EP0806965A1 - Cd44 expression in glatten muskelzellen - Google Patents

Cd44 expression in glatten muskelzellen

Info

Publication number
EP0806965A1
EP0806965A1 EP95910105A EP95910105A EP0806965A1 EP 0806965 A1 EP0806965 A1 EP 0806965A1 EP 95910105 A EP95910105 A EP 95910105A EP 95910105 A EP95910105 A EP 95910105A EP 0806965 A1 EP0806965 A1 EP 0806965A1
Authority
EP
European Patent Office
Prior art keywords
smooth muscle
muscle cell
compound
expression
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP95910105A
Other languages
English (en)
French (fr)
Other versions
EP0806965A4 (de
Inventor
Qi He
Edgar Haber
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Harvard University
Original Assignee
Harvard University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Harvard University filed Critical Harvard University
Publication of EP0806965A1 publication Critical patent/EP0806965A1/de
Publication of EP0806965A4 publication Critical patent/EP0806965A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70585—CD44
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/08—Vasodilators for multiple indications
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • This invention relates to the prevention and treatment of arteriosclerosis.
  • CD44 (Pgp-1, Hermes-3, HCAM, ECMR III) is a widely expressed glycoprotein with a molecular weight of 85 to 90 Da (Haynes et al., 1989, Immunol. Today 10:423-428). Immunological studies have shown that CD44 is involved in a diverse range of biological functions, such as lymphocyte binding to high endothelial venules (Jalkanen et al., 1987, J. Cell. Biol. 105:983-990), lymphopoiesis (Miyake et al., 1990, J. Exp. Med. 171:477-488) and activation of leukocytes (Webb et al., 1990, Science
  • CD44 has also been shown to play a role in extracellular matrix binding, cell migration, lymphocyte activation, lymphocyte homing, and proliferation of bronchial smooth muscle cells (Herrlich et al., Immunology today, 14 (8) :395-399, 1993; Lesley et al., Immunology, 54:271-335, 1993; Lazzar et al., Journal of Experimental Medicine, 180:807-816, 1994).
  • a splice variant of CD44, CD44-V6 has been shown to play a role in tumor cell metastasis (Gunthert et al., Cell, 65:13- 24, 1991).
  • CD44 cDNA sequence has revealed a domain of some 90 a ino acids near the N-terminus bearing a significant similarity to the link and core proteins in proteoglycan (Goldstein et al., 1989, Cell 56:1063-1072), leading to the establishment of hyaluronate, a major component of the extracellular matrix, as a ligand for
  • CD44 (Miyake et al., 1990, J. Exp. Med. 172:69-75; Aruffo et al., 1990, Cell 61:1303-1313). Fibronectin and collagen type I and VI have also been shown to interact with CD44 (Carter et al., 1988, J. Biol. Che . 263:4193- 4201) .
  • CD44 is a widely distributed heterogenous population of cell surface adhesion molecules.
  • the CD44 gene has twenty exon ⁇ , ten of which encode the sequence for standard CD44. An additional ten variable exons are inserted by alternative splicing.
  • CD44 variants Although the standard 85 kDa CD44 is broadly expressed by many different types of cells, the expression of CD44 variants is rather limited. Arch et al. have demonstrated a transient expression of a CD44 variant, V6, in leukocytes from animals after allogeneic immunization (Arch et al, 1992, Science 257:682-685), indicating a possible role for this variant in mediating leukocyte trafficking.
  • CD44 isoforms there are at least 18 different CD44 isoforms identified in various species of animals (Stamenkovic et al., 1991, Embo. J. 10:343-8; He et al., 1992, J. Cell. Biol. 119:1711-1719; Jackson et al. , 1992, J. Biol. Chem. 267:4732-4739). But the functional significance of these isoforms is still unknown.
  • CD44 cell surface antigen
  • the invention features a method of treating arteriosclerosis (the abnormal hardening or thickening of arterial walls) or vascular restenosis (the narrowing or constriction of blood vessel walls) in an animal by inhibiting the expression of CD44 on smooth muscle cells.
  • expression 11 is meant the transcription of the gene encoding CD44, translation of the transcript into protein product, translocation of the protein product to the cell membrane and appropriate anchoring of the protein product in the cell membrane.
  • expression of CD44 may be inhibited by introducing CD44 antisense DNA into smooth muscle cells.
  • antisense DNA is meant a nucleic acid which binds to the coding strand of DNA resulting in the prevention of transcription.
  • the antisense DNA is complementary to the coding strand of DNA of CD44.
  • Other methods of inhibiting expression of CD44 may also be used, e.g., inhibiting translation of the RNA transcript, inhibiting translocation of the protein product.
  • expression of the CD44-V6 isoform of CD44 is inhibited.
  • smooth muscle cell expression of CD44 is upregulated as a result of blood vessel injury.
  • the invention features a method of decreasing migration of a smooth muscle cell by inhibiting the expression of CD44.
  • expression of CD44 or the CD44-V6 isoform which may have been upregulated as a result of blood vessel injury, may be inhibited by introducing CD44 antisense DNA into the smooth muscle cells.
  • the invention features a method of decreasing proliferation of a smooth muscle cell by inhibiting the expression of CD44.
  • a method of decreasing smooth muscle cell migration is featured.
  • a smooth muscle cell is contacted with a compound which blocks the binding of the cell to a component of the extracellular matrix.
  • the compound is a CD44-specific antibody or an antigen- binding fragment thereof, e.g., an antibody or antigen- binding fragment which binds to the V6 domain of CD44.
  • the compound may also be a soluble fragment of CD44, e.g., a fragment of CD44 which includes the V6 domain of the protein.
  • the compound binds to the extracellular domain of CD44.
  • the compound may be hyaluronic acid, fibronectin, or any compound with the binding properties of hyaluronic acid or fibronectin.
  • the compound may be a soluble fragment of the cytoplasmic domain of CD44 or any compound which inhibits CD44-mediated signal transduction.
  • a fifth aspect of the invention features a method of decreasing migration of a smooth muscle cell by contacting a smooth muscle cell with a compound which blocks the binding of the cell to a second cell.
  • a sixth aspect of the invention defines a method of decreasing proliferation of a smooth muscle cell by contacting the smooth muscle cell with a compound which blocks the binding of the cell to a component of the extracellular matrix.
  • the invention features a method of decreasing proliferation of a smooth muscle cell by contacting the smooth muscle cell with a compound inhibits CD44-mediated signal transduction, e.g., a soluble fragment of the cytoplas ic domain of CD44.
  • the invention encompasses a method of decreasing proliferation of a smooth muscle cell by contacting a smooth muscle cell with a compound which blocks the binding of the cell to a second cell.
  • a method of screening candidate compounds to identify a compound capable of inhibiting CD44-mediated smooth muscle cell migration is featured.
  • the screening assay includes the steps of providing a smooth muscle cell bearing CD44 on its surface; contacting the smooth muscle cell with a candidate compound; and, determining the amount of smooth muscle cell migration.
  • a decrease in migration of the smooth muscle cell in the presence of a candidate compound compared to the amount in the absence of a candidate compound indicates that the candidate compound inhibits CD44-mediated smooth muscle cell migration.
  • the invention features a method of screening candidate compounds to identify a compound capable of inhibiting CD44-mediated smooth muscle cell proliferation.
  • the screening assay includes the steps of providing a smooth muscle cell bearing CD44 on its surface; contacting the smooth muscle cell with a candidate compound; and, determining the amount of proliferation of the smooth muscle cell. A decrease in the amount of proliferation in the presence of a candidate compound compared to the amount in the absence of a candidate compound indicates that the candidate compound inhibits CD44-mediated smooth muscle cell proliferation.
  • the invention features a method of screening candidate compounds to identify compounds capable of inhibiting expression of CD44.
  • the screening method of the invention includes the following steps: providing an activated smooth muscle cell; contacting the smooth muscle cell with a candidate compound; and determining the amount of CD44 expression in the smooth muscle cell.
  • a decrease in the amount of CD44 expression in cells exposed to the candidate compound compared to the amount of expression in cells in the absence of compound indicates that the compound inhibits expression of CD44 in smooth muscle cells.
  • Fig. 1 is a diagram comparing the structure of the V6 isoform of CD44 expressed on smooth muscle cell to the structure of standard CD44.
  • Fig. 2 is a diagram showing the structure and post-translational modification of proteoglycan CD44. CD44 is shown anchored in the cell membrane.
  • Fig. 3 is a histogram showing expression of CD44 on the surface of smooth muscle cells.
  • Fig. 4 is a histogram showing the expression of the CD44-V6 variant on rat smooth muscle cells (RASMC) .
  • Fig. 5 is histogram showing FACS analysis of surface antigens of human aortic smooth muscle cells (HASMC) and RASMC.
  • Fig. 6A is a histogram showing cell surface expresssion of CD44 on RASMC.
  • Fig. 6B is a histogram showing cell surface expresssion of ⁇ on RASMC.
  • Fig. 6C is a histogram showing cell surface expresssion of CD44 V6 on RASMC.
  • Fig. 6C is a histogram showing cell surface expresssion of ⁇ 3 on RASMC.
  • Fig. 7 is a photograph of a Northern blot analysis showing CD44 expression in quiescent smooth muscle cells compared to activated smooth muscle cells.
  • Fig. 8A is a bar graph showing a comparison of CD44 expression in RASMC grown on plastic in 10% FCS (growing and confluent) to CD44 expression in RASMC grown on matrigel
  • Fig. 8B is a photograph of a Northern blot showing a comparison of CD44 expression in RASMC grown on plastic in 10% FCS (growing and confluent) to CD44 expression in RASMC grown on matrigel.
  • Fig. 9A is a photograph of a Northern blot showing CD44-V6 expression in carotid artery tissue after carotid artery balloon injury; 20 ⁇ g of RNA was loaded per lane.
  • Fig. 9B is a bar graph showing CD44-V6 expression in carotid artery tissue after carotid artery balloon injury.
  • Fig. 10A is a Northern blot showing CD44 expression in carotid artery tissue after carotid artery injury; 7.5 ⁇ g of RNA was loaded per lane.
  • Fig. 10B is a bar graph showing CD44-V6 expression after carotid artery balloon injury.
  • Fig. 11A is a bar graph showing proliferation of HASMC to hyaluronate.
  • Fig. 11B is a bar graph showing proliferation of RASMC to hyaluronate.
  • Fig. 12A is a bar graph showing proliferation of HASMC to antibody.
  • Fig. 12B is a bar graph showing proliferation of RASMC to antibody. Detailed Description Cell Culture
  • RASMC were harvested from the thoracic aorta of male Sprague-Dawley rats (200-250 g) by enzymatic dissociation.
  • the cells were grown in Dulbecco's modified Eagle's medium (DMEM) (JRH Biosciences, Lenexa, KS) supplemented with 10% fetal calf serum (FCS) , penicillin (100 units/ml) , streptomycin (100 ⁇ g/ml) , and 25 mM Hepes (pH 7.4) in a 37° C, 5% C0 2 , humidified incubator. Cells from passage 5-8 were used in the experiments.
  • DMEM Dulbecco's modified Eagle's medium
  • FCS fetal calf serum
  • penicillin 100 units/ml
  • streptomycin 100 ⁇ g/ml
  • Hepes 25 mM Hepes
  • HASMC HASMC (Clonetics, San Diego) were grown in M199 medium (GIBCO) containing 20% FCS, penicillin (100 units/ml) , streptomycin (100 ⁇ g/ml) , and 25 mM Hepes (pH 7.4). Cells from passages 8-10 were used. To promote differentiation, RASMC were grown in vitro on matrigel (Collaborative Research) according to the manufacturer's instructions. Cells (2 x 10 6 ) were evenly plated on the dishes and examined for morphological changes after 24 hours.
  • RASMC and HASMC in 24 well plates were made quiescent by incubation in DMEM (0.4% CS) and M199 medium (0.4% FCS), respectively, for 72 hours before addition of hyaluronic acid (HA) (Anika Chemical Company, Boston, MA) or monoclonal antibody, e.g., OX-49 (Pharmingen, San Diego, CA) , OX-50 (Biosource International, Camarillo, CA) , NIH44 (National Institutes of Health) .
  • HA hyaluronic acid
  • OX-50 Biosource International, Camarillo, CA
  • NIH44 National Institutes of Health
  • a cDNA fragment from RASMC RNA was amplified by the reverse transcription polymerase chain reaction.
  • Primers were designed using the published sequence of the rat CD44 and CD44-V6 sequence. The following primers were used to amplify a 1228 base pair fragment of CD44: forward primer 5' AGCCAGTGACAGGTTCCATT 3' (SEQ ID N0:1) and reverse primer 5' TGTTGTGTCTTTTCAAGTTA 3' (SEQ ID NO:2) .
  • the forward primer 5' GGCGGATCCTAATAGCACAACAG 3' (SEQ ID NO:3) and reverse primer 5' GGCGGATCCTTCTGTCACATGGGAG 3' (SEQ ID NO:4) were used to amplify a 108 base pair fragment.
  • the polymerase chain fragment was then subcloned and sequenced by the dideoxy chain termination method known in the art. The sequence of the two fragments were identical to the known sequence (Gunthert, 1991, CELL 65:13-24).
  • Rats subjected to balloon carotid injury were obtained at various time points from Zivic-Miller Company. Rats were anesthetized using chloral hydrate, and the injured carotid artery isolated. Total RNA was extracted using the RNA-Zol method (Cinna/Ciotecx Laboratories International) . Total RNA from cultured cells was obtained by guanidinium isothiocyanate extraction and centrifuged through cesium chloride. The RNA was fractionated on a 1.3% formaldehyde-agarose gel and transferred to nitrocellulose filters. The filters were hybridized with a randomly primed 32 P-labeled CD44 or CD44-V6 probes.
  • the hybridized filters were washed in 30 mM sodium chloride, 3 mM sodium citrate, and 0.1% sodium dodecyl sulfate solution at 55° C and autoradiographed with Kodak XAR film at -80° C for 12-48 hours or stored on phosphor screens for 12-18 hours.
  • the filters were washed in a 50% formamide solution at 80° C and rehybridized with a 18S oligonucleotide probe.
  • the filters were scanned, and radioactivity was measured on a Phosphorlmager running the ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA) .
  • Rat aortic smooth muscle cells were obtained as described above. Cells were briefly exposed to 0.025%/1.5 mM EDTA, washed and incubated on ice for 30 minutes with various antibodies. Labeled cells were washed three times with DMEM media containing 10% FCS and incubated with FITC-conjugated secondary antibody. Analysis was done on a Beckton Dickinson FACS scanner. Antibodies used were: Ox-49; 1.1 ASML; rabbit anti-rat jS- L integrin antiserum; Fll (anti-rat ⁇ 3 integrin, IgGl (Pharmingen) .
  • CD44 variants The involvement of CD44 variants in arterial smooth muscle cell activities was studied using a rat carotid artery injury model. The existence of CD44 variants and their potential in regulating medial smooth muscle cell proliferation and migration was examined. Specifically, the role of CD44 in the migration of smooth muscle cells involved in the formation of lesions characteristic of vascular injury was examined. This disclosure represents the first report of CD44 and its V6 isoform expression on smooth muscle cells. Cell surface expression of CD44 was measured by FACS and tissue staining. Expression of CD44 was confirmed by analysis of CD44-V6 transcripts in cultured smooth muscle cells.
  • Figs. 3-5 smooth muscle cells were found to express high levels of CD44 on their surface (see Figs. 3-5) .
  • FIG. 3 cultured smooth muscle cells were incubated in the presence and absence of tumor necrosis factor- ⁇ (TNF- ) , an inflammatory cytokine, followed by FACS analysis of the cells using an anti-CD44 antibody.
  • TNF- tumor necrosis factor- ⁇
  • the right peak of the histogram represents CD44 expression.
  • the data which is plotted on a logarithmic scale, clearly indicates that CD44 expression is substantially increased on cells exposed to TNF- ⁇ .
  • Cells incubated in the absence of TNF- ⁇ were also observed to express CD44, but in amounts much lower than the TNF- ⁇ - treated cells.
  • the low level of expression is believed to be due to a basal level of activation of cultured smooth muscle cells.
  • CD44 expression on cultured human muscle cells grown in culture media deprived of serum growth factors was compared to the expression on cells grown under optimal conditions, i.e., media supplemented with serum growth factors.
  • Fig. 5 shows that CD44 expression is elevated in cells grown under normal conditions compared to cells grown under suboptimal conditions.
  • CD44 was found to be expressed on cultured human as well as cultured RASMC.
  • CD44 expression was also examined in primary tissues. Rat carotid arteries were collected from normal and balloon injured animals. Tissue samples were stained with anti-CD44 monoclonal antibodies. In contrast to studies using cultured smooth muscle cells, neither CD44 standard form nor the V6 isoform was detectable on normal vessels. However, after mechanical injury of a blood vessel by balloon denudation (angioplasty) , CD44-V6 was found to be expressed in both the neointima of the blood vessel and in the media as indicated by immunofluorescence staining. These results indicate that expression of CD44 is increased after injury.
  • CD44-V6 may be directly involved in smooth muscle cell migration.
  • CD44-V6, and fragments thereof can be used as blocking agents to interfere with binding of smooth muscle cells to other cells or to components of the extracellular matrix and thus, migration of smooth muscle cells to sites of vascular injury.
  • CD44 may also act as a mediator of other cellular activities by influencing other adhesion molecules such as integrins.
  • Compounds can be used inhibit the migration or proliferation of smooth muscle cells by blocking the association of CD44 to a ligand on a second cell or to a component of the extracellular matrix.
  • soluble peptides which bind to CD44 or to the ligand to which CD44 binds may be used to prevent or disrupt CD44 association with a ligand.
  • Peptides such as a soluble fragment of CD44 extracellular domain or a soluble fragment of a CD44 ligand, could also be used.
  • Such peptides will ordinarily be at least about 10 amino acids, usually about 20 contiguous amino acids, preferably at least 40 contiguous amino acids, more preferably at least 50 contiguous amino acids, and most preferably at least about 60 to 80 or more contiguous amino acids in length.
  • Such peptides can be generated by methods known to those skilled in the art, including proteolytic cleavage of the protein, de novo synthesis of the fragment, or genetic engineering, e.g., cloning and expression of a fragment of CD44 cDNA (Aruffo et al., supra ; Gunthert et al., supra ; Jackson et al., supra ; Qi et al. , supra) .
  • Analogs of the above peptides may also be used to block CD44 binding.
  • Analogs can differ from the native peptides of CD44 by amino acid sequence, or by modifications which do not affect the sequence, or by both. Modifications (which do not normally alter primary sequence) include in vivo or in vitro chemical derivitization of polypeptides, e.g., acetylation or carboxylation.
  • glycosylation e.g., those made by modifying the glycosylation patterns of a polypeptide during its synthesis and processing or in further processing steps, e.g., by exposing the polypeptide to enzymes which affect glycosylation e.g., mammalian glycosylating or deglycosylating enzymes.
  • Soluble compounds such as portions of known CD44 ligands, e.g., hyaluronic acid, fibronectin, collagen type I and type VI, can also be used to block the association of CD44 with its ligand.
  • Synthetic ligands which bind to CD44 such as those with the binding properties of hyaluronic acid or fibronectin, collagen type I and type VI could also be used.
  • Antibodies or antigen-binding fragments thereof which are specific for either the extracellular domain of CD44 or the ligand to which CD44 binds, are also useful to block CD44 binding.
  • the peptide bonds of a peptide may be replaced with an alternative type of covalent bond (a "peptide mimetic") .
  • a peptide mimetic an alternative type of covalent bond
  • replacement of a particularly sensitive peptide bond with a noncleavable peptide mimetic will make the resulting peptide more stable and thus, more useful as a therapeutic.
  • mimetics, and methods of incorporating them into polypeptides are well known in the art.
  • the replacement of an L- a ino acid residue with a D-amino acid is a standard way of rendering the polypeptide less sensitive to proteolysis.
  • amino-terminal blocking groups such as t-butyloxycarbonyl, acetyl, theyl, succinyl, methoxysuccinyl, suberyl, adipyl, azelayl, dansyl, benzyloxycarbonyl, fluorenylmethoxycarbonyl, methoxyazelayl, methoxyadipyl, methoxysuberyl, and 2,4,- dinitrophenyl.
  • Blocking the charged amino- and carboxy- termini of the peptides would have the additional benefit of enhancing passage of the peptide through the hydrophobic cellular membrane and into the cell. This modification may be especially useful in the delivery of peptides into cells, the delivery of fragments of the cytoplasmic domain of CD44 into the cell to inhibit CD44- mediated signal transduction. Liposomal delivery is also favored for intracellular delivery of compounds.
  • Peptides may be administered to the patient intravenously in a pharmaceutically acceptable carrier such as physiological saline. Such methods are well known to those of ordinary skill in the art. It is expected that an intravenous dosage of approximately 1 to 100 ⁇ moles of the peptide of the invention would be administered per kg of body weight per day.
  • the formulations of this invention are useful for parenteral administration, such as intravenous, subcutaneous, intramuscular, and intraperitoneal.
  • CD44 expression may be an important functional step in smooth muscle cell migration.
  • manipulation of CD44 expression could be used to prevent or inhibit smooth muscle cell migration.
  • administration of compounds which inhibit CD44 expression would be useful to prevent restenosis after vascular injury.
  • an isolated CD44 antisense DNA may be introduced into target cells of the patient by standard vectors and/or gene delivery systems.
  • Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, naked DNA, and viral vectors such as herpes viruses, retroviruses, and adenoviruses, among others.
  • Pharmaceutically acceptable carriers are biologically compatible vehicles which are suitable for administration to an animal: e.g., physiological saline.
  • a therapeutically effective amount is an amount of the nucleic acid of the invention which is capable of producing a medically desirable result in a treated animal, i.e., decreased expression of CD44.
  • dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Dosages for the compounds of the invention will vary, but a preferred dosage for intravenous administration is from approximately 10 6 to 10 22 copies of the nucleic acid molecule.
  • Screening assays CD44 may be considered targets for the development of drugs that it inhibit its action, either in binding to one of its critical ligands or in inhibiting possible intracellular signaling after ligand binding. These drugs would have application in the prevention of arteriosclerosis, or of post-angioplasty or post-bypass surgery restenosis.
  • a, sample of cells expressing CD44 on their surface can be incubated in the presence of a candidate compound and a control sample of cells incubated in the absence of the same candidate compound.
  • the migration of each sample of cells can then be compared using methods well known in the art. For example, movement of cells can be evaluated using a Boyden chamber or any multiwell chamber in which the wells of the chamber are separated by a membrane through which cells are capable of passing, e.g., a polycarbonate membrane with pores large enough (e.g, 3 ⁇ m) to accommodate the size of migrating cells.
  • Treated or untreated cells can be added to one well of the multiwell chamber and movement of cells from one well to the other well of the chamber measured. A decrease in the amount of migration of cells from one well to the other well in the presence of candidate compound compared to that in the absence of candidate compound indicates that the compound inhibits CD44-mediated smooth muscle cell migration.
  • a sample of cells expressing CD44 on the surface can be incubated in the presence of a candidate compound. Similarly, a control sample of cells is incubated in the absence of the same candidate compound. Following incubation, proliferation of each sample of cells can be evaluated by exposing the cells to medium containing [ 3 H]-thymidine. Incorporation of thymidine into the DNA of the cells indicates that the cells are replicating or proliferating. The amount of [ 3 H]-thymidine incorporated into each sample of cells is can be measured and corrected with cell proliferation. A decrease in the amount of incorporated [ 3 H]-thymidine in cells that were contacted with candidate compound compared to the amount in cells that were not contacted with the compound indicates that the candidate compound inhibits smooth muscle cell proliferation.
  • a screening assay to identify compounds which are capable of inhibiting expression of CD44 in smooth muscle cells can be carried out as follows.
  • a sample of activated smooth muscle cells e.g. cultured smooth muscle cells
  • a sample of control cells can be incubated in the absence of the compound.
  • Each sample of cells can then be evaluated for the expression of CD44.
  • each sample of cells can be incubated with a CD44-specific antibody and the cells evaluated for binding of the antibody by immunofluorecent staining or FACS. The amount of antibody binding is correlated with the level of expression of CD44.
  • CD44 expression can also be measured at the level of gene transcription.
  • CD44 transcripts can be measured by Northern blotting techniques using CD44- specific DNA probes or by PCR using CD44-specific DNA primers. A decrease in the amount CD44 expression in treated cells, as measured by any such technique compared, compared to the amount in untreated cells indicates that the candidate compound is capable of inhibiting the expression of CD44 in smooth muscle cells.
  • EXAMPLE l Demonstration of CD44 and CD44-V6 on vascular smooth muscle cells in vivo and in vitro
  • CD44 and CD44-V6 on cultured rat aortic smooth muscle cells (10% FCS) was established by flow cytometry analysis using monoclonal antibodies and FITC labeled secondary antibody. As seen in Figs. 6A-6D, the standard form of CD44 was expressed at levels considerably higher than ⁇ 1 or ⁇ 3 integrins. CD44-V6 was expressed at levels similar to those of ⁇ and ⁇ 3 integrins but lower than standard CD44. Expression of CD44 and its variant were lower in quiescent (0.4% FCS) versus activated cells (10% FCS) .
  • vascular smooth muscle cells were analyzed to determine the level of CD44 and CD44-V6 expression in vivo . The effect of cellular stimulation on expression of these proteins was also determined.
  • One method of stimulating vascular smooth muscle cells is through arterial wall injury. Carotid artery specimens after injury were compared to control (uninjured) vessels by immunocytochemical staining. CD44 and CD44-V6 levels were found to be markedly upregulated after injury.
  • vascular smooth muscle cells express both CD44 and CD44-V6 in vitro and in vivo, and levels are upregulated after serum or mechanical stimulation.
  • EXAMPLE 2 Determination of mRNA levels in vitro and in vivo
  • Fig. 7 shows a comparison of mRNA expression of CD44 in quiescent (0.4% FCS) to that in activated (10% FCS) smooth muscle cells. Three bands were detected in each lane corresponding to sizes of known CD44 transcripts. However, no significant difference was seen between quiescent and activated vascular smooth muscle cells in culture. Since passaged RASMC represent a synthetic, dedifferentiated phenotype it is possible that these cells, despite being cultured in 0.4% FCS, are not truly quiescent. Thus, mRNA levels of cells grown on matrigel were also evaluated.
  • Matrigel is a solubilized basement membrane matrix which has recently been used to maintain cultured cells in a highly differentiated phenotype (Li et al., 1994, J. Biol. Chem., 269:19653-19658).
  • Figs. 8A and 8B show a comparison of CD44 expression in cells grown on plastic in 10% FCS (growing and confluent) to cells grown on matrigel. A decrease in mRNA expression was seen in cells grown on matrigel.
  • CD44 and CD44-V6 are smooth muscle cells
  • in situ analysis was performed on rat carotid artery injury specimens using digoxigenin labeled riboprobes. Smooth muscle cells in the media and neointima were found to have considerably more labeling than the control.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Public Health (AREA)
  • Cardiology (AREA)
  • Toxicology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Vascular Medicine (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
EP95910105A 1994-01-18 1995-01-18 Cd44 expression in glatten muskelzellen Withdrawn EP0806965A4 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US18315694A 1994-01-18 1994-01-18
US183156 1994-01-18
PCT/US1995/000740 WO1995019183A1 (en) 1994-01-18 1995-01-18 Cd44 expression in smooth muscle cells

Publications (2)

Publication Number Publication Date
EP0806965A1 true EP0806965A1 (de) 1997-11-19
EP0806965A4 EP0806965A4 (de) 2000-06-07

Family

ID=22671682

Family Applications (1)

Application Number Title Priority Date Filing Date
EP95910105A Withdrawn EP0806965A4 (de) 1994-01-18 1995-01-18 Cd44 expression in glatten muskelzellen

Country Status (5)

Country Link
EP (1) EP0806965A4 (de)
JP (1) JPH09508265A (de)
AU (1) AU689226B2 (de)
CA (1) CA2179391A1 (de)
WO (1) WO1995019183A1 (de)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5990299A (en) * 1995-08-14 1999-11-23 Icn Pharmaceuticals, Inc. Control of CD44 gene expression for therapeutic use
AU6721696A (en) * 1996-07-15 1998-03-06 Human Genome Sciences, Inc. Cd44-like protein
MX2013010910A (es) * 2011-03-24 2014-03-27 Neurim Pharma 1991 Peptidos neuroprotectores.
CN112673983A (zh) * 2020-12-21 2021-04-20 重庆工商大学 一种基于糖基化改性大豆分离蛋白的宠物咬胶的制备方法及产品

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994007505A1 (en) * 1991-07-03 1994-04-14 Norpharmco Inc. Use of hyaluronic acid and forms to prevent arterial restenosis

Also Published As

Publication number Publication date
WO1995019183A1 (en) 1995-07-20
AU689226B2 (en) 1998-03-26
CA2179391A1 (en) 1995-07-20
AU1832695A (en) 1995-08-01
EP0806965A4 (de) 2000-06-07
JPH09508265A (ja) 1997-08-26

Similar Documents

Publication Publication Date Title
Tedesco et al. The cytolytically inactive terminal complement complex activates endothelial cells to express adhesion molecules and tissue factor procoagulant activity
Cherayil et al. Molecular cloning of a human macrophage lectin specific for galactose.
Wilting et al. The transcription factor Prox1 is a marker for lymphatic endothelial cells in normal and diseased human tissues
Burger et al. Chronic lymphocytic leukemia B cells express functional CXCR4 chemokine receptors that mediate spontaneous migration beneath bone marrow stromal cells
Watt et al. PECAM-1: its expression and function as a cell adhesion molecule on hemopoietic and endothelial cells
Dippold et al. Expression of intercellular adhesion molecule 1 (ICAM-1, CD54) in colonic epithelial cells.
Small et al. STK-1, the human homolog of Flk-2/Flt-3, is selectively expressed in CD34+ human bone marrow cells and is involved in the proliferation of early progenitor/stem cells.
Sassetti et al. Identification of endoglycan, a member of the CD34/podocalyxin family of sialomucins
Siler et al. Characterization and functional analysis of laminin isoforms in human bone marrow
Salles et al. Alternatively spliced CD44 transcripts in diffuse large-cell lymphomas: characterization and comparison with normal activated B cells and epithelial malignancies
JPH07501212A (ja) TGF−β型受容体cDNAおよびその用途
US20090012020A1 (en) Inhibiting formation of atherosclerotic lesions
EP0362278A1 (de) Autokrine beweglichkeitsfaktoren bei der diagnose und behandlung von krebs
JP2014221055A (ja) インテグリンヘテロ二量体およびそのサブユニット
Jones et al. Expression of complement regulatory molecules and other surface markers on neutrophils from synovial fluid and blood of patients with rheumatoid arthritis
US20040072259A1 (en) Methods and products for manipulating hematopoietic stem cells
HU215778B (hu) Eljárás szindekántartalom kimutatására biológiai anyagokban, így szövetekben és testnedvekben, a sejtek rosszindulatú transzformációinak jelzésére
Arencibia et al. Collagen receptor on T lymphocytes and the control of lymphocyte motility
AU689226B2 (en) CD44 expression in smooth muscle cells
US6358915B1 (en) Methods for inhibiting metastasis
Ruegg et al. B4B, a novel growth-arrest gene, is expressed by a subset of progenitor/pre-B lymphocytes negative for cytoplasmic mu-chain
Chakrabarti et al. Control of islet intercellular adhesion molecule-1 expression by interferon-α and hypoxia
Navarrete Santos et al. Regulation by transforming growth factor-beta1 of class II mRNA and protein expression in fibroblast-like synoviocytes from patients with rheumatoid arthritis.
US7524622B2 (en) Methods for increasing production of IFN-gamma in natural killer cells expressing LLT1 receptor
Kanda et al. Autotaxin, a lysophosphatidic acid-producing ectoenzyme, promotes lymphocyte entry into secondary lymphoid organs

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19960719

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

A4 Supplementary search report drawn up and despatched

Effective date: 20000427

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20020801