by replacing the sequence between the BSTXI site, which cleaves after nucleotide 3229, and the NotI site in the polylinker sequence at the 3' end of pBSHFB2HT2-27 (SEQ ID NO: 1) with the sequence contained in HT2 between the BstXl site and the Notl site at the 3' end of HT2. Thus this clone contains sequences that are identical to MCCS 1 a nucleotides 1 to 5159 of SEQ ID NO: 1(encoding amino acids 1 to 1609 of SEQ ID NO: 2) linked to sequences that are identical to clone 517 nucleotides 1 to 2610 of SEQ ID NO: 3 (encoding amino acids 1 to 870 of SEQ ID NO: 4). As noted above, subsequent sequence analysis revealed errors in nucleotides 1 to 5159 of SEQ ID NO: 1. Corrected MCCS 10 DNA and deduced amino acid sequences that include the same corrections that appear in MCCS 1 a SEQ
ID NOs: 23 and 24 are set out in SEQ ID NOs: 25 and 26. The SEQ ID NO: 25 clone represents a cDNA encoding a full length MCCS 1/3 kinase. Further sequences for MCCS10 including corrections of errors identified in resequencing the MCCS1a clone are presented in SEQ ID NOs: 32 and 33.
The MCCS 1 products can be divided into three regions based on sini ilarity to other PIK-related kinases: an amino terminal domain (MCCSIa amino acids 1 to 1081 of SEQ ID NO: 31 and MCCSIO amino acids I to 1150 of SEQ ID
NO: 33), a region with similarity to rad3+ (MCCSIa amino acids 1082 to 2082 of SEQ ID NO: 31 and MCSS 1(3 amino acids 1151 to 2151 of SEQ ID NO: 33) and a PIK domain (MCCSIa amino acids 2083 to 2410 of SEQ ID NO: 31 and MCCS1/3 amino acids 2152 to 2480 of SEQ ID NO: 33) including a kinase domain. The amino terminal region and rad3+ region are regulatory domains that modulate the kinase activity of the enzyme and are involved in interactions with associated proteins.
Results of comparisons of the nucleotide and amino acid sequence of MCCS 1 a and MCCS 1 Q to the sequences of other PIK-related and non-PIK-related kinases are shown in Table 1. Specifically, the 3' end of MCCS 1 a(nucleotides to 7562 of SEQ ID NO: 30 encoding the kinase domain), the 3' end of MCCS1(3 (nucleotides 1627 to 2379 of SEQ ID NO: 32 encoding the kinase domain), the rad3+ domain of MCCS1 (nucleotides 3576 to 6578 of SEQ ID NO: 30), and the rad3+ domain of MCCS1(3 (clone 517 nucleotides 1 to 1626 of SEQ ID NO: 3) were compared to the analogous region in human ATM [Savitsky et al., supra], human DNA-PK [Huntley et al., Cell, 82: 849-856 (1995)], human FRAP [Brown et al., supra], human p110 [Hu et al., Mol. Cell. Biol., 13(12): 7677-7688 (1993)], S. cerevisiae MEC1 [Weinert et al., Genes Dev., 8(6): 652-665 (1994), S. pombe rad3+ [Seaton et al., supra and Hari et al., Cell, 82: 815-821 (1995)] and an cAMP-dependent protein kinase (PKA) [Beebe et al., Mol. Endocrinol., 4(3): 465-475 (1990)]. Percent identity of nucleotides is shown in the top line, percent identity of amino acids is shown in the middle line, and percent similarity of amino acids (i. e. , including identical amino acids and conservative variations in amino acids) is shown in the bottom line for each kinase in Table 1. Conservative variation as used herein denotes biologically similar residues. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, or glutamine for asparagine, and the like. In the Table, "ND" indicates a value was not determined either because the nucleotide sequence encoding the kinase (i. e. , rad3 +) was not publically available or because the kinase (i. e. , FRAP, p 110,Q, or PKA) lacks the particular domain being compared.
Table I
Protein Kinase MCCSIa/MCCS1,6 MCCSIa MCCS1o Kinase rar13+ rad3+
Domain Domain Domain S. pombe rad3 + ND ND ND
S. cerevisiae 51 42 44 Human ATM 50 41 41 Human DNA-PK 43 39 43 Human FRAP 45 ND ND
Human p110Q 45 ND ND
Human PKA 39 ND ND
Protein Kinase MCCSIa/MCCS1,6 MCCSIa MCCS1o Kinase rar13+ rad3+
Domain Domain Domain S. pombe rad3 + ND ND ND
S. cerevisiae 51 42 44 Human ATM 50 41 41 Human DNA-PK 43 39 43 Human FRAP 45 ND ND
Human p110Q 45 ND ND
Human PKA 39 ND ND
Example 2 The MCCSI gene was mapped to chromosome 3 by a PCR-based assay. Human/rodent somatic cell hybrids containing various human chromosome panels available from the NIGMS Human Genetic Mutant Cell Repository [Drwinga et al., Genomics, 16: 311-314 (1993)] were used as templates.
Two oligonucleotide primers oDH23 (SEQ ID NO: 12) and oDH26 5' TGG'ITTCTGAGAACATTCCCTGA 3' (SEQ ID NO: 19) based on the MCCS 1 a cDNA sequence were utilized to amplify a portion of the gene. The primers generate 237 bp PCR products. PCR conditions consisted of 50 ng genomic DNA, 0.5 g of each primer, 200 M dNTPs, 1.5mM MgC12, 1X PCR buffer (Perkin Elmer-Cetus), and 1 unit of Amplitaq polymerase (Perkin-Elmer Cetus) in a 25 pl reaction volume.
The samples were denatured for 4 minutes and then cycled 35 times with denaturing, annealing, and extension times of 45 seconds, 30 seconds, and 45 seconds, respectively, in a Model 480 Cetus Thecmocycler. Five Fcl of the resulting PCR
product was electrophoresed on a 3% agarose gel and stained with ethidium bromide.
DNA corresponding to the human/rodent chromosome 3 hybrid yielded a positive amplification product.
In a second set of amplification reactions, the same oligonucleotide primers were used to sublocalize the MCCS 1 gene to a specific region on chromosome 3. The templates for these amplifications consisted of DNA samples from patients with chromosome 3 truncations [Leach et al., Genomics, 24: 549-(1994)]. Amplifications were performed as described in the foregoing paragraph.
The pattern of positive amplification products narrowed the localization to the interval between q21 and q25.1.
Example 3 Polynucleotides encoding carboxyl terminal portions of the PIK-related kinase MCCS 1/3 were expressed by recombinant techniques in E. coli.
Two E. coli expression plasmids were constructed that expressed either the COOH-terminal 423 or 571 amino acid residues of the kinase in the Pinpoint fusion protein expression/purification system (Promega, Madison, Wisconsin).
Briefly, DNA sequences encoding the COOH-terminal portion of the kinase (nucleotides 1339 to 2630 or nucleotides 898 to 2630 of SEQ ID NO: 3) were fused in frame to the COOH-terminus of a 13 kD peptide derived from the transcarboxylase complex from propionibacterium shermanii. This region undergoes biotination in E.
coli, and thus provides a means for monitoring expression and purification of the fusion proteins. Expression was driven from the tac promoter in pinpoint W.
Fusion protein expression was induced with 0.1mM IPTG and confirmed using streptavidin alkaline phosphatase in a pseudo-Western format as described by the manufacturer.
Example 4 Recombinant versions of MCCS I may also expressed in yeast or in SF9 insect cells using a baculovirus expression system. The FRAP kinase has been expressed, purified and is enzymaticaliy active after expression in the baculovirus system [Brown et al., supra].
The coding region of MCCSI is fused at the amino terminus to a heterologous peptide sequence, such as the FLAG tag MDYKDDDDK (SEQ ID NO:
20) or a six-histidine tag, and reconstructed into the appropriate vectors.
Once expressed in insect cells, a monoclonal antibody that recognizes the FLAG tag (Eastman Kodak, Rochester, New York) is used to purify large quantities of the FLAG-PIK-related kinase fusion protein. Infected insect cells are incubated for 48 hours and lysed in lysis buffer (25mM 2-glycerolphosphate, 50mM sodium phosphate pH 7.2, 0.5% Triton-X 100, 2mM EDTA, 2mM EGTA, 25 mM sodium fluoride, 100 M sodium vanadate, 1mM PMSF, l g/ml leupeptin, 1 g/ml pepstatin, 1mM
benzamidine, and 2mM DTT). Expressed FLAG fusion proteins are purified over a column containing anti-FLAG antibody M2 affinity resin (Eastman Kodak). The column is washed with 20 column volumes of lysis buffer, then 5 column volumes of 0.5M lithium chloride, 50mM Tris pH 7.6, 1 mM DTT, and then eluted either with 0.1M glycine pH 3.0 followed by immediate neutralization or by competitive elution with the FLAG peptide. For six-histidine tagged proteins, Ni-NTA agarose (Qiagen) is used for protein purification.
Two oligonucleotide primers oDH23 (SEQ ID NO: 12) and oDH26 5' TGG'ITTCTGAGAACATTCCCTGA 3' (SEQ ID NO: 19) based on the MCCS 1 a cDNA sequence were utilized to amplify a portion of the gene. The primers generate 237 bp PCR products. PCR conditions consisted of 50 ng genomic DNA, 0.5 g of each primer, 200 M dNTPs, 1.5mM MgC12, 1X PCR buffer (Perkin Elmer-Cetus), and 1 unit of Amplitaq polymerase (Perkin-Elmer Cetus) in a 25 pl reaction volume.
The samples were denatured for 4 minutes and then cycled 35 times with denaturing, annealing, and extension times of 45 seconds, 30 seconds, and 45 seconds, respectively, in a Model 480 Cetus Thecmocycler. Five Fcl of the resulting PCR
product was electrophoresed on a 3% agarose gel and stained with ethidium bromide.
DNA corresponding to the human/rodent chromosome 3 hybrid yielded a positive amplification product.
In a second set of amplification reactions, the same oligonucleotide primers were used to sublocalize the MCCS 1 gene to a specific region on chromosome 3. The templates for these amplifications consisted of DNA samples from patients with chromosome 3 truncations [Leach et al., Genomics, 24: 549-(1994)]. Amplifications were performed as described in the foregoing paragraph.
The pattern of positive amplification products narrowed the localization to the interval between q21 and q25.1.
Example 3 Polynucleotides encoding carboxyl terminal portions of the PIK-related kinase MCCS 1/3 were expressed by recombinant techniques in E. coli.
Two E. coli expression plasmids were constructed that expressed either the COOH-terminal 423 or 571 amino acid residues of the kinase in the Pinpoint fusion protein expression/purification system (Promega, Madison, Wisconsin).
Briefly, DNA sequences encoding the COOH-terminal portion of the kinase (nucleotides 1339 to 2630 or nucleotides 898 to 2630 of SEQ ID NO: 3) were fused in frame to the COOH-terminus of a 13 kD peptide derived from the transcarboxylase complex from propionibacterium shermanii. This region undergoes biotination in E.
coli, and thus provides a means for monitoring expression and purification of the fusion proteins. Expression was driven from the tac promoter in pinpoint W.
Fusion protein expression was induced with 0.1mM IPTG and confirmed using streptavidin alkaline phosphatase in a pseudo-Western format as described by the manufacturer.
Example 4 Recombinant versions of MCCS I may also expressed in yeast or in SF9 insect cells using a baculovirus expression system. The FRAP kinase has been expressed, purified and is enzymaticaliy active after expression in the baculovirus system [Brown et al., supra].
The coding region of MCCSI is fused at the amino terminus to a heterologous peptide sequence, such as the FLAG tag MDYKDDDDK (SEQ ID NO:
20) or a six-histidine tag, and reconstructed into the appropriate vectors.
Once expressed in insect cells, a monoclonal antibody that recognizes the FLAG tag (Eastman Kodak, Rochester, New York) is used to purify large quantities of the FLAG-PIK-related kinase fusion protein. Infected insect cells are incubated for 48 hours and lysed in lysis buffer (25mM 2-glycerolphosphate, 50mM sodium phosphate pH 7.2, 0.5% Triton-X 100, 2mM EDTA, 2mM EGTA, 25 mM sodium fluoride, 100 M sodium vanadate, 1mM PMSF, l g/ml leupeptin, 1 g/ml pepstatin, 1mM
benzamidine, and 2mM DTT). Expressed FLAG fusion proteins are purified over a column containing anti-FLAG antibody M2 affinity resin (Eastman Kodak). The column is washed with 20 column volumes of lysis buffer, then 5 column volumes of 0.5M lithium chloride, 50mM Tris pH 7.6, 1 mM DTT, and then eluted either with 0.1M glycine pH 3.0 followed by immediate neutralization or by competitive elution with the FLAG peptide. For six-histidine tagged proteins, Ni-NTA agarose (Qiagen) is used for protein purification.
Shortly after the filing of parent application U.S.S.N. 08/558,666, a gene identified as ATR was described by Antony M. Carr and co-workers (personal communications). ATR appears to encode the same or a closely related protein to MCCS I based on a comparison of amino acid sequences between ATR and MCCS 1.
The DNA and deduced amino acid sequences of ATR are presented in SEQ ID NOs:
The DNA and deduced amino acid sequences of ATR are presented in SEQ ID NOs:
28 and 29, respectively. The sequence differences between ATR and MCCS1(.3 are as follows. ATR includes an additional 98 amino acid residues at the N-terminus.
At nucleotide position 1284 (SEQ ID NO: 32) there is a conservative base change from "A" in MCCS1/3 to "T" in ATR and at nucleotide position 4176, there is an additional conservative base change from "C" in MCCS1/3 to "T" in ATR.
The FLAG tag was fused at the amino-terminus of a truncated ATR
molecule which lacked the first sixty-six ATR amino acids. The FLAG tag was added by PCR as follows. The oligos FLAG-ATR
(5'-CGGGATCCGCCATGGACTACAAGGACGATGACAAGATGTTGCTTGA17TC-3').
And HFB24 (5'CTTAAGCCGCATGAGCACACCGTC-3') were used in the following PCR reaction: 100ng of pcDNAATR (obtained from Antony M. Carr) as template; IX PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCIZ, 200 M each of dATP, dGTP, dCTP, and TTP, 10 ng/ l of each primer; lU AmpliTaq (Perkin-Elmer Cetus). The reaction was denatured at 94 C for 4 minutes followed by 30 cycles of 94 C for 30 seconds, 60 C for 30 seconds and 72 C for 30 seconds.
The resulting approximately 800 bp PCR product was digested with BamHI and Nhel and was ligated to the 10kb fragment of the mammalian ATR expression plasmid, pcDNAATR digested with BamHI and BstXI along with the remainder of the ATR
coding sequences contained on a 2.5 kb BstXI to NheI fragment. Sequence analysis confirmed the addition of the FLAG tag. The insert contained within this plasmid was then used to construct a baculovirus expression plasmid that would express the FLAG tagged ATR truncate. The 5' end of ATR contained on a BamHI to BstXI
fragment and the 3' end of ATR contained on a BstXI to SaII fragment derived from pBTM ATR were ligated to the baculovirus expression vector, pFB (Gibco/BRL) that had been digested with BamHI and SaII. This plasmid was designated pFMBCCS(3FLAG.
The full coding region of ATR was fused at the amino terminus to the six histidine tag by PCR. Oligonucleotides MCCS6his (5'-CGGGATCCAGCATGCATCACCATCACCATCACATGGGGGAACATGGGC-3') and Frp1R ("5'-CATGACCACTGGCCATTCCACACG-3') were used in a PCR
reaction to add the six histidine tag to sequences encoding the amino-terminus of ATR. PCR conditions were as follows: 100 ng of PstA 12ATR (obtained from Antony M. Carr) was used as template; 1X PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCIZ, 200liM each of dATP, dGTP, dCTP, and TTP, 10 ng/ l of each primer;
IU AmpliTaq (Perkine-Eimer Cetus). The reaction was denatured at 94 C for 4 minutes followed by 25 cycles of 94 C for 30 seconds, 60 C for 30 seconds and 72 C for 30 seconds. The approximately 800 bp PCR product was digested with BamHI and Mscl and ligated to two other fragments: a 10kb fragment from pcDNAATR digested with BamHI and BstXI and an approximately 3 kb Mscl to BstXI fragment containing the remainder of the ATR coding sequence. The addition of the six histidine tag was verified by sequence analysis. The resulting plasmid encoding a six-histidine tagged full length ATR molecule was designated pcDNA6his ATR.
To construct a baculovirus expression plasmid that expressed the entire coding sequence of ATR, the 1.2 kb BamHI to Agel fragment from pFBMCCS/3FLAG was ligated to the BamHI to Agel fragment from pcDNA6his ATR. The resulting plasmid, designated pFB/HisX6MCCS-1 plasmid was transformed into the E.coli strain, DH5a (Gibco/BRL) for screening of recombinants.
This plasmid was purified by using the Promega "Wizard" mini-prep kit, then transformed into E. coli aSF9 cells (Invitrogen) using the Cellfectin protocol described by Gibco/BRL.
Forty eight hours after transfection, the SF9 cell pellet and baculovirus produced by the transfected cells were harvested. The virus was stored at 4 C
in Grace's Complete media containing 10% FBS, Pennicillin-Streptomycin, and Gentamicin. This viral prep was used to make a high titer (P2) virus stock.
The P2 virus stock was used to infect a 50 ml culture of SF9 cells. The cells were collected 48 hours after infection and centrifuged at low speed to pellet the cells without lysis.
The cell pellet was stored at -20 C for 24 hours before lysis. The cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 8.0; 500 mM NaCI; 1% NP40; 100 m PMSF). Expression of ATR was confirmed by immunoblot using the polyclonal antibody anti-AgDH2 as a probe. The FBHisX6 ATR baculovirus produced an approximately 300 kDa protein that was immunoreactive with anti-AgDH2 antibodies and comigrated with a protein in a mouse testes cell extract.
The P2 virus stock was also used to infect a 2 liter culture of SF9 cells.
The cells were collected 48 hours after infection, centrifuged at low speed to pellet the cells without lysis and stored at -20 C. A cell pellet from 150 mis of this culture was lysed in 7.5 ml of lysis buffer (50mM NaPO1 pH7.2; 0.5% NP-40; 10mM
imidazole, 25mM NaF, 100 M Na3VO4; 0.5mM AEBSF; 1 g/ml leupeptin; l g/ml pepstatin A) and incubated on ice for 15 minutes. The lysate was then centrifuged for 30 minutes at 10,000 x g. The supernatant was removed and any DNA in the lysate resulting from broken nuclei was sheared by aspirating through an 20 gauge needle. Particulate matter was then removed by filtering through a 0.8 micron filter followed by a 0.2 micron filter. This cleared lysate was adjusted to contain 5 mM
0-mercaptoethanol and 0.4 M NaCI. A 1 ml Ni-NTA-agarose column (Qiagen) was equilibrated in Buffer A (0.4 M NaCI; 5 mM 0-mercaptoethanol; 0.1 % Triton X-100; 50 mM NaPO4 10 mM imidazole; 25 mM NaF, 100 M Na3VO4; 0.5 mM
AEBSF; 1 g/ml leupeptin; 1 g/ml pepstatin A) prior to loading the cleared lysate.
The sample was loaded at a flow rate of 0.25 ml/minute, washed 5 ml of Buffer A
and then eluted in 10 ml of a gradient of 50 to 500 mM imidazole in Buffer A.
One half ml fractions were collected and was assayed for kinase activity as follows. Five l of each fraction was incubated in kinase buffer, 10 Ci 32PyATP, 10 M ATP, and 5Ag of substrate PHAS-1 (Stratagene) and incubated at 37 C for 20 minutes.
The reaction was then spotted onto phosphocellulose spin columns and centrifuged at 2500x g, washed twice with 0.5 ml of 75 mM phosphoric acid and once with 0.5 ml absolute ethanol. The phosphocellulose disks were then transferred to scintillation vials and the counts per minutes incorporated into the PHAS-1 proteins were recorded. Fractions 4 through 9 were found to contain activity toward PHAS-1 and immunoblot analysis confirmed that ATR was also present in the same fractions.
At nucleotide position 1284 (SEQ ID NO: 32) there is a conservative base change from "A" in MCCS1/3 to "T" in ATR and at nucleotide position 4176, there is an additional conservative base change from "C" in MCCS1/3 to "T" in ATR.
The FLAG tag was fused at the amino-terminus of a truncated ATR
molecule which lacked the first sixty-six ATR amino acids. The FLAG tag was added by PCR as follows. The oligos FLAG-ATR
(5'-CGGGATCCGCCATGGACTACAAGGACGATGACAAGATGTTGCTTGA17TC-3').
And HFB24 (5'CTTAAGCCGCATGAGCACACCGTC-3') were used in the following PCR reaction: 100ng of pcDNAATR (obtained from Antony M. Carr) as template; IX PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCIZ, 200 M each of dATP, dGTP, dCTP, and TTP, 10 ng/ l of each primer; lU AmpliTaq (Perkin-Elmer Cetus). The reaction was denatured at 94 C for 4 minutes followed by 30 cycles of 94 C for 30 seconds, 60 C for 30 seconds and 72 C for 30 seconds.
The resulting approximately 800 bp PCR product was digested with BamHI and Nhel and was ligated to the 10kb fragment of the mammalian ATR expression plasmid, pcDNAATR digested with BamHI and BstXI along with the remainder of the ATR
coding sequences contained on a 2.5 kb BstXI to NheI fragment. Sequence analysis confirmed the addition of the FLAG tag. The insert contained within this plasmid was then used to construct a baculovirus expression plasmid that would express the FLAG tagged ATR truncate. The 5' end of ATR contained on a BamHI to BstXI
fragment and the 3' end of ATR contained on a BstXI to SaII fragment derived from pBTM ATR were ligated to the baculovirus expression vector, pFB (Gibco/BRL) that had been digested with BamHI and SaII. This plasmid was designated pFMBCCS(3FLAG.
The full coding region of ATR was fused at the amino terminus to the six histidine tag by PCR. Oligonucleotides MCCS6his (5'-CGGGATCCAGCATGCATCACCATCACCATCACATGGGGGAACATGGGC-3') and Frp1R ("5'-CATGACCACTGGCCATTCCACACG-3') were used in a PCR
reaction to add the six histidine tag to sequences encoding the amino-terminus of ATR. PCR conditions were as follows: 100 ng of PstA 12ATR (obtained from Antony M. Carr) was used as template; 1X PCR buffer (Perkin-Elmer Cetus); 1.5 mM MgCIZ, 200liM each of dATP, dGTP, dCTP, and TTP, 10 ng/ l of each primer;
IU AmpliTaq (Perkine-Eimer Cetus). The reaction was denatured at 94 C for 4 minutes followed by 25 cycles of 94 C for 30 seconds, 60 C for 30 seconds and 72 C for 30 seconds. The approximately 800 bp PCR product was digested with BamHI and Mscl and ligated to two other fragments: a 10kb fragment from pcDNAATR digested with BamHI and BstXI and an approximately 3 kb Mscl to BstXI fragment containing the remainder of the ATR coding sequence. The addition of the six histidine tag was verified by sequence analysis. The resulting plasmid encoding a six-histidine tagged full length ATR molecule was designated pcDNA6his ATR.
To construct a baculovirus expression plasmid that expressed the entire coding sequence of ATR, the 1.2 kb BamHI to Agel fragment from pFBMCCS/3FLAG was ligated to the BamHI to Agel fragment from pcDNA6his ATR. The resulting plasmid, designated pFB/HisX6MCCS-1 plasmid was transformed into the E.coli strain, DH5a (Gibco/BRL) for screening of recombinants.
This plasmid was purified by using the Promega "Wizard" mini-prep kit, then transformed into E. coli aSF9 cells (Invitrogen) using the Cellfectin protocol described by Gibco/BRL.
Forty eight hours after transfection, the SF9 cell pellet and baculovirus produced by the transfected cells were harvested. The virus was stored at 4 C
in Grace's Complete media containing 10% FBS, Pennicillin-Streptomycin, and Gentamicin. This viral prep was used to make a high titer (P2) virus stock.
The P2 virus stock was used to infect a 50 ml culture of SF9 cells. The cells were collected 48 hours after infection and centrifuged at low speed to pellet the cells without lysis.
The cell pellet was stored at -20 C for 24 hours before lysis. The cells were lysed in 5 ml of lysis buffer (50 mM Tris, pH 8.0; 500 mM NaCI; 1% NP40; 100 m PMSF). Expression of ATR was confirmed by immunoblot using the polyclonal antibody anti-AgDH2 as a probe. The FBHisX6 ATR baculovirus produced an approximately 300 kDa protein that was immunoreactive with anti-AgDH2 antibodies and comigrated with a protein in a mouse testes cell extract.
The P2 virus stock was also used to infect a 2 liter culture of SF9 cells.
The cells were collected 48 hours after infection, centrifuged at low speed to pellet the cells without lysis and stored at -20 C. A cell pellet from 150 mis of this culture was lysed in 7.5 ml of lysis buffer (50mM NaPO1 pH7.2; 0.5% NP-40; 10mM
imidazole, 25mM NaF, 100 M Na3VO4; 0.5mM AEBSF; 1 g/ml leupeptin; l g/ml pepstatin A) and incubated on ice for 15 minutes. The lysate was then centrifuged for 30 minutes at 10,000 x g. The supernatant was removed and any DNA in the lysate resulting from broken nuclei was sheared by aspirating through an 20 gauge needle. Particulate matter was then removed by filtering through a 0.8 micron filter followed by a 0.2 micron filter. This cleared lysate was adjusted to contain 5 mM
0-mercaptoethanol and 0.4 M NaCI. A 1 ml Ni-NTA-agarose column (Qiagen) was equilibrated in Buffer A (0.4 M NaCI; 5 mM 0-mercaptoethanol; 0.1 % Triton X-100; 50 mM NaPO4 10 mM imidazole; 25 mM NaF, 100 M Na3VO4; 0.5 mM
AEBSF; 1 g/ml leupeptin; 1 g/ml pepstatin A) prior to loading the cleared lysate.
The sample was loaded at a flow rate of 0.25 ml/minute, washed 5 ml of Buffer A
and then eluted in 10 ml of a gradient of 50 to 500 mM imidazole in Buffer A.
One half ml fractions were collected and was assayed for kinase activity as follows. Five l of each fraction was incubated in kinase buffer, 10 Ci 32PyATP, 10 M ATP, and 5Ag of substrate PHAS-1 (Stratagene) and incubated at 37 C for 20 minutes.
The reaction was then spotted onto phosphocellulose spin columns and centrifuged at 2500x g, washed twice with 0.5 ml of 75 mM phosphoric acid and once with 0.5 ml absolute ethanol. The phosphocellulose disks were then transferred to scintillation vials and the counts per minutes incorporated into the PHAS-1 proteins were recorded. Fractions 4 through 9 were found to contain activity toward PHAS-1 and immunoblot analysis confirmed that ATR was also present in the same fractions.
MCCS 1 encoding plasmid DNA was transformed into an esrl-1 diploid yeast strain (Mata 1eu2-1 his4-4canl ura3 cyh2 ade6 ade2 esrl-1/MATa leu2-27his4 trpl met2 ade2 esrl-1), and cells were grown to mid-log phase in either galactose or glucose containing medium. Cells were pelleted, washed and all steps perfornned at 4 C. Cell pastes were resuspended in buffer (20 mM Tris at pH 8.0, 300 mM
NaCI, 10% glycerol, 0.1 mM PMSF, 0.25 mg/ml pepstatin, leupeptin, and aprotinin) and lysed in a French Press or using glass beads. Lysis was verified by microscopy following a low-speed (10K) spin and a high-speed spin (100K), and the supernatant was loaded onto a 1.5 ml Ni-NTA agarose (Qiagen, Inc., Chatsworth, CA) column prewashed in 1 x buffer. The column was washed with six column volumes of buffer.
The column was eluted stepwise with 8 ml of 10 mM, 50 mM, 100 mM, and 250 mM imidazole in buffer. Fractions were collected and Western analysis was performed using 15 IAl of each elution peak. Kinase activity was measured as described above.
Example 5 Polyclonal and monoclonal antibodies specific for MCCS l were generated by standard techniques in the art.
Two different bacterial expression plasmids, pGEX 1-MEC and pGEX3-MEC, were constructed for the recombinant production of portions of the MCCS1 polypeptide as fusions to the COOH-terminus of glutathione S-transferase (GST).
Both plasmids were used for the generation of antigens AgDH-2 and AgDH-3, from pGEXl-MEC and pGEX3-MEC respectively for use in a standard immunization protocol. pGEXI-MEC contains an EcoRI fragment encoding amino acid residues 566 to 870 of SEQ ID NO: 4 fused to GST in the pGEXI vector (Pharmacia Biotech, Milwaukee, Wisconsin); pGEX3-MEC contains an Eco RI fragment encoding amino acid residues 118 to 567 of SEQ ID NO: 4 fused to GST in the pGEX3 vector (Pharmacia Biotech). Induction of the pGEX tac promoter with 0.1mM IPTG led to high level expression of each fusion protein in an insoluble form (inclusion bodies).
Following lysis of induced cultures with a French pressure cell, AgDH-2 and AgDH-3 extracts were centrifuged through a 35% sucrose solution containing 0.1M
NaCI, O.O1M Tris pH7.5, and 0.OOIM EDTA (STE). Pellets were then washed twice and resuspended in STE.
For the generation of polyclonal antisera in rabbits, AgDH-2 and AgDH-3 were further purified using preparative SDS polyacrylamide gel electrophoresis and electroelution of each antigen from gel slices. Primary immunization of female New Zealand White rabbits was with 200 g of each antigen mixed with complete Freund's adjuvant injected at multiple sites subcutaneously.
Subsequent immunizations were with 100,ug antigen mixed with incomplete Freund's adjuvant at approximately 21 day intervals, and test bleeds were taken after itnmunizations 3, 4 and 5. Western blot analysis of extracts of human testis tissue demonstrates antibody reactivity against an approximately 270 kD protein in immune but not preimmune antisera. In addition, the immune sera showed reactivity against the MCCS I pinpoint fusion proteins described in Example 3, providing evidence of the generation of MCCS 1-specific antibodies.
The MCCS 1-specific antibodies were purified as follows. Inclusion body preparations of AgDH-2 and AgDH-3 were coupled to cyanogen bromide (CNBr)-activated Sepharose (Pharmacia, Alameda, CA). Two mg of antigen were solubilized in 1% SDS (4.5 ml final volume) and dialyzed overnight against Coupling Buffer (0.1M NaHCO3/0.1 % SDS). 0.5 ml of 5M NaCl were added to each antigen preparation prior to incubation with the CNBr Sepharose. 0.4 gm of freeze-dried CNBr Sepharose (per antigen) were resuspended in 1 mM HC 1 and washed in a scintered glass funnel with 250 ml 1 mM HCI added in several aliquots over 15 minutes. The HCI-washed CNBr Sepharose was then removed to a 15 mi snap cap tube and washed twice with 5 ml of Coupling Buffer. Dialyzed antigen preps were added to the washed Sepharose and then incubated at room temperature for 1.5 hours on a slowly rotating wheel. The Sepharose was washed once with 5 ml of Coupling Buffer, once with 10 mJ of 0.1M Tris pH8.0, and then incubated in 10 ml 0.1M
Tris 8.0 for 2 hours at room temperature to block any remaining reactive groups on the resin. Coupling efficiency was 60-80% as judged by SDS-PAGE analysis. The antigen columns were then washed with 15 ml of 6M Guanidine HCI (to remove uncoupled antigen), 25 ml of Buffer A(50mM Tris pH 7.4), 15 ml of Buffer B
(4.5M MgClZ/lmg/ml BSA/50mM Tris 7.4), and then 50 ml of Buffer A. Thirty ml of rabbit serum from immunized animals (rabbit 4747 immunized with AgDH-3 and rabbit 4779 immunized with AgDH-2) were passed over the appropriate antigen column over the course of 3 hours. The columns were then washed with 20 ml of Buffer A, 40 ml of 1M Guanidine HCI, and then equilibrated with an additional ml of Buffer A. Anti-AgDH-3 or Anti-AgDH-2 antibodies were then eluted off the antigen columns with 10 ml of Buffer B. One ml fractions were collected, IgG-containing fractions were pooled and dialyzed against I L of phosphate buffered saline (PBS) for 3 hours, and then overnight against 1 L of PBS containing 35 %
glycerol.
Antipeptide antibodies were generated against the human ATM protein by coupling a 15-amino-acid peptide (residues 1359-1373) to Keyhole Limpet Hemocyanin-using EDC as described by the manufacturer (Pierce), followed by injection of the coupled immunogen into rabbits. The antibodies were first precipitated from the serum (#6076) with an equal volume of saturated ammonium chloride followed by resuspension and dialysis against PBS. Affinity purification was carried out using a peptide column prepared by coupling the antigenic peptide to CNBr-activated Sepharose (Phannacia) as described by the manufacturer. The antibodies were then bound to the peptide column and washed with 2 m KCI-PBS.
Elution was carried out with 20 ml S m Nal (in 1 mM sodium thiosulfate), which was dialyzed immediately against PBS.
To generate monoclonal antibodies, female Balb/c mice were immunized with 50 ug AgDH-2 or AgDH-3. Additional mice were immunized with to 50 ug AgDH-2 or AgDH-3 that had been combined with an equal molar ratio of mAb 61F3B, a monoclonal antibody with specific reactivity to GST. A third 25 group of mice were immunized with SDS polyacrylamide gel slices containing AgDH-2 or AgDH-3. The immunogen for each group of mice was prepared in complete Freund's adjuvant, with subsequent boosts (25 ug antigen in incomplete Freund's) at about 21 day intervals. Cell lines producing monoclonal antibodies were isolated as follows. Briefly a single cell suspension was formed by grinding immunized mouse spleen in serum free RPMI 1640, supplemented with 2mM L-glutamine, 1mM sodium pyruvate, 100 units/ml penicillin, and 100 g/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension was filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 mi serum free RPMI. Thymocytes taken from three naive Balb/c mice were prepared in this manner.
NS-1 myeloma cells kept in log phase in RPMI with II % fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described in the foregoing paragraph. After washing, each cell suspension was brought to a final volume of 10 ml in serum free RPMI, and 10 l was diluted 10:100. Twenty l of each dilution was removed, mixed with 20 gl 0.4% trypan blue stain in 0.85% saline (Gibco), loaded onto a hemacytometer and counted.
Two x 108 spleen cells were combined with 4 x 10' NS-1 cells, centrifuged, and the supematant was aspirated. The cell pellet was dislodged by tapping the tube and 2 ml of 37 C PEG 1500 (50% in 75mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes. An additional 16 mi RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI
containing 15% FBS, 100 M sodium hypoxanthine, 0.4 M aminopterin, 16 M thymidine (HAT) (Gibco), 25 units/ml IL-6 (Mallinckrodt, Folcrost, Pennsylvania), and 1.5 x 106 thymocytes/ml. The suspension was dispensed into ten 96-well flat bottom tissue culture plates at 200 141/well. Cells in plates were fed 3 to 4 times between fusing and screening by aspirating approximately half the medium from each well with an 18 G needle and replenishing plating medium described above except containing units/ml IL-6 and lacking thymocytes.
Fusions were screened when cell growth reached 60-80% confluency (day 7 to 9) by ELISA on AgDH2 versus AgDH3. Immunlon 4 plates (Dynatech, Cambridge, MA) were coated at 4`C overnight with 100 ng/well protein in 30mM
carbonate buffer, pH 9.6. Plates were blocked with 100 g/well 0.5% fish skin gelatin in PBS for one hour at 37 C, washed 3 times with PBS, 0.05% Tween 20 (PBST) and 50 l culture supernatant is added. After incubation at 37 C for minutes, and washing as described above, 50 l of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, PA) diluted 1:10,000 in PBST was added. Plates were incubated as above, washed 4 times with PBST and 100 tcl substrate consisting of 100 g/ml of tetramethylbenzidine and 0.15 l/m1 H,O., in 100mM sodium acetate, pH 5.5, was added. The color reaction was stopped in 5-10 minutes with the addition of 50 ul of 15 % H,SOa. A49o was read on a plate reader.
Fifty three pools of hybridomas that were positive in an ELISA were screened for the ability to immunoblot or immunoprecipitate MCCS from a mouse testes cell lysate. Immunoblot analysis using the mouse testes extract is described in Example 6. Immunoprecipitations was performed as follows. A six percent SDS
polyacrylamide gel was run and transferred to Immobilon-PVDF in 192 mM
glycine, 25 mM Tris base, 0.1 % SDS, 20% methanol, then blocked for 1 hour in 5%
powdered nonfat milk, 20 mM Tris ph 7.5, 100 mM NaCI 0.1 % Tween 20, and cut into the appropriate number of strips. The primary antibody (well supematant) was diluted in the above block solution and incubated for one hour at room temperature, washed four times in block minus milk, incubated in goat anti-mouse IgG (H+L) HRP (BioRad #170-6516), washed again in block solution minus milk, transfered to NEN Renaissance ECL reagent and developed for 5 minutes.
Immunoprecipitation was performed as follows. Fifty ttl of hybridoma supematant was incubated for one hour on ice with 300 g of testes cell lysate prepared as described in Example 6. Thirty l of a 50% slurry of protein A
agarose (Pierce, Rockford, IL), prebound to a rabbit anti-mouse bridging antibody (5 tcg/reaction) (Pierce) was added and incubated at 4 C with rocking. The immune complexes were washed three times in lysis buffer and the antigen/antibody complex eluted by boiling in SDS sample buffer (2% SDS, 20 mM Tris pH 6.8, 20%
glycerol, 0.001 % bromphenol blue). The resulting supernatant was separated on a 6% SDS
polyacrylamide gel and transferred to Immobilon-PVDF (Millipore) and an immunoblot was performed using affinity purified rabbit anti-Ag DH2 polyclonal antiserum. Four hybridomas were cloned and characterized in immunoblots, immunoprecipitations and in immunoprecipitation/kinase assays as described in Example 6. The four hybridoma cell lines were designated 224B, 224C (ATCC HB
WO 97/18323 PCT/i1S96/19337 12233), 224F (ATCC HB 12234) and 224G. All four monoclonal antibodies recognized MCCS 1 by immunoblot and immunoprecipitation.
Example 6 MCCS 1 associated protein kinase activity was immunoprecipitated using the MCCS1-specific polyclonal antibodies described in Example 5.
Extracts were made from fresh testes tissue isolated from Balb/c mice.
Minced testes were homogenized on ice with 10-15 strokes of a tight fitting dounce homogenizer in Lysis Buffer (50 mM NaPO4, pH 7.2; 0.5% TritonX-100; 2 mM
EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM
phenylmethylsulfonyl fluoride [PMSF]; I g/ml leupeptin; 1 g/m1 pepstatin A;
2 mM
DTT) and incubated on ice for 30 minutes. The lysate was centrifuged at 13,000xg rpm for 10 minutes at 4 C in a TL-100 table-top ultracentrifuge (Beckman) to remove unbroken cells and other insoluble material. Aliquots of cell lysate were snap frozen in liquid N2 and stored at -70 C. Five hundred ug of testes extract was incubated with either 5 ug of affinity purified anti-AgDH-2 polyclonal antibody or 5 ug purified rabbit IgG (Zymed, So. San Francisco, CA) in 1 ml of Lysis buffer for one hour on ice in microcentrifuge tubes. Thirty l of protein A sepharose beads (Repligen, Cambridge, MA) (washed in Lysis buffer) were added to the extracts, and then incubated for an additional 30 minutes at 4 C on a rocking platform. The immune complex/Protein A sepharose beads were washed four times with 1 ml of Lysis buffer, one time with 1 mi Kinase Buffer (25 mM Hepes pH 7.7; 50 mM KCI;
10 mM MgC12; 0.1 % NP-40; 2% glycerol; 1 mM DTT), and then incubated in 20 ul Kinase Buffer with 10 ttCi ATP [50 Ci/mmol]) for 20 minutes at 37 C. The kinase reactions were stopped with 20 t4l 2X SDS sample buffer and heated to C prior to separation on 6% polyacrylamide gels. Gels were fixed in 20%
methanol/7% Acetic acid, and then dried onto Whatman 3NIM paper prior to autoradiography. While little or no phosphorylation was evident in control immunoprecipitations, immunoprecipitations using anti-AgDH-2 antibody contained two major phosphorylated bands at approximately 300 kD and approximately 180 kD.
In addition, there were several minor phosphorylation products, including one which comigrated with the MCCS 1 protein itself as demonstrated by Western blot analysis (see Example 8 for Western blot description.) Phosphoaminoacid analysis of the approximately 300 kD protein identified the presence of phosphoserine residues.
Addition of 5 ug of AgDH-2 (but not AgDH-3) dramatically reduced or eliminated the MCCS1-associated kinase activity found in the immunoprecipitates.
Example 7 The expression pattern of MCCSI in various human tissues was examined by Northern blot hybridization.
Nylon membranes containing 2gg of size-fractionated polyA+ RNA
from a variety of human tissue sources were obtained from Clontech Laboratories, Inc., and the hybridization protocol supplied by the manufacturer was followed precisely, except that the final wash was performed at 55 C, rather than 50' C, to minimize the possibility of cross-hybridization to related sequences. The 32P-labelled DNA hybridization probe used was generated by PCR. A DNA encoding the COOH-terminal 30 % of MCCS 1 a was used as a template to amplify a 1. 3 kb fragment in the presence of'ZP-dCTP using primers 279-3 5'TGGATGATGACAGCTGTGTC 3' (SEQ ID NO: 21) and 279-6 5'TGTAGTCGCTGCTCAATGTC3' (SEQ ID NO: 22).
Results of the Northern blots show that MCCS 1 is expressed as an approximately 9 kb mRNA in a wide variety of human tissues. Testis tissue contains the highest level of MCCSI mRNA, though the transcript is also expressed in small intestine, ovary, prostate, thymus, spleen, heart, peripheral blood lymphocytes, colon, brain, placenta, skeletal muscle, kidney and pancreas.
Expression of MCCS I mRNA in human cancer cell lines was also examined using a human cancer cell line RNA blot obtained from Clonetech. The RNA blot contained RNA from the cell lines HL-60 (promyelocytic leukemia), HeLa (cervical carcinoma), K-562 (chronic myelogenous leukemia), MOLT-4 (lymphoblastic leukemia), Raji (Burkitt's lymphoma), SW480 (colorectal adenocarcinoma), A549 (lung carcinoma), and G361 (melanoma). Northern blot analysis was performed as directed by the manufacturer with hybridization being carried out at 65'C using a 2.0kb Kpn!-Sall fragment of the MCCS1 partial clone HFB2. Expression was observed in the HL-60, HeLa, K-562, Raji, SW480, and G361 cell lines with the highest level of expression occurring in the G361 cell line.
NaCI, 10% glycerol, 0.1 mM PMSF, 0.25 mg/ml pepstatin, leupeptin, and aprotinin) and lysed in a French Press or using glass beads. Lysis was verified by microscopy following a low-speed (10K) spin and a high-speed spin (100K), and the supernatant was loaded onto a 1.5 ml Ni-NTA agarose (Qiagen, Inc., Chatsworth, CA) column prewashed in 1 x buffer. The column was washed with six column volumes of buffer.
The column was eluted stepwise with 8 ml of 10 mM, 50 mM, 100 mM, and 250 mM imidazole in buffer. Fractions were collected and Western analysis was performed using 15 IAl of each elution peak. Kinase activity was measured as described above.
Example 5 Polyclonal and monoclonal antibodies specific for MCCS l were generated by standard techniques in the art.
Two different bacterial expression plasmids, pGEX 1-MEC and pGEX3-MEC, were constructed for the recombinant production of portions of the MCCS1 polypeptide as fusions to the COOH-terminus of glutathione S-transferase (GST).
Both plasmids were used for the generation of antigens AgDH-2 and AgDH-3, from pGEXl-MEC and pGEX3-MEC respectively for use in a standard immunization protocol. pGEXI-MEC contains an EcoRI fragment encoding amino acid residues 566 to 870 of SEQ ID NO: 4 fused to GST in the pGEXI vector (Pharmacia Biotech, Milwaukee, Wisconsin); pGEX3-MEC contains an Eco RI fragment encoding amino acid residues 118 to 567 of SEQ ID NO: 4 fused to GST in the pGEX3 vector (Pharmacia Biotech). Induction of the pGEX tac promoter with 0.1mM IPTG led to high level expression of each fusion protein in an insoluble form (inclusion bodies).
Following lysis of induced cultures with a French pressure cell, AgDH-2 and AgDH-3 extracts were centrifuged through a 35% sucrose solution containing 0.1M
NaCI, O.O1M Tris pH7.5, and 0.OOIM EDTA (STE). Pellets were then washed twice and resuspended in STE.
For the generation of polyclonal antisera in rabbits, AgDH-2 and AgDH-3 were further purified using preparative SDS polyacrylamide gel electrophoresis and electroelution of each antigen from gel slices. Primary immunization of female New Zealand White rabbits was with 200 g of each antigen mixed with complete Freund's adjuvant injected at multiple sites subcutaneously.
Subsequent immunizations were with 100,ug antigen mixed with incomplete Freund's adjuvant at approximately 21 day intervals, and test bleeds were taken after itnmunizations 3, 4 and 5. Western blot analysis of extracts of human testis tissue demonstrates antibody reactivity against an approximately 270 kD protein in immune but not preimmune antisera. In addition, the immune sera showed reactivity against the MCCS I pinpoint fusion proteins described in Example 3, providing evidence of the generation of MCCS 1-specific antibodies.
The MCCS 1-specific antibodies were purified as follows. Inclusion body preparations of AgDH-2 and AgDH-3 were coupled to cyanogen bromide (CNBr)-activated Sepharose (Pharmacia, Alameda, CA). Two mg of antigen were solubilized in 1% SDS (4.5 ml final volume) and dialyzed overnight against Coupling Buffer (0.1M NaHCO3/0.1 % SDS). 0.5 ml of 5M NaCl were added to each antigen preparation prior to incubation with the CNBr Sepharose. 0.4 gm of freeze-dried CNBr Sepharose (per antigen) were resuspended in 1 mM HC 1 and washed in a scintered glass funnel with 250 ml 1 mM HCI added in several aliquots over 15 minutes. The HCI-washed CNBr Sepharose was then removed to a 15 mi snap cap tube and washed twice with 5 ml of Coupling Buffer. Dialyzed antigen preps were added to the washed Sepharose and then incubated at room temperature for 1.5 hours on a slowly rotating wheel. The Sepharose was washed once with 5 ml of Coupling Buffer, once with 10 mJ of 0.1M Tris pH8.0, and then incubated in 10 ml 0.1M
Tris 8.0 for 2 hours at room temperature to block any remaining reactive groups on the resin. Coupling efficiency was 60-80% as judged by SDS-PAGE analysis. The antigen columns were then washed with 15 ml of 6M Guanidine HCI (to remove uncoupled antigen), 25 ml of Buffer A(50mM Tris pH 7.4), 15 ml of Buffer B
(4.5M MgClZ/lmg/ml BSA/50mM Tris 7.4), and then 50 ml of Buffer A. Thirty ml of rabbit serum from immunized animals (rabbit 4747 immunized with AgDH-3 and rabbit 4779 immunized with AgDH-2) were passed over the appropriate antigen column over the course of 3 hours. The columns were then washed with 20 ml of Buffer A, 40 ml of 1M Guanidine HCI, and then equilibrated with an additional ml of Buffer A. Anti-AgDH-3 or Anti-AgDH-2 antibodies were then eluted off the antigen columns with 10 ml of Buffer B. One ml fractions were collected, IgG-containing fractions were pooled and dialyzed against I L of phosphate buffered saline (PBS) for 3 hours, and then overnight against 1 L of PBS containing 35 %
glycerol.
Antipeptide antibodies were generated against the human ATM protein by coupling a 15-amino-acid peptide (residues 1359-1373) to Keyhole Limpet Hemocyanin-using EDC as described by the manufacturer (Pierce), followed by injection of the coupled immunogen into rabbits. The antibodies were first precipitated from the serum (#6076) with an equal volume of saturated ammonium chloride followed by resuspension and dialysis against PBS. Affinity purification was carried out using a peptide column prepared by coupling the antigenic peptide to CNBr-activated Sepharose (Phannacia) as described by the manufacturer. The antibodies were then bound to the peptide column and washed with 2 m KCI-PBS.
Elution was carried out with 20 ml S m Nal (in 1 mM sodium thiosulfate), which was dialyzed immediately against PBS.
To generate monoclonal antibodies, female Balb/c mice were immunized with 50 ug AgDH-2 or AgDH-3. Additional mice were immunized with to 50 ug AgDH-2 or AgDH-3 that had been combined with an equal molar ratio of mAb 61F3B, a monoclonal antibody with specific reactivity to GST. A third 25 group of mice were immunized with SDS polyacrylamide gel slices containing AgDH-2 or AgDH-3. The immunogen for each group of mice was prepared in complete Freund's adjuvant, with subsequent boosts (25 ug antigen in incomplete Freund's) at about 21 day intervals. Cell lines producing monoclonal antibodies were isolated as follows. Briefly a single cell suspension was formed by grinding immunized mouse spleen in serum free RPMI 1640, supplemented with 2mM L-glutamine, 1mM sodium pyruvate, 100 units/ml penicillin, and 100 g/ml streptomycin (RPMI) (Gibco, Canada). The cell suspension was filtered through sterile 70-mesh Nitex cell strainer (Becton Dickinson, Parsippany, New Jersey), and washed twice by centrifuging at 200 g for 5 minutes and resuspending the pellet in 20 mi serum free RPMI. Thymocytes taken from three naive Balb/c mice were prepared in this manner.
NS-1 myeloma cells kept in log phase in RPMI with II % fetal bovine serum (FBS) (Hyclone Laboratories, Inc., Logan, Utah) for three days prior to fusion, were centrifuged at 200 g for 5 minutes, and the pellet was washed twice as described in the foregoing paragraph. After washing, each cell suspension was brought to a final volume of 10 ml in serum free RPMI, and 10 l was diluted 10:100. Twenty l of each dilution was removed, mixed with 20 gl 0.4% trypan blue stain in 0.85% saline (Gibco), loaded onto a hemacytometer and counted.
Two x 108 spleen cells were combined with 4 x 10' NS-1 cells, centrifuged, and the supematant was aspirated. The cell pellet was dislodged by tapping the tube and 2 ml of 37 C PEG 1500 (50% in 75mM Hepes, pH 8.0) (Boehringer Mannheim) was added with stirring over the course of 1 minute, followed by adding 14 ml of serum free RPMI over 7 minutes. An additional 16 mi RPMI was added and the cells were centrifuged at 200 g for 10 minutes. After discarding the supernatant, the pellet was resuspended in 200 ml RPMI
containing 15% FBS, 100 M sodium hypoxanthine, 0.4 M aminopterin, 16 M thymidine (HAT) (Gibco), 25 units/ml IL-6 (Mallinckrodt, Folcrost, Pennsylvania), and 1.5 x 106 thymocytes/ml. The suspension was dispensed into ten 96-well flat bottom tissue culture plates at 200 141/well. Cells in plates were fed 3 to 4 times between fusing and screening by aspirating approximately half the medium from each well with an 18 G needle and replenishing plating medium described above except containing units/ml IL-6 and lacking thymocytes.
Fusions were screened when cell growth reached 60-80% confluency (day 7 to 9) by ELISA on AgDH2 versus AgDH3. Immunlon 4 plates (Dynatech, Cambridge, MA) were coated at 4`C overnight with 100 ng/well protein in 30mM
carbonate buffer, pH 9.6. Plates were blocked with 100 g/well 0.5% fish skin gelatin in PBS for one hour at 37 C, washed 3 times with PBS, 0.05% Tween 20 (PBST) and 50 l culture supernatant is added. After incubation at 37 C for minutes, and washing as described above, 50 l of horseradish peroxidase conjugated goat anti-mouse IgG(fc) (Jackson ImmunoResearch, West Grove, PA) diluted 1:10,000 in PBST was added. Plates were incubated as above, washed 4 times with PBST and 100 tcl substrate consisting of 100 g/ml of tetramethylbenzidine and 0.15 l/m1 H,O., in 100mM sodium acetate, pH 5.5, was added. The color reaction was stopped in 5-10 minutes with the addition of 50 ul of 15 % H,SOa. A49o was read on a plate reader.
Fifty three pools of hybridomas that were positive in an ELISA were screened for the ability to immunoblot or immunoprecipitate MCCS from a mouse testes cell lysate. Immunoblot analysis using the mouse testes extract is described in Example 6. Immunoprecipitations was performed as follows. A six percent SDS
polyacrylamide gel was run and transferred to Immobilon-PVDF in 192 mM
glycine, 25 mM Tris base, 0.1 % SDS, 20% methanol, then blocked for 1 hour in 5%
powdered nonfat milk, 20 mM Tris ph 7.5, 100 mM NaCI 0.1 % Tween 20, and cut into the appropriate number of strips. The primary antibody (well supematant) was diluted in the above block solution and incubated for one hour at room temperature, washed four times in block minus milk, incubated in goat anti-mouse IgG (H+L) HRP (BioRad #170-6516), washed again in block solution minus milk, transfered to NEN Renaissance ECL reagent and developed for 5 minutes.
Immunoprecipitation was performed as follows. Fifty ttl of hybridoma supematant was incubated for one hour on ice with 300 g of testes cell lysate prepared as described in Example 6. Thirty l of a 50% slurry of protein A
agarose (Pierce, Rockford, IL), prebound to a rabbit anti-mouse bridging antibody (5 tcg/reaction) (Pierce) was added and incubated at 4 C with rocking. The immune complexes were washed three times in lysis buffer and the antigen/antibody complex eluted by boiling in SDS sample buffer (2% SDS, 20 mM Tris pH 6.8, 20%
glycerol, 0.001 % bromphenol blue). The resulting supernatant was separated on a 6% SDS
polyacrylamide gel and transferred to Immobilon-PVDF (Millipore) and an immunoblot was performed using affinity purified rabbit anti-Ag DH2 polyclonal antiserum. Four hybridomas were cloned and characterized in immunoblots, immunoprecipitations and in immunoprecipitation/kinase assays as described in Example 6. The four hybridoma cell lines were designated 224B, 224C (ATCC HB
WO 97/18323 PCT/i1S96/19337 12233), 224F (ATCC HB 12234) and 224G. All four monoclonal antibodies recognized MCCS 1 by immunoblot and immunoprecipitation.
Example 6 MCCS 1 associated protein kinase activity was immunoprecipitated using the MCCS1-specific polyclonal antibodies described in Example 5.
Extracts were made from fresh testes tissue isolated from Balb/c mice.
Minced testes were homogenized on ice with 10-15 strokes of a tight fitting dounce homogenizer in Lysis Buffer (50 mM NaPO4, pH 7.2; 0.5% TritonX-100; 2 mM
EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM
phenylmethylsulfonyl fluoride [PMSF]; I g/ml leupeptin; 1 g/m1 pepstatin A;
2 mM
DTT) and incubated on ice for 30 minutes. The lysate was centrifuged at 13,000xg rpm for 10 minutes at 4 C in a TL-100 table-top ultracentrifuge (Beckman) to remove unbroken cells and other insoluble material. Aliquots of cell lysate were snap frozen in liquid N2 and stored at -70 C. Five hundred ug of testes extract was incubated with either 5 ug of affinity purified anti-AgDH-2 polyclonal antibody or 5 ug purified rabbit IgG (Zymed, So. San Francisco, CA) in 1 ml of Lysis buffer for one hour on ice in microcentrifuge tubes. Thirty l of protein A sepharose beads (Repligen, Cambridge, MA) (washed in Lysis buffer) were added to the extracts, and then incubated for an additional 30 minutes at 4 C on a rocking platform. The immune complex/Protein A sepharose beads were washed four times with 1 ml of Lysis buffer, one time with 1 mi Kinase Buffer (25 mM Hepes pH 7.7; 50 mM KCI;
10 mM MgC12; 0.1 % NP-40; 2% glycerol; 1 mM DTT), and then incubated in 20 ul Kinase Buffer with 10 ttCi ATP [50 Ci/mmol]) for 20 minutes at 37 C. The kinase reactions were stopped with 20 t4l 2X SDS sample buffer and heated to C prior to separation on 6% polyacrylamide gels. Gels were fixed in 20%
methanol/7% Acetic acid, and then dried onto Whatman 3NIM paper prior to autoradiography. While little or no phosphorylation was evident in control immunoprecipitations, immunoprecipitations using anti-AgDH-2 antibody contained two major phosphorylated bands at approximately 300 kD and approximately 180 kD.
In addition, there were several minor phosphorylation products, including one which comigrated with the MCCS 1 protein itself as demonstrated by Western blot analysis (see Example 8 for Western blot description.) Phosphoaminoacid analysis of the approximately 300 kD protein identified the presence of phosphoserine residues.
Addition of 5 ug of AgDH-2 (but not AgDH-3) dramatically reduced or eliminated the MCCS1-associated kinase activity found in the immunoprecipitates.
Example 7 The expression pattern of MCCSI in various human tissues was examined by Northern blot hybridization.
Nylon membranes containing 2gg of size-fractionated polyA+ RNA
from a variety of human tissue sources were obtained from Clontech Laboratories, Inc., and the hybridization protocol supplied by the manufacturer was followed precisely, except that the final wash was performed at 55 C, rather than 50' C, to minimize the possibility of cross-hybridization to related sequences. The 32P-labelled DNA hybridization probe used was generated by PCR. A DNA encoding the COOH-terminal 30 % of MCCS 1 a was used as a template to amplify a 1. 3 kb fragment in the presence of'ZP-dCTP using primers 279-3 5'TGGATGATGACAGCTGTGTC 3' (SEQ ID NO: 21) and 279-6 5'TGTAGTCGCTGCTCAATGTC3' (SEQ ID NO: 22).
Results of the Northern blots show that MCCS 1 is expressed as an approximately 9 kb mRNA in a wide variety of human tissues. Testis tissue contains the highest level of MCCSI mRNA, though the transcript is also expressed in small intestine, ovary, prostate, thymus, spleen, heart, peripheral blood lymphocytes, colon, brain, placenta, skeletal muscle, kidney and pancreas.
Expression of MCCS I mRNA in human cancer cell lines was also examined using a human cancer cell line RNA blot obtained from Clonetech. The RNA blot contained RNA from the cell lines HL-60 (promyelocytic leukemia), HeLa (cervical carcinoma), K-562 (chronic myelogenous leukemia), MOLT-4 (lymphoblastic leukemia), Raji (Burkitt's lymphoma), SW480 (colorectal adenocarcinoma), A549 (lung carcinoma), and G361 (melanoma). Northern blot analysis was performed as directed by the manufacturer with hybridization being carried out at 65'C using a 2.0kb Kpn!-Sall fragment of the MCCS1 partial clone HFB2. Expression was observed in the HL-60, HeLa, K-562, Raji, SW480, and G361 cell lines with the highest level of expression occurring in the G361 cell line.
Detectable but low levels of expression were observed in the MOLT-4 and A549 cell lines.
Example 8 The expression of MCCS 1 mRNA and protein in normal and irradiated mouse testes and in mouse embryos was examined by in situ hybridization, immunostaining and/or immunoblotting.
In situ Hybridization Normal and irradiated mouse testes were harvested from male Balb/c mice.
The tissues were sectioned at 61.cm thickness, picked up on Superfrost Plus (VWR
Scientific) slides and allowed to air-dry at room temperature ovelnight.
Sections were stored at -70o C if not immediately used. The tissue sections were fixed in 4%
paraformaldehyde (Sigma) in PBS for 20 minutes at 4c) C, dehydrated (70%, 95%, 100% ethanol) for 1 minute at 4o C in each grade, then allowed to air dry for minutes at room temperature. The slides were acetylated in a solution of 0.25 % (v/v) acetic anhydride (Sigma)/0.1M triethanolamine pH 8.0 for 10 minutes at room temperature with stirring, rinsed in 0.2X SSC for 10 minutes at room temperature with stirring, and dehydrated and air dried as described above. The tissues were hybridized in situ with digoxigenin-labeled single-stranded mRNA generated from murine MCCSI DNA by in vitro RNA transcription incorporating digoxigen-UTP
(Boehringer Mannheim). The labeled riboprobes (see sequence in SEQ ID NO: 27) ( I gg/section) and diethylpyrocarbonate (depc)-treated water were added to hybridization buffer with a final concentration of 50% formamide, 0.3 M NaCI, mM Tris pH 7.5, 10% dextran sulfate, 1X Denhardt's solution, 100 mM
dithiothreitol (DTT) and 5 mM EDTA, and 20 g1 of the solution was applied to each section and covered with a sterile, RNase-free 22 x 22 cover slip. The mRNA in both the section and the probe solution was denatured by heating the slides to for 10 minutes in an oven. Hybridization was carried out overnight (12-16 hours) at 50 C.
After hybridization, sections were washed for 1 hour at room temperature in 4X SSC/10 mM DTT, then for 30 minutes at 50 C in 50%
formamide/2X SSC/10 mM DTT, 30 minutes at 37 C in a solution of 500 mM
Example 8 The expression of MCCS 1 mRNA and protein in normal and irradiated mouse testes and in mouse embryos was examined by in situ hybridization, immunostaining and/or immunoblotting.
In situ Hybridization Normal and irradiated mouse testes were harvested from male Balb/c mice.
The tissues were sectioned at 61.cm thickness, picked up on Superfrost Plus (VWR
Scientific) slides and allowed to air-dry at room temperature ovelnight.
Sections were stored at -70o C if not immediately used. The tissue sections were fixed in 4%
paraformaldehyde (Sigma) in PBS for 20 minutes at 4c) C, dehydrated (70%, 95%, 100% ethanol) for 1 minute at 4o C in each grade, then allowed to air dry for minutes at room temperature. The slides were acetylated in a solution of 0.25 % (v/v) acetic anhydride (Sigma)/0.1M triethanolamine pH 8.0 for 10 minutes at room temperature with stirring, rinsed in 0.2X SSC for 10 minutes at room temperature with stirring, and dehydrated and air dried as described above. The tissues were hybridized in situ with digoxigenin-labeled single-stranded mRNA generated from murine MCCSI DNA by in vitro RNA transcription incorporating digoxigen-UTP
(Boehringer Mannheim). The labeled riboprobes (see sequence in SEQ ID NO: 27) ( I gg/section) and diethylpyrocarbonate (depc)-treated water were added to hybridization buffer with a final concentration of 50% formamide, 0.3 M NaCI, mM Tris pH 7.5, 10% dextran sulfate, 1X Denhardt's solution, 100 mM
dithiothreitol (DTT) and 5 mM EDTA, and 20 g1 of the solution was applied to each section and covered with a sterile, RNase-free 22 x 22 cover slip. The mRNA in both the section and the probe solution was denatured by heating the slides to for 10 minutes in an oven. Hybridization was carried out overnight (12-16 hours) at 50 C.
After hybridization, sections were washed for 1 hour at room temperature in 4X SSC/10 mM DTT, then for 30 minutes at 50 C in 50%
formamide/2X SSC/10 mM DTT, 30 minutes at 37 C in a solution of 500 mM
NaCI, 10 mM Tris-HC 1, 1 mM EDTA, pH 7.5 (NTE buffer), 30 minutes at 37 C
in a bath of 10 g/mL RNase A (Boehringer Mannheim) in NTE buffer, 15 minutes at 37 C in NTE buffer, 15 minutes at room temperature in 2X SSC, 15 minutes at room temperature in 0.1X SSC, and 2 minutes at room temperature in 100 mM Tris-HC 1, 150 mM NaCI, pH 7.5 (Buffer 1). To detect the labeled riboprobes, the sections were blocked for 30 minutes at room temperature in a solution of 5 %
normal sheep serum (Harlan Bioproducts for Science, Indianapolis, IN) and 0.3% Triton X-100 (Sigma) in Buffer I with gentle stirring, after which 150 I/section of sheep aDigoxigenin-gold conjugate (Goldmark Biologicals, Philipburg, Pa) was applied to the tissues and incubated for 2 hours at room temperature. The slides were then washed three times for 5 minutes in Buffer 1, five times for 3 minutes in sterile deionized water, the excess liquid blotted off the slide and 2 drops each of silver enhancing and initiating solution (Goldmark Biologicals) applied to each section. The chemical reaction was allowed to proceed for 23 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in Nuclear Fast Red (Vector), rinsed again in sterile deionized water, air dried overnight at room temperature and mounted with Cytoseal 60 (VWR).
In both normal and irradiated mouse testes signal was observed in the cytoplasm of spermatogonia and spermatocytes. The expression level in irradiated testis was not increased over that seen in normal testis.
Immunostaining Testis tissue from nonnal male Balb/c mice was sectioned at 6 m thickness, picked up on Superfrost Plus (VWR Scientific) slides and allowed to air-dry at room temperature overnight. Sections were stored at -70 C if not immediately used. The sections were fixed in cold (4 C) acetone for 10 minutes at room temperature; once the slides were removed from the acetone the reagent was allowed to evaporate from the sections. Each tissue section was blocked with 150 l of a solution of 30% normal rat serum (Harlan Bioproducts), 5% normal goat serum (Vector Laboratories) and 1% bovine serum albumin (BSA) (Sigma) in IX TBS for 30 minutes at room temperature. After blocking, the solution was gently blotted from the sections and anti-AgDH-3 and anti-AgDH-2 polyclonal antibodies and preimmune sera from the same rabbits were diluted 1:50 and 1:100 in the blocking solution and 100 tcl applied to each tissue section and incubated for 30 minutes at 37 C.
The antibody solution was blotted gently from the sections and unbound antibody removed from the sections by washing the slides 3 times for 5 minutes each in 1X TBS.
The excess TBS was blotted from the slide and 100 l of the biotinylated goat anti-rabbit antibody contained in the Elite Rabbit IgG Vectastain ABC kit (Vector), prepared according to the product insert, were applied to each section and incubated for 15 minutes at 37 C. After incubation, the slides were washed 2 times in 1X TBS
for 5 minutes in each wash. Next, 100 l of streptavidin-gold conjugate (Goldmark Biologicals) diluted 1:100 in a solution containing 5% normal rat serum and 1%
BSA
was applied to each section and incubated for 1 hour at room temperature. The slides were then washed 3 times in 1X TBS for 5 minutes each wash, and 100 141 of 1%
glutaraldehyde (Sigma) in TBS buffer was applied to the slides for 5 minutes at room temperature. The slides were then washed 3 times for 5 minutes each in TBS, then 4 times in sterile deionized water for 3 minutes each. The excess liquid was blotted from each slide and 2 drops each of silver enhancing and initiating solution (Goldmark Biologicals) were applied to each section. The chemical reaction was allowed to proceed for 13 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in Nuclear Fast Red (Vector), rinsed again in sterile deionized water, air dried overnight at room temperature and mounted with Cytoseal 60 (VWR).
Signal was detected in the spermatogonia and primary spermatocytes with both of the polyclonal antibodies, but not with the preimmune sera from the same animals.
ImmunoblottinQ
Freshly obtained mouse testicles were minced with razor blades in cold PBS, and a cell suspension was generated using a loose fitting dounce homogenizer.
This cell suspension was then boiled with an equal volume of 2X SDS sample buffer.
Fifty ug aliquots of each extract were separated on 6% polyacrylamide gels, transferred onto Immobilon membranes (Millipore, Bedford, MA) and analyzed for anti-MCCS 1-reactivity using the affinity purified antibodies in Example 5, and HRP-conjugated goat anti-rabbit secondary antibody and the Renaissance Enhanced Chemiluminescence kit (Dupont/NEN, Boston, MA). Extracts prepared from fresh lnouse testis contain a high molecular weight species (about 294 kD) that was recognized by both affinity-purified antiserum. No reactivity against this protein was seen with either of the preimmune sera. Importantly, the signal obtained from each affinity purified sera was specifically blocked after pre-incubation of the antibody with the corresponding immunogen.
In summary, high levels of MCCS I mRNA and protein are detected in mouse testis in the spermatogonia and primary spermatocytes, cells that are in the early stages of meiosis. This suggests that MCCSI plays an important role in meiotic cell division. Meiosis is a specialized form of cell division that produces germ cells in higher eukaryotes. There are two major characteristics of meiosis that distinguish it from mitosis. Whereas mitotic cell division results in genetically identical cells containing two of each chromosome, meiotic cell division results in cells containing one of each chromosome. Early in meiosis, during the "reduction division"
process, sister chromatids pair and undergo reciprocal recombination at some regions.
During this process, these cells are exposed to DNA strand breaks. It is likely that the cellular response to the DNA strand breaks during meiosis is similar to the cellular response found in non-germ cells in response to IR-induced DNA damage. This interpretation is further substantiated by studies that demonstrate the MECI
is upregulated 10 to 20 fold during sporulation, indicating an important role for during meiosis in addition to its role in DNA repair.
Example 9 In order to identify the cells within the developing mouse testis that express MCCS1, Western blot analysis of MCCSI expression within populations of meiotic cells was performed. Extracts of purified pachytene spermatocytes, round spermatids, condensing spermatids, and epididymal sperm cells were examined for MCCS 1 expression as described above in Example 8.
Pachytene spermatocytes, round, and condensing spermatids were prepared from decapsulated testes of adult mice by sequential dissociation with collagenase and trypsin-DNase 1. The cells were separated into discrete populations by sedimentation velocity at unit gravity in 2-4% BSA gradients in Enriched Krebs Ringer Bicarbonate Medium (EKRB). The pachytene spermatocyte and round spermatid populations were each at least 85 % pure, while the condensing spermatid population was about 40-50% pure (contaminated primarily with enucleated residual bodies and some round spermatids). Sperm were obtained from the cauda epididymides. Purified populations of spermatogenic cells were dissolved directly in SDS-sample buffer containing 40 mM DTT, heated to 100 C for 5 minutes, and the amount of protein in each sample determined by the Amido-Black procedure.
The highest levels of MCCS 1 protein were found in pachytene spermatocytes, with the level dropping significantly in round spermatids.
MCCSI
protein levels were barely detectable lower in the condensing spermatid population, and this may reflect the presence of round spermatids in the preparation (see above).
No MCCS1 protein was detected in epididymal sperm. The Western analysis thus corroborates the immunocytochemical data, and suggests a role for MCCS 1 in meiotic cells.
Example 10 Substrates of MCCS 1 and proteins that interact with MCCS 1(for example, members of the cell cycle checkpoint pathway and proteins that localize MCCSI in cells) may be identified by various assays.
A. Identification of Substrates Substrates of MCCS 1 may be identified by incorporating test compounds in assays for kinase activity. MCCSI kinase is resuspended in 20 l kinase buffer (25mM Hepes pH7.4, 25mM KCI, 10mM MgC12, 1 mM DTT, 2%
glycerol, 0.1 % NP40, 0.5mM ATP, 10 uCI gamma 32P-ATP) and incubated for 30 minutes, either in the presence or absence of 4 g test compound (e.g., casein, histone H 1, or appropriate substrate peptide). Reactions are separated on 12 % PAGE
gels and dried onto Whatman paper prior to autoradiography. Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate indicates that the test compound is a substrate of the kinase.
The protein PHAS-1 has been identified as an in vitro substrate of ATR
(Example 4). PHAS- I is a heat and acid-stable protein that phosphorylated at several sites in vivo in response to insulin and growth factors. PHAS-1 binds to the mRNA
in a bath of 10 g/mL RNase A (Boehringer Mannheim) in NTE buffer, 15 minutes at 37 C in NTE buffer, 15 minutes at room temperature in 2X SSC, 15 minutes at room temperature in 0.1X SSC, and 2 minutes at room temperature in 100 mM Tris-HC 1, 150 mM NaCI, pH 7.5 (Buffer 1). To detect the labeled riboprobes, the sections were blocked for 30 minutes at room temperature in a solution of 5 %
normal sheep serum (Harlan Bioproducts for Science, Indianapolis, IN) and 0.3% Triton X-100 (Sigma) in Buffer I with gentle stirring, after which 150 I/section of sheep aDigoxigenin-gold conjugate (Goldmark Biologicals, Philipburg, Pa) was applied to the tissues and incubated for 2 hours at room temperature. The slides were then washed three times for 5 minutes in Buffer 1, five times for 3 minutes in sterile deionized water, the excess liquid blotted off the slide and 2 drops each of silver enhancing and initiating solution (Goldmark Biologicals) applied to each section. The chemical reaction was allowed to proceed for 23 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in Nuclear Fast Red (Vector), rinsed again in sterile deionized water, air dried overnight at room temperature and mounted with Cytoseal 60 (VWR).
In both normal and irradiated mouse testes signal was observed in the cytoplasm of spermatogonia and spermatocytes. The expression level in irradiated testis was not increased over that seen in normal testis.
Immunostaining Testis tissue from nonnal male Balb/c mice was sectioned at 6 m thickness, picked up on Superfrost Plus (VWR Scientific) slides and allowed to air-dry at room temperature overnight. Sections were stored at -70 C if not immediately used. The sections were fixed in cold (4 C) acetone for 10 minutes at room temperature; once the slides were removed from the acetone the reagent was allowed to evaporate from the sections. Each tissue section was blocked with 150 l of a solution of 30% normal rat serum (Harlan Bioproducts), 5% normal goat serum (Vector Laboratories) and 1% bovine serum albumin (BSA) (Sigma) in IX TBS for 30 minutes at room temperature. After blocking, the solution was gently blotted from the sections and anti-AgDH-3 and anti-AgDH-2 polyclonal antibodies and preimmune sera from the same rabbits were diluted 1:50 and 1:100 in the blocking solution and 100 tcl applied to each tissue section and incubated for 30 minutes at 37 C.
The antibody solution was blotted gently from the sections and unbound antibody removed from the sections by washing the slides 3 times for 5 minutes each in 1X TBS.
The excess TBS was blotted from the slide and 100 l of the biotinylated goat anti-rabbit antibody contained in the Elite Rabbit IgG Vectastain ABC kit (Vector), prepared according to the product insert, were applied to each section and incubated for 15 minutes at 37 C. After incubation, the slides were washed 2 times in 1X TBS
for 5 minutes in each wash. Next, 100 l of streptavidin-gold conjugate (Goldmark Biologicals) diluted 1:100 in a solution containing 5% normal rat serum and 1%
BSA
was applied to each section and incubated for 1 hour at room temperature. The slides were then washed 3 times in 1X TBS for 5 minutes each wash, and 100 141 of 1%
glutaraldehyde (Sigma) in TBS buffer was applied to the slides for 5 minutes at room temperature. The slides were then washed 3 times for 5 minutes each in TBS, then 4 times in sterile deionized water for 3 minutes each. The excess liquid was blotted from each slide and 2 drops each of silver enhancing and initiating solution (Goldmark Biologicals) were applied to each section. The chemical reaction was allowed to proceed for 13 minutes at room temperature, then the sections were rinsed thoroughly in sterile deionized water, counterstained in Nuclear Fast Red (Vector), rinsed again in sterile deionized water, air dried overnight at room temperature and mounted with Cytoseal 60 (VWR).
Signal was detected in the spermatogonia and primary spermatocytes with both of the polyclonal antibodies, but not with the preimmune sera from the same animals.
ImmunoblottinQ
Freshly obtained mouse testicles were minced with razor blades in cold PBS, and a cell suspension was generated using a loose fitting dounce homogenizer.
This cell suspension was then boiled with an equal volume of 2X SDS sample buffer.
Fifty ug aliquots of each extract were separated on 6% polyacrylamide gels, transferred onto Immobilon membranes (Millipore, Bedford, MA) and analyzed for anti-MCCS 1-reactivity using the affinity purified antibodies in Example 5, and HRP-conjugated goat anti-rabbit secondary antibody and the Renaissance Enhanced Chemiluminescence kit (Dupont/NEN, Boston, MA). Extracts prepared from fresh lnouse testis contain a high molecular weight species (about 294 kD) that was recognized by both affinity-purified antiserum. No reactivity against this protein was seen with either of the preimmune sera. Importantly, the signal obtained from each affinity purified sera was specifically blocked after pre-incubation of the antibody with the corresponding immunogen.
In summary, high levels of MCCS I mRNA and protein are detected in mouse testis in the spermatogonia and primary spermatocytes, cells that are in the early stages of meiosis. This suggests that MCCSI plays an important role in meiotic cell division. Meiosis is a specialized form of cell division that produces germ cells in higher eukaryotes. There are two major characteristics of meiosis that distinguish it from mitosis. Whereas mitotic cell division results in genetically identical cells containing two of each chromosome, meiotic cell division results in cells containing one of each chromosome. Early in meiosis, during the "reduction division"
process, sister chromatids pair and undergo reciprocal recombination at some regions.
During this process, these cells are exposed to DNA strand breaks. It is likely that the cellular response to the DNA strand breaks during meiosis is similar to the cellular response found in non-germ cells in response to IR-induced DNA damage. This interpretation is further substantiated by studies that demonstrate the MECI
is upregulated 10 to 20 fold during sporulation, indicating an important role for during meiosis in addition to its role in DNA repair.
Example 9 In order to identify the cells within the developing mouse testis that express MCCS1, Western blot analysis of MCCSI expression within populations of meiotic cells was performed. Extracts of purified pachytene spermatocytes, round spermatids, condensing spermatids, and epididymal sperm cells were examined for MCCS 1 expression as described above in Example 8.
Pachytene spermatocytes, round, and condensing spermatids were prepared from decapsulated testes of adult mice by sequential dissociation with collagenase and trypsin-DNase 1. The cells were separated into discrete populations by sedimentation velocity at unit gravity in 2-4% BSA gradients in Enriched Krebs Ringer Bicarbonate Medium (EKRB). The pachytene spermatocyte and round spermatid populations were each at least 85 % pure, while the condensing spermatid population was about 40-50% pure (contaminated primarily with enucleated residual bodies and some round spermatids). Sperm were obtained from the cauda epididymides. Purified populations of spermatogenic cells were dissolved directly in SDS-sample buffer containing 40 mM DTT, heated to 100 C for 5 minutes, and the amount of protein in each sample determined by the Amido-Black procedure.
The highest levels of MCCS 1 protein were found in pachytene spermatocytes, with the level dropping significantly in round spermatids.
MCCSI
protein levels were barely detectable lower in the condensing spermatid population, and this may reflect the presence of round spermatids in the preparation (see above).
No MCCS1 protein was detected in epididymal sperm. The Western analysis thus corroborates the immunocytochemical data, and suggests a role for MCCS 1 in meiotic cells.
Example 10 Substrates of MCCS 1 and proteins that interact with MCCS 1(for example, members of the cell cycle checkpoint pathway and proteins that localize MCCSI in cells) may be identified by various assays.
A. Identification of Substrates Substrates of MCCS 1 may be identified by incorporating test compounds in assays for kinase activity. MCCSI kinase is resuspended in 20 l kinase buffer (25mM Hepes pH7.4, 25mM KCI, 10mM MgC12, 1 mM DTT, 2%
glycerol, 0.1 % NP40, 0.5mM ATP, 10 uCI gamma 32P-ATP) and incubated for 30 minutes, either in the presence or absence of 4 g test compound (e.g., casein, histone H 1, or appropriate substrate peptide). Reactions are separated on 12 % PAGE
gels and dried onto Whatman paper prior to autoradiography. Moles of phosphate transferred by the kinase to the test compound are measured by autoradiography or scintillation counting. Transfer of phosphate indicates that the test compound is a substrate of the kinase.
The protein PHAS-1 has been identified as an in vitro substrate of ATR
(Example 4). PHAS- I is a heat and acid-stable protein that phosphorylated at several sites in vivo in response to insulin and growth factors. PHAS-1 binds to the mRNA
cap binding factor, EIF-4E, and prevents translation of capped mRNAs.
Phosphorylation of PHAS-1 at a specific serine residue results in dissociation of PHAS-l form EIF-4E and thus releasing the inhibition of translation of capped mRNAs. This mechanism allows for a rapid synthesis of protein in response to a particular stimulus. PHAS-1 may be phosphorylated by several protein kinases in vivo including a protein kinase that is sensitive to rapamycin. Since the rapamycin-sensitive protein kinase, FRAP, is related to ATR, it would be reasonable to assume that there might be an overlap in substrate specificity between FRAP and ATR
and that PHAS-1 is a substrate for both of these protein kinases in vitro. To test this hypothesis, ATR that was immunoprecipitated from a mouse testes cell extract or His-tagged ATR purified from baculovirus-infected SF9 cells (Example 4) was incubated with 10 ttg PHAS-1 (Stratagene) in kinase buffer (25 mM Hepes pH 7.4, 25 mM
KC 1, 10 mM MgC 12i 1 mM DTT, 0.1 % NP-40), 10 M ATP and 10 Ci32P=yATP
for 20 minutes at 37 C. Since phosphorylated PHAS-1 was known to bind to phosphocellulose paper, the reaction was spotted onto phosphocellulose spin columns and centrifuged at 2500 x g, washed twice with 0.5 ml of 75 mM phosphoric acid and once with 0.5 ml absolute ethanol. The phosphocellulose disks were then transferred to scintillation vials and the counts per minutes incorporated into the PHAS-1 proteins were recorded. ATR readily phosphorylated PHAS-1 whereas negative controls showed little or no PHAS-1 phosphorylation. To map which residue is phosphorylated, the following peptides representing PHAS-1 sequences containing serine and threonine residues were synthesized.
Peptide PH-1 MSGGSSCQTPSRAIPATRR (SEQ ID NO: 36) Peptide PH-2 GDYSTTPGGTLFSTTPGGTRR (SEQ ID NO: 37) Peptide PH-3 ECRNSPVTKTRR (SEQ ID NO: 38) Peptide PH-4 GVTSPSSDEPRR (SEQ ID NO: 39) Peptide PH-5 MEASQSHLRR (SEQ ID NO: 40) Peptide PH-6 RRNSPEDKRAGG (SEQ ID NO: 41) Peptide PH-7 GEESQFEMDIRR (SEQ ID NO: 42) These peptides are tested in the same kinase reaction to determine which peptide(s) is (are) phosphorylated by ATR. The peptide(s) are then used as substrate for ATR
or MCCS 1 in assays such as described in Example 11 to identify modulators.
The same kinase reaction was also used to determine if proteins such as histone H1 (Upstate Biotechnology, Inc., Waltham, NY) and myelin basic protein (Gibco BRL, Gaithersburg, MD) which are known to be substrates of other protein kinases are substrates of MCCSI and ATR. No phosphorylation of histone HI or myelin basic protein was observed under the conditions of the assay. Moreover, a peptide from p53 known to be a substrate of DNA-PK was also not phosphorylated in the assay.
B. Identification of Interacting Proteins Interacting proteins may be identified by the following assays.
A first assay contemplated by the invention is a two-hybrid screen.
The two-hybrid system was developed in yeast [Chien et al., Proc. Natl. Acad.
Sci.
USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene. Specifically, a polynucleotide encoding a protein that interacts with MCCSI is isolated by: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA
binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and either the DNA
binding domain or the activating domain of the transcription factor;
expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative MCCS 1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion;
detecting binding of an MCCS 1 interacting protein to MCCS 1 in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell. Presently preferred for use in the assay are a lexA promoter to drive expression of the repoiter gene, the lacZ reporter gene, a transcription factor comprising the IexA DNA binding domain and the GAIA transactivation domain, and yeast host cells.
Other assays for identifying proteins that interact with MCCSI may involve immobilizing MCCS1 or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCS1.
Another type of assay for identifying MCCS 1 interacting proteins involves immobilizing MCCS1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the florescent agent. Alternatively, the putative interacting protein may be immobilized and MCCS I may be labelled in the assay.
Example 11 Modulators of MCCS I include MCCS 1 variants and other molecules.
The modulators may affect MCCS 1 kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway. Presently preferred regions of MCCS 1 which are targets for mutation or the development of selective modulators include the following four regions: the MCCS 1 a amino telminal effector domain (amino acids 1 to 1081 of SEQ ID NO: 31), the MCCS 1O amino terminal effector domain (amino acids I to 1150 of SEQ ID NO: 33), the MCCSIa rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS10 rad3+
domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCSI a PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS 10 PIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).
MCCS 1 variants having mutations in the kinase domain may be useful as a radiosensitizing agents. Mutations specifically contemplated by the invention are, replacement of the MCCS1a aspartic acid at amino acid 2241, the asparagine at 2246, and the aspartic acid at 2260 of SEQ ID NO: 31 with alanine or methionine, and the corresponding mutations in MCCS1O. Analogous mutations in the rad3+ gene resulted in yeast hypersensitive to radiation. In addition, mutations in the kinase domain of ATM are found in patients with AT, a disease that causes radiation sensitivity.
Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.
For example, an assay for identifying modulators of MCCS 1 kinase activity involves incubating an MCCS1 kinase preparation in kinase buffer with gamma 32P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. For example, 2 l of the 50 mM imidazole elution pool is added to kinase buffer. (See Example 6.) The reactions are incubated at 37 C for 20 min and samples are analyzed by SDS-PAGE prior to autoradiography or Western analysis.
An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS l kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCSI kinase.
Moreover, assays for identifying compounds that modulate interaction of MCCS 1 with other proteins may involve: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA
sequence encoding part or all of a protein that interacts with MCCS I and the DNA
binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS 1 and the interacting protein by detecting binding of the interacting protein to MCCS1 in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence of the modulating compound. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ
reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
Another type of assay for identifying compounds that modulate the interaction between MCCS 1 and an interacting protein involves immobilizing MCCS I
or a natural MCCSI interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCSI interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCS 1 interaction with the protein.
Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCS 1 and an interacting protein involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the florescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound. Alternatively, the MCCS 1 interacting protein may be immobilized and MCCS I may be labelled in the assay.
Phosphorylation of PHAS-1 at a specific serine residue results in dissociation of PHAS-l form EIF-4E and thus releasing the inhibition of translation of capped mRNAs. This mechanism allows for a rapid synthesis of protein in response to a particular stimulus. PHAS-1 may be phosphorylated by several protein kinases in vivo including a protein kinase that is sensitive to rapamycin. Since the rapamycin-sensitive protein kinase, FRAP, is related to ATR, it would be reasonable to assume that there might be an overlap in substrate specificity between FRAP and ATR
and that PHAS-1 is a substrate for both of these protein kinases in vitro. To test this hypothesis, ATR that was immunoprecipitated from a mouse testes cell extract or His-tagged ATR purified from baculovirus-infected SF9 cells (Example 4) was incubated with 10 ttg PHAS-1 (Stratagene) in kinase buffer (25 mM Hepes pH 7.4, 25 mM
KC 1, 10 mM MgC 12i 1 mM DTT, 0.1 % NP-40), 10 M ATP and 10 Ci32P=yATP
for 20 minutes at 37 C. Since phosphorylated PHAS-1 was known to bind to phosphocellulose paper, the reaction was spotted onto phosphocellulose spin columns and centrifuged at 2500 x g, washed twice with 0.5 ml of 75 mM phosphoric acid and once with 0.5 ml absolute ethanol. The phosphocellulose disks were then transferred to scintillation vials and the counts per minutes incorporated into the PHAS-1 proteins were recorded. ATR readily phosphorylated PHAS-1 whereas negative controls showed little or no PHAS-1 phosphorylation. To map which residue is phosphorylated, the following peptides representing PHAS-1 sequences containing serine and threonine residues were synthesized.
Peptide PH-1 MSGGSSCQTPSRAIPATRR (SEQ ID NO: 36) Peptide PH-2 GDYSTTPGGTLFSTTPGGTRR (SEQ ID NO: 37) Peptide PH-3 ECRNSPVTKTRR (SEQ ID NO: 38) Peptide PH-4 GVTSPSSDEPRR (SEQ ID NO: 39) Peptide PH-5 MEASQSHLRR (SEQ ID NO: 40) Peptide PH-6 RRNSPEDKRAGG (SEQ ID NO: 41) Peptide PH-7 GEESQFEMDIRR (SEQ ID NO: 42) These peptides are tested in the same kinase reaction to determine which peptide(s) is (are) phosphorylated by ATR. The peptide(s) are then used as substrate for ATR
or MCCS 1 in assays such as described in Example 11 to identify modulators.
The same kinase reaction was also used to determine if proteins such as histone H1 (Upstate Biotechnology, Inc., Waltham, NY) and myelin basic protein (Gibco BRL, Gaithersburg, MD) which are known to be substrates of other protein kinases are substrates of MCCSI and ATR. No phosphorylation of histone HI or myelin basic protein was observed under the conditions of the assay. Moreover, a peptide from p53 known to be a substrate of DNA-PK was also not phosphorylated in the assay.
B. Identification of Interacting Proteins Interacting proteins may be identified by the following assays.
A first assay contemplated by the invention is a two-hybrid screen.
The two-hybrid system was developed in yeast [Chien et al., Proc. Natl. Acad.
Sci.
USA, 88: 9578-9582 (1991)] and is based on functional in vivo reconstitution of a transcription factor which activates a reporter gene. Specifically, a polynucleotide encoding a protein that interacts with MCCSI is isolated by: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA
binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and either the DNA
binding domain or the activating domain of the transcription factor;
expressing in the host cells a library of second hybrid DNA sequences encoding second fusions of part or all of putative MCCS 1 binding proteins and the DNA binding domain or activating domain of the transcription factor which is not incorporated in the first fusion;
detecting binding of an MCCS 1 interacting protein to MCCS 1 in a particular host cell by detecting the production of reporter gene product in the host cell; and isolating second hybrid DNA sequences encoding the interacting protein from the particular host cell. Presently preferred for use in the assay are a lexA promoter to drive expression of the repoiter gene, the lacZ reporter gene, a transcription factor comprising the IexA DNA binding domain and the GAIA transactivation domain, and yeast host cells.
Other assays for identifying proteins that interact with MCCSI may involve immobilizing MCCS1 or a test protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the amount of label bound. Bound label indicates that the test protein interacts with MCCS1.
Another type of assay for identifying MCCS 1 interacting proteins involves immobilizing MCCS1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling a test protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled test protein, detecting light emission by the fluorescent agent, and identifying interacting proteins as test proteins which result in the emission of light by the florescent agent. Alternatively, the putative interacting protein may be immobilized and MCCS I may be labelled in the assay.
Example 11 Modulators of MCCS I include MCCS 1 variants and other molecules.
The modulators may affect MCCS 1 kinase activity, its localization in the cell, and/or its interaction with members of the cell cycle checkpoint pathway. Presently preferred regions of MCCS 1 which are targets for mutation or the development of selective modulators include the following four regions: the MCCS 1 a amino telminal effector domain (amino acids 1 to 1081 of SEQ ID NO: 31), the MCCS 1O amino terminal effector domain (amino acids I to 1150 of SEQ ID NO: 33), the MCCSIa rad3+ domain (amino acids 1082 to 2082 of SEQ ID NO: 31), the MCCS10 rad3+
domain (amino acids 1151 to 2151 of SEQ ID NO: 33), the MCCSI a PIK domain (amino acids 2083 to 2410 of SEQ ID NO: 31), and the MCCS 10 PIK domain (amino acids 2152 to 2480 of SEQ ID NO: 33).
MCCS 1 variants having mutations in the kinase domain may be useful as a radiosensitizing agents. Mutations specifically contemplated by the invention are, replacement of the MCCS1a aspartic acid at amino acid 2241, the asparagine at 2246, and the aspartic acid at 2260 of SEQ ID NO: 31 with alanine or methionine, and the corresponding mutations in MCCS1O. Analogous mutations in the rad3+ gene resulted in yeast hypersensitive to radiation. In addition, mutations in the kinase domain of ATM are found in patients with AT, a disease that causes radiation sensitivity.
Furthermore, combinatorial libraries, peptide and peptide mimetics, defined chemical entities, oligonucleotides, and natural product libraries may be screened for activity as modulators in assays such as those described below.
For example, an assay for identifying modulators of MCCS 1 kinase activity involves incubating an MCCS1 kinase preparation in kinase buffer with gamma 32P-ATP and an exogenous kinase substrate, both in the presence and absence of a test compound, and measuring the moles of phosphate transferred to the substrate. For example, 2 l of the 50 mM imidazole elution pool is added to kinase buffer. (See Example 6.) The reactions are incubated at 37 C for 20 min and samples are analyzed by SDS-PAGE prior to autoradiography or Western analysis.
An increase in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the test compound is an activator of said MCCS l kinase. Conversely, a decrease in the moles of phosphate transferred to the substrate in presence of the test compound compared to the moles of phosphate transferred to the substrate in the absence of the test compound indicates that the modulator is an inhibitor of said MCCSI kinase.
Moreover, assays for identifying compounds that modulate interaction of MCCS 1 with other proteins may involve: transforming or transfecting appropriate host cells with a DNA construct comprising a reporter gene under the control of a promoter regulated by a transcription factor having a DNA-binding domain and an activating domain; expressing in the host cells a first hybrid DNA sequence encoding a first fusion of part or all of MCCS 1 and the DNA binding domain or the activating domain of the transcription factor; expressing in the host cells a second hybrid DNA
sequence encoding part or all of a protein that interacts with MCCS I and the DNA
binding domain or activating domain of the transcription factor which is not incorporated in the first fusion; evaluating the effect of a test compound on the interaction between MCCS 1 and the interacting protein by detecting binding of the interacting protein to MCCS1 in a particular host cell by measuring the production of reporter gene product in the host cell in the presence or absence of the test compound; and identifying modulating compounds as those test compounds altering production of the reported gene product in comparison to production of the reporter gene product in the absence of the modulating compound. Presently preferred for use in the assay are a lexA promoter to drive expression of the reporter gene, the lacZ
reporter gene, a transcription factor comprising the lexA DNA binding domain and the GAL4 transactivation domain, and yeast host cells.
Another type of assay for identifying compounds that modulate the interaction between MCCS 1 and an interacting protein involves immobilizing MCCS I
or a natural MCCSI interacting protein, detectably labelling the nonimmobilized binding partner, incubating the binding partners together and determining the effect of a test compound on the amount of label bound wherein a reduction in the label bound in the present of the test compound compared to the amount of label bound in the absence of the test compound indicates that the test agent is an inhibitor of MCCSI interaction with protein. Conversely, an increase in the bound in the presence of the test compound compared to the amount label bound in the absence of the compound indicates that the putative modulator is an activator of MCCS 1 interaction with the protein.
Yet another method contemplated by the invention for identifying compounds that modulate the binding between MCCS 1 and an interacting protein involves immobilizing MCCS 1 or a fragment thereof on a solid support coated (or impregnated with) a fluorescent agent, labelling the interacting protein with a compound capable of exciting the fluorescent agent, contacting the immobilized MCCS 1 with the labelled interacting protein in the presence and absence of a test compound, detecting light emission by the fluorescent agent, and identifying modulating compounds as those test compounds that affect the emission of light by the florescent agent in comparison to the emission of light by the fluorescent agent in the absence of the test compound. Alternatively, the MCCS 1 interacting protein may be immobilized and MCCS I may be labelled in the assay.
Example 12 Cell based complementation assays for identifying modulators of MCCS1 or ATM are described below.
In one type of assay, host cells (for example, esrl -1 yeast cells) are transformed with MCCS1-encoding DNA as is described in Example 4. The esrl-l yeast strain is normally sensitive to treatment with ultraviolet (UV) light, but esrl-l yeast cells expressing MCCS 1 or ATR are no longer sensitive to treatment with W
light. The transformed yeast cells are exposed to test compounds and the effect of the test compounds on UV sensitivity of the transformed host cell is determined. Test compounds that are inhibitors of MCCS1 or ATR activity restore UV sensitivity to the MCCS 1 transformed esrl-l cells. Alternatively, esrl-l tell double mutant yeast cells are used as host cells instead of esrl-l yeast cells. The TELI gene is homologous to ATM and the TEL1 mutation is described in Morrow, et al., Cell, 82:831-840 (1995). The invention also specifically contemplates that the esrl-l or esrl-1 tell double mutant yeast host cells may be transformed with ATM-encoding DNA (SEQ ID NO: 34).
In an alternative embodiment, the assays include clastogenic agents or events instead of treatment with UV light (e. g. , IR, hydroxyurea, or DNA
damaging agents). Appropriate host cells for use in such embodiments would be those that are sensitive to the alternative clastogenic agents or events.
Another type of complementation assay involves the use of mammalian host cells such as cell lines derived from cells of AT patients. As described above for yeast cells, the mammalian cells are transfected with DNA encoding MCCS 1, ATR, or ATM and then exposed to test compounds. Test compounds that are inhibitors of MCCS 1, ATR, or ATM activity will restore the phenotype of the untransformed host cell (e.g., sensitivity to IR).
The above assays can be used to identify compounds that inhibit activity of MCCS 1, ATR, and ATM or compounds that inhibit activity of only one of the enzymes.
In an alternative type of assay, the yeast or mammalian host cells are transformed with DNA encoding chimeric polypeptides including various combinations of MCCS1 and ATM domains. MCCSI and ATM show structural similarities, and chimeric polypeptides which comprise portions of MCCS 1 and ATM
are useful in elucidating active sites and binding domains of both MCCS 1 and ATM.
Polynucleotides encoding the chimeras can be prepared by standard molecular biology techniques known to the skilled worker and as exemplified herein. The chimeric polypeptides are expressed in host cells and modulators of the chimeras can be identified by the assays disclosed herein.
Example 13 MCCS 1 and ATM are both involved in meiosis I checkpoints. Since MCCSI is demonstrated herein to have kinase activity, assays were performed to determine if ATM possessed kinase activity. To determine the kinase activity of ATM, ATM was immunoprecipitated from MRC-5 fibroblasts (ATCC #171-CCL) with polyclonal antisera, 6076. MRC-5 cells are human lung embryonal diploid fibroblasts. MRC-5 cells were obtained from the ATCC at passage 19 and maintained in Minimal Essential Medium supplemented with 10 % fetal bovine serum, 100 units/ml penicillin, 100 mg/mi streptomycin, and 100 mM MEM non-essential amino acids. Media and media supplements were obtained through Gibco Life Technologies. Cell lines were maintained in a water-saturated 37 C incubator with 5% C.
MRC-5 cell extracts were prepared by lysis of a 10cm plate of log-pliase cells in 0.5 ml of Lysis Buffer I(50 mM NaPO4i pH 7.2; 0.5 % TritonX-100;
2 mM EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM
phenylmethylsulfonyl fluoride [PMSF]; 1 g/ml leupeptin 1 g/ml pepstatin A; 2 mM
DTT) on ice. Cells were scraped from plates using a rubber spatula then sonicated in a cup horn sonicator (Sonifier 250, Branson Ultrasonics Corp., Danbury, CT) at 100% output for 90 seconds. Lysates were then clarified in a 4 C microfuge for minutes. Preclearing was done by adding 10 g purified rabbit IgG (Zymed) and l Protein A Agarose slurry (Pierce) followed by incubation at 4 C for 60 minutes while rocking. To the precleared lysates, 10 g of affinity purified 6076 antisera (or 10 g 6076 pre-blocked with 0.04 mg P45 peptide for 30 min.) was added and incubated on ice for 60 minutes. Immunoprecipitates were collected by addition of 30 l Protein A agarose slurry and incubated with rocking at 4 C for 30 minutes followed by four washes in Lysis Buffer I.
Kinase reactions were carried out by washing the immunoprecipitations once with kinase buffer (25 M Hepes pH 7.7; 50 mM KCI; 10 mM MgCI2; 0. 1 %
NP-40; 2% glycerol; I mM DTT), followed by incubation in 20 tiI of Kinase Buffer containing 10 M ATP + 10 Ci -y 32P-ATP [50 Ci/mmol] for 20 minutes at 37 C.
Reactions were stopped by the addition of 20 12X SDS sample buffer and boiled for 5 minutes prior to separation on 6% SDS polyacrylamide gels. The gels were dried and exposed to x-ray film (Kodak, XAR-5) at -80 C overnight.
10 cm plates of log-phase MRC-5 cells were washed once with PBS
then incubated in Dulbeco's Modified Eagle Medium (minus methionine) containing 2 % dialyzed fetal bovine serum for 30 minutes. Cells were labeled by adding Ci35S-methionine (1000 Ci/mmol TRAN35S-LABEL, ICN Radiochemicals) for 2 hours. Labeled cells were then washed once with PBS and frozen at -80 C prior to immunoprecipitation.
The incubation of the immunoprecipitated complexes in kinase buffer produced a phosphorylated product with a molecular weight of approximately 350,000 that co-migrated with ATM in polyacrylamide gels.
Similar results were obtained for ATR immune complexes immunoprecipitated with anti-AgDH-2 (MCCS1) polyclonal antisera of Example 5.
ATR and ATM thus appear to be able to self-phosphorylate or associate with a protein kinase.
To determine the role of ATR and ATM in meiosis, immunostaining techniques on surface spreads of mouse spermatocytes were utilized to localize ATR
and ATM to meiotic chromosomes. Antibodies recognizing ATR and ATM were utilized with mouse antibodies against Corl. Corl is a component of axial/lateral elements of synapsing chromosomes [Dobson et al., J. Cell Sci., 107:2749-2760 (1994)]. Corl chromosomal staining appears when the axial elements begin to form between the sister chromatids of each homolog in leptonema of meiotic prophase, prior to the initiation of synapsis. As homologous bivalents synapse, the axial elements from the two homologs align and a central element forms between them, completing the structure called the synaptonemal complex (SC).
In one type of assay, host cells (for example, esrl -1 yeast cells) are transformed with MCCS1-encoding DNA as is described in Example 4. The esrl-l yeast strain is normally sensitive to treatment with ultraviolet (UV) light, but esrl-l yeast cells expressing MCCS 1 or ATR are no longer sensitive to treatment with W
light. The transformed yeast cells are exposed to test compounds and the effect of the test compounds on UV sensitivity of the transformed host cell is determined. Test compounds that are inhibitors of MCCS1 or ATR activity restore UV sensitivity to the MCCS 1 transformed esrl-l cells. Alternatively, esrl-l tell double mutant yeast cells are used as host cells instead of esrl-l yeast cells. The TELI gene is homologous to ATM and the TEL1 mutation is described in Morrow, et al., Cell, 82:831-840 (1995). The invention also specifically contemplates that the esrl-l or esrl-1 tell double mutant yeast host cells may be transformed with ATM-encoding DNA (SEQ ID NO: 34).
In an alternative embodiment, the assays include clastogenic agents or events instead of treatment with UV light (e. g. , IR, hydroxyurea, or DNA
damaging agents). Appropriate host cells for use in such embodiments would be those that are sensitive to the alternative clastogenic agents or events.
Another type of complementation assay involves the use of mammalian host cells such as cell lines derived from cells of AT patients. As described above for yeast cells, the mammalian cells are transfected with DNA encoding MCCS 1, ATR, or ATM and then exposed to test compounds. Test compounds that are inhibitors of MCCS 1, ATR, or ATM activity will restore the phenotype of the untransformed host cell (e.g., sensitivity to IR).
The above assays can be used to identify compounds that inhibit activity of MCCS 1, ATR, and ATM or compounds that inhibit activity of only one of the enzymes.
In an alternative type of assay, the yeast or mammalian host cells are transformed with DNA encoding chimeric polypeptides including various combinations of MCCS1 and ATM domains. MCCSI and ATM show structural similarities, and chimeric polypeptides which comprise portions of MCCS 1 and ATM
are useful in elucidating active sites and binding domains of both MCCS 1 and ATM.
Polynucleotides encoding the chimeras can be prepared by standard molecular biology techniques known to the skilled worker and as exemplified herein. The chimeric polypeptides are expressed in host cells and modulators of the chimeras can be identified by the assays disclosed herein.
Example 13 MCCS 1 and ATM are both involved in meiosis I checkpoints. Since MCCSI is demonstrated herein to have kinase activity, assays were performed to determine if ATM possessed kinase activity. To determine the kinase activity of ATM, ATM was immunoprecipitated from MRC-5 fibroblasts (ATCC #171-CCL) with polyclonal antisera, 6076. MRC-5 cells are human lung embryonal diploid fibroblasts. MRC-5 cells were obtained from the ATCC at passage 19 and maintained in Minimal Essential Medium supplemented with 10 % fetal bovine serum, 100 units/ml penicillin, 100 mg/mi streptomycin, and 100 mM MEM non-essential amino acids. Media and media supplements were obtained through Gibco Life Technologies. Cell lines were maintained in a water-saturated 37 C incubator with 5% C.
MRC-5 cell extracts were prepared by lysis of a 10cm plate of log-pliase cells in 0.5 ml of Lysis Buffer I(50 mM NaPO4i pH 7.2; 0.5 % TritonX-100;
2 mM EDTA; 2 mM EGTA; 25 mM NaF; 25 mM 2-glycerophosphate; 1 mM
phenylmethylsulfonyl fluoride [PMSF]; 1 g/ml leupeptin 1 g/ml pepstatin A; 2 mM
DTT) on ice. Cells were scraped from plates using a rubber spatula then sonicated in a cup horn sonicator (Sonifier 250, Branson Ultrasonics Corp., Danbury, CT) at 100% output for 90 seconds. Lysates were then clarified in a 4 C microfuge for minutes. Preclearing was done by adding 10 g purified rabbit IgG (Zymed) and l Protein A Agarose slurry (Pierce) followed by incubation at 4 C for 60 minutes while rocking. To the precleared lysates, 10 g of affinity purified 6076 antisera (or 10 g 6076 pre-blocked with 0.04 mg P45 peptide for 30 min.) was added and incubated on ice for 60 minutes. Immunoprecipitates were collected by addition of 30 l Protein A agarose slurry and incubated with rocking at 4 C for 30 minutes followed by four washes in Lysis Buffer I.
Kinase reactions were carried out by washing the immunoprecipitations once with kinase buffer (25 M Hepes pH 7.7; 50 mM KCI; 10 mM MgCI2; 0. 1 %
NP-40; 2% glycerol; I mM DTT), followed by incubation in 20 tiI of Kinase Buffer containing 10 M ATP + 10 Ci -y 32P-ATP [50 Ci/mmol] for 20 minutes at 37 C.
Reactions were stopped by the addition of 20 12X SDS sample buffer and boiled for 5 minutes prior to separation on 6% SDS polyacrylamide gels. The gels were dried and exposed to x-ray film (Kodak, XAR-5) at -80 C overnight.
10 cm plates of log-phase MRC-5 cells were washed once with PBS
then incubated in Dulbeco's Modified Eagle Medium (minus methionine) containing 2 % dialyzed fetal bovine serum for 30 minutes. Cells were labeled by adding Ci35S-methionine (1000 Ci/mmol TRAN35S-LABEL, ICN Radiochemicals) for 2 hours. Labeled cells were then washed once with PBS and frozen at -80 C prior to immunoprecipitation.
The incubation of the immunoprecipitated complexes in kinase buffer produced a phosphorylated product with a molecular weight of approximately 350,000 that co-migrated with ATM in polyacrylamide gels.
Similar results were obtained for ATR immune complexes immunoprecipitated with anti-AgDH-2 (MCCS1) polyclonal antisera of Example 5.
ATR and ATM thus appear to be able to self-phosphorylate or associate with a protein kinase.
To determine the role of ATR and ATM in meiosis, immunostaining techniques on surface spreads of mouse spermatocytes were utilized to localize ATR
and ATM to meiotic chromosomes. Antibodies recognizing ATR and ATM were utilized with mouse antibodies against Corl. Corl is a component of axial/lateral elements of synapsing chromosomes [Dobson et al., J. Cell Sci., 107:2749-2760 (1994)]. Corl chromosomal staining appears when the axial elements begin to form between the sister chromatids of each homolog in leptonema of meiotic prophase, prior to the initiation of synapsis. As homologous bivalents synapse, the axial elements from the two homologs align and a central element forms between them, completing the structure called the synaptonemal complex (SC).
When short stretches of Corl begin to appear prior to any evidence of synapsis, neither ATR nor ATM is detectable. As homologs start synapsis, both proteins were seen at pairing forks; however, the location and behavior of the two proteins differed markedly. In nonmal zygotene nuclei, the stage during which homologs synapse, ATR was present in small amounts and transiently at discrete foci along the asynapsed (unpaired) axes. As homologs synapse, ATR disappeared from these locations. However, at regions delayed in synapsis, often seen near the proximal ends of autosomal bivalents, there was an accumulation of ATR foci along the unsynapsed axes. ATR was detected at similar locations on the two axial elements. In nuclei where an entire autosome fails to find its homologous pairing partner, ATR foci were detected along the entire lengths of these asynapsed axis. In males, where the X chromosome has no homolog, ATR foci were localized along the unpaired axis.
ATM was also visualized as foci and was first detected during zygonema as homologs synapse, but ATM localization was different than ATR.
ATM was first observed along synapsed axes when homologous autosomal axial elements come into contact. However, during mid-pachynema, after autosomal synapsis has been completed, ATM foci appeared on the X chromosome axis. ATM
localization persisted on fully synapsed bivalents into pachynema, a substage that lasts 3 days in mouse oocytes and 6 days in mouse spermatocytes. During pachynema, the number of foci drops gradually, stabilizing briefly in mid-pachynema before eventually disappearing mid-to late pachynema. Thus, ATR and ATM protein kinases play important and complementary roles at distinct stages in meiosis I.
The involvement of ATR appears to be transient during early meiotic prophase while the role of ATM appears to be more prolonged. However, both ATR
and ATM coordinate the various events of meiotic prophase by performing similar checkpoint functions.
The foregoing illustrative examples relate to presently preferred embodiments of the invention and numerous modifications and variations thereof are expected to occur to those skilled in the art. Thus only such limitations as appear in the appended claims should be placed upon the scope of the present invention.
ATM was also visualized as foci and was first detected during zygonema as homologs synapse, but ATM localization was different than ATR.
ATM was first observed along synapsed axes when homologous autosomal axial elements come into contact. However, during mid-pachynema, after autosomal synapsis has been completed, ATM foci appeared on the X chromosome axis. ATM
localization persisted on fully synapsed bivalents into pachynema, a substage that lasts 3 days in mouse oocytes and 6 days in mouse spermatocytes. During pachynema, the number of foci drops gradually, stabilizing briefly in mid-pachynema before eventually disappearing mid-to late pachynema. Thus, ATR and ATM protein kinases play important and complementary roles at distinct stages in meiosis I.
The involvement of ATR appears to be transient during early meiotic prophase while the role of ATM appears to be more prolonged. However, both ATR
and ATM coordinate the various events of meiotic prophase by performing similar checkpoint functions.
The foregoing illustrative examples relate to presently preferred embodiments of the invention and numerous modifications and variations thereof are expected to occur to those skilled in the art. Thus only such limitations as appear in the appended claims should be placed upon the scope of the present invention.
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: ICOS Corporation (ii) TITLE OF INVENTION: Cell Cycle Checkpoint PIK-Related Kinase Materials and Methods ( iii ) NUMBER OF SEQUENCES : 42 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Marshall, O'Toole, Gerstein, Murray & Borun (B) STREET: 6300 Sears Tower, 233 S. Wacker Dr.
(C) CITY: Chicago (D) STATE: Illinois ( E ) CO[JNTRY : USA
(F) ZIP: 60606 (v) COMP[TTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Noland, Greta E.
(B) REGISTRATION NUMBER: 35,302 (C) REFERENCE/DOCKET NUMBER: 27866/33607 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (312) 474-6300 (B) TELEFAX: (312) 474-0448 (C) TELEX: 25-3856 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7621 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: pBSHFB2HT2-27 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 333..7559 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
(1) GENERAL INFORMATION:
(i) APPLICANT: ICOS Corporation (ii) TITLE OF INVENTION: Cell Cycle Checkpoint PIK-Related Kinase Materials and Methods ( iii ) NUMBER OF SEQUENCES : 42 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Marshall, O'Toole, Gerstein, Murray & Borun (B) STREET: 6300 Sears Tower, 233 S. Wacker Dr.
(C) CITY: Chicago (D) STATE: Illinois ( E ) CO[JNTRY : USA
(F) ZIP: 60606 (v) COMP[TTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: Patentln Release #1.0, Version #1.30 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Noland, Greta E.
(B) REGISTRATION NUMBER: 35,302 (C) REFERENCE/DOCKET NUMBER: 27866/33607 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (312) 474-6300 (B) TELEFAX: (312) 474-0448 (C) TELEX: 25-3856 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7621 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: pBSHFB2HT2-27 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 333..7559 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:
CAAGGATT'1'A GCAAATGAAT TAGCACTTCG GATATACTTG TTTATTTAAT ATCTTTTTTG 120 Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe Ile Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gin Leu Gly Gly Leu Pro Ala Gin Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gin Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu CTT TTT GTC TTA AGA ATG AAG GAA GCA TAT ACA CAT GCC C.AA ATA TCA 2417 Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gin Phe Leu Val Glu Ser Leu His Ser Ser Gin Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr IZe Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gin Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala GTG CAA GAT TT"T CTT CAT GAA ATA TAT TTT TTA CCT GAT CAT CCA GAA 3617 Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Giu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ser Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2409 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gin Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe Ile Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Vai Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gin Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gin His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg i ~~ ~ Al~ u Met yi Y~~~~~pV~ OC).~f%A$~~e~'Oa~~l{~fA ^~e ~
hEMB# o"iDMu-eI~~A~oAS aa a 2 v_ .~ uzv &~''uR
Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gin Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2835 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
( vi i ) IMMEDIATE SOURCE :
(B) CLONE: 517 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..2610 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala .
Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala TGC CTG CCA GAA TGG GAG GAT GGG CAT T'I'T TAC CTT GCC AAG TAC TAT 816 Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ser Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile ACA GAG CAT ACA AAC TAT TTA GCT CCA TAT CAA TTT TI'G ACT GCT TTT 1104 Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe CCT GGA CAT TGG GCC TAT ATT GCA GGG TTT GAT GAT ATG GTG GAA A'I'I' 1584 Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu GGT TGG ACT CCA TAT ATG TGAAATGAAA TTATGTAP.AA GAATATGTTA 2640 Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 870 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gin Ala Leu Ile Val Leu Gin Lys Gly Vai Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ser Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Tlir Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu G1n Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gin Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDHl5a (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(15, 18, 24, 30) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(15, 18, 24) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH16 (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: 24 (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH17a (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(21, 24, 27, 30) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH17b (ix) FEATURE:
(A) NAME/KEY: modifiedbase (B) LOCATION: group(24, 27, 30, 33) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH18a (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(15, 18, 21, 24, 30) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH18b (ix) FEATURE:
(A) NAME/KEY: modifiedbase (B) LOCATION: group(15, 18, 21) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH23 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer mo3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IDMEDIATE SOURCE:
(B) CLONE: Primer mo6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oHT9-1 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oHT9-4 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7440 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: MCCSlbeta (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1__7437 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gin Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe Ile Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gin Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gin Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gin Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn GAA TTA TTG CTG CGT ATT GGA GAA CAC TAT CAA CAG GTT TT'T AAT GGT 2784 Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gin Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Giy Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His I1e Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro CAC AGC AAA TCA AAC AGA AAT AAG GTP. GAC TCA ATG GTA TCT ACT GTG 4368 His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ser Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gin Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile WO 97/18323 PCT/tJS96l19337 -Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gin Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu 'Iyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2479 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe I1e Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Tzp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Giy Leu Pro Ala Gin Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gin Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gin Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Giy Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gin Asp Ile Ala Ser Asp Leu Cys Gin Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ser Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys 'Iyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH26 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (vii) IMMEDIATE SOURCE:
(B) CLONE: FLAG tag (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Met Asp Tyr Lys Asp Asp Asp Asp Lys (2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer 279-3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer 279-6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7624 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 333..7562 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
CAAGGATTTA GCAAATGAAT TAGCACTTCG GATATACTTG TTTATT'TAAT ATCTTT TTTG 120 TTAAAP.GCAA GAGTCCTGCT ATTTTTGGGG TACTCACAAA AGAATTATTA CAACTTTTTG 300 Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gin Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gin Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu G1n Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Vai Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gin His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Giu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn AAG GTT ATC ACA GAG CAT ACA AAC TAT TTA GCT CCA TAT CAA TTT 'ITG 6257 Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gin Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2410 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gin His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gin Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gin Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala G1n Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gin Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln GIu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gin Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Giu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lfs Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val WO 97/18323 I'CT/US96/19337 -Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7502 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7440 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gin Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Clu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gin Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala TCT ATA CTT GGT CAA CTT GTC TGT ACT CTT CAC GGC ATG T'I'T TAT CTG 1680 Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gin His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp TCT GAA GAT GGA Z'TT ATA AAG GAG CTT TTT GTC TTA AGA ATG AAG GAA 2064 Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Plie Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr GTG GAT TAT GAA GAC TAT CAG AGT GTA ACC CGT TT"T CTA GAC CTC ATA 4416 Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gin Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile GTT CTT CAT TTT GGC AGA TCT CTA CAP. TAT GGA AAT CAG TTC ATA TAT 5760 Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gin Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn WO 97/18323 PCT/US96/19337 _ Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met TGAAATGAAA TTATGTAAAA GAATATGTTA ATAATCTAAA AGTAAAAAAA AAAAAP,AAP,A 7500 (2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2480 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gin Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gin Gin Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gin Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gin Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu -Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gin Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gin Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His 1505 7.510 1515 1520 Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gin Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gin Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:27:
(i1 SEQUENCE CHARACTERISTICS:
(A) LENGTH: 878 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7935 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7932 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
Met Gly Glu His Gly Leu Glu Leu Ala Ser Met Ile Pro Ala Leu Arg Glu Leu Gly Ser Ala Thr Pro Glu Glu Tyr Asn Thr Val Val Gln Lys Pro Arg Gln Ile Leu Cys Gln Phe Ile Asp Arg Ile Leu Thr Asp Val Asn Val Val Ala Val Glu Leu Val Lys Lys Thr Asp Ser Gln Pro Thr Ser Val Met Leu Leu Asp Phe Ile Gln His Ile Met Lys Ser Ser Pro Leu Met Phe Val Asn Val Ser Giy Ser His Glu Arg Lys Gly Ser Cys Ile Glu Phe Ser Asn Tzp Ile Ile Thr Arg Leu Leu Arg Ile Ala Ala Thr Pro Ser Cys His Leu Leu His Lys Lys Ile Cys Glu Val Ile Cys Ser Leu Leu Phe Leu Phe Lys Ser Lys Ser Pro Ala Ile Phe Gly Val Leu Thr Lys Glu Leu Leu Gln Leu Phe Glu Asp Leu Val Tyr Leu His Arg Arg Asn Val Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu ACT CTG T'IT CCA AGA AGA ATA TTC CTT GAG TGG AGA ACA GCA GTT TAC 1968 Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln TAT AAG AAP, CCC ATC TGT CAG TTT TTG GTA GAA TCC CTT CAC TCT AGT 2832 Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Giu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe WO 97/18323 PCT/iJS96/19337 Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gin Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gin Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gin Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu TTG TGC AAT AAA CCG GTT GAT GGA AC,T AGT TCC ACA TTA AGC ATG AGC 6720 Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2644 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE; protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
Met Gly Glu His Gly Leu Glu Leu Ala Ser Met Ile Pro Ala Leu Arg Glu Leu Gly Ser Ala Thr Pro Glu Glu Tyr Asn Thr Val Val Gln Lys Pro Arg Gln Ile Leu Cys Gln Phe Ile Asp Arg Ile Leu Thr Asp Val Asn Val Val Ala Val Glu Leu Val Lys Lys Thr Asp Ser Gln Pro Thr Ser Val Met Leu Leu Asp Phe Ile Gln His Ile Met Lys Ser Ser Pro Leu Met Phe Val Asn Val Ser Gly Ser His Glu Arg Lys Gly Ser Cys Ile Glu Phe Ser Asn Trp Ile Ile Thr Arg Leu Leu Arg Ile Ala Ala Thr Pro Ser Cys His Leu Leu His Lys Lys Ile Cys Glu Val Ile Cys Ser Leu Leu Phe Leu Phe Lys Ser Lys Ser Pro Ala Ile Phe Gly Val Leu Thr Lys Glu Leu Leu Gln Leu Phe Glu Asp Leu Val Tyr Leu His Arg Arg Asn Val Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gin Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gin Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gin Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFO[tMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7624 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY : CDS
(B) LOCATION: 333..7562 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
CTTGTGAAGA GAATGTTI'TA CACTCTTGTT AGTGAAGTTT ATTCT'ITAAA AGTCAATCGT 60 TTAARAGCAA GAGTCCTGCT ATTTI"PGGGG TACTCACAAA AGAATTATTA CAACTTTTTG 300 Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly TAT TTA CAA TCA GCT CCT TTG CAG TTG ATG AGT ATG CAP, AAT TTA GAA 449 Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gin Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gin Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys GAG CTT TTT GTC TTA AGA ATG AAG GAA GCA TAT ACA CAT GCC C.AA ATA 2417 Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gin Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile 'Iyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gin Leu Ser Met Lys Ala WO 97/18323 PCT/[JS96/19337 Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gin Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gin Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2410 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gin Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gin Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu WO 97l18323 PCT/U S96l19337 _ Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Giu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gin Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr G1n Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gin Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gin Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gin Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Giu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gin Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7502 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear -(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7440 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile AAA TCC CTA GCA ATT AGC TTT TTA ACA GAA CTT TT'T CAG CTT GGA GGA 288 Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Vai Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile ILe Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln AAA GCT GAA TCC CTT CAG ATT TCC C'TT GAA TAC AGT GGC CTA AAG AAT 960 Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr TCA CCA CAG GCA CAA TCA CGA TGT GTG Z"TT CTT CTG ACT CTG TTT CCA 1440 Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gin Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp TCT GAA GAT GGA T'i'T ATA AAG GAG CTT TTT GTC TTA AGA ATG AAG GAA 2064 Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Giu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gin Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Giu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gin Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Giu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln WO 97/18323 PCT/US96/19337 _ Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr -Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Giy Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu - l 74-Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gin Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2480 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gin Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gin Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gin Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gin Cys Gln Thr Gln Gin Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Giy Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lvs Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pxo Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu 6?5 680 685 Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gin Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gin Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys 'I, .jr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr -isa-Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val IlP Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Giy Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR.SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9385 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(v) FRAGMENT TYPE: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 190..9357 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
Met Ser Leu Val Leu Asn Asp Leu Leu Ile Cys Cys Arg Gln Leu Glu His Asp Arg Ala Thr Glu Arg Lys Lys Glu Val Glu Lys Phe Lys Arg Leu Ile Arg Asp Pro Glu Thr Ile Lys His Leu Asp Arg His Ser Asp Ser Lys Gln Gly Lys Tyr Leu Asn Trp Asp Ala Val Phe Arg Phe Leu Gln Lys Tyr Ile Gln Lys Glu Thr Glu Cys Leu Arg Ile Ala Lys Pro Asn Val Ser Ala Ser Thr Gln Ala Ser Arg Gln Lys Lys Met Gln Glu Ile Ser Ser Leu Val Lys Tyr Phe Ile Lys Cys Ala Asn Arg Arg Ala Pro Arg Leu Lys Cys Gln Glu Leu Leu Asn Tyr Ile Met Asp Thr Val Lys Asp Ser Ser Asn Gly Ala Ile Tyr Gly Ala Asp Cys Ser Asn Ile Leu Leu Lys Asp Ile Leu Ser Val Arg Lys Tyr Trp Cys Glu Ile Ser Gln Gln Gln Trp Leu Glu Leu Phe Ser Val Tyr Phe Arg Leu Tyr Leu Lys Pro Ser Gln Asp Val His Arg Val Leu Val Ala Arg Ile Ile His Ala Val Thr Lys Gly Cys Cys Ser Gln Thr Asp Gly Leu Asn Ser Lys Phe Leu Asp Phe Phe Ser Lys Ala Ile Gln Cys Ala Arg Gln Glu Lys Ser Ser Ser Gly Leu Asn His Ile Leu Ala Ala Leu Thr Ile Phe Leu Lys Thr Leu Ala Val Asn Phe Arg Ile Arg Val Cys Glu Leu Gly Asp Glu Ile Leu Pro Thr Leu Leu Tyr Ile Trp Thr Gln His Arg Leu Asn Asp Ser Leu Lys Glu Val Ile Ile Glu Leu Phe Gln Leu Gln Ile Tyr Ile His His Pro Lys Gly Ala Lys Thr Gln Glu Lys Gly Ala Tyr Glu Ser Thr Lys Trp Arg Ser Ile Leu Tyr Asn Leu Tyr Asp Leu Leu Val Asn Glu Ile Ser His Ile Gly Ser Arg Gly Lys Tyr Ser Ser Gly Phe Arg Asn Ile Ala Val Lys Glu Asn Leu Ile Glu Leu Met Ala Asp Ile Cys His Gln Val Phe Asn Glu Asp Thr Arg Ser Leu Glu Ile Ser Gln Ser Tyr Thr Thr Thr Gln Arg Glu Ser Ser Asp Tyr Ser Val Pro Cys Lys Arg Lys Lys Ile Glu Leu Gly Trp Glu Val Ile Lys Asp His Leu Gln Lys Ser Gln Asn Asp Phe Asp Leu Val Pro Trp Leu Gln Ile Ala Thr Gln Leu Ile Ser Lys Tyr Pro Ala Ser Leu Pro Asn Cys Glu Leu Ser Pro Leu Leu Met Ile Leu Ser Gln Leu Leu Pro Gln Gln Arg His Gly Glu Arg Thr Pro Tyr Val Leu Arg Cys Leu Thr Glu Val Ala Leu Cys Gln Asp Lys Arg Ser Asn Leu Glu Ser Ser Gln Lys Ser Asp Leu Leu Lys Leu Trp Asn Lys Ile Trp Cys Ile Thr Phe Arg Gly Ile Ser Ser Glu Gin Ile Gln Ala Glu Asn Phe Gly Leu Leu Gly Ala Ile Ile Gln Gly Ser Leu Val Glu Val Asp Arg Glu Phe Trp Lys Leu Phe Thr Gly Ser Ala Cys Arg Pro Ser Cys Pro Ala Val Cys Cys WO 97/18323 PCT/[JS96/19337 Leu Thr Leu Ala Leu Thr Thr Ser Ile Val Pro Gly Ala Val Lys Met Gly Ile Glu Gln Asn Met Cys Glu Val Asn Arg Ser Phe Ser Leu Lys Glu Ser Ile Met Lys Trp Leu Leu Phe Tyr Gln Leu Glu Gly Asp Leu Glu Asn Ser Thr Glu Val Pro Pro Ile Leu His Ser Asn Phe Pro His Leu Val Leu Glu Lys Ile Leu Val Ser Leu Thr Met Lys Asn Cys Lys Ala Ala Met Asn Phe Phe Gln Ser Val Pro Glu Cys Glu His His Gln Lys Asp Lys Glu Glu Leu Ser Phe Ser Glu Val Glu Glu Leu Phe Leu Gln Thr Thr Phe Asp Lys Met Asp Phe Leu Thr Ile Val Arg Glu Cys Gly Ile Glu Lys His Gln Ser Ser Ile Gly Phe Ser Val His Gln Asn Leu Lys Glu Ser Leu Asp Arg Cys Leu Leu Gly Leu Ser Glu Gin Leu Leu Asn Asn Tyr Ser Ser Glu Ile Thr Asn Ser Glu Thr Leu Val Arg Cys Ser Arg Leu Leu Val Gly Val Leu Gly Cys Tyr Cys Tyr Met Gly Val Ile Ala Glu Glu Glu Ala Tyr Lys Ser Glu Leu Phe Gln Lys Ala Asn Ser Leu Met Gln Cys Ala Gly Glu Ser Ile Thr Leu Phe Lys Asn Lys Thr Asn Glu Glu Phe Arg Ile Gly Ser Leu Arg Asn Met Met Gln Leu Cys Thr Arg Cys Leu Ser Asn Cys Thr Lys Lys Ser Pro Asn Lys Ile Ala Ser Gly Phe Phe Leu Arg Leu Leu Thr Ser Lys Leu Met Asn Asp Ile Ala Asp Ile Cys Lys Ser Leu Ala Ser Phe Ile Lys Lys Pro Phe Asp Arg Gly Glu Val Glu Ser Met Glu Asp Asp Thr Asn Gly Asn Leu Met Glu Val Glu Asp Gln Ser Ser Met Asn Leu Phe Asn Asp Tyr Pro Asp Ser Ser Val Ser Asp Ala Asn Glu Pro Gly Glu Ser Gln Ser Thr Ile Gly Ala Ile Asn Pro Leu Ala Glu Glu Tyr Leu Ser Lys Gln Asp Leu Leu Phe Leu Asp Met Leu Lys Phe Leu Cys Leu Cys Val Thr Thr Ala Gln Thr Asn Thr Val Ser Phe Arg Ala Ala Asp Ile Arg Arg Lys Leu Leu Met Leu Ile Asp Ser Ser Thr Leu Glu Pro Thr Lys Ser Leu His Leu His Met Tyr Leu Met Leu Leu Lys Glu Leu Pro Gly Glu Glu Tyr Pro Leu Pro Met Glu Asp Val Leu Glu Leu Leu Lys Pro Leu Ser Asn Val Cys Ser Leu Tyr Arg Arg Asp Gln Asp Val Cys Lys Thr Ile Leu Asn His Val Leu His Val Val Lys Asn Leu Gly Gln Ser Asn Met Asp Ser Glu Asn Thr Arg Asp Ala Gln Gly Gln Phe Leu Thr Val ATT GGA GCA TTT TGG CAT CTA ACA AAG GAG AGG AAA TAT ATA TI'C TCT 3300 Ile Gly Ala Phe Trp His Leu Thr Lys Glu Arg Lys Tyr Ile Phe Ser Val Arg Met Ala Leu Val Asn Cys Leu Lys Thr Leu Leu Glu Ala Asp Pro Tyr Ser Lys Trp Ala Ile Leu Asn Val Met Gly Lys Asp Phe Pro Val Asn Glu Val Phe Thr Gln Phe Leu Ala Asp Asn His His Gln Val Arg Met Leu Ala Ala Glu Ser Ile Asn Arg Leu Phe Gln Asp Thr Lys Gly Asp Ser Ser Arg Leu Leu Lys Ala Leu Pro Leu Lys Leu Gln Gln Thr Ala Phe Glu Asn Ala Tyr Leu Lys Ala Gln Glu Gly Met Arg Glu Met Ser His Ser Ala Glu Asn Pro Glu Thr Leu Asp Glu Ile Tyr Asn Arg Lys Ser Val Leu Leu Thr Leu Ile Ala Val Val Leu Ser Cys Ser Pro Ile Cys Glu Lys Gln Ala Leu Phe Ala Leu Cys Lys Ser Val Lys Glu Asn Gly Leu Glu Pro His Leu Val Lys Lys Val Leu Glu Lys Val Ser Glu Thr Phe Gly Tyr Arg Arg Leu Glu Asp Phe Met Ala Ser His Leu Asp Tyr Leu Val Leu Glu Trp Leu Asn Leu Gln Asp Thr Glu Tyr Asn Leu Ser Ser Phe Pro Phe Ile Leu Leu Asn Tyr Thr Asn Ile Glu Asp Phe Tyr Arg Ser Cys Tyr Lys Val Leu Ile Pro His Leu Val Ile Arg Ser His Phe Asp Glu Val Lys Ser Ile Ala Asn Gln Ile Gln Glu Asp Trp Lys Ser Leu Leu Thr Asp Cys Phe Pro Lys Ile Leu Val Asn Ile Leu Pro Tyr Phe Ala Tyr Glu Gly Thr Arg Asp Ser Gly Met Ala Gln Gln Arg Glu Thr Ala Thr Lys Val Tyr Asp Met Leu Lys Ser Glu Asn Leu Leu Gly Lys Gln Ile Asp His Leu Phe Ile Ser Asn Leu Pro Glu Ile Val Val Glu Leu Leu Met Thr Leu His Glu Pro Ala Asn Ser Ser Ala Ser Gln Ser Thr Asp Leu Cys Asp Phe Ser Gly Asp Leu Asp Pro Ala Pro Asn Pro Pro His Phe Pro Ser His Val Ile Lys Ala Thr Phe Ala Tyr Ile Ser Asn Cys His Lys Thr Lys Leu Lys Ser Ile Leu Glu Ile Leu Ser Lys Ser Pro Asp Ser Tyr Gln Lys Ile Leu Leu Ala Ile Cys Glu Gln Ala Ala Glu Thr Asn Asn Val Tyr Lys Lys His Arg Ile Leu Lys Ile Tyr His Leu Phe Val Ser Leu Leu Leu Lys Asp Ile Lys Ser Gly Leu Gly Gly Ala Trp Ala Phe Val Leu Arg Asp Val Ile Tyr Thr Leu Ile His Tyr Ile Asn Gln Arg Pro Ser Cys Ile Met Asp Val Ser Leu Arg Ser Phe Ser Leu Cys Cys Asp Leu Leu Ser Gln Val Cys Gln Thr Ala Val Thr Tyr Cys Lys Asp Ala Leu Glu Asn His Leu His Val Ile Val Gly Thr Leu Ile Pro Leu Val Tyr Glu Gln Val Glu Val Gln Lys Gln Val Leu Asp Leu Leu Lys Tyr Leu Val Ile Asp Asn Lys Asp Asn Glu Asn Leu Tyr Ile Thr Ile Lys Leu Leu Asp Pro Phe Pro Asp His Val Val Phe Lys Asp Leu Arg Ile Thr Gln Gln Lys Ile Lys Tyr Ser Arg Gly Pro Phe Ser Leu Leu Glu Glu Ile Asn His Phe Leu Ser Val Ser Val Tyr Asp Ala Leu Pro Leu Thr Arg Leu Glu Gly Leu Lys Asp Leu Arg Arg Gln Leu Glu Leu His Lys Asp Gln Met Val Asp Ile Met Arg Ala Ser Gln Asp Asn Pro Gln Asp Gly Ile Met Val Lys Leu Val Val Asn Leu Leu Gln Leu Ser Lys Met Ala Ile Asn His Thr Gly Glu Lys Glu Val Leu Glu Ala Val Gly Ser Cys Leu Gly Glu Val Gly Pro Ile Asp Phe Ser Thr Ile Ala Ile Gln His Ser Lys Asp Ala Ser Tyr Thr Lys Ala Leu Lys Leu Phe Glu Asp Lys Glu Leu Gln Trp Thr Phe Ile Met Leu Thr Tyr Leu Asn Asn Thr Leu Val Glu Asp Cys Val Lys Val Arg Ser Ala Ala Val Thr Cys Leu Lys Asn Ile Leu Ala Thr Lys Thr Gly His Ser Phe Trp Glu Ile Tyr Lys Met Thr Thr Asp Pro Met Leu Ala Tyr Leu Gln Pro Phe Arg Thr Ser Arg Lys Lys Phe Leu Glu Val Pro Arg Phe Asp Lys Glu Asn Pro Phe Glu Gly Leu Asp Asp Ile Asn Leu Trp Ile Pro Leu Ser Glu Asn His Asp Ile Trp Ile Lys Thr Leu Thr Cys Ala Phe Leu Asp Ser Gly Gly Thr Lys Cys Glu Ile Leu Gln Leu Leu Lys Pro Met Cys Glu Val Lys Thr Asp Phe Cys Gln Thr Val Leu Pro Tyr Leu Ile His Asp Ile Leu Leu Gln Asp Thr Asn Glu Ser Trp Arg Asn Leu Leu Ser Thr His Val Gln Gly Phe Phe Thr Ser Cys Leu Arg His Phe Ser Gln Thr Ser Arg Ser Thr Thr Pro Ala Asn Leu Asp Ser Glu Ser Glu His Phe Phe Arg Cys Cys Leu Asp Lys Lys Ser Gln Arg Thr Met Leu Ala Val Val Asp Tyr Met Arg Arg Gln Lys Arg Pro Ser Ser Gly Thr Ile Phe Asn Asp Ala Phe Trp Leu Asp Leu Asn Tyr Leu Glu Val Ala Lys Val Ala Gln Ser Cys Ala Ala His Phe Thr Ala Leu Leu Tyr Ala Glu Ile Tyr Ala Asp Lys Lys Ser Met Asp Asp Gin Glu Lys Arg Ser Leu Ala Phe Glu Glu Gly Ser Gln Ser Thr Thr Ile Ser Ser Leu Ser Glu Lys Ser Lys Glu Glu Thr Gly Ile Ser Leu Gln Asp Leu Leu Leu Glu Ile Tyr Arg Ser Ile Gly Glu Pro Asp Ser Leu Tyr Gly Cys Gly Gly Gly Lys Met Leu Gln Pro Ile Thr Arg Leu Arg Thr Tyr Glu His Glu Ala Met Trp Gly Lys Ala Leu Val Thr Tyr Asp Leu Glu Thr Ala Ile Pro Ser Ser Thr Arg Gln Ala Gly Ile Ile Gln Ala Leu Gln Asn Leu Gly Leu Cys His Ile Leu Ser Val Tyr Leu Lys Gly Leu Asp Tyr Glu Asn Lys Asp Trp Cys Pro Glu Leu Glu Glu Leu His Tyr Gln Ala Ala Trp Arg Asn Met Gln Trp Asp His Cys Thr Ser Val Ser Lys Glu Val Glu Gly Thr Ser Tyr His Glu Ser Leu Tyr Asn Ala Leu Gln Ser Leu Arg Asp Arg Glu Phe Ser Thr Phe Tyr Glu Ser Leu Lys Tyr Ala Arg Val Lys Glu Val Glu Glu Met Cys Lys Arg Ser Leu Glu Ser Val Tyr Ser Leu Tyr Pro Thr Leu Ser Arg Leu Gln Ala Ile Gly Glu Leu Glu Ser Ile Gly Glu Leu Phe Ser Arg Ser Val Thr His Arg Gln Leu Ser Glu Val Tyr Ile Lys Trp Gln Lys His Ser Gln Leu Leu Lys Asp Ser Asp Phe Ser Phe Gln Glu Pro Ile Met Ala Leu Arg Thr Val Ile Leu Glu Ile Leu Met Glu Lys Glu Met Asp Asn Ser Gln Arg Glu Cys Ile Lys Asp Ile Leu Thr Lys His Leu Val Glu Leu Ser Ile Leu Ala Arg Thr Phe Lys Asn Thr Gln Leu Pro Glu Arg Ala Ile Phe Gin Ile Lys Gln Tyr Asn Ser Val Ser Cys Gly Val Ser Glu Trp Gln Leu Glu Glu Ala Gln Val Phe Trp Ala Lys Lys Glu Gln Ser Leu Ala Leu Ser Ile Leu Lys Gln Met Ile Lys Lys Leu Asp Ala Ser Cys Ala Ala Asn Asn Pro Ser Leu Lys Leu Thr Tyr Thr Glu Cys Leu Arg Val Cys Gly Asn Trp Leu Ala Glu Thr Cys Leu Glu Asn Pro Ala Val Ile Met Gln Thr Tyr Leu Glu Lys Ala Val Glu Val Ala Gly Asn Tyr Asp Gly Glu Ser Ser Asp Glu Leu Arg Asn Gly Lys Met Lys Ala Phe Leu Ser Leu Ala Arg Phe Ser Asp Thr Gln Tyr Gln Arg Ile Glu Asn Tyr Met Lys Ser Ser Glu Phe Glu Asn Lys Gln Ala Leu Leu Lys Arg Ala Lys Glu Glu Val Gly Leu Leu Arg Glu His Lys Ile Gln Thr Asn Arg Tyr Thr Val Lys Val Gln Arg Glu Leu Glu Leu Asp Glu Leu Ala Leu Arg Ala Leu Lys Glu Asp Arg Lys Arg Phe Leu Cys Lys Ala Val Glu Asn Tyr Ile Asn Cys Leu Leu Ser Gly Glu Glu His Asp Met Trp Val Phe Arg Leu Cys Ser Leu Trp Leu Glu Asn Ser Gly Val Ser Glu Val Asn Gly Met Met Lys Arg Asp Gly Met Lys Ile Pro Thr Tyr Lys Phe Leu Pro Leu Met Tyr Gln Leu Ala Ala Arg Met Gly Thr Lys Met Met Gly Gly Leu Gly Phe His Glu Val Leu Asn Asn Leu Ile Ser Arg Ile Ser Met Asp His Pro His His Thr Leu Phe Ile Ile Leu Ala Leu Ala Asn Ala Asn Arg Asp Glu Phe Leu Thr Lys Pro Glu Val Ala Arg Arg Ser Arg Ile Thr Lys Asn Val Pro Lys Gln Ser Ser Gln Leu Asp Glu Asp Arg Thr Glu Ala Ala Asn Arg Ile Ile Cys Thr Ile Arg Ser Arg Arg Pro Gln Met Val Arg Ser Val Glu Ala Leu Cys Asp Ala Tyr Ile Ile Leu Ala Asn Leu Asp Ala Thr Gln Trp Lys Thr Gln Arg Lys Gly Ile Asn Ile Pro Ala Asp Gln Pro Ile Thr Lys Leu Lys Asn Leu Glu Asp Val Val Val Pro Thr Met Glu Ile Lys Val Asp His Thr Gly Glu Tyr Gly Asn Leu Val Thr Ile Gln Ser Phe Lys Ala Glu Phe Arg Leu Ala Gly Gly Val Asn Leu Pro Lys Ile Ile Asp Cys Val Gly Ser Asp Gly Lys Glu Arg Arg Gln Leu Val Lys Gly Arg Asp Asp Leu Arg Gln Asp Ala Val Met Gln Gln Val Phe Gln Met Cys Asn Thr Leu Leu Gln Arg Asn Thr Glu Thr Arg Lys Arg Lys Leu Thr Ile Cys Thr Tyr Lys Val Val Pro Leu Ser Gln Arg Ser Gly Val Leu Glu Trp Cys Thr Gly Thr Val Pro Ile Gly Glu Phe Leu Val Asn Asn Glu Asp Gly Ala His Lys Arg Tyr Arg Pro Asn Asp Phe Ser Ala Phe Gln Cys Gln Lys Lys Met Met Glu Val Gln Lys Lys Ser Phe Glu Glu Lys Tyr Glu Val Phe Met Asp Val Cys Gln Asn Phe Gln Pro Val Phe Arg Tyr Phe Cys Met Glu Lys Phe Leu Asp Pro Ala Ile Trp Phe Glu Lys Arg Leu Ala Tyr Thr Arg Ser Val Ala Thr Ser Ser Ile Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Val Gln Asn Ile Leu Ile Asn Glu Gln Ser Ala Glu Leu Val His Ile Asp Leu Gly Val Ala Phe Glu Gln Gly Lys Ile Leu Pro Thr Pro Glu Thr Val Pro Phe Arg Leu Thr Arg Asp Ile Val Asp Gly Met Gly Ile Thr Gly Val Glu Gly Val Phe Arg Arg Cys Cys Glu Lys Thr Met Glu Val Met Arg Asn Ser Gln Glu Thr Leu Leu Thr Ile Val Glu Val Leu Leu Tyr Asp Pro Leu Phe Asp Trp Thr Met Asn Pro Leu Lys Ala Leu Tyr Leu Gln Gln Arg Pro Glu Asp Glu Thr Glu Leu His Pro Thr Leu Asn Ala Asp Asp Gln WO 97/18323 PCTfUS96/19337 Glu Cys Lys Arg Asn Leu Ser Asp Ile Asp Gln Ser Phe Asp Lys Val Ala Glu Arg Val Leu Met Arg Leu Gln Glu Lys Leu Lys Gly Val Glu Glu Gly Thr Val Leu Ser Val Gly Gly Gln Val Asn Leu Leu Ile Gln Gln Ala Ile Asp Pro Lys Asn Leu Ser Arg Leu Phe Pro Gly Trp Lys Ala Trp Val (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3056 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
Met Ser Leu Val Leu Asn Asp Leu Leu Ile Cys Cys Arg Gln Leu Glu His Asp Arg Ala Thr Glu Arg Lys Lys Glu Val Glu Lys Phe Lys Arg Leu Ile Arg Asp Pro Glu Thr Ile Lys His Leu Asp Arg His Ser Asp Ser Lys Gln Gly Lys Tyr Leu Asn Trp Asp Ala Val Phe Arg Phe Leu Gln Lys Tyr Ile Gln Lys Glu Thr Glu Cys Leu Arg Ile Ala Lys Pro Asn Val Ser Ala Ser Thr Gln Ala Ser Arg Gln Lys Lys Met Gln Glu Ile Ser Ser Leu Val Lys Tyr Phe Ile Lys Cys Ala Asn Arg Arg Ala Pro Arg Leu Lys Cys Gln Glu Leu Leu Asn Tyr Ile Met Asp Thr Val Lys Asp Ser Ser Asn Gly Ala Ile Tyr Gly Ala Asp Cys Ser Asn Ile Leu Leu Lys Asp Ile Leu Ser Val Arg Lys Tyr Trp Cys Glu Ile Ser Gln Gln Gln Trp Leu Glu Leu Phe Ser Val Tyr Phe Arg Leu Tyr Leu Lys Pro Ser Gln Asp Val His Arg Val Leu Val Ala Arg Ile Ile His Ala Val Thr Lys Gly Cys Cys Ser Gln Thr Asp Gly Leu Asn Ser Lys Phe Leu Asp Phe Phe Ser Lys Ala Ile Gln Cys Ala Arg Gln Glu Lys Ser Ser Ser Gly Leu Asn His Ile Leu Ala Ala Leu Thr Ile Phe Leu Lys Thr Leu Ala Val Asn Phe Arg Ile Arg Val Cys Glu Leu Gly Asp Glu Ile Leu Pro Thr Leu Leu Tyr Ile Trp Thr Gln His Arg Leu Asn Asp Ser Leu Lys Glu Val Ile Ile Glu Leu Phe Gln Leu Gln Ile Tyr Ile His His Pro Lys Gly Ala Lys Thr Gln Glu Lys Gly Ala Tyr Glu Ser Thr Lys Trp Arg Ser Ile Leu Tyr Asn Leu Tyr Asp Leu Leu Val Asn Glu Ile Ser His Ile Gly Ser Arg Gly Lys Tyr Ser Ser Gly Phe Arg Asn Ile Ala Val Lys Glu Asn Leu Ile Glu Leu Met Ala Asp Ile Cys His Gln Val Phe Asn Glu Asp Thr Arg Ser Leu Glu Ile Ser Gln Ser Tyr Thr Thr Thr Gln Arg Glu Ser Ser Asp Tyr Ser Val Pro Cys Lys Arg Lys Lys Ile Glu Leu Gly Trp Glu Val Ile Lys Asp His Leu Gln Lys Ser Gln Asn Asp Phe Asp Leu Val Pro Trp Leu Gln Ile Ala Thr Gin Leu Ile Ser Lys Tyr Pro Ala Ser Leu Pro Asn Cys Glu Leu Ser Pro Leu Leu Met Ile Leu Ser Gln Leu Leu Pro Gln Gln Arg His Gly Glu Arg Thr Pro Tyr Val Leu Arg Cys Leu Thr Glu Val Ala Leu Cys Gln Asp Lys Arg Ser Asn Leu Glu Ser Ser Gln Lys Ser Asp Leu Leu Lys Leu Trp Asn Lys Ile Trp Cys Ile Thr Phe Arg Gly Ile Ser Ser Glu Gln Ile Gln Ala Glu Asn Phe Gly Leu Leu Gly Ala Ile Ile Gln Gly Ser Leu Val Glu Val Asp Arg Glu Phe Trp Lys Leu Phe Thr Gly Ser Ala Cys Arg Pro Ser Cys Pro Ala Val Cys Cys Leu Thr Leu Ala Leu Thr Thr Ser Ile Val Pro Gly Ala Val Lys Met Gly Ile Glu Gln Asn Met Cys Glu Val Asn Arg Ser Phe Ser Leu Lys Glu Ser Ile Met Lys Trp Leu Leu Phe Tyr Gin Leu Glu Gly Asp Leu Glu Asn Ser Thr Glu Val Pro Pro Ile Leu His Ser Asn Phe Pro His Leu Val Leu Glu Lys Ile Leu Val Ser Leu Thr Met Lys Asn Cys Lys Ala Ala Met Asn Phe Phe Gln Ser Val Pro Glu Cys Glu His His Gln Lys Asp Lys Glu Glu Leu Ser Phe Ser Glu Val Glu Glu Leu Phe Leu Gln Thr Thr Phe Asp Lys Met Asp Phe Leu Thr Ile Val Arg Glu Cys Gly Ile Glu Lys His Gln Ser Ser Ile Gly Phe Ser Val His Gln Asn Leu Lys Glu Ser Leu Asp Arg Cys Leu Leu Gly Leu Ser Glu Gln Leu Leu Asn Asn Tyr Ser Ser Glu Ile Thr Asn Ser Glu Thr Leu Val Arg Cys Ser Arg Leu Leu Val Gly Val Leu Gly Cys Tyr Cys Tyr Met Gly Val Ile Ala Glu Glu Glu Ala Tyr Lys Ser Glu Leu Phe Gln Lys Ala Asn Ser Leu Met Gln Cys Ala Gly Glu Ser Ile Thr Leu Phe Lys Asn Lys Thr Asn Glu Glu Phe Arg Ile Gly Ser Leu Arg Asn Met Met Gln Leu Cys Thr Arg Cys Leu Ser Asn Cys Thr Lys Lys Ser Pro Asn Lys Ile Ala Ser Gly Phe Phe Leu Arg Leu Leu Thr Ser Lys Leu Met Asn Asp Ile Ala Asp Ile Cys Lys Ser Leu Ala Ser Phe Ile Lys Lys Pro Phe Asp Arg Gly Glu Val Glu Ser Met Glu Asp Asp Thr Asn Gly Asn Leu Met Glu Val Glu Asp Gln Ser Ser Met Asn Leu Phe Asn Asp Tyr Pro Asp Ser Ser Val Ser Asp Ala Asn Glu Pro Gly Glu Ser Gln Ser Thr Ile Gly Ala Ile Asn Pro Leu Ala Glu Giu Tyr Leu Ser Lys Gln Asp Leu Leu Phe Leu Asp Met Leu Lys Phe Leu Cys Leu Cys Val Thr Thr Ala Gln Thr Asn Thr Val Ser Phe Arg Ala Ala Asp Ile Arg Arg Lys Leu Leu Met Leu Ile Asp Ser Ser Thr Leu Glu Pro Thr Lys Ser Leu His Leu His Met Tyr Leu Met Leu Leu Lys Glu Leu Pro Gly Glu Glu Tyr Pro Leu Pro Met Glu Asp Val Leu Glu Leu Leu Lys Pro Leu Ser Asn Val Cys Ser Leu Tyr Arg Arg Asp Gln Asp Val Cys Lys Thr Ile Leu Asn His Val Leu His Val Val Lys Asn Leu Gly Gln Ser Asn Met Asp Ser Glu Asn Thr Arg Asp Ala Gln Gly Gln Phe Leu Thr Val Ile Gly Ala Phe Trp His Leu Thr Lys Glu Arg Lys Tyr Ile Phe Ser Val Arg Met Ala Leu Val Asn Cys Leu Lys Thr Leu Leu Glu Ala Asp Pro Tyr Ser Lys Trp Ala Ile Leu Asn Val Met Gly Lys Asp Phe Pro Val Asn Glu Val Phe Thr Gln Phe Leu Ala Asp Asn His His Gln Val Arg Met Leu Ala Ala Glu Ser Ile Asn Arg Leu Phe Gln Asp Thr Lys Gly Asp Ser Ser Arg Leu Leu Lys Ala Leu Pro Leu Lys Leu Gln Gln Thr Ala Phe Glu Asn Ala Tyr Leu Lys Ala Gln Glu Gly Met Arg Glu Met Ser His Ser Ala Glu Asn Pro Glu Thr Leu Asp Glu Ile Tyr Asn Arg Lys Ser Val Leu Leu Thr Leu Ile Ala Val Val Leu Ser Cys Ser Pro Ile Cys Glu Lys Gln Ala Leu Phe Ala Leu Cys Lys Ser Val Lys Glu Asn Giy Leu Glu Pro His Leu Val Lys Lys Val Leu Glu Lys Val Ser Glu Thr Phe Gly Tyr Arg Arg Leu Glu Asp Phe Met Ala Ser His Leu Asp Tyr Leu Val Leu Glu Trp Leu Asn Leu Gln Asp Thr Glu Tyr Asn Leu Ser Ser Phe Pro Phe Ile Leu Leu Asn Tyr Thr Asn Ile Glu Asp Phe Tyr Arg Ser Cys Tyr Lys Val Leu Ile Pro His Leu Val Ile Arg Ser His Phe Asp Glu Val Lys Ser Ile Ala Asn Gln Ile Gln Glu Asp Trp Lys Ser Leu Leu Thr Asp Cys Phe Pro Lys Ile Leu Val Asn Ile Leu Pro Tyr Phe Ala Tyr Glu Gly Thr Arg Asp Ser Gly Met Ala Gln Gln Arg Glu Thr Ala Thr Lys Val Tyr Asp Met Leu Lys Ser Glu Asn Leu Leu Gly Lys Gln Ile Asp His Leu Phe Ile Ser Asn Leu Pro Glu Ile Val Val Glu Leu Leu Met Thr Leu His Glu Pro Ala Asn Ser Ser Ala Ser Gln Ser Thr Asp Leu Cys Asp Phe Ser Gly Asp Leu Asp Pro Ala Pro Asn Pro Pro His Phe Pro Ser His Val Ile Lys Ala Thr Phe Ala Tyr Ile Ser Asn Cys His Lys Thr Lys Leu Lys Ser Ile Leu Glu Ile Leu Ser Lys Ser Pro Asp Ser Tyr Gln Lys Ile Leu Leu Ala Ile Cys Glu Gln Ala Ala Glu Thr Asn Asn Val Tyr Lys Lys His Arg Ile Leu Lys Ile Tyr His Leu Phe Val Ser Leu Leu Leu Lys Asp Ile Lys Ser Gly Leu Gly Gly Ala Trp Ala Phe Val Leu Arg Asp Val Ile Tyr Thr Leu Ile His Tyr Ile Asn Gln Arg Pro Ser Cys Ile Met Asp Val Ser Leu Arg Ser Phe Ser Leu Cys Cys Asp Leu Leu Ser G2n Val Cys Gln Thr Ala Val Thr Tyr Cys Lys Asp Ala Leu Glu Asn His Leu His Val Ile Val Gly Thr Leu Ile Pro Leu Val Tyr Glu Gln Val Glu Val Gln Lys Gin Val Leu Asp Leu Leu Lys Tyr Leu Val Ile Asp Asn Lys Asp Asn Glu Asn Leu Tyr Ile Thr Ile Lys Leu Leu Asp Pro Phe Pro Asp His Val Val Phe Lys Asp Leu Arg Ile Thr Gln Gln Lys Ile Lys Tyr Ser Arg Gly Pro Phe Ser Leu Leu Glu Glu Ile Asn His Phe Leu Ser Val Ser Val Tyr Asp Ala Leu Pro Leu Thr Arg Leu Glu Gly Leu Lys Asp Leu Arg Arg Gln Leu Glu Leu His Lys Asp Gln Met Val Asp Ile Met Arg Ala Ser Gln Asp Asn Pro Gln Asp Gly Ile Met Val Lys Leu Val Val Asn Leu Leu Gln Leu Ser Lys Met Ala Ile Asn His Thr Gly Glu Lys Glu Val Leu Glu Ala Val Gly Ser Cys Leu Gly Glu Val Gly Pro Ile Asp Phe Ser Thr Ile Ala Ile Gln His Ser Lys Asp Ala Ser Tyr Thr Lys Ala Leu Lys Leu Phe Glu Asp Lys Glu Leu Gln Trp Thr Phe Ile Met Leu Thr Tyr Leu Asn Asn Thr Leu Val Glu Asp Cys Val Lys Val Arg Ser Ala Ala Val Thr Cys Leu Lys Asn Ile Leu Ala Thr Lys Thr Gly His Ser Phe Trp Glu Ile Tyr Lys Met Thr Thr Asp Pro Met Leu Ala Tyr Leu Gin Pro Phe Arg Thr Ser Arg Lys Lys Phe Leu Glu Val Pro Arg Phe Asp Lys Glu Asn Pro Phe Glu Gly Leu Asp Asp Ile Asn Leu Trp Ile Pro Leu Ser Glu Asn His Asp Ile Trp Ile Lys Thr Leu Thr Cys Ala Phe Leu Asp Ser Gly Gly Thr Lys Cys Glu Ile Leu Gln Leu Leu Lys Pro Met Cys Glu Val Lys Thr Asp Phe Cys Gln Thr Val Leu Pro Tyr Leu Ile His Asp Ile Leu Leu Gln Asp Thr Asn Glu Ser Trp Arg Asn Leu Leu Ser Thr His Val Gln Gly Phe Phe Thr Ser Cys Leu Arg His Phe Ser Gln Thr Ser Arg Ser Thr Thr Pro Ala Asn Leu Asp Ser Glu Ser Glu His Phe Phe Arg Cys Cys Leu Asp Lys Lys Ser Gln Arg Thr Met Leu Ala Val Val Asp Tyr Met Arg Arg Gln Lys Arg Pro Ser Ser Gly Thr Ile Phe Asn Asp Ala Phe Trp Leu Asp Leu Asn Tyr Leu Glu Val Ala Lys Val Ala Gln Ser Cys Ala Ala His Phe Thr Ala Leu Leu Tyr Ala Glu Ile Tyr Ala Asp Lys Lys Ser Met Asp Asp Gln Glu Lys Arg Ser Leu Ala Phe Glu Glu Gly Ser Gln Ser Thr Thr Ile Ser Ser Leu Ser Glu Lys Ser Lys Glu Glu Thr Gly Ile Ser Leu Gln Asp Leu Leu Leu Glu Ile Tyr Arg Ser Ile Gly Glu Pro Asp Ser Leu Tyr Gly Cys Gly Gly Gly Lys Met Leu Gln Pro Ile Thr Arg Leu Arg Thr Tyr Glu His Glu Ala Met Trp Gly Lys Ala Leu Val Thr Tyr Asp Leu Glu Thr Ala Ile Pro Ser Ser Thr Arg Gln Ala Gly Ile Ile Gin Ala Leu Gln Asn Leu Gly Leu Cys His Ile Leu Ser Val Tyr Leu Lys Gly Leu Asp Tyr Glu Asn Lys Asp Trp Cys Pro Glu Leu Glu Glu Leu His Tyr Gln Ala Ala Trp Arg Asn Met Gln Trp Asp His Cys Thr Ser Val Ser Lys Glu Val Glu Gly Thr Ser Tyr His Glu Ser Leu Tyr Asn Ala Leu Gln Ser Leu Arg Asp Arg Glu Phe Ser Thr Phe Tyr Glu Ser Leu Lys Tyr Ala Arg Val Lys Glu Val Glu Glu Met Cys Lys Arg Ser Leu Glu Ser Val Tyr Ser Leu Tyr Pro Thr Leu Ser Arg Leu Gln Ala Ile Gly Glu Leu Glu Ser Ile Gly Glu Leu Phe Ser Arg Ser Val Thr His Arg Gln Leu Ser Giu Val Tyr Ile Lys Trp Gln Lys His Ser Gln Leu Leu Lys Asp Ser Asp Phe Ser Phe Gin Glu Pro Ile Met Ala Leu Arg Thr Val Ile Leu Glu Ile Leu Met Glu Lys Glu Met Asp Asn Ser Gln Arg Glu Cys Ile Lys Asp Ile Leu Thr Lys His Leu Val Glu Leu Ser Ile Leu Ala Arg Thr Phe Lys Asn Thr Gln Leu Pro Glu Arg Ala Ile Phe Gln Ile Lys Gln Tyr Asn Ser Val Ser Cys Gly Val Ser Glu Trp Gln Leu Glu Glu Ala Gln Val Phe Trp Ala Lys Lys Glu Gln Ser Leu Ala Leu Ser Ile Leu Lys Gln Met Ile Lys Lys Leu Asp Ala Ser Cys Ala Ala Asn Asn Pro Ser Leu Lys Leu Thr Tyr Thr Glu Cys Leu Arg Val Cys Gly Asn Trp Leu Ala Glu Thr Cys Leu Glu Asn Pro Ala Val Ile Met Gln Thr Tyr Leu Glu Lys Ala Val Glu Val Ala Gly Asn Tyr Asp Gly Glu Ser Ser Asp Glu Leu Arg Asn Gly Lys Met Lys Ala Phe Leu Ser Leu Ala Arg Phe Ser Asp Thr Gln Tyr Gln Arg Ile Glu Asn Tyr Met Lys Ser Ser Glu Phe Glu Asn Lys Gln Ala Leu Leu Lys Arg Ala Lys Glu Glu Val Gly Leu Leu Arg Glu His Lys Ile Gln Thr Asn Arg Tyr Thr Val Lys Val Gln Arg Glu Leu Glu Leu Asp Glu Leu Ala Leu Arg Ala Leu Lys Glu Asp Arg Lys Arg Phe Leu Cys Lys Ala Val Glu Asn Tyr Ile Asn Cys Leu Leu Ser Gly Glu Glu His Asp Met Trp Val Phe Arg Leu Cys Ser Leu Trp Leu Glu Asn Ser Gly Val Ser Glu Val Asn Gly Met Met Lys Arg Asp Gly Met Lys Ile Pro Thr Tyr Lys Phe Leu Pro Leu Met Tyr Gln Leu Ala Ala Arg Met Gly Thr Lys Met Met Gly Gly Leu Gly Phe His Glu Val Leu Asn Asn Leu Ile Ser Arg Ile Ser Met Asp His Pro His His Thr Leu Phe Ile Ile Leu Ala Leu Ala Asn Ala Asn Arg Asp Glu Phe Leu Thr Lys Pro Glu Val Ala Arg Arg Ser Arg Ile Thr Lys Asn Val Pro Lys Gln Ser Ser Gln Leu Asp Glu Asp Arg Thr Glu Ala Ala Asn Arg Ile Ile Cys Thr Ile Arg Ser Arg Arg Pro Gln Met Val Arg Ser Val Glu Ala Leu Cys Asp Ala Tyr Ile Ile Leu Ala Asn Leu Asp Ala Thr Gln Trp Lys Thr Gin Arg Lys Gly Ile Asn Ile Pro Ala Asp Gin Pro Ile Thr Lys Leu Lvs Asn Leu Glu Asp Val Val Val Pro Thr Met Glu Ile Lys Val Asp His Thr Gly Glu Tyr Gly Asn Leu Val Thr Ile Gln Ser Phe Lys Ala Glu Phe Arg Leu Ala Gly Gly Val Asn Leu Pro Lys Ile Ile Asp Cys Val Gly Ser Asp Gly Lys Glu Arg Arg Gln Leu Val Lys Gly Arg Asp Asp Leu Arg Gln Asp Ala Val Met Gln Gln Val Phe Gln Met Cys Asn Thr Leu Leu Gln Arg Asn Thr Glu Thr Arg Lys Arg Lys Leu Thr Ile Cys Thr Tyr Lys Val Val Pro Leu Ser Gln Arg Ser Gly Val Leu Glu Trp Cys Thr Gly Thr Val Pro Ile Gly Glu Phe Leu Val Asn Asn Glu Asp Gly Ala His Lys Arg Tyr Arg Pro Asn Asp Phe Ser Ala Phe Gln Cys Gln Lys Lys Met Met Glu Val Gln Lys Lys Ser Phe Glu Glu Lys Tyr Glu Val Phe Met Asp Val Cys Gln Asn Phe Gln Pro Val Phe Arg Tyr Phe Cys Met Glu Lys Phe Leu Asp Pro Ala Ile Trp Phe Glu Lys Arg Leu Ala Tyr Thr Arg Ser Val Ala Thr Ser Ser Ile Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Val Gln Asn Ile Leu Ile Asn Glu Gln Ser Ala Glu Leu Val His Ile Asp Leu Gly Val Ala Phe Glu Gln Gly Lys Ile Leu Pro Thr Pro Glu Thr Val Pro Phe Arg Leu Thr Arg Asp Ile Val Asp Gly Met Gly Ile Thr Gly Val Glu Giy Val Phe Arg Arg Cys Cys Glu Lys Thr Met Glu Val Met Arg Asn Ser Gln Glu Thr Leu Leu Thr Ile Val Glu Val Leu Leu Tyr Asp Pro Leu Phe Asp Trp Thr Met Asn Pro Leu Lys Ala Leu Tyr Leu Gln Gln Arg Pro Giu Asp Glu Thr Glu Leu His Pro Thr Leu Asn Ala Asp Asp Gln Glu Cys Lys Arg Asn Leu Ser Asp Ile Asp Gln Ser Phe Asp Lys Val Ala Glu Arg Val Leu Met Arg Leu Gln Glu Lys Leu Lys Gly Val Glu Glu Gly Thr Val Leu Ser Val Gly Gly Gln Val Asn Leu Leu Ile Gln Gln Ala Ile Asp Pro Lys Asn Leu Ser Arg Leu Phe Pro Gly Trp Lys Ala Trp Val (2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:36:
Met Ser Gly Gly Ser Ser Cys Gln Thr Pro Ser Arg Ala Ile Pro Ala Thr Arg Arg (2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
Gly Asp Tyr Ser Thr Thr Pro Gly Gly Thr Leu Phe Ser Thr Thr Pro Gly Gly Thr Arg Arg (2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
Glu Cys Arg Asn Ser Pro Val Thr Lys Thr Arg Arg (2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Gly Val Thr Ser Pro Ser Ser Asp Glu Pro Arg Arg (2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
Met Glu Ala Ser Gln Ser His Leu Arg Arg (2) INFORMATION FOR SEQ ID NO:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Arg Arg Asn Ser Pro Glu Asp Lys Arg Ala Gly Gly (2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Gly Glu Glu Ser Gln Phe Glu Met Asp Ile Arg Arg INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCF Rule 13Gis) A. The indications made below relate to the microorganism referred to in the description on page 10 , lines 2-6 B. IDEiVTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution American Type Culture Collection Address of depositary institution (including postal code and country) 12301 Parklawn Drive Rockville, MD 20852 us Date of deposit Accession Number s 7 Noventber 1996 HB 12233 and HB 12234 C. ADDITIONAL INDICATIONS (leave blank iJnot applicablr) This information is continued on an additional sbeet ~
"In respect of those designations in which a European patent is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC)."
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE
(i/theindicationtarenot(orapduignatedStatu) EP
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicablt) The indications listed below wilt be submitted to the International Bureau later (specify tkegaraaf naiureofthe indicatioRt e.g., 'Accersion Number ofDeposit') For receiving Office use only For International Bureau use only f[XTbis sheet was received with tbe international application This sheet was received by the international Bureau on:
Auth rFzed~ fj ~'1 ;~ Authorized ofGcer {T~~ r 1 ~
Forrn PCT/RO/134 (July 1992)
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2409 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gin Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe Ile Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Vai Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gin Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gin His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg i ~~ ~ Al~ u Met yi Y~~~~~pV~ OC).~f%A$~~e~'Oa~~l{~fA ^~e ~
hEMB# o"iDMu-eI~~A~oAS aa a 2 v_ .~ uzv &~''uR
Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gin Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2835 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
( vi i ) IMMEDIATE SOURCE :
(B) CLONE: 517 (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..2610 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala .
Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala TGC CTG CCA GAA TGG GAG GAT GGG CAT T'I'T TAC CTT GCC AAG TAC TAT 816 Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ser Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile ACA GAG CAT ACA AAC TAT TTA GCT CCA TAT CAA TTT TI'G ACT GCT TTT 1104 Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe CCT GGA CAT TGG GCC TAT ATT GCA GGG TTT GAT GAT ATG GTG GAA A'I'I' 1584 Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu GGT TGG ACT CCA TAT ATG TGAAATGAAA TTATGTAP.AA GAATATGTTA 2640 Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 870 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gin Ala Leu Ile Val Leu Gin Lys Gly Vai Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ser Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Tlir Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu G1n Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gin Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDHl5a (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(15, 18, 24, 30) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(15, 18, 24) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH16 (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: 24 (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH17a (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(21, 24, 27, 30) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH17b (ix) FEATURE:
(A) NAME/KEY: modifiedbase (B) LOCATION: group(24, 27, 30, 33) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH18a (ix) FEATURE:
(A) NAME/KEY: modified_base (B) LOCATION: group(15, 18, 21, 24, 30) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH18b (ix) FEATURE:
(A) NAME/KEY: modifiedbase (B) LOCATION: group(15, 18, 21) (D) OTHER INFORMATION: The nucleotides at these positions are inosines.
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH23 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer mo3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IDMEDIATE SOURCE:
(B) CLONE: Primer mo6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oHT9-1 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:15:
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oHT9-4 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7440 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: MCCSlbeta (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1__7437 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gin Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe Ile Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gin Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gin Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gin Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn GAA TTA TTG CTG CGT ATT GGA GAA CAC TAT CAA CAG GTT TT'T AAT GGT 2784 Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gin Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Giy Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His I1e Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro CAC AGC AAA TCA AAC AGA AAT AAG GTP. GAC TCA ATG GTA TCT ACT GTG 4368 His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ser Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gin Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile WO 97/18323 PCT/tJS96l19337 -Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gin Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu 'Iyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2479 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Lys Leu Glu Phe I1e Glu Val Thr Leu Leu Thr Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Tzp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Giy Leu Pro Ala Gin Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gin Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Thr Val Leu Lys Ser Cys Arg Arg Leu Leu Glu Ser Val Gln Lys Arg Thr Gly Gly Asn Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gin Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Giy Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Pro Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gin Asp Ile Ala Ser Asp Leu Cys Gin Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ser Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys 'Iyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer oDH26 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (vii) IMMEDIATE SOURCE:
(B) CLONE: FLAG tag (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Met Asp Tyr Lys Asp Asp Asp Asp Lys (2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer 279-3 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(vii) IMMEDIATE SOURCE:
(B) CLONE: Primer 279-6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7624 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 333..7562 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
CAAGGATTTA GCAAATGAAT TAGCACTTCG GATATACTTG TTTATT'TAAT ATCTTT TTTG 120 TTAAAP.GCAA GAGTCCTGCT ATTTTTGGGG TACTCACAAA AGAATTATTA CAACTTTTTG 300 Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gin Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gin Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu G1n Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Vai Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gin His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Giu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn AAG GTT ATC ACA GAG CAT ACA AAC TAT TTA GCT CCA TAT CAA TTT 'ITG 6257 Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gin Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2410 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gin His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gin Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gin Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala G1n Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gin Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln GIu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gin Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Giu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lfs Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val WO 97/18323 I'CT/US96/19337 -Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7502 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7440 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gin Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Clu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gin Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala TCT ATA CTT GGT CAA CTT GTC TGT ACT CTT CAC GGC ATG T'I'T TAT CTG 1680 Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gin His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp TCT GAA GAT GGA Z'TT ATA AAG GAG CTT TTT GTC TTA AGA ATG AAG GAA 2064 Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Plie Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr GTG GAT TAT GAA GAC TAT CAG AGT GTA ACC CGT TT"T CTA GAC CTC ATA 4416 Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gin Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile GTT CTT CAT TTT GGC AGA TCT CTA CAP. TAT GGA AAT CAG TTC ATA TAT 5760 Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gin Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn WO 97/18323 PCT/US96/19337 _ Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met TGAAATGAAA TTATGTAAAA GAATATGTTA ATAATCTAAA AGTAAAAAAA AAAAAP,AAP,A 7500 (2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2480 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gin Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gin Gin Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gin Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gin Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu -Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gin Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gin Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His 1505 7.510 1515 1520 Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gin Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gin Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Asp Gly Asn Asn Ser Gln Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:27:
(i1 SEQUENCE CHARACTERISTICS:
(A) LENGTH: 878 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7935 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7932 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
Met Gly Glu His Gly Leu Glu Leu Ala Ser Met Ile Pro Ala Leu Arg Glu Leu Gly Ser Ala Thr Pro Glu Glu Tyr Asn Thr Val Val Gln Lys Pro Arg Gln Ile Leu Cys Gln Phe Ile Asp Arg Ile Leu Thr Asp Val Asn Val Val Ala Val Glu Leu Val Lys Lys Thr Asp Ser Gln Pro Thr Ser Val Met Leu Leu Asp Phe Ile Gln His Ile Met Lys Ser Ser Pro Leu Met Phe Val Asn Val Ser Giy Ser His Glu Arg Lys Gly Ser Cys Ile Glu Phe Ser Asn Tzp Ile Ile Thr Arg Leu Leu Arg Ile Ala Ala Thr Pro Ser Cys His Leu Leu His Lys Lys Ile Cys Glu Val Ile Cys Ser Leu Leu Phe Leu Phe Lys Ser Lys Ser Pro Ala Ile Phe Gly Val Leu Thr Lys Glu Leu Leu Gln Leu Phe Glu Asp Leu Val Tyr Leu His Arg Arg Asn Val Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu ACT CTG T'IT CCA AGA AGA ATA TTC CTT GAG TGG AGA ACA GCA GTT TAC 1968 Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln TAT AAG AAP, CCC ATC TGT CAG TTT TTG GTA GAA TCC CTT CAC TCT AGT 2832 Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Giu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe WO 97/18323 PCT/iJS96/19337 Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gin Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gin Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gin Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu TTG TGC AAT AAA CCG GTT GAT GGA AC,T AGT TCC ACA TTA AGC ATG AGC 6720 Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:29:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2644 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE; protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:
Met Gly Glu His Gly Leu Glu Leu Ala Ser Met Ile Pro Ala Leu Arg Glu Leu Gly Ser Ala Thr Pro Glu Glu Tyr Asn Thr Val Val Gln Lys Pro Arg Gln Ile Leu Cys Gln Phe Ile Asp Arg Ile Leu Thr Asp Val Asn Val Val Ala Val Glu Leu Val Lys Lys Thr Asp Ser Gln Pro Thr Ser Val Met Leu Leu Asp Phe Ile Gln His Ile Met Lys Ser Ser Pro Leu Met Phe Val Asn Val Ser Gly Ser His Glu Arg Lys Gly Ser Cys Ile Glu Phe Ser Asn Trp Ile Ile Thr Arg Leu Leu Arg Ile Ala Ala Thr Pro Ser Cys His Leu Leu His Lys Lys Ile Cys Glu Val Ile Cys Ser Leu Leu Phe Leu Phe Lys Ser Lys Ser Pro Ala Ile Phe Gly Val Leu Thr Lys Glu Leu Leu Gln Leu Phe Glu Asp Leu Val Tyr Leu His Arg Arg Asn Val Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gin Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gin Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gin Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFO[tMATION FOR SEQ ID NO:30:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7624 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY : CDS
(B) LOCATION: 333..7562 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:
CTTGTGAAGA GAATGTTI'TA CACTCTTGTT AGTGAAGTTT ATTCT'ITAAA AGTCAATCGT 60 TTAARAGCAA GAGTCCTGCT ATTTI"PGGGG TACTCACAAA AGAATTATTA CAACTTTTTG 300 Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly TAT TTA CAA TCA GCT CCT TTG CAG TTG ATG AGT ATG CAP, AAT TTA GAA 449 Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gin Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gin Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys GAG CTT TTT GTC TTA AGA ATG AAG GAA GCA TAT ACA CAT GCC C.AA ATA 2417 Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gin Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile 'Iyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gin Leu Ser Met Lys Ala WO 97/18323 PCT/[JS96/19337 Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gin Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gin Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2410 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gin Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gin Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu WO 97l18323 PCT/U S96l19337 _ Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Giu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gin Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr G1n Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gin Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gin Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gin Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Giu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gin Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:32:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7502 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear -(ii) MOLECULE TYPE: cDNA
(ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..7440 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gln Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gln Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile AAA TCC CTA GCA ATT AGC TTT TTA ACA GAA CTT TT'T CAG CTT GGA GGA 288 Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gln Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Vai Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile ILe Glu Glu Ile Gln Cys Gln Thr Gln Gln Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln AAA GCT GAA TCC CTT CAG ATT TCC C'TT GAA TAC AGT GGC CTA AAG AAT 960 Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Gly Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr TCA CCA CAG GCA CAA TCA CGA TGT GTG Z"TT CTT CTG ACT CTG TTT CCA 1440 Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gin Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lys Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pro Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp TCT GAA GAT GGA T'i'T ATA AAG GAG CTT TTT GTC TTA AGA ATG AAG GAA 2064 Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Giu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gin Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Giu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gln Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gin Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Giu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln WO 97/18323 PCT/US96/19337 _ Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gln Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys Tyr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val Ile Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr -Ile Ala Gly Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Giy Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu - l 74-Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gin Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2480 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Met Gly His Ala Val Glu Trp Pro Val Val Met Ser Arg Phe Leu Ser Gln Leu Asp Glu His Met Gly Tyr Leu Gin Ser Ala Pro Leu Gln Leu Met Ser Met Gln Asn Leu Glu Phe Ile Glu Val Thr Leu Leu Met Val Leu Thr Arg Ile Ile Ala Ile Val Phe Phe Arg Arg Gin Glu Leu Leu Leu Trp Gln Ile Gly Cys Val Leu Leu Glu Tyr Gly Ser Pro Lys Ile Lys Ser Leu Ala Ile Ser Phe Leu Thr Glu Leu Phe Gln Leu Gly Gly Leu Pro Ala Gln Pro Ala Ser Thr Phe Phe Ser Ser Phe Leu Glu Leu Leu Lys His Leu Val Glu Met Asp Thr Asp Gln Leu Lys Leu Tyr Glu Glu Pro Leu Ser Lys Leu Ile Lys Thr Leu Phe Pro Phe Glu Ala Glu Ala Tyr Arg Asn Ile Glu Pro Val Tyr Leu Asn Met Leu Leu Glu Lys Leu Cys Val Met Phe Glu Asp Gly Val Leu Met Arg Leu Lys Ser Asp Leu Leu Lys Ala Ala Leu Cys His Leu Leu Gin Tyr Phe Leu Lys Phe Val Pro Ala Gly Tyr Glu Ser Ala Leu Gln Val Arg Lys Val Tyr Val Arg Asn Ile Cys Lys Ala Leu Leu Asp Val Leu Gly Ile Glu Val Asp Ala Glu Tyr Leu Leu Gly Pro Leu Tyr Ala Ala Leu Lys Met Glu Ser Met Glu Ile Ile Glu Glu Ile Gin Cys Gln Thr Gln Gin Glu Asn Leu Ser Ser Asn Ser Asp Gly Ile Ser Pro Lys Arg Arg Arg Leu Ser Ser Ser Leu Asn Pro Ser Lys Arg Ala Pro Lys Gln Thr Glu Glu Ile Lys His Val Asp Met Asn Gln Lys Ser Ile Leu Trp Ser Ala Leu Lys Gln Lys Ala Glu Ser Leu Gln Ile Ser Leu Glu Tyr Ser Gly Leu Lys Asn Pro Val Ile Glu Met Leu Glu Gly Ile Ala Val Val Leu Gln Leu Thr Ala Leu Cys Thr Val His Cys Ser His Gln Asn Met Asn Cys Arg Thr Phe Lys Asp Cys Gln His Lys Ser Lys Lys Lys Pro Ser Val Val Ile Thr Trp Met Ser Leu Asp Phe Tyr Thr Lys Val Leu Lys Ser Cys Arg Ser Leu Leu Glu Ser Val Gln Lys Leu Asp Leu Glu Ala Thr Ile Asp Lys Val Val Lys Ile Tyr Asp Ala Leu Ile Tyr Met Gln Val Asn Ser Ser Phe Glu Asp His Ile Leu Glu Asp Leu Cys Gly Met Leu Ser Leu Pro Trp Ile Tyr Ser His Ser Asp Asp Giy Cys Leu Lys Leu Thr Thr Phe Ala Ala Asn Leu Leu Thr Leu Ser Cys Arg Ile Ser Asp Ser Tyr Ser Pro Gln Ala Gln Ser Arg Cys Val Phe Leu Leu Thr Leu Phe Pro Arg Arg Ile Phe Leu Glu Trp Arg Thr Ala Val Tyr Asn Trp Ala Leu Gln Ser Ser His Glu Val Ile Arg Ala Ser Cys Val Ser Gly Phe Phe Ile Leu Leu Gln Gln Gln Asn Ser Cys Asn Arg Val Pro Lys Ile Leu Ile Asp Lys Val Lys Asp Asp Ser Asp Ile Val Lys Lys Glu Phe Ala Ser Ile Leu Gly Gln Leu Val Cys Thr Leu His Gly Met Phe Tyr Leu Thr Ser Ser Leu Thr Glu Pro Phe Ser Glu His Gly His Val Asp Leu Phe Cys Arg Asn Leu Lys Ala Thr Ser Gln His Glu Cys Ser Ser Ser Gln Leu Lvs Ala Ser Val Cys Lys Pro Phe Leu Phe Leu Leu Lys Lys Lys Ile Pxo Ser Pro Val Lys Leu Ala Phe Ile Asp Asn Leu His His Leu Cys Lys His Leu Asp Phe Arg Glu Asp Glu Thr Asp Val Lys Ala Val Leu Gly Thr Leu Leu Asn Leu Met Glu Asp Pro Asp Lys Asp Val Arg Val Ala Phe Ser Gly Asn Ile Lys His Ile Leu Glu Ser Leu Asp Ser Glu Asp Gly Phe Ile Lys Glu Leu Phe Val Leu Arg Met Lys Glu 6?5 680 685 Ala Tyr Thr His Ala Gln Ile Ser Arg Asn Asn Glu Leu Lys Asp Thr Leu Ile Leu Thr Thr Gly Asp Ile Gly Arg Ala Ala Lys Gly Asp Leu Val Pro Phe Ala Leu Leu His Leu Leu His Cys Leu Leu Ser Lys Ser Ala Ser Val Ser Gly Ala Ala Tyr Thr Glu Ile Arg Ala Leu Val Ala Ala Lys Ser Val Lys Leu Gln Ser Phe Phe Ser Gln Tyr Lys Lys Pro Ile Cys Gln Phe Leu Val Glu Ser Leu His Ser Ser Gln Met Thr Ala Leu Pro Asn Thr Pro Cys Gln Asn Ala Asp Val Arg Lys Gln Asp Val Ala His Gln Arg Glu Met Ala Leu Asn Thr Leu Ser Glu Ile Ala Asn Val Phe Asp Phe Pro Asp Leu Asn Arg Phe Leu Thr Arg Thr Leu Gln Val Leu Leu Pro Asp Leu Ala Ala Lys Ala Ser Pro Ala Ala Ser Ala Leu Ile Arg Thr Leu Gly Lys Gln Leu Asn Val Asn Arg Arg Glu Ile Leu Ile Asn Asn Phe Lys Tyr Ile Phe Ser His Leu Val Cys Ser Cys Ser Lys Asp Glu Leu Glu Arg Ala Leu His Tyr Leu Lys Asn Glu Thr Glu Ile Glu Leu Gly Ser Leu Leu Arg Gln Asp Phe Gln Gly Leu His Asn Glu Leu Leu Leu Arg Ile Gly Glu His Tyr Gln Gln Val Phe Asn Gly Leu Ser Ile Leu Ala Ser Phe Ala Ser Ser Asp Asp Pro Tyr Gln Gly Pro Arg Asp Ile Ile Ser Pro Glu Leu Met Ala Asp Tyr Leu Gln Pro Lys Leu Leu Gly Ile Leu Ala Phe Phe Asn Met Gln Leu Leu Ser Ser Ser Val Gly Ile Glu Asp Lys Lys Met Ala Leu Asn Ser Leu Met Ser Leu Met Lys Leu Met Gly Pro Lys His Val Ser Ser Val Arg Val Lys Met Met Thr Thr Leu Arg Thr Gly Leu Arg Phe Lys Asp Asp Phe Pro Glu Leu Cys Cys Arg Ala Trp Asp Cys Phe Val Arg Cys Leu Asp His Ala Cys Leu Gly Ser Leu Leu Ser His Val Ile Val Ala Leu Leu Pro Leu Ile His Ile Gln Pro Lys Glu Thr Ala Ala Ile Phe His Tyr Leu Ile Ile Glu Asn Arg Asp Ala Val Gln Asp Phe Leu His Glu Ile Tyr Phe Leu Pro Asp His Pro Glu Leu Lys Lys Ile Lys Ala Val Leu Gln Glu Tyr Arg Lys Glu Thr Ser Glu Ser Thr Asp Leu Gln Thr Thr Leu Gln Leu Ser Met Lys Ala Ile Gln His Glu Asn Val Asp Val Arg Ile His Ala Leu Thr Ser Leu Lys Glu Thr Leu Tyr Lys Asn Gln Glu Lys Leu Ile Lys Tyr Ala Thr Asp Ser Glu Thr Val Glu Pro Ile Ile Ser Gln Leu Val Thr Val Leu Leu Lys Gly Cys Gln Asp Ala Asn Ser Gln Ala Arg Leu Leu Cys Gly Glu Cys Leu Gly Glu Leu Gly Ala Ile Asp Pro Gly Arg Leu Asp Phe Ser Thr Thr Glu Thr Gln Gly Lys Asp Phe Thr Phe Val Thr Gly Val Glu Asp Ser Ser Phe Ala Tyr Gly Leu Leu Met Glu Leu Thr Arg Ala Tyr Leu Ala Tyr Ala Asp Asn Ser Arg Ala Gln Asp Ser Ala Ala Tyr Ala Ile Gln Glu Leu Leu Ser Ile Tyr Asp Cys Arg Glu Met Glu Thr Asn Gly Pro Gly His Gln Leu Trp Arg Arg Phe Pro Glu His Val Arg Glu Ile Leu Glu Pro His Leu Asn Thr Arg Tyr Lys Ser Ser Gin Lys Ser Thr Asp Trp Ser Gly Val Lys Lys Pro Ile Tyr Leu Ser Lys Leu Gly Ser Asn Phe Ala Glu Trp Ser Ala Ser Trp Ala Gly Tyr Leu Ile Thr Lys Val Arg His Asp Leu Ala Ser Lys Ile Phe Thr Cys Cys Ser Ile Met Met Lys His Asp Phe Lys Val Thr Ile Tyr Leu Leu Pro His Ile Leu Val Tyr Val Leu Leu Gly Cys Asn Gln Glu Asp Gln Gln Glu Val Tyr Ala Glu Ile Met Ala Val Leu Lys His Asp Asp Gln His Thr Ile Asn Thr Gln Asp Ile Ala Ser Asp Leu Cys Gln Leu Ser Thr Gln Thr Val Phe Ser Met Leu Asp His Leu Thr Gln Trp Ala Arg His Lys Phe Gln Ala Leu Lys Ala Glu Lys Cys Pro His Ser Lys Ser Asn Arg Asn Lys Val Asp Ser Met Val Ser Thr Val Asp Tyr Glu Asp Tyr Gln Ser Val Thr Arg Phe Leu Asp Leu Ile Pro Gln Asp Thr Leu Ala Val Ala Ser Phe Arg Ser Lys Ala Tyr Thr Arg Ala Val Met His Phe Glu Ser Phe Ile Thr Glu Lys Lys Gln Asn Ile Gln Glu His Leu Gly Phe Leu Gln Lys Leu Tyr Ala Ala Met His Glu Pro Asp Gly Val Ala Gly Val Ser Ala Ile Arg Lys Ala Glu Pro Ser Leu Lys Glu Gln Ile Leu Glu His Glu Ser Leu Gly Leu Leu Arg Asp Ala Thr Ala Cys Tyr Asp Arg Ala Ile Gln Leu Glu Pro Asp Gln Ile Ile His Tyr His Gly Val Val Lys Ser Met Leu Gly Leu Gly Gln Leu Ser Thr Val Ile Thr Gln Val Asn Gly Val His Ala Asn Arg Ser Glu Trp Thr Asp Glu Leu Asn Thr Tyr Arg Val Glu Ala Ala Trp Lys Leu Ser Gln Trp Asp Leu Val Glu Asn Tyr Leu Ala Ala Asp Gly Lys Ser Thr Thr Trp Ser Val Arg Leu Gly Gln Leu Leu Leu Ser Ala Lys Lys Arg Asp Ile Thr Ala Phe Tyr Asp Ser Leu Lys Leu Val Arg Ala Glu Gln Ile Val Pro Leu Ser Ala Ala Ser Phe Glu Arg Gly Ser Tyr Gin Arg Gly Tyr Glu Tyr Ile Val Arg Leu His Met Leu Cys Glu Leu Glu His Ser Ile Lys Pro Leu Phe Gln His Ser Pro Gly Asp Ser Ser Gln Glu Asp Ser Leu Asn Trp Val Ala Arg Leu Glu Met Thr Gln Asn Ser Tyr Arg Ala Lys Glu Pro Ile Leu Ala Leu Arg Arg Ala Leu Leu Ser Leu Asn Lys Arg Pro Asp Tyr Asn Glu Met Val Gly Glu Cys Trp Leu Gln Ser Ala Arg Val Ala Arg Lys Ala Gly His His Gln Thr Ala Tyr Asn Ala Leu Leu Asn Ala Gly Glu Ser Arg Leu Ala Glu Leu Tyr Val Glu Arg Ala Lys Trp Leu Trp Ser Lys Gly Asp Val His Gln Ala Leu Ile Val Leu Gln Lys Gly Val Glu Leu Cys Phe Pro Glu Asn Glu Thr Pro Pro Glu Gly Lys Asn Met Leu Ile His Gly Arg Ala Met Leu Leu Val Gly Arg Phe Met Glu Glu Thr Ala Asn Phe Glu Ser Asn Ala Ile Met Lys Lys Tyr Lys Asp Val Thr Ala Cys Leu Pro Glu Trp Glu Asp Gly His Phe Tyr Leu Ala Lys 'I, .jr Tyr Asp Lys Leu Met Pro Met Val Thr Asp Asn Lys Met Glu Lys Gln Gly Asp Leu Ile Arg Tyr Ile Val Leu His Phe Gly Arg Ser Leu Gln Tyr Gly Asn Gln Phe Ile Tyr -isa-Gln Ser Met Pro Arg Met Leu Thr Leu Trp Leu Asp Tyr Gly Thr Lys Ala Tyr Glu Trp Glu Lys Ala Gly Arg Ser Asp Arg Val Gln Met Arg Asn Asp Leu Gly Lys Ile Asn Lys Val IlP Thr Glu His Thr Asn Tyr Leu Ala Pro Tyr Gln Phe Leu Thr Ala Phe Ser Gln Leu Ile Ser Arg Ile Cys His Ser His Asp Glu Val Phe Val Val Leu Met Glu Ile Ile Ala Lys Val Phe Leu Ala Tyr Pro Gln Gln Ala Met Trp Met Met Thr Ala Val Ser Lys Ser Ser Tyr Pro Met Arg Val Asn Arg Cys Lys Glu Ile Leu Asn Lys Ala Ile His Met Lys Lys Ser Leu Glu Lys Phe Val Gly Asp Ala Thr Arg Leu Thr Asp Lys Leu Leu Glu Leu Cys Asn Lys Pro Val Asp Gly Ser Ser Ser Thr Leu Ser Met Ser Thr His Phe Lys Met Leu Lys Lys Leu Val Glu Glu Ala Thr Phe Ser Glu Ile Leu Ile Pro Leu Gln Ser Val Met Ile Pro Thr Leu Pro Ser Ile Leu Gly Thr His Ala Asn His Ala Ser His Glu Pro Phe Pro Gly His Trp Ala Tyr Ile Ala Giy Phe Asp Asp Met Val Glu Ile Leu Ala Ser Leu Gln Lys Pro Lys Lys Ile Ser Leu Lys Gly Ser Asp Gly Lys Phe Tyr Ile Met Met Cys Lys Pro Lys Asp Asp Leu Arg Lys Asp Cys Arg Leu Met Glu Phe Asn Ser Leu Ile Asn Lys Cys Leu Arg Lys Asp Ala Glu Ser Arg Arg Arg Glu Leu His Ile Arg Thr Tyr Ala Val Ile Pro Leu Asn Asp Glu Cys Gly Ile Ile Glu Trp Val Asn Asn Thr Ala Gly Leu Arg Pro Ile Leu Thr Lys Leu Tyr Lys Glu Lys Gly Val Tyr Met Thr Gly Lys Glu Leu Arg Gln Cys Met Leu Pro Lys Ser Ala Ala Leu Ser Glu Lys Leu Lys Val Phe Arg Glu Phe Leu Leu Pro Arg His Pro Pro Ile Phe His Glu Trp Phe Leu Arg Thr Phe Pro Asp Pro Thr Ser Trp Tyr Ser Ser Arg Ser Ala Tyr Cys Arg Ser Thr Ala Val Met Ser Met Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Gly Glu Asn Ile Leu Phe Asp Ser Leu Thr Gly Glu Cys Val His Val Asp Phe Asn Cys Leu Phe Asn Lys Gly Glu Thr Phe Glu Val Pro Glu Ile Val Pro Phe Arg Leu Thr His Asn Met Val Asn Gly Met Gly Pro Met Gly Thr Glu Gly Leu Phe Arg Arg Ala Cys Glu Val Thr Met Arg Leu Met Arg Asp Gln Arg Glu Pro Leu Met Ser Val Leu Lys Thr Phe Leu His Asp Pro Leu Val Glu Trp Ser Lys Pro Val Lys Gly His Ser Lys Ala Pro Leu Asn Glu Thr Gly Glu Val Val Asn Glu Lys Ala Lys Thr His Val Leu Asp Ile Glu Gln Arg Leu Gln Gly Val Ile Lys Thr Arg Asn Arg Val Thr Gly Leu Pro Leu Ser Ile Glu Gly His Val His Tyr Leu Ile Gln Glu Ala Thr Asp Glu Asn Leu Leu Cys Gln Met Tyr Leu Gly Trp Thr Pro Tyr Met (2) INFORMATION FOR.SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9385 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(v) FRAGMENT TYPE: linear (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 190..9357 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:
Met Ser Leu Val Leu Asn Asp Leu Leu Ile Cys Cys Arg Gln Leu Glu His Asp Arg Ala Thr Glu Arg Lys Lys Glu Val Glu Lys Phe Lys Arg Leu Ile Arg Asp Pro Glu Thr Ile Lys His Leu Asp Arg His Ser Asp Ser Lys Gln Gly Lys Tyr Leu Asn Trp Asp Ala Val Phe Arg Phe Leu Gln Lys Tyr Ile Gln Lys Glu Thr Glu Cys Leu Arg Ile Ala Lys Pro Asn Val Ser Ala Ser Thr Gln Ala Ser Arg Gln Lys Lys Met Gln Glu Ile Ser Ser Leu Val Lys Tyr Phe Ile Lys Cys Ala Asn Arg Arg Ala Pro Arg Leu Lys Cys Gln Glu Leu Leu Asn Tyr Ile Met Asp Thr Val Lys Asp Ser Ser Asn Gly Ala Ile Tyr Gly Ala Asp Cys Ser Asn Ile Leu Leu Lys Asp Ile Leu Ser Val Arg Lys Tyr Trp Cys Glu Ile Ser Gln Gln Gln Trp Leu Glu Leu Phe Ser Val Tyr Phe Arg Leu Tyr Leu Lys Pro Ser Gln Asp Val His Arg Val Leu Val Ala Arg Ile Ile His Ala Val Thr Lys Gly Cys Cys Ser Gln Thr Asp Gly Leu Asn Ser Lys Phe Leu Asp Phe Phe Ser Lys Ala Ile Gln Cys Ala Arg Gln Glu Lys Ser Ser Ser Gly Leu Asn His Ile Leu Ala Ala Leu Thr Ile Phe Leu Lys Thr Leu Ala Val Asn Phe Arg Ile Arg Val Cys Glu Leu Gly Asp Glu Ile Leu Pro Thr Leu Leu Tyr Ile Trp Thr Gln His Arg Leu Asn Asp Ser Leu Lys Glu Val Ile Ile Glu Leu Phe Gln Leu Gln Ile Tyr Ile His His Pro Lys Gly Ala Lys Thr Gln Glu Lys Gly Ala Tyr Glu Ser Thr Lys Trp Arg Ser Ile Leu Tyr Asn Leu Tyr Asp Leu Leu Val Asn Glu Ile Ser His Ile Gly Ser Arg Gly Lys Tyr Ser Ser Gly Phe Arg Asn Ile Ala Val Lys Glu Asn Leu Ile Glu Leu Met Ala Asp Ile Cys His Gln Val Phe Asn Glu Asp Thr Arg Ser Leu Glu Ile Ser Gln Ser Tyr Thr Thr Thr Gln Arg Glu Ser Ser Asp Tyr Ser Val Pro Cys Lys Arg Lys Lys Ile Glu Leu Gly Trp Glu Val Ile Lys Asp His Leu Gln Lys Ser Gln Asn Asp Phe Asp Leu Val Pro Trp Leu Gln Ile Ala Thr Gln Leu Ile Ser Lys Tyr Pro Ala Ser Leu Pro Asn Cys Glu Leu Ser Pro Leu Leu Met Ile Leu Ser Gln Leu Leu Pro Gln Gln Arg His Gly Glu Arg Thr Pro Tyr Val Leu Arg Cys Leu Thr Glu Val Ala Leu Cys Gln Asp Lys Arg Ser Asn Leu Glu Ser Ser Gln Lys Ser Asp Leu Leu Lys Leu Trp Asn Lys Ile Trp Cys Ile Thr Phe Arg Gly Ile Ser Ser Glu Gin Ile Gln Ala Glu Asn Phe Gly Leu Leu Gly Ala Ile Ile Gln Gly Ser Leu Val Glu Val Asp Arg Glu Phe Trp Lys Leu Phe Thr Gly Ser Ala Cys Arg Pro Ser Cys Pro Ala Val Cys Cys WO 97/18323 PCT/[JS96/19337 Leu Thr Leu Ala Leu Thr Thr Ser Ile Val Pro Gly Ala Val Lys Met Gly Ile Glu Gln Asn Met Cys Glu Val Asn Arg Ser Phe Ser Leu Lys Glu Ser Ile Met Lys Trp Leu Leu Phe Tyr Gln Leu Glu Gly Asp Leu Glu Asn Ser Thr Glu Val Pro Pro Ile Leu His Ser Asn Phe Pro His Leu Val Leu Glu Lys Ile Leu Val Ser Leu Thr Met Lys Asn Cys Lys Ala Ala Met Asn Phe Phe Gln Ser Val Pro Glu Cys Glu His His Gln Lys Asp Lys Glu Glu Leu Ser Phe Ser Glu Val Glu Glu Leu Phe Leu Gln Thr Thr Phe Asp Lys Met Asp Phe Leu Thr Ile Val Arg Glu Cys Gly Ile Glu Lys His Gln Ser Ser Ile Gly Phe Ser Val His Gln Asn Leu Lys Glu Ser Leu Asp Arg Cys Leu Leu Gly Leu Ser Glu Gin Leu Leu Asn Asn Tyr Ser Ser Glu Ile Thr Asn Ser Glu Thr Leu Val Arg Cys Ser Arg Leu Leu Val Gly Val Leu Gly Cys Tyr Cys Tyr Met Gly Val Ile Ala Glu Glu Glu Ala Tyr Lys Ser Glu Leu Phe Gln Lys Ala Asn Ser Leu Met Gln Cys Ala Gly Glu Ser Ile Thr Leu Phe Lys Asn Lys Thr Asn Glu Glu Phe Arg Ile Gly Ser Leu Arg Asn Met Met Gln Leu Cys Thr Arg Cys Leu Ser Asn Cys Thr Lys Lys Ser Pro Asn Lys Ile Ala Ser Gly Phe Phe Leu Arg Leu Leu Thr Ser Lys Leu Met Asn Asp Ile Ala Asp Ile Cys Lys Ser Leu Ala Ser Phe Ile Lys Lys Pro Phe Asp Arg Gly Glu Val Glu Ser Met Glu Asp Asp Thr Asn Gly Asn Leu Met Glu Val Glu Asp Gln Ser Ser Met Asn Leu Phe Asn Asp Tyr Pro Asp Ser Ser Val Ser Asp Ala Asn Glu Pro Gly Glu Ser Gln Ser Thr Ile Gly Ala Ile Asn Pro Leu Ala Glu Glu Tyr Leu Ser Lys Gln Asp Leu Leu Phe Leu Asp Met Leu Lys Phe Leu Cys Leu Cys Val Thr Thr Ala Gln Thr Asn Thr Val Ser Phe Arg Ala Ala Asp Ile Arg Arg Lys Leu Leu Met Leu Ile Asp Ser Ser Thr Leu Glu Pro Thr Lys Ser Leu His Leu His Met Tyr Leu Met Leu Leu Lys Glu Leu Pro Gly Glu Glu Tyr Pro Leu Pro Met Glu Asp Val Leu Glu Leu Leu Lys Pro Leu Ser Asn Val Cys Ser Leu Tyr Arg Arg Asp Gln Asp Val Cys Lys Thr Ile Leu Asn His Val Leu His Val Val Lys Asn Leu Gly Gln Ser Asn Met Asp Ser Glu Asn Thr Arg Asp Ala Gln Gly Gln Phe Leu Thr Val ATT GGA GCA TTT TGG CAT CTA ACA AAG GAG AGG AAA TAT ATA TI'C TCT 3300 Ile Gly Ala Phe Trp His Leu Thr Lys Glu Arg Lys Tyr Ile Phe Ser Val Arg Met Ala Leu Val Asn Cys Leu Lys Thr Leu Leu Glu Ala Asp Pro Tyr Ser Lys Trp Ala Ile Leu Asn Val Met Gly Lys Asp Phe Pro Val Asn Glu Val Phe Thr Gln Phe Leu Ala Asp Asn His His Gln Val Arg Met Leu Ala Ala Glu Ser Ile Asn Arg Leu Phe Gln Asp Thr Lys Gly Asp Ser Ser Arg Leu Leu Lys Ala Leu Pro Leu Lys Leu Gln Gln Thr Ala Phe Glu Asn Ala Tyr Leu Lys Ala Gln Glu Gly Met Arg Glu Met Ser His Ser Ala Glu Asn Pro Glu Thr Leu Asp Glu Ile Tyr Asn Arg Lys Ser Val Leu Leu Thr Leu Ile Ala Val Val Leu Ser Cys Ser Pro Ile Cys Glu Lys Gln Ala Leu Phe Ala Leu Cys Lys Ser Val Lys Glu Asn Gly Leu Glu Pro His Leu Val Lys Lys Val Leu Glu Lys Val Ser Glu Thr Phe Gly Tyr Arg Arg Leu Glu Asp Phe Met Ala Ser His Leu Asp Tyr Leu Val Leu Glu Trp Leu Asn Leu Gln Asp Thr Glu Tyr Asn Leu Ser Ser Phe Pro Phe Ile Leu Leu Asn Tyr Thr Asn Ile Glu Asp Phe Tyr Arg Ser Cys Tyr Lys Val Leu Ile Pro His Leu Val Ile Arg Ser His Phe Asp Glu Val Lys Ser Ile Ala Asn Gln Ile Gln Glu Asp Trp Lys Ser Leu Leu Thr Asp Cys Phe Pro Lys Ile Leu Val Asn Ile Leu Pro Tyr Phe Ala Tyr Glu Gly Thr Arg Asp Ser Gly Met Ala Gln Gln Arg Glu Thr Ala Thr Lys Val Tyr Asp Met Leu Lys Ser Glu Asn Leu Leu Gly Lys Gln Ile Asp His Leu Phe Ile Ser Asn Leu Pro Glu Ile Val Val Glu Leu Leu Met Thr Leu His Glu Pro Ala Asn Ser Ser Ala Ser Gln Ser Thr Asp Leu Cys Asp Phe Ser Gly Asp Leu Asp Pro Ala Pro Asn Pro Pro His Phe Pro Ser His Val Ile Lys Ala Thr Phe Ala Tyr Ile Ser Asn Cys His Lys Thr Lys Leu Lys Ser Ile Leu Glu Ile Leu Ser Lys Ser Pro Asp Ser Tyr Gln Lys Ile Leu Leu Ala Ile Cys Glu Gln Ala Ala Glu Thr Asn Asn Val Tyr Lys Lys His Arg Ile Leu Lys Ile Tyr His Leu Phe Val Ser Leu Leu Leu Lys Asp Ile Lys Ser Gly Leu Gly Gly Ala Trp Ala Phe Val Leu Arg Asp Val Ile Tyr Thr Leu Ile His Tyr Ile Asn Gln Arg Pro Ser Cys Ile Met Asp Val Ser Leu Arg Ser Phe Ser Leu Cys Cys Asp Leu Leu Ser Gln Val Cys Gln Thr Ala Val Thr Tyr Cys Lys Asp Ala Leu Glu Asn His Leu His Val Ile Val Gly Thr Leu Ile Pro Leu Val Tyr Glu Gln Val Glu Val Gln Lys Gln Val Leu Asp Leu Leu Lys Tyr Leu Val Ile Asp Asn Lys Asp Asn Glu Asn Leu Tyr Ile Thr Ile Lys Leu Leu Asp Pro Phe Pro Asp His Val Val Phe Lys Asp Leu Arg Ile Thr Gln Gln Lys Ile Lys Tyr Ser Arg Gly Pro Phe Ser Leu Leu Glu Glu Ile Asn His Phe Leu Ser Val Ser Val Tyr Asp Ala Leu Pro Leu Thr Arg Leu Glu Gly Leu Lys Asp Leu Arg Arg Gln Leu Glu Leu His Lys Asp Gln Met Val Asp Ile Met Arg Ala Ser Gln Asp Asn Pro Gln Asp Gly Ile Met Val Lys Leu Val Val Asn Leu Leu Gln Leu Ser Lys Met Ala Ile Asn His Thr Gly Glu Lys Glu Val Leu Glu Ala Val Gly Ser Cys Leu Gly Glu Val Gly Pro Ile Asp Phe Ser Thr Ile Ala Ile Gln His Ser Lys Asp Ala Ser Tyr Thr Lys Ala Leu Lys Leu Phe Glu Asp Lys Glu Leu Gln Trp Thr Phe Ile Met Leu Thr Tyr Leu Asn Asn Thr Leu Val Glu Asp Cys Val Lys Val Arg Ser Ala Ala Val Thr Cys Leu Lys Asn Ile Leu Ala Thr Lys Thr Gly His Ser Phe Trp Glu Ile Tyr Lys Met Thr Thr Asp Pro Met Leu Ala Tyr Leu Gln Pro Phe Arg Thr Ser Arg Lys Lys Phe Leu Glu Val Pro Arg Phe Asp Lys Glu Asn Pro Phe Glu Gly Leu Asp Asp Ile Asn Leu Trp Ile Pro Leu Ser Glu Asn His Asp Ile Trp Ile Lys Thr Leu Thr Cys Ala Phe Leu Asp Ser Gly Gly Thr Lys Cys Glu Ile Leu Gln Leu Leu Lys Pro Met Cys Glu Val Lys Thr Asp Phe Cys Gln Thr Val Leu Pro Tyr Leu Ile His Asp Ile Leu Leu Gln Asp Thr Asn Glu Ser Trp Arg Asn Leu Leu Ser Thr His Val Gln Gly Phe Phe Thr Ser Cys Leu Arg His Phe Ser Gln Thr Ser Arg Ser Thr Thr Pro Ala Asn Leu Asp Ser Glu Ser Glu His Phe Phe Arg Cys Cys Leu Asp Lys Lys Ser Gln Arg Thr Met Leu Ala Val Val Asp Tyr Met Arg Arg Gln Lys Arg Pro Ser Ser Gly Thr Ile Phe Asn Asp Ala Phe Trp Leu Asp Leu Asn Tyr Leu Glu Val Ala Lys Val Ala Gln Ser Cys Ala Ala His Phe Thr Ala Leu Leu Tyr Ala Glu Ile Tyr Ala Asp Lys Lys Ser Met Asp Asp Gin Glu Lys Arg Ser Leu Ala Phe Glu Glu Gly Ser Gln Ser Thr Thr Ile Ser Ser Leu Ser Glu Lys Ser Lys Glu Glu Thr Gly Ile Ser Leu Gln Asp Leu Leu Leu Glu Ile Tyr Arg Ser Ile Gly Glu Pro Asp Ser Leu Tyr Gly Cys Gly Gly Gly Lys Met Leu Gln Pro Ile Thr Arg Leu Arg Thr Tyr Glu His Glu Ala Met Trp Gly Lys Ala Leu Val Thr Tyr Asp Leu Glu Thr Ala Ile Pro Ser Ser Thr Arg Gln Ala Gly Ile Ile Gln Ala Leu Gln Asn Leu Gly Leu Cys His Ile Leu Ser Val Tyr Leu Lys Gly Leu Asp Tyr Glu Asn Lys Asp Trp Cys Pro Glu Leu Glu Glu Leu His Tyr Gln Ala Ala Trp Arg Asn Met Gln Trp Asp His Cys Thr Ser Val Ser Lys Glu Val Glu Gly Thr Ser Tyr His Glu Ser Leu Tyr Asn Ala Leu Gln Ser Leu Arg Asp Arg Glu Phe Ser Thr Phe Tyr Glu Ser Leu Lys Tyr Ala Arg Val Lys Glu Val Glu Glu Met Cys Lys Arg Ser Leu Glu Ser Val Tyr Ser Leu Tyr Pro Thr Leu Ser Arg Leu Gln Ala Ile Gly Glu Leu Glu Ser Ile Gly Glu Leu Phe Ser Arg Ser Val Thr His Arg Gln Leu Ser Glu Val Tyr Ile Lys Trp Gln Lys His Ser Gln Leu Leu Lys Asp Ser Asp Phe Ser Phe Gln Glu Pro Ile Met Ala Leu Arg Thr Val Ile Leu Glu Ile Leu Met Glu Lys Glu Met Asp Asn Ser Gln Arg Glu Cys Ile Lys Asp Ile Leu Thr Lys His Leu Val Glu Leu Ser Ile Leu Ala Arg Thr Phe Lys Asn Thr Gln Leu Pro Glu Arg Ala Ile Phe Gin Ile Lys Gln Tyr Asn Ser Val Ser Cys Gly Val Ser Glu Trp Gln Leu Glu Glu Ala Gln Val Phe Trp Ala Lys Lys Glu Gln Ser Leu Ala Leu Ser Ile Leu Lys Gln Met Ile Lys Lys Leu Asp Ala Ser Cys Ala Ala Asn Asn Pro Ser Leu Lys Leu Thr Tyr Thr Glu Cys Leu Arg Val Cys Gly Asn Trp Leu Ala Glu Thr Cys Leu Glu Asn Pro Ala Val Ile Met Gln Thr Tyr Leu Glu Lys Ala Val Glu Val Ala Gly Asn Tyr Asp Gly Glu Ser Ser Asp Glu Leu Arg Asn Gly Lys Met Lys Ala Phe Leu Ser Leu Ala Arg Phe Ser Asp Thr Gln Tyr Gln Arg Ile Glu Asn Tyr Met Lys Ser Ser Glu Phe Glu Asn Lys Gln Ala Leu Leu Lys Arg Ala Lys Glu Glu Val Gly Leu Leu Arg Glu His Lys Ile Gln Thr Asn Arg Tyr Thr Val Lys Val Gln Arg Glu Leu Glu Leu Asp Glu Leu Ala Leu Arg Ala Leu Lys Glu Asp Arg Lys Arg Phe Leu Cys Lys Ala Val Glu Asn Tyr Ile Asn Cys Leu Leu Ser Gly Glu Glu His Asp Met Trp Val Phe Arg Leu Cys Ser Leu Trp Leu Glu Asn Ser Gly Val Ser Glu Val Asn Gly Met Met Lys Arg Asp Gly Met Lys Ile Pro Thr Tyr Lys Phe Leu Pro Leu Met Tyr Gln Leu Ala Ala Arg Met Gly Thr Lys Met Met Gly Gly Leu Gly Phe His Glu Val Leu Asn Asn Leu Ile Ser Arg Ile Ser Met Asp His Pro His His Thr Leu Phe Ile Ile Leu Ala Leu Ala Asn Ala Asn Arg Asp Glu Phe Leu Thr Lys Pro Glu Val Ala Arg Arg Ser Arg Ile Thr Lys Asn Val Pro Lys Gln Ser Ser Gln Leu Asp Glu Asp Arg Thr Glu Ala Ala Asn Arg Ile Ile Cys Thr Ile Arg Ser Arg Arg Pro Gln Met Val Arg Ser Val Glu Ala Leu Cys Asp Ala Tyr Ile Ile Leu Ala Asn Leu Asp Ala Thr Gln Trp Lys Thr Gln Arg Lys Gly Ile Asn Ile Pro Ala Asp Gln Pro Ile Thr Lys Leu Lys Asn Leu Glu Asp Val Val Val Pro Thr Met Glu Ile Lys Val Asp His Thr Gly Glu Tyr Gly Asn Leu Val Thr Ile Gln Ser Phe Lys Ala Glu Phe Arg Leu Ala Gly Gly Val Asn Leu Pro Lys Ile Ile Asp Cys Val Gly Ser Asp Gly Lys Glu Arg Arg Gln Leu Val Lys Gly Arg Asp Asp Leu Arg Gln Asp Ala Val Met Gln Gln Val Phe Gln Met Cys Asn Thr Leu Leu Gln Arg Asn Thr Glu Thr Arg Lys Arg Lys Leu Thr Ile Cys Thr Tyr Lys Val Val Pro Leu Ser Gln Arg Ser Gly Val Leu Glu Trp Cys Thr Gly Thr Val Pro Ile Gly Glu Phe Leu Val Asn Asn Glu Asp Gly Ala His Lys Arg Tyr Arg Pro Asn Asp Phe Ser Ala Phe Gln Cys Gln Lys Lys Met Met Glu Val Gln Lys Lys Ser Phe Glu Glu Lys Tyr Glu Val Phe Met Asp Val Cys Gln Asn Phe Gln Pro Val Phe Arg Tyr Phe Cys Met Glu Lys Phe Leu Asp Pro Ala Ile Trp Phe Glu Lys Arg Leu Ala Tyr Thr Arg Ser Val Ala Thr Ser Ser Ile Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Val Gln Asn Ile Leu Ile Asn Glu Gln Ser Ala Glu Leu Val His Ile Asp Leu Gly Val Ala Phe Glu Gln Gly Lys Ile Leu Pro Thr Pro Glu Thr Val Pro Phe Arg Leu Thr Arg Asp Ile Val Asp Gly Met Gly Ile Thr Gly Val Glu Gly Val Phe Arg Arg Cys Cys Glu Lys Thr Met Glu Val Met Arg Asn Ser Gln Glu Thr Leu Leu Thr Ile Val Glu Val Leu Leu Tyr Asp Pro Leu Phe Asp Trp Thr Met Asn Pro Leu Lys Ala Leu Tyr Leu Gln Gln Arg Pro Glu Asp Glu Thr Glu Leu His Pro Thr Leu Asn Ala Asp Asp Gln WO 97/18323 PCTfUS96/19337 Glu Cys Lys Arg Asn Leu Ser Asp Ile Asp Gln Ser Phe Asp Lys Val Ala Glu Arg Val Leu Met Arg Leu Gln Glu Lys Leu Lys Gly Val Glu Glu Gly Thr Val Leu Ser Val Gly Gly Gln Val Asn Leu Leu Ile Gln Gln Ala Ile Asp Pro Lys Asn Leu Ser Arg Leu Phe Pro Gly Trp Lys Ala Trp Val (2) INFORMATION FOR SEQ ID NO:35:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3056 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
Met Ser Leu Val Leu Asn Asp Leu Leu Ile Cys Cys Arg Gln Leu Glu His Asp Arg Ala Thr Glu Arg Lys Lys Glu Val Glu Lys Phe Lys Arg Leu Ile Arg Asp Pro Glu Thr Ile Lys His Leu Asp Arg His Ser Asp Ser Lys Gln Gly Lys Tyr Leu Asn Trp Asp Ala Val Phe Arg Phe Leu Gln Lys Tyr Ile Gln Lys Glu Thr Glu Cys Leu Arg Ile Ala Lys Pro Asn Val Ser Ala Ser Thr Gln Ala Ser Arg Gln Lys Lys Met Gln Glu Ile Ser Ser Leu Val Lys Tyr Phe Ile Lys Cys Ala Asn Arg Arg Ala Pro Arg Leu Lys Cys Gln Glu Leu Leu Asn Tyr Ile Met Asp Thr Val Lys Asp Ser Ser Asn Gly Ala Ile Tyr Gly Ala Asp Cys Ser Asn Ile Leu Leu Lys Asp Ile Leu Ser Val Arg Lys Tyr Trp Cys Glu Ile Ser Gln Gln Gln Trp Leu Glu Leu Phe Ser Val Tyr Phe Arg Leu Tyr Leu Lys Pro Ser Gln Asp Val His Arg Val Leu Val Ala Arg Ile Ile His Ala Val Thr Lys Gly Cys Cys Ser Gln Thr Asp Gly Leu Asn Ser Lys Phe Leu Asp Phe Phe Ser Lys Ala Ile Gln Cys Ala Arg Gln Glu Lys Ser Ser Ser Gly Leu Asn His Ile Leu Ala Ala Leu Thr Ile Phe Leu Lys Thr Leu Ala Val Asn Phe Arg Ile Arg Val Cys Glu Leu Gly Asp Glu Ile Leu Pro Thr Leu Leu Tyr Ile Trp Thr Gln His Arg Leu Asn Asp Ser Leu Lys Glu Val Ile Ile Glu Leu Phe Gln Leu Gln Ile Tyr Ile His His Pro Lys Gly Ala Lys Thr Gln Glu Lys Gly Ala Tyr Glu Ser Thr Lys Trp Arg Ser Ile Leu Tyr Asn Leu Tyr Asp Leu Leu Val Asn Glu Ile Ser His Ile Gly Ser Arg Gly Lys Tyr Ser Ser Gly Phe Arg Asn Ile Ala Val Lys Glu Asn Leu Ile Glu Leu Met Ala Asp Ile Cys His Gln Val Phe Asn Glu Asp Thr Arg Ser Leu Glu Ile Ser Gln Ser Tyr Thr Thr Thr Gln Arg Glu Ser Ser Asp Tyr Ser Val Pro Cys Lys Arg Lys Lys Ile Glu Leu Gly Trp Glu Val Ile Lys Asp His Leu Gln Lys Ser Gln Asn Asp Phe Asp Leu Val Pro Trp Leu Gln Ile Ala Thr Gin Leu Ile Ser Lys Tyr Pro Ala Ser Leu Pro Asn Cys Glu Leu Ser Pro Leu Leu Met Ile Leu Ser Gln Leu Leu Pro Gln Gln Arg His Gly Glu Arg Thr Pro Tyr Val Leu Arg Cys Leu Thr Glu Val Ala Leu Cys Gln Asp Lys Arg Ser Asn Leu Glu Ser Ser Gln Lys Ser Asp Leu Leu Lys Leu Trp Asn Lys Ile Trp Cys Ile Thr Phe Arg Gly Ile Ser Ser Glu Gln Ile Gln Ala Glu Asn Phe Gly Leu Leu Gly Ala Ile Ile Gln Gly Ser Leu Val Glu Val Asp Arg Glu Phe Trp Lys Leu Phe Thr Gly Ser Ala Cys Arg Pro Ser Cys Pro Ala Val Cys Cys Leu Thr Leu Ala Leu Thr Thr Ser Ile Val Pro Gly Ala Val Lys Met Gly Ile Glu Gln Asn Met Cys Glu Val Asn Arg Ser Phe Ser Leu Lys Glu Ser Ile Met Lys Trp Leu Leu Phe Tyr Gin Leu Glu Gly Asp Leu Glu Asn Ser Thr Glu Val Pro Pro Ile Leu His Ser Asn Phe Pro His Leu Val Leu Glu Lys Ile Leu Val Ser Leu Thr Met Lys Asn Cys Lys Ala Ala Met Asn Phe Phe Gln Ser Val Pro Glu Cys Glu His His Gln Lys Asp Lys Glu Glu Leu Ser Phe Ser Glu Val Glu Glu Leu Phe Leu Gln Thr Thr Phe Asp Lys Met Asp Phe Leu Thr Ile Val Arg Glu Cys Gly Ile Glu Lys His Gln Ser Ser Ile Gly Phe Ser Val His Gln Asn Leu Lys Glu Ser Leu Asp Arg Cys Leu Leu Gly Leu Ser Glu Gln Leu Leu Asn Asn Tyr Ser Ser Glu Ile Thr Asn Ser Glu Thr Leu Val Arg Cys Ser Arg Leu Leu Val Gly Val Leu Gly Cys Tyr Cys Tyr Met Gly Val Ile Ala Glu Glu Glu Ala Tyr Lys Ser Glu Leu Phe Gln Lys Ala Asn Ser Leu Met Gln Cys Ala Gly Glu Ser Ile Thr Leu Phe Lys Asn Lys Thr Asn Glu Glu Phe Arg Ile Gly Ser Leu Arg Asn Met Met Gln Leu Cys Thr Arg Cys Leu Ser Asn Cys Thr Lys Lys Ser Pro Asn Lys Ile Ala Ser Gly Phe Phe Leu Arg Leu Leu Thr Ser Lys Leu Met Asn Asp Ile Ala Asp Ile Cys Lys Ser Leu Ala Ser Phe Ile Lys Lys Pro Phe Asp Arg Gly Glu Val Glu Ser Met Glu Asp Asp Thr Asn Gly Asn Leu Met Glu Val Glu Asp Gln Ser Ser Met Asn Leu Phe Asn Asp Tyr Pro Asp Ser Ser Val Ser Asp Ala Asn Glu Pro Gly Glu Ser Gln Ser Thr Ile Gly Ala Ile Asn Pro Leu Ala Glu Giu Tyr Leu Ser Lys Gln Asp Leu Leu Phe Leu Asp Met Leu Lys Phe Leu Cys Leu Cys Val Thr Thr Ala Gln Thr Asn Thr Val Ser Phe Arg Ala Ala Asp Ile Arg Arg Lys Leu Leu Met Leu Ile Asp Ser Ser Thr Leu Glu Pro Thr Lys Ser Leu His Leu His Met Tyr Leu Met Leu Leu Lys Glu Leu Pro Gly Glu Glu Tyr Pro Leu Pro Met Glu Asp Val Leu Glu Leu Leu Lys Pro Leu Ser Asn Val Cys Ser Leu Tyr Arg Arg Asp Gln Asp Val Cys Lys Thr Ile Leu Asn His Val Leu His Val Val Lys Asn Leu Gly Gln Ser Asn Met Asp Ser Glu Asn Thr Arg Asp Ala Gln Gly Gln Phe Leu Thr Val Ile Gly Ala Phe Trp His Leu Thr Lys Glu Arg Lys Tyr Ile Phe Ser Val Arg Met Ala Leu Val Asn Cys Leu Lys Thr Leu Leu Glu Ala Asp Pro Tyr Ser Lys Trp Ala Ile Leu Asn Val Met Gly Lys Asp Phe Pro Val Asn Glu Val Phe Thr Gln Phe Leu Ala Asp Asn His His Gln Val Arg Met Leu Ala Ala Glu Ser Ile Asn Arg Leu Phe Gln Asp Thr Lys Gly Asp Ser Ser Arg Leu Leu Lys Ala Leu Pro Leu Lys Leu Gln Gln Thr Ala Phe Glu Asn Ala Tyr Leu Lys Ala Gln Glu Gly Met Arg Glu Met Ser His Ser Ala Glu Asn Pro Glu Thr Leu Asp Glu Ile Tyr Asn Arg Lys Ser Val Leu Leu Thr Leu Ile Ala Val Val Leu Ser Cys Ser Pro Ile Cys Glu Lys Gln Ala Leu Phe Ala Leu Cys Lys Ser Val Lys Glu Asn Giy Leu Glu Pro His Leu Val Lys Lys Val Leu Glu Lys Val Ser Glu Thr Phe Gly Tyr Arg Arg Leu Glu Asp Phe Met Ala Ser His Leu Asp Tyr Leu Val Leu Glu Trp Leu Asn Leu Gln Asp Thr Glu Tyr Asn Leu Ser Ser Phe Pro Phe Ile Leu Leu Asn Tyr Thr Asn Ile Glu Asp Phe Tyr Arg Ser Cys Tyr Lys Val Leu Ile Pro His Leu Val Ile Arg Ser His Phe Asp Glu Val Lys Ser Ile Ala Asn Gln Ile Gln Glu Asp Trp Lys Ser Leu Leu Thr Asp Cys Phe Pro Lys Ile Leu Val Asn Ile Leu Pro Tyr Phe Ala Tyr Glu Gly Thr Arg Asp Ser Gly Met Ala Gln Gln Arg Glu Thr Ala Thr Lys Val Tyr Asp Met Leu Lys Ser Glu Asn Leu Leu Gly Lys Gln Ile Asp His Leu Phe Ile Ser Asn Leu Pro Glu Ile Val Val Glu Leu Leu Met Thr Leu His Glu Pro Ala Asn Ser Ser Ala Ser Gln Ser Thr Asp Leu Cys Asp Phe Ser Gly Asp Leu Asp Pro Ala Pro Asn Pro Pro His Phe Pro Ser His Val Ile Lys Ala Thr Phe Ala Tyr Ile Ser Asn Cys His Lys Thr Lys Leu Lys Ser Ile Leu Glu Ile Leu Ser Lys Ser Pro Asp Ser Tyr Gln Lys Ile Leu Leu Ala Ile Cys Glu Gln Ala Ala Glu Thr Asn Asn Val Tyr Lys Lys His Arg Ile Leu Lys Ile Tyr His Leu Phe Val Ser Leu Leu Leu Lys Asp Ile Lys Ser Gly Leu Gly Gly Ala Trp Ala Phe Val Leu Arg Asp Val Ile Tyr Thr Leu Ile His Tyr Ile Asn Gln Arg Pro Ser Cys Ile Met Asp Val Ser Leu Arg Ser Phe Ser Leu Cys Cys Asp Leu Leu Ser G2n Val Cys Gln Thr Ala Val Thr Tyr Cys Lys Asp Ala Leu Glu Asn His Leu His Val Ile Val Gly Thr Leu Ile Pro Leu Val Tyr Glu Gln Val Glu Val Gln Lys Gin Val Leu Asp Leu Leu Lys Tyr Leu Val Ile Asp Asn Lys Asp Asn Glu Asn Leu Tyr Ile Thr Ile Lys Leu Leu Asp Pro Phe Pro Asp His Val Val Phe Lys Asp Leu Arg Ile Thr Gln Gln Lys Ile Lys Tyr Ser Arg Gly Pro Phe Ser Leu Leu Glu Glu Ile Asn His Phe Leu Ser Val Ser Val Tyr Asp Ala Leu Pro Leu Thr Arg Leu Glu Gly Leu Lys Asp Leu Arg Arg Gln Leu Glu Leu His Lys Asp Gln Met Val Asp Ile Met Arg Ala Ser Gln Asp Asn Pro Gln Asp Gly Ile Met Val Lys Leu Val Val Asn Leu Leu Gln Leu Ser Lys Met Ala Ile Asn His Thr Gly Glu Lys Glu Val Leu Glu Ala Val Gly Ser Cys Leu Gly Glu Val Gly Pro Ile Asp Phe Ser Thr Ile Ala Ile Gln His Ser Lys Asp Ala Ser Tyr Thr Lys Ala Leu Lys Leu Phe Glu Asp Lys Glu Leu Gln Trp Thr Phe Ile Met Leu Thr Tyr Leu Asn Asn Thr Leu Val Glu Asp Cys Val Lys Val Arg Ser Ala Ala Val Thr Cys Leu Lys Asn Ile Leu Ala Thr Lys Thr Gly His Ser Phe Trp Glu Ile Tyr Lys Met Thr Thr Asp Pro Met Leu Ala Tyr Leu Gin Pro Phe Arg Thr Ser Arg Lys Lys Phe Leu Glu Val Pro Arg Phe Asp Lys Glu Asn Pro Phe Glu Gly Leu Asp Asp Ile Asn Leu Trp Ile Pro Leu Ser Glu Asn His Asp Ile Trp Ile Lys Thr Leu Thr Cys Ala Phe Leu Asp Ser Gly Gly Thr Lys Cys Glu Ile Leu Gln Leu Leu Lys Pro Met Cys Glu Val Lys Thr Asp Phe Cys Gln Thr Val Leu Pro Tyr Leu Ile His Asp Ile Leu Leu Gln Asp Thr Asn Glu Ser Trp Arg Asn Leu Leu Ser Thr His Val Gln Gly Phe Phe Thr Ser Cys Leu Arg His Phe Ser Gln Thr Ser Arg Ser Thr Thr Pro Ala Asn Leu Asp Ser Glu Ser Glu His Phe Phe Arg Cys Cys Leu Asp Lys Lys Ser Gln Arg Thr Met Leu Ala Val Val Asp Tyr Met Arg Arg Gln Lys Arg Pro Ser Ser Gly Thr Ile Phe Asn Asp Ala Phe Trp Leu Asp Leu Asn Tyr Leu Glu Val Ala Lys Val Ala Gln Ser Cys Ala Ala His Phe Thr Ala Leu Leu Tyr Ala Glu Ile Tyr Ala Asp Lys Lys Ser Met Asp Asp Gln Glu Lys Arg Ser Leu Ala Phe Glu Glu Gly Ser Gln Ser Thr Thr Ile Ser Ser Leu Ser Glu Lys Ser Lys Glu Glu Thr Gly Ile Ser Leu Gln Asp Leu Leu Leu Glu Ile Tyr Arg Ser Ile Gly Glu Pro Asp Ser Leu Tyr Gly Cys Gly Gly Gly Lys Met Leu Gln Pro Ile Thr Arg Leu Arg Thr Tyr Glu His Glu Ala Met Trp Gly Lys Ala Leu Val Thr Tyr Asp Leu Glu Thr Ala Ile Pro Ser Ser Thr Arg Gln Ala Gly Ile Ile Gin Ala Leu Gln Asn Leu Gly Leu Cys His Ile Leu Ser Val Tyr Leu Lys Gly Leu Asp Tyr Glu Asn Lys Asp Trp Cys Pro Glu Leu Glu Glu Leu His Tyr Gln Ala Ala Trp Arg Asn Met Gln Trp Asp His Cys Thr Ser Val Ser Lys Glu Val Glu Gly Thr Ser Tyr His Glu Ser Leu Tyr Asn Ala Leu Gln Ser Leu Arg Asp Arg Glu Phe Ser Thr Phe Tyr Glu Ser Leu Lys Tyr Ala Arg Val Lys Glu Val Glu Glu Met Cys Lys Arg Ser Leu Glu Ser Val Tyr Ser Leu Tyr Pro Thr Leu Ser Arg Leu Gln Ala Ile Gly Glu Leu Glu Ser Ile Gly Glu Leu Phe Ser Arg Ser Val Thr His Arg Gln Leu Ser Giu Val Tyr Ile Lys Trp Gln Lys His Ser Gln Leu Leu Lys Asp Ser Asp Phe Ser Phe Gin Glu Pro Ile Met Ala Leu Arg Thr Val Ile Leu Glu Ile Leu Met Glu Lys Glu Met Asp Asn Ser Gln Arg Glu Cys Ile Lys Asp Ile Leu Thr Lys His Leu Val Glu Leu Ser Ile Leu Ala Arg Thr Phe Lys Asn Thr Gln Leu Pro Glu Arg Ala Ile Phe Gln Ile Lys Gln Tyr Asn Ser Val Ser Cys Gly Val Ser Glu Trp Gln Leu Glu Glu Ala Gln Val Phe Trp Ala Lys Lys Glu Gln Ser Leu Ala Leu Ser Ile Leu Lys Gln Met Ile Lys Lys Leu Asp Ala Ser Cys Ala Ala Asn Asn Pro Ser Leu Lys Leu Thr Tyr Thr Glu Cys Leu Arg Val Cys Gly Asn Trp Leu Ala Glu Thr Cys Leu Glu Asn Pro Ala Val Ile Met Gln Thr Tyr Leu Glu Lys Ala Val Glu Val Ala Gly Asn Tyr Asp Gly Glu Ser Ser Asp Glu Leu Arg Asn Gly Lys Met Lys Ala Phe Leu Ser Leu Ala Arg Phe Ser Asp Thr Gln Tyr Gln Arg Ile Glu Asn Tyr Met Lys Ser Ser Glu Phe Glu Asn Lys Gln Ala Leu Leu Lys Arg Ala Lys Glu Glu Val Gly Leu Leu Arg Glu His Lys Ile Gln Thr Asn Arg Tyr Thr Val Lys Val Gln Arg Glu Leu Glu Leu Asp Glu Leu Ala Leu Arg Ala Leu Lys Glu Asp Arg Lys Arg Phe Leu Cys Lys Ala Val Glu Asn Tyr Ile Asn Cys Leu Leu Ser Gly Glu Glu His Asp Met Trp Val Phe Arg Leu Cys Ser Leu Trp Leu Glu Asn Ser Gly Val Ser Glu Val Asn Gly Met Met Lys Arg Asp Gly Met Lys Ile Pro Thr Tyr Lys Phe Leu Pro Leu Met Tyr Gln Leu Ala Ala Arg Met Gly Thr Lys Met Met Gly Gly Leu Gly Phe His Glu Val Leu Asn Asn Leu Ile Ser Arg Ile Ser Met Asp His Pro His His Thr Leu Phe Ile Ile Leu Ala Leu Ala Asn Ala Asn Arg Asp Glu Phe Leu Thr Lys Pro Glu Val Ala Arg Arg Ser Arg Ile Thr Lys Asn Val Pro Lys Gln Ser Ser Gln Leu Asp Glu Asp Arg Thr Glu Ala Ala Asn Arg Ile Ile Cys Thr Ile Arg Ser Arg Arg Pro Gln Met Val Arg Ser Val Glu Ala Leu Cys Asp Ala Tyr Ile Ile Leu Ala Asn Leu Asp Ala Thr Gln Trp Lys Thr Gin Arg Lys Gly Ile Asn Ile Pro Ala Asp Gin Pro Ile Thr Lys Leu Lvs Asn Leu Glu Asp Val Val Val Pro Thr Met Glu Ile Lys Val Asp His Thr Gly Glu Tyr Gly Asn Leu Val Thr Ile Gln Ser Phe Lys Ala Glu Phe Arg Leu Ala Gly Gly Val Asn Leu Pro Lys Ile Ile Asp Cys Val Gly Ser Asp Gly Lys Glu Arg Arg Gln Leu Val Lys Gly Arg Asp Asp Leu Arg Gln Asp Ala Val Met Gln Gln Val Phe Gln Met Cys Asn Thr Leu Leu Gln Arg Asn Thr Glu Thr Arg Lys Arg Lys Leu Thr Ile Cys Thr Tyr Lys Val Val Pro Leu Ser Gln Arg Ser Gly Val Leu Glu Trp Cys Thr Gly Thr Val Pro Ile Gly Glu Phe Leu Val Asn Asn Glu Asp Gly Ala His Lys Arg Tyr Arg Pro Asn Asp Phe Ser Ala Phe Gln Cys Gln Lys Lys Met Met Glu Val Gln Lys Lys Ser Phe Glu Glu Lys Tyr Glu Val Phe Met Asp Val Cys Gln Asn Phe Gln Pro Val Phe Arg Tyr Phe Cys Met Glu Lys Phe Leu Asp Pro Ala Ile Trp Phe Glu Lys Arg Leu Ala Tyr Thr Arg Ser Val Ala Thr Ser Ser Ile Val Gly Tyr Ile Leu Gly Leu Gly Asp Arg His Val Gln Asn Ile Leu Ile Asn Glu Gln Ser Ala Glu Leu Val His Ile Asp Leu Gly Val Ala Phe Glu Gln Gly Lys Ile Leu Pro Thr Pro Glu Thr Val Pro Phe Arg Leu Thr Arg Asp Ile Val Asp Gly Met Gly Ile Thr Gly Val Glu Giy Val Phe Arg Arg Cys Cys Glu Lys Thr Met Glu Val Met Arg Asn Ser Gln Glu Thr Leu Leu Thr Ile Val Glu Val Leu Leu Tyr Asp Pro Leu Phe Asp Trp Thr Met Asn Pro Leu Lys Ala Leu Tyr Leu Gln Gln Arg Pro Giu Asp Glu Thr Glu Leu His Pro Thr Leu Asn Ala Asp Asp Gln Glu Cys Lys Arg Asn Leu Ser Asp Ile Asp Gln Ser Phe Asp Lys Val Ala Glu Arg Val Leu Met Arg Leu Gln Glu Lys Leu Lys Gly Val Glu Glu Gly Thr Val Leu Ser Val Gly Gly Gln Val Asn Leu Leu Ile Gln Gln Ala Ile Asp Pro Lys Asn Leu Ser Arg Leu Phe Pro Gly Trp Lys Ala Trp Val (2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID N0:36:
Met Ser Gly Gly Ser Ser Cys Gln Thr Pro Ser Arg Ala Ile Pro Ala Thr Arg Arg (2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
Gly Asp Tyr Ser Thr Thr Pro Gly Gly Thr Leu Phe Ser Thr Thr Pro Gly Gly Thr Arg Arg (2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:
Glu Cys Arg Asn Ser Pro Val Thr Lys Thr Arg Arg (2) INFORMATION FOR SEQ ID NO:39:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Gly Val Thr Ser Pro Ser Ser Asp Glu Pro Arg Arg (2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 10 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:
Met Glu Ala Ser Gln Ser His Leu Arg Arg (2) INFORMATION FOR SEQ ID NO:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Arg Arg Asn Ser Pro Glu Asp Lys Arg Ala Gly Gly (2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:
Gly Glu Glu Ser Gln Phe Glu Met Asp Ile Arg Arg INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCF Rule 13Gis) A. The indications made below relate to the microorganism referred to in the description on page 10 , lines 2-6 B. IDEiVTIFICATION OF DEPOSIT Further deposits are identified on an additional sheet Name of depositary institution American Type Culture Collection Address of depositary institution (including postal code and country) 12301 Parklawn Drive Rockville, MD 20852 us Date of deposit Accession Number s 7 Noventber 1996 HB 12233 and HB 12234 C. ADDITIONAL INDICATIONS (leave blank iJnot applicablr) This information is continued on an additional sbeet ~
"In respect of those designations in which a European patent is sought, a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which the application has been refused or withdrawn or is deemed to be withdrawn, only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC)."
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE
(i/theindicationtarenot(orapduignatedStatu) EP
E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicablt) The indications listed below wilt be submitted to the International Bureau later (specify tkegaraaf naiureofthe indicatioRt e.g., 'Accersion Number ofDeposit') For receiving Office use only For International Bureau use only f[XTbis sheet was received with tbe international application This sheet was received by the international Bureau on:
Auth rFzed~ fj ~'1 ;~ Authorized ofGcer {T~~ r 1 ~
Forrn PCT/RO/134 (July 1992)
Claims (26)
1. A purified and isolated polynucleotide comprising a polynucleotide encoding the PIK-related kinase MCCS1.alpha. amino acid sequence set out in SEQ ID
NO: 31.
NO: 31.
2. A purified and isolated polynucleotide comprising a polynucleotide encoding the PIK-related kinase MCCS1.beta. amino acid sequence set out in SEQ
ID
NO: 33.
ID
NO: 33.
3. The polynucleotide of claim 1 or 2 which is a DNA.
4. The DNA of claim 3 which is a cDNA.
5. A MCCS1.alpha. cDNA consisting of the DNA sequence set out in SEQ
ID NO: 30.
ID NO: 30.
6. A MCCS1.beta. DNA consisting of the DNA sequence set out in SEQ
ID NO: 32.
ID NO: 32.
7. The DNA of claim 3 which is a genomic DNA.
8. An RNA transcript of the DNA of claim 3.
9. The DNA of claim 3 which is a wholly or partially chemically synthesized DNA.
10. A DNA comprising a DNA encoding a full length mammalian MCCS1 kinase selected from the group consisting of:
a) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 30;
b) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 3; and c) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 32.
a) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 30;
b) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 3; and c) a DNA which hybridizes under stringent conditions to the non-coding strand of the DNA of SEQ ID NO: 32.
11. A vector comprising a DNA according to claim 3 or 10.
12. The vector of claim 11 wherein said DNA is operatively linked to an expression control DNA sequence.
13. A host cell stably transformed or transfected with a DNA
according to claim 3 or 10 in a manner allowing the expression in said host cell of the MCCS1 kinase.
according to claim 3 or 10 in a manner allowing the expression in said host cell of the MCCS1 kinase.
14. A method for producing the PIK-related kinase MCCS1, said method comprising growing a host cell according to claim 11 in a suitable nutrient medium and isolating the MCCS1 kinase from said cell or the medium of its growth.
15. A purified and isolated polypeptide comprising the PIK-related kinase MCCS1.alpha. amino acid sequence consisting of SEQ ID NO: 31.
16. A purified and isolated polypeptide comprising the PIK-related kinase MCCS1.beta. amino acid sequence consisting of SEQ ID NO: 33.
17. A polypeptide or peptide capable of specifically binding to PIK-related kinase MCCS1.
18. An antibody product according to claim 17.
19. A monoclonal antibody according to claim 18.
20. A hybridoma cell line producing a monoclonal antibody according to claim 19.
21. An assay for identifying modulators of MCCS1 kinase activity comprising the steps of:
a) incubating a MCCS1 kinase preparation in kinase buffer with gamma 32P-ATP and an exogenous kinase substrate in the presence and absence of a test compound, and b) measuring the moles of phosphate transferred to said substrate;
wherein an increase in the moles of 32P-phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an activator of said MCCS1 kinase and a decrease in the moles of phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an inhibitor of said MCCS1 kinase.
a) incubating a MCCS1 kinase preparation in kinase buffer with gamma 32P-ATP and an exogenous kinase substrate in the presence and absence of a test compound, and b) measuring the moles of phosphate transferred to said substrate;
wherein an increase in the moles of 32P-phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an activator of said MCCS1 kinase and a decrease in the moles of phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an inhibitor of said MCCS1 kinase.
22. The hybridoma cell line 224C.
23. The hybridoma cell line 224F.
24. A method of identifying a compound that inhibits MCCS1 comprising the steps of:
a) expressing MCCS1 in a genetically altered cell, thereby decreasing the sensitivity of the cell to DNA damage, said sensitivity being associated with the genetic alteration;
b) exposing the genetically altered cell of step (a) to DNA
damaging treatment in the presence and absence of a test modulator compound;
c) measuring the sensitivity of the cell to DNA damage; and d) identifying a test compound that restores the sensitivity of the cell to DNA damage as an inhibitor of MCCS1 activity.
a) expressing MCCS1 in a genetically altered cell, thereby decreasing the sensitivity of the cell to DNA damage, said sensitivity being associated with the genetic alteration;
b) exposing the genetically altered cell of step (a) to DNA
damaging treatment in the presence and absence of a test modulator compound;
c) measuring the sensitivity of the cell to DNA damage; and d) identifying a test compound that restores the sensitivity of the cell to DNA damage as an inhibitor of MCCS1 activity.
25. A method of identifying a compound that inhibits ATM
comprising the steps of:
a) expressing ATM in a genetically altered cell, thereby decreasing the sensitivity of the cell to DNA damage, said sensitivity being associated with the genetic alteration;
b) exposing the genetically altered cell of step (a) to DNA
damaging treatment in the presence and absence of a test modulator compound;
c) measuring the sensitivity of the cell to DNA damage; and d) identifying a test compound that restores the sensitivity of the cell to DNA damage as an inhibitor of ATM activity.
comprising the steps of:
a) expressing ATM in a genetically altered cell, thereby decreasing the sensitivity of the cell to DNA damage, said sensitivity being associated with the genetic alteration;
b) exposing the genetically altered cell of step (a) to DNA
damaging treatment in the presence and absence of a test modulator compound;
c) measuring the sensitivity of the cell to DNA damage; and d) identifying a test compound that restores the sensitivity of the cell to DNA damage as an inhibitor of ATM activity.
26. An assay for identifying modulators of ATM kinase activity comprising the steps of:
a) incubating a ATM kinase preparation in kinase buffer with gamma-32P-ATP and an exogenous kinase substrate in the presence and absence of a test compound, and b) measuring the moles of phosphate transferred to said substrate;
wherein an increase in the moles of 32P-phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an activator of said ATM kinase and a decrease in the moles of 32P-phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an inhibitor of said ATM kinase.
a) incubating a ATM kinase preparation in kinase buffer with gamma-32P-ATP and an exogenous kinase substrate in the presence and absence of a test compound, and b) measuring the moles of phosphate transferred to said substrate;
wherein an increase in the moles of 32P-phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an activator of said ATM kinase and a decrease in the moles of 32P-phosphate transferred to said substrate in presence of said test compound compared to the moles of 32P-phosphate transferred to said substrate in the absence of said test compound indicates that said test compound is an inhibitor of said ATM kinase.
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US55866695A | 1995-11-16 | 1995-11-16 | |
| US08/558,666 | 1995-11-16 | ||
| US60731296A | 1996-02-27 | 1996-02-27 | |
| US08/607,312 | 1996-02-27 | ||
| US72530496A | 1996-10-21 | 1996-10-21 | |
| US08/725,304 | 1996-10-21 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2210650A1 true CA2210650A1 (en) | 1997-05-22 |
Family
ID=27415778
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002210650A Abandoned CA2210650A1 (en) | 1995-11-16 | 1996-11-18 | Cell cycle checkpoint pik-related kinase materials and methods |
Country Status (2)
| Country | Link |
|---|---|
| CA (1) | CA2210650A1 (en) |
| CZ (1) | CZ254797A3 (en) |
-
1996
- 1996-11-18 CZ CZ972547A patent/CZ254797A3/en unknown
- 1996-11-18 CA CA002210650A patent/CA2210650A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| CZ254797A3 (en) | 1998-03-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sap et al. | Cloning and expression of a widely expressed receptor tyrosine phosphatase. | |
| EP0690876B1 (en) | Protein kinases | |
| AU1461197A (en) | Cell cycle checkpoint pik-related kinase materials and methods | |
| US5691147A (en) | CDK4 binding assay | |
| CA2148252C (en) | Interaction trap system for isolating novel proteins | |
| JP3462498B2 (en) | CDNA cloning method of receptor tyrosine kinase target protein and hGRB protein | |
| US6218136B1 (en) | Methods of the identification of pharmaceutically active compounds | |
| US5989885A (en) | Specific mutations of map kinase 4 (MKK4) in human tumor cell lines identify it as a tumor suppressor in various types of cancer | |
| US6586577B2 (en) | Telomere repeat binding factors and diagnostic and therapeutic use thereof | |
| US20040170995A1 (en) | Isolated nucleic acid molecules encoding a novel human signal transducing kinase-mapkap-2; encoded proteins, cells transformed therewith and uses thereof | |
| US5674748A (en) | Human cyclin-dependent kinase-like proteins and methods of using the same | |
| CA2270911A1 (en) | Mammalian chk1 effector cell-cycle checkpoint protein kinase materials and methods | |
| US5830699A (en) | SOK-1 and methods of use | |
| EP1263939B1 (en) | 18477, a human protein kinase and uses therefor | |
| JP2001510684A (en) | Assays, methods of treatment and therapeutic means | |
| US20070172493A1 (en) | 12832, a novel human kinase-like molecule and uses thereof | |
| CA2210650A1 (en) | Cell cycle checkpoint pik-related kinase materials and methods | |
| CA2318519A1 (en) | Genes and polypeptides associated with ultraviolet radiation-mediated skin damage and uses thereof | |
| EP0807169A2 (en) | Cell cycle checkpoint pik-related kinase materials and methods | |
| US5627064A (en) | Protein kinases | |
| SK111597A3 (en) | Cell-cycle checkpoint phosphatidylinositol- (pik-) related kinases, genes coding therefor and methods for assaying and modulating enzymatic activity | |
| US5840536A (en) | Growth factor receptor-binding insulin receptor | |
| WO1997020573A1 (en) | Growth factor receptor-binding protein 2 homolog | |
| KR19990044317A (en) | Manipulation and detection of amylophosphatase 2C-P2Cα-expression | |
| US20020098174A1 (en) | 33166, a human hydrolase-like molecule and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |