EP0806478A2 - Protéine p53as et anticorps correspondant - Google Patents

Protéine p53as et anticorps correspondant Download PDF

Info

Publication number
EP0806478A2
EP0806478A2 EP97107696A EP97107696A EP0806478A2 EP 0806478 A2 EP0806478 A2 EP 0806478A2 EP 97107696 A EP97107696 A EP 97107696A EP 97107696 A EP97107696 A EP 97107696A EP 0806478 A2 EP0806478 A2 EP 0806478A2
Authority
EP
European Patent Office
Prior art keywords
p53as
protein
cells
antibody
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP97107696A
Other languages
German (de)
English (en)
Other versions
EP0806478A3 (fr
Inventor
Molly F. Kulesz-Martin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Health Research Inc
Original Assignee
Health Research Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US08/644,456 external-priority patent/US5747650A/en
Priority claimed from US08/644,289 external-priority patent/US7238523B1/en
Priority claimed from US08/644,291 external-priority patent/US5726024A/en
Application filed by Health Research Inc filed Critical Health Research Inc
Publication of EP0806478A2 publication Critical patent/EP0806478A2/fr
Publication of EP0806478A3 publication Critical patent/EP0806478A3/fr
Ceased legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4746—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used p53
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • This invention relates to p53 protein and variations thereof, and more particularly relates to antibodies to such variations, vectors containing coding sequences for such variations and uses for such variations, antibodies and vectors.
  • p53 protein is a protein encoded by p53 gene.
  • the p53 gene has a size of from 10 to 20Kb, usually has eleven exons, is believed to occur in all vertebrates and such p53 genes have at least five significant homologous domains all the way from Xenopus up through primates. Structural aspects of the p53 protein in relation to gene evolution, Soussi et al., Oncogene, (1990), 5, 945-952; The p53 Tumor Suppressor Protein; Meeting Review, Prives et al, Genes and Development, (1993) 7:529-534. In mice and humans, a single copy of a functional p53 gene is found on haploid genomes where it is located on chromosome 11.
  • p53 protein contains a negative regulatory domain for p53 sequence specific DNA binding which is found within the last 50 amino acids at the p53 C terminus.
  • the negative regulatory domain of p53 negates p53 sequence specific binding in certain cellular environments which in turn causes p53 to lose activity.
  • the p53 gene which encodes for p53 protein is defective in over half of all human cancers. It is furthermore significant because introduction of a normal p53 gene into a variety of cancer cells arrests their growth. Thus, defects in the p53 gene product (that is, the p53 protein) are common in many cancers and, if corrected, could inhibit cancer cell growth. In many human cancers, the p53 protein is inactive because of mutation of the p53 gene. Replacement of a single amino acid can be sufficient to change the normal folding of the p53 protein, making it inactive as a growth control gene.
  • the folding of a mutant p53 protein can be stabilized in the normal conformation by binding to cellular factors, suggesting that it may be possible to create peptides which bind to p53 protein and cause it to be maintained in the normal conformation (conformations are forms of a protein created due to folding; conformations can change without (or with) changes in amino acid sequence).
  • the normal conformation has the tumor suppressor effect. Cells expressing primarily mutant p53 conformation give rise to aggressive tumors at high frequency while cells which primarily express p53 protein in a normal conformation give rise to slow-growing tumors at low frequency.
  • p53as RNA exists in normal mouse cells and tissues and in tumor cells (Han et al. (b) (1992), "Alternatively spliced p53 RNA in transformed and normal cells of different tissue types", Nucleic Acids Res. , 20(8), 1979-1981.
  • p53as alternatively spliced p53 (p53as, for alternative splice) RNA exists in cultured cells and normal tissues of mice at approximately 30% of the major p53 RNA form (Han and Kulesz-Martin, Nucleic Acid Res., 20:1979-81, 1992).
  • the predicted protein encoded by the p53as transcript differs from p53 protein in 17 C-terminal amino acids and is truncated by 9 amino acids due to alternative splicing of intron 10 of the wild type p53 gene.
  • antibody to the 17 C-terminal amino acids to detect p53as protein the following points have been demonstrated.
  • Natural p53as protein is an alternatively spliced product of the wild type p53 gene. First detected in mouse epidermal cells, it is present in non-transformed and malignant cells. Like its major counterpart, p53 protein, it is located in the nucleus. However, while p53 antigen activity is primarily found in cells at the G1 stage of the cell cycle and is thought to play a role in G1 arrest in cells following treatment with DNA damaging agents, p53as is found in cells preferentially distributed in the G2 phase of the cell cycle and in a "tail" of cells with >G2 DNA content. These properties of p53as protein are suggestive of cellular functions distinct from the major p53 protein. The well established ability of the p53 protein to oligomerize and the finding of co-expression of p53as antigen activity with p53 in cells suggested potential for cooperation with p53 in its functions related to cell cycle control.
  • the finding of naturally occurring p53as protein in mouse tumor cells and antibodies for its detection has applications in basic research on cell growth and differentiation.
  • the development of a homologous protein for use in human cells has applications in the diagnosis, prognosis and design of treatment strategy in human diseases of growth and differentiation such as cancer.
  • the association with G2 suggests a functional role in G2 arrest and potential for gene therapy using the p53as coding sequence.
  • the p53as antibodies having the utilities described may be antibodies to naturally occurring or synthetic p53as.
  • a form of natural p53as is present in normal cells of at least some mammals.
  • p53as is essentially identical to known normal growth controlling protein p53, at least until the final 50 and preferably until the final 30 amino acids of the carboxy terminal end of the protein. "Essentially identical" means at least 80% and preferably at least 90% sequential correspondence with p53. It should be noted that mouse p53 has an 81% identity with mouse p53as at the protein level.
  • Mouse p53as has a highly acidic N terminus, a basic C-terminus and a central region containing uncharged amino acids
  • the final 50 amino acids of p53as protein proximate the carboxy terminus of the p53as protein are at least partly different than the final 50 amino acids of p53 protein.
  • the difference in naturally occurring p53as is believed to be at least in part due to different amino acid sequences in the two proteins proximate the carboxy termination of the protein and may also be partly due to a longer or shorter p53as amino acid chain when compared with p53. It is believed that the most common and probable final few amino acids at the carboxy termination of naturally occurring p53as contain the sequences SPNC and SPPC.
  • p53as has been found to function as a growth regulator in all mammals tested regardless of whether or not p53as has been found to naturally occur in the mammal.
  • p53as may be of natural or synthetic form, provided that, at a minimum, terminal amino acids differ in whole or in part from the 50 terminal amino acids of p53 so that the modified products will act the same as active p53 protein.
  • p53as is functionally the same as p53 except that a p53as lacks the negative regulatory domain for p53 sequence specific DNA binding which is found within the last 50 amino acids at the p53 C terminus.
  • the negative regulatory domain of p53 negates p53 sequence specific binding in certain cellular environments which in turn causes p53 to lose activity.
  • p53as lacks the negative regulatory domain and thus remains active in similar cellular environments.
  • the terminal amino acids of p53 are preferably modified, i.e., there is at least some substitution, as opposed to simple truncation.
  • p53as protein has "tumor suppressor" activity in mouse and human cells, activates transcription through p53 target sequences of mouse and human cells, and forms tetramers, a DNA binding form observed for the tumor suppressor gene p53as.
  • the invention includes a method for characterization of unknown cell products by: reacting the unknown cell products with an antibody which does not bind to a normal p53 from a mammal and which specifically binds to a p53as protein; determining the presence and concentrations of p53as in the unknown cell products as a result of the reaction of the unknown cell products with the antibody; and comparing the determined concentrations of p53as in the unknown cell products with p53as concentrations in known cell products for assistance in characterizing the unknown cell products.
  • the invention also comprises plasmids and viral vectors containing a p53as cDNA sequence.
  • a preferred viral vector is baculovirus vector. Support is provided for the utility of p53as gene expression from plasmids and vectors.
  • the invention includes antibodies both polyclonal and monoclonal, to p53as and to at least a portion of human p53 intron 10 sequence encoding SLRPFKALVREKGHRPSSHSC (Sequence ID # 1) which is related to p53as sequences and plasmids and viral vectors containing such sequences.
  • the antibodies can detect the presence of p53as and related sequences and when incorporated into cells could cause cell cycle arrest and the plasmids and viral vectors, with appropriate promotors, can cause expression of the p53as and p53 intron 10 sequences which can affect cell growth and perhaps arrest certain malignancies.
  • Figure 1 shows a diagram for a proposed mechanism of activation of DNA binding by p53 protein.
  • Figure 2 shows a diagram for a proposed model for p53as protein activity.
  • Figure 3 is a domain map of p53 protein showing changes introduced by alternative splicing (Sequence ID #'s 15 and 16).
  • Mouse p53 has 390 amino acids. Domains (see Vogelstein et al., (1992), "p53 function and dysfunction", Cell 70, 523-526 and references therein) are ACT:transcriptional activation domain; HSP; heat shock protein binding region of mutant p53; HOT spots; highly conserved regions among p53 proteins in which most transforming mutations occur; PAb240; region binding antibody conformation-specific for certain mutants, murine amino acids 156-214; PAb246: region binding antibody to normal wt. conformation, murine amino acids 88-109; PAb421: region binding antibody to wt.
  • intron 10 retained in p53as mRNA is indicated as a triangle between exons.
  • Acidic amino acids (within a predicted alpha-helix spanning 334-356) and basic amino acids (Between position 363 and 386 - underlined in the C-terminal peptide sequence at bottom) are labeled according to Sturzbecher et al., (1992), "A C-terminal a -helix plus basic region motif is the major structural determinant of p53 tetramerization", Oncogene 7, 1513-1523.
  • Figure 4 shows a graph of reactivities with p53as peptide of anti-p53as serum and affinity-purified antibodies detected by ELISA.
  • New Zealand White female rabbits were immunized with a peptide equivalent to the C-terminal 17-amino acids of p53as.
  • p53as peptide was synthesized at the RPCI Biopolymer facility and immunizations were performed at RPCI Springville Laboratories.
  • ELISA plates were coated with 2 ⁇ g peptide and reacted with pre-immune serum or day 63 immune serum at 1/500 through 1/640,000 (1/2 dilutions) and peroxidase-conjugated, affinity-isolated goat anti-rabbit immunoglobulin.
  • Figure 5 shows an anti-p53as immunoprecipitation of a 53kd protein.
  • proteins were resolved by electrophoresis as described in Experimental Procedures. 53kd proteins were detectable by PAb421 and affinity purified anti-p53as (ApAs) and rabbit polyclonal anti-p53 serum CM5.
  • Figure 6 views A through E shows immunofluorescence fields indicating nuclear localization of p53as antigen activity.
  • Cells were plated at 1.5x10 4 cells/cm 2 on glass coverslips and grown until about 70% confluent. Nuclear reactivity was detected using affinity-purified anti-ASp53 antibody in indirect immunofluorescence assays of 100% EtOH-fixed cells (A). This reactivity was completely blocked by competition with 1:1 ratio (by weight) of the 17 amino acid peptide corresponding to the C-terminus of the p53as protein (C). No competition was evident with up to a 10:1 ratio of an unrelated 16 amino acid peptide (E).
  • Phase contrast optics corresponding to the immunofluorescence field are shown at right (B, D, F). Findings were similar for all epidermal cell lines (transfectant clone 119 of 291.03 RAT is shown). Fluorescence in IgG2a, IgG1 or ammonium-sulfate fractionated pre-immune serum controls were negligible (data not shown). Bar equals 15 ⁇ m.
  • Figure 7 shows comparative immunoprecipitation of p53 from proliferating (LC) or differentiating (HC) nontransformed parental 291 cells and from 291.03RAT (03RAT) carcinoma cells or its derivative clone 119 transfected with a mutant p53 (valine-135).
  • Cell lysates are incubated with 2 ⁇ g PAb421, 4 ⁇ PAb246 or 1.4 ⁇ anti-p53as (ApAs) in NET/GEL.
  • Immunocomplexes were incubated with 5mg protein A for 2h at 4°C, centrifuged and immunoprecipitated protein was eluted from pellets with heating at 85°C for 15 min.
  • Immunoprecipitable p53as protein in clone 119 could have resulted from transfected mutant transcripts or from endogenous wt. p53as RNA.
  • the densities of the p53 signal in each lane are provided (numbers at bottom of each lane) relative to ApAs reactivity of 291LC as 1.
  • Figure 8 shows a northern blot of p53 RNA in 291.05 RAT carcinoma cells following treatment with actinomycin D. Cells were harvested after exposure to 0.5nM actinomycin D or 0.2% acetone for 48h and RNA was extracted as detailed in Experimental Procedures.
  • Figures 9A through 9F show expression of p53 (PAb421) and p53as antigen activities in 291.05RAT carcinoma cells.
  • Cells were treated with 0.5nM actinomycin D for 2 days and harvested by trypsinization. Cells were permeabilized and stained in suspension with anti-p53as and PAb421 antibodies (in the same tube) in all cases shown except for the primary antibody control (upper left).
  • the FL1 fluorescence intensity on the x-axis was FITC (green), used to visualize PAb421 reactivity
  • the FL2 fluorescence intensity on the y-axis was phycoerythrin (red) used to visualize anti-p53as reactivity.
  • the anti-p53as antibody Prior to incubation with cells, the anti-p53as antibody was exposed to either p53as peptide, which competitively removed the specific anti-p53as reactivity, or to an unrelated peptide, which controlled for nonspecific binding to peptide, leaving only specific reactivity to p53as protein. Events collected by flow cytometry were single cells only as described in Experimental Procedures.
  • the cell cycle distribution of events from each region is shown in the 3 histograms at bottom.
  • the numbers of cells in each region expressed as a percentage of the total cells were: unrelated peptide, R1, 0.02, R2, 1.7, R3, 17 and R4, 79 (numbers may not add to 100 due to rounding error and to a negligible number of events outside the windows included in the analysis); p53as peptide, R1, 0.02, R2, 0.05, R3, 19, R4, 79.
  • Figures 10A through 10F show expression of p53 (PAb421) and p53as antigen activities in 291.05RAT carcinoma cells.
  • Cells were cultured under low Ca 2+ conditions (LC) which favored cell growth. Treatment and analysis was the same as for carcinoma cells presented in Figures 9A through 9F.
  • the dot plots are shown in Figures 10A through 10C and the histograms are shown in Figures 10D through 10F.
  • the numbers of cells in each region expressed as a percentage of the total cells were: unrelated peptide. R1, 1.2, R1, 2, R3, 4 and R4, 92; p53as peptide, R1, 0.1, R2, 0.1, R3, 5, R4, 94.
  • Figures 11A and 11B show immunoprecipitation of proteins translated in vitro :
  • Figure 11A shows reactions for p53 and
  • Figure 11B shows reactions for p53as, respectively.
  • PAb421 is specific for the major p53 form only, and ApAs is specific for p53as protein only.
  • 10 ⁇ g of plasmid pBSp53as or pBSp53 was linearized by BamHI and transcribed with 20 Units T3 RNA polymerase.
  • the in vitro translation was performed according to a standard protocol (Promega) by incubating 3 ⁇ g RNA with 35 ⁇ l of rabbit reticulocyte lysate in the presence of 4 ⁇ l (40 ⁇ Ci) 35 S-methionine for labeling of proteins.
  • Figure 12 through Fig. 16 represent electrophoretic mobility shift assays (EMSA) of p53 and p53as proteins translated in vitro using the DNA probe sequence presented in Table 2.
  • ESA electrophoretic mobility shift assays
  • p53as protein binds specifically and efficiently to DNA. Binding of p53as protein translated in vitro (5 ⁇ l of 250 ⁇ l reaction) to 32 P-labeled oligonucleotide (ng) in the presence of increasing amount of unlabeled wt p53 binding sequence (wt) or of mutated (mut) sequence (see [1] in Materials and Methods) demonstrates the specificity of p53as protein for the p53 binding motif. 200ng ApAs antibody to p53as can super-shift the binding complex. 200ng of pre-immune rabbit serum (Pre) and PAb421 (421) were used as controls.
  • Pre pre-immune rabbit serum
  • PAb421 421
  • p53as protein complex with DNA is shifted by anti-p53as (ApAs) and abrogated by anti-p53 antibodies PAb246 (246) and CM5 but not mutant conformation-specific PAb240 (240).
  • p53as protein was translated in vitro in reticulocyte lysates and assayed by EMSA for binding to 32 P-labeled probe in the absence of antibodies (-) or in the presence of PAb421, 200ng PAb246 and rabbit polyclonal anti-p53 antibody CM5, or 200 ng ApAs.
  • IgG2a (IgG) pre-immune serum
  • Pre non-programmed reticulocyte lysate
  • FIG. 15 Interaction of p53as with p53 and its effects on DNA binding activity of p53as.
  • Equal amount of in vitro transcripted p53 and p53as RNA's were co-translated (AP) or translated individually and p53 (P) and p53as (AS) proteins were assayed for their DNA binding activities by EMSA.
  • the co-translated proteins have lower DNA binding activities (lane 1) than p53as alone (lane 8).
  • Two binding complexes can be detected when 200ng PAb421 (lane 2) or 200ng PAb421 plus ApAs (lane 4) were included in the reactions containing co-translated proteins, while only one binding complex appears as PAb421 activates p53 DNA binding activity (lane 7).
  • 200ng ApAs did not cause any apparent supershift for co-translated proteins (lane 3).
  • Two higher molecular weight binding complexes can be seen when ApAs was added to the reaction containing only p53as protein (lane 9
  • Figure 16 Lack of interaction of p53as and p53 proteins mixed posttranslationally. Equal amounts of p53 and p53as translated in vitro were mixed and assayed for binding to 32 P-labeled oligonucleotide by non-denaturing polyacrylamide gel electrophoresis (lane 1). 200ng each of the indicated antibodies were added to the binding reaction.
  • FIG. 1 Heteroligomers of p53 with p53as identified by immunoprecipitation followed by immunoblotting.
  • In vitro translated proteins were p53as (AS), p53 (P), cotranslated p53 and p53as (AP) or a mixture of p53as plus p53 translated individually (A+P) and non-programmed reticulocyte lysate control (Lys).
  • the translated proteins (15 ⁇ l each lysate, 30 ⁇ l for cotranslation) were immunoprecipitated with anti-p53 antibody PAb421 (421) rabbit antibody to p53as (ApAs), pre-immune (Pre) or IgG2a (IgG) controls.
  • the immune complexes were fractionated on a 10% SDS-polyacrylamide minigel, transferred to a nitrocellulose membrane and incubated with horseradish peroxidase-conjugated ApAs for 1 hour.
  • the p53as was visualized through chemiluminescence (ECL, Amersham, Arlington Heights, IL.).
  • Figure 18A is a table showing percent distribution of p53as reactivity at various stages of insect cell cycles after infection with baculovirus vector containing the full length p53as cDNA. Insect cells arrest in G2 phase of the cell cycle after infection with the baculovirus vector.
  • Figure 18B is a graph showing p53as(-) distribution for insect cells.
  • Figure 18C is a graph showing p53as(+) distribution for insect cells.
  • Figure 19A is a table showing percent distribution of cells in various stages after being transfected with plasmid containing p53as cDNA and showing that transfected cells were preferentially distributed in the G2 phase of the cell cycle.
  • the cells used are mouse squamous cell carcinoma cells which arrest in the G2 phase of the cell cycle after transfection with a plasmid construct containing p53as cDNA.
  • Figure 19B shows distribution of ApAs/PE intensity vs. FITc intensity for mouse squamous cells.
  • Figure 19C is a graph showing p53as(-) for transfected mouse squamous cells.
  • Figure 19D is a graph showing p53as(+) for transfected mouse squamous cells.
  • Figures 20A, 20B and 20C show colony formation of Saos-2 cells transfected with CMV plasmids.
  • Figure 20A shows a control without a cDNA insect.
  • Figure 20B shows a p53as cDNA insect and
  • Figure 20C shows a p53 cDNA insect.
  • Plasmid containing p53as containing a CMV promoter (which drives expression of p53as in the target mammalian cell) is introduced into human osteosarcoma cells which lack p53 which stops tumor cell growth and reduces the number and area of colonies present in the culture dishes.
  • This assay is commonly used to show tumor suppressor activity of various genes and p53 used as a control shows similar activity, thus wild type p53as acts as a tumor suppressor.
  • a plasmid containing an alternatively spliced mutant p53 sequence had transforming activity (Eliyahu et al., Oncogene 3,313-321, 1988.).
  • Tumor suppressor activity was found in human cells as well as mouse cells.
  • Human osteosarcoma cell line Saos-2 was transfected using lipofectin, BRL0 with 5 ng of the pCMV plasmids containing the p53 or p53as cDNA indicated and a neomycin resistance gene.
  • Vector without the cDNA insert was used as a control. Forty-eight hours after transfection, cells were trypsinized, passaged at a 1:4 ratio and cultured in media containing 500 ⁇ g/ml G418 for 3 weeks. Colonies were fixed in methanol and stained with Giemsa and measured using an image analysis system (Spectra Services).
  • Figures 21A, 21B and 21C show gel filtration profiles of proteins translated in vitro .
  • the in vitro translations were carried out as described in parent application 08/195,952.
  • p53as ( Figure 11A), p53 ( Figure 11B) and cotranslated p53 and p53as ( Figure 11C) were fractionated by gel filtration (FPLC) on a Superose 6 column (Pharmacia) with column buffer (0.4M NaCl, 0.5% NP-20, 20 mM Tris-HCl, pH 7.2) at a flow rate of 0.4ml/min.
  • 0.4 ml eluant was collected in each fraction.
  • the 35 S-labeled proteins in each fraction were visualized by SDS-PAGE and autoradiography.
  • Black arrows indicate the predicted positions of tetramers (4) and dimers (2) based on the positions of molecular weight standards, amylase (200 kd) and phosphorylase B (97 kd).
  • p53as protein for a mammal means a natural or synthetic protein having at least 80 and preferably at least 90% identity with p53 protein from that mammal and which has the same sequence specific binding on the cellular level as the active p53 protein for that mammal, except that all of the sequence specific binding remains active in cellular environments in which p53 sequence specific binding is deactivated.
  • p53as protein does not contain the p53 negative regulatory domain.
  • the p53as of the invention is usually longer or shorter than p53 protein and differs from p53 protein within the final 50 carboxy terminal amino acids, and contains a specific antigen site within its final 50 carboxy terminal amino acids which gives rise to an antibody unique for the p53as. The antibody to the specific site, binds to the p53as without binding to the p53.
  • p53as protein may also be referred to as alternatively spliced p53.
  • p53as antibody is the antibody which specifically binds to p53as protein without binding to p53 protein.
  • p53as gene means a gene encoding p53RNA.
  • p53RNA is RNA which encodes p53 protein.
  • p53asRNA is RNA which encodes p53as protein.
  • a novel form of a natural wild type (normal) p53 protein is present in nontransformed mouse cell strains and mouse squamous cell carcinomas.
  • Designated p53as, (alternatively spliced p53) it arises from a normal variation in processing of the p53 messenger RNA (mRNA).
  • p53as alternatively spliced p53
  • p53as protein is preferentially expressed during the G2 phase of the cell cycle and in cells with greater than G2 DNA content, compared to the major p53 protein which is preferentially expressed in G1.
  • the p53as immunoreactivity is elevated and shifted to the G1 phase of the cell cycle following actinomycin D treatment of nontransformed but not malignant cells.
  • actinomycin D treatment of nontransformed but not malignant cells.
  • the presence of p53as protein in cells has important implications for understanding the physiological function(s) of the p53 gene.
  • the p53as protein natural and synthetic, similar to p53, may be used in studying cell growth and maturation, detecting normal versus abnormal cell growth and may be used to normalize cell growth of abnormally growing cells.
  • p53 protein recognized to date will be referred to as the major form of p53 or simply p53; this does not rule out the existence of a cell type in which p53as may be present in relatively higher amounts than p53.
  • DNA is transcribed to RNA which is then processed by removal of segments called introns to give the mature messenger RNA which encodes protein.
  • introns segments of an intron are retained in the coding sequence (called an alternatively spliced messenger RNA) and makes a protein which is partly different from the major form of the protein.
  • the p53as sequence found in mouse normal and tumor cells has 17 different amino acids at the carboxyl terminus of the p53 protein (out of a total of 390 amino acids in the major p53 form). This unique sequence was used to generate antibody specific to mouse p53as. The antibody does not cross react with the major p53 protein.
  • p53as protein in complex with itself (dimer formation is possible due to retention of acidic residues known to be important for dimerization of p53 protein) or in complex with the major p53 protein will bind to DNA and modulate transcription of specific target genes with altered, perhaps greater, efficiency than homodimers or homotetramers of the major p53 protein only (see Figure 2).
  • Polyclonal and monoclonal antibodies available prior to the present invention do not specifically and selectively recognize p53as; although antibodies exist which recognize p53. These include PAb246 which recognizes mouse p53 in its normal folding state, PAb240 which recognizes certain mutant p53 proteins, PAb421 which recognizes the carboxyl terminal amino acids replaced or lost in p53as. Similarly, human p53 is recognized by monoclonal and polyclonal antibodies. No report of a human p53 generated by alternative splicing at the carboxyl terminus has been reported and no specific antibody to human p53as is available.
  • p53as may readily be made by deleting or altering the negative regulatory domain within the final 50 carboxy terminal amino acids of p53.
  • the synthetic p53as acts as an active form of p53 even in cellular environments where p53 is normally deactivated through its negative regulatory sequence.
  • the p53as for a mammal is provided with a unique antigen site to which an antibody may be formed which recognizes the p53as but does not recognize p53 from the mammal.
  • antibody to p53as protein permits studies of whether p53 protein and p53as protein associate in the cell, and will permit in vitro studies of the efficiency of DNA binding and transcriptional regulation of complexes between p53 and p53as proteins.
  • Such antibodies may also permit detection of cells having normal growth from cells having abnormal accelerated growth.
  • mouse p53as peptide LQPRAFQALIKEESPNC (Sequence ID # 2). It was produced by standard synthesis, tested for authenticity and is stored in the laboratory. Details and procedures are as follows:
  • p53 mRNA was first cloned as a mutant p53 cDNA (M-8) from a chemically transformed fibroblast cell line by Wolf et al., (1985) "Isolation of a lull-length mouse cDNA clone coding for an immunologically distinct p53 molecule", Mol. and Cell. Biol. 51, 127-132: Arai et al., supra, reported the sequence of this p53 cDNA variant, confirming its origin by alternative splicing. It appeared to be specific to this tumor cell lineage because it was undetectable in a nontransformed helper T-cell cDNA library.
  • wild type alternatively spliced 53 RNA is expressed in normal cells and tissues at about 25 to 33% of the major p53 RNA form (Han et al., (b) (1992) supra). In addition, it is present at approximately the same ratio in the two independently-derived epidermal carcinoma lines which overexpress p53 RNA (noted above), and thus appeared to be coordinately elevated with the major form of p53.
  • the translation of alternatively spliced p53 results in the substitution of 17 amino acids and in truncation of the regularly spliced form of p53 by 9 amino acids (Fig. 3).
  • the protein translated from the alternatively spliced p53 RNA lacks the serine-389 casein kinase II and RNA binding site, the epitope for PAb421 p53 antibody binding and the basic oligomerization domain, with the potential for profound effects on p53 oligomerization, DNA binding and transcriptional activation.
  • a polyclonal antibody to the 17 amino acid sequence unique to the mouse p53 as was generated in rabbits was generated in rabbits.
  • Rabbit serum collected at intervals after immunization was tested for reactivity to p53as peptide coated on ELISA plate wells (Fig. 4).
  • High titer serum (shown) was affinity-purified against the 17 amino acid peptide.
  • the reactivity (per ⁇ g antigen) of 10ng affinity-purified antibody was approximately equivalent to a 1/40,000 dilution of whole anti-p53as antiserum.
  • Anti-p53as reactivity in the ELISA and indirect immunofluorescence assays was blocked competitively by pre-incubation of antibody with the p53as peptide.
  • Figs. 6A - 6F nuclear staining was observed with affinity-purified anti-p53as antibody. This activity was completely blocked by competitive binding with p53as peptide (Fig. 6C).
  • Anti-p53as antibody reactivity in 291 nontransformed cells and carcinoma cells was always nuclear under the conditions of these assays (data for clone 119 is shown), and in this respect, was like PAb246 antibody reactivity which recognizes the tumor suppressor conformation of p53.
  • Squamous cell carcinoma 291.03RAT expresses 3-fold more p53 mRNA and up to 10-fold less p53 protein (PAb421 and PAb246 antibody reactivity) than the progenitor 291 cells (Han et al. (a) (1992), "Altered expression of wild-type p53 tumor suppressor gene during murine epithelial cell transformation", Cancer Research 52, 749-753). Comparison of the expression of p53as protein in these cell lines was done by immunoprecipitation. As shown in Fig. 7, reactivity with anti-p53as antibody was detected in nontransformed 291 cells and carcinoma cells.
  • the p53as-precipitable protein in these cell lines migrates slightly faster than the PAb421 and PAb246-precipitable proteins, as expected from the truncation of p53as by 9 carboxy-terminus amino acids (expected to result in an approximately 1 kd difference in molecular weight).
  • immunoreactivity to all three anti-p53 antibodies was lower in 291.03RAT carcinoma cells than normal cells.
  • the ratio of immunoprecipitable protein in populations of proliferating cells vs. differentiating 291 cells was higher for anti-p53as (5/1) and for PAb421 (ratio of 2/1) than PAb246 reactivity (1/1).
  • p53 protein has been postulated to participate in a cell cycle checkpoint regulating entry into S phase after exposure of cells to DNA damaging agents such as actinomycin D.
  • PAb421 reactivity wt. p53
  • Moderately-differentiated squamous cell carcinoma line 291.05RAT was used for these studies because it expressed higher levels of immunoprecipitable p53 protein than 291.03RAT, but like 291.03RAT is derived from epidermal clone 291 and has the wt. p53 gene (Han et al. (a) supra). Treatment with actinomycin D induced p53 and p53as protein expression in two separate experiments, based on the percentage of cells positive for reactivity with p53 antibodies by indirect immunofluorescence (Table 1).
  • the increase in positive cells was less for p53as than for PAb421 and PAb246 reactivities and required a higher concentration of actinomycin D, but this may reflect the lower abundance of p53as protein.
  • the p53as antibody reactivity in actinomycin D-treated cells was nuclear.
  • the p53as-positive nuclei were also positive for PAb421 or PAb246, whereas most PAb421(+) or PAb246(+) cells were negative for p53as antibody reactivity.
  • telomeres The abundance of p53 RNA in actinomycin D-treated 291.05RAT cells was increased over 3-fold according to northern blot analysis (Fig. 8).
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • Both p53 and p53as transcripts were increased coordinately in samples from actinomycin-D treated cells compared to controls (data not shown), suggesting that the response of epidermal cells to actinomycin D involve increases in RNA abundance.
  • Phycoerythrin (red) conjugated to anti-rabbit immunoglobulin was used to recognize p53as and FITC (green) conjugated to anti-mouse immunoglobulin was used to recognize PAb421 and PAb246.
  • the specificity of anti-p53as is demonstrated in Figs. 9A - 9F. Coordinates were set based on fluorescence intensity to divide detected events (single cells) into those positive for p53as alone (region 1, R1), positive for p53as and PAb421 or PAb246 (R2), negative for p53as and positive for PAb421 or PAb246 (R3) and negative for both anti-p53as and PAb421 or PAb246 (R4).
  • the carcinoma cells were rarely positive for anti-p53as alone (Fig. 9A). Cells positive for anti-p53as also were positive for PAb421 or PAb246. Competition with p53as peptide, but not an unrelated peptide, completely blocked events detectable in the R2 region (shown for 291.05RAT in Figs. 9A - 9F and for 291 cells in Figs. 10A - 10F), without reducing the percentage of R3 events, verifying the specificity of the anti-p53as antibody. Events from each region R1 through R4 were collected in quantity (see Figs. 9A - 9F) for analysis of cell cycle distribution, represented in the histograms (Figs.
  • a population of 291 cells positive for anti-p53as reactivity alone was observed (Figs. 10A - 10F). These showed a similar cell cycle distribution to cells labeled with anti-p53as and PAb421 or PAb246. Unlike the carcinoma cells, the p53as(+) 291 cells observed on coverslips were generally mononucleated.
  • the 291.05RAT tumor cells showed little difference up the percentage of cells in G1 in response to actinomycin D treatment, suggesting that the p53 protein in these cells was less capable of causing G1 arrest, even though the percentages of cells positive for PAb421 and PAb246 were elevated.
  • Human p53as protein is defined herein as the human p53 protein 1) which is generated from a human p53 transcript by reverse transcriptase (RT)/polymerase chain reaction (PCR) (as described below) which is itself generated by alternative splicing of a region of intron 10 of the human p53 gene, and 2) which contains carboxyl terminal amino acids distinct from those of the major human p53 protein.
  • the p53 transcript may be detectable in human cells or may be synthesized. Antibodies selective for human p53as peptide would permit verification of the presence of the p53as in human cells.
  • CM-1 is expected to react with multiple regions on the p53 gene and thus would be expected to react with both human p53 and p53as proteins.
  • human intron 10 encodes a peptide which has a motif (SPPC) similar to the last 4 amino acids of the mouse p53as (SPNC).
  • a peptide unique to human p53as may be identified as follows:
  • Primers are constructed which are used to amplify by polymerase chain reaction (PCR) a region of the human p53 cDNA including part of exon 10, all of intron 10 sequences retained in the alternatively spliced p53 mRNA and part of exon 11.
  • Human cDNA is generated from cellular RNA (isolated by guanidinium/cesium chloride extraction) by RT/PCR.
  • RT/PCR is carried out as follows: 5 ⁇ g of human cell total RNA is combined with 1mM each of 4 deoxynucleotidetriphosphates, 5 ⁇ g random hexamer primer (to make cDNA to all available mRNA), 5 ⁇ l AMV reverse transcriptase (RT, 5 to 10 units per ⁇ l), 3.5 mM MgCl 2 (or as optimized), 2.5 ⁇ l Rnasin 5 ⁇ l PCR buffer (Perkin Elmer; without Mg 2+ ) and depc-treated water to adjust the volume to 50 ⁇ l. Reaction is allowed to proceed at 23°C for 10 minutes, 42°C for 1h and 95°C for 10 minutes then transferred to ice.
  • PCR is optimized to obtain efficient production of the specific product and minimize background. PCR is performed for 35 cycles of denaturation (95°C, 30 sec), annealing (60°C, 1 min) and extension (72°C, 3 min) in a DNA thermal cycler.
  • Amplified fragments of human p53 and p53as C-terminal coding regions are desalted by centricon ultrafiltration, digested with the restriction enzymes appropriate to the synthetic primers (see example below) and isolated from low melting temperature agarose for cloning into pGEM3zf(+) (Promega) for the sense strand or pBluescript KS(+) (Stratagene) for the antisense strand and transfected into E. coli for production and sequencing as we have described (Han et al. supra).
  • Human cells as the source of RNA include (but are not limited to) normal human epidermal keratinocytes and two clones (B and F2A) of squamous cell carcinoma line SCC-12.
  • the PCR amplification product generated using the primers which span intron 10 include the major p53 transcript and p53as transcript(s). These are distinguished by differences in molecular weight and/or by sequencing of the amplified PCR products as has been demonstrated previously for mouse p53as transcripts (Han et al. (b) supra). Sequencing of the PCR products permits determination of the sequence of the protein encoded by human p53as RNA. The amino acid sequence of the human p53as protein is compared to that of the major human p53 protein to determine the unique sequence at the carboxyl terminal region of human p53 as protein.
  • primer set which spans intron 10 of the human p53 gene is: 5' primer/sense strand ATCGAAGCTT GAGATGTTCCGAGAGAGCTGAAT (within exon 10 beginning at nucleotide 17,593 of the genomic p53 sequence Genbank accession No.
  • human p53 DNA or RNA may be restricted to remove the p53 negative regulatory domain.
  • a unique sequence may then be grafted to restricted p53 which will give rise to a p53as protein to which a specific antibody may be raised.
  • Polyclonal antibody to mouse p53as unique peptide noted above has been raised in rabbits, its high titer has been determined by enzyme linked immunosorbent assay (ELISA), its specificity for p53 protein has been determined by immunoprecipitation from mouse cells, western immunoblotting of anti-p53 precipitable protein to a polyclonal antibody to p53 (CM5, reactive with epitopes shared by p53 and p53as proteins), ability of the peptide to competitively block reactivity in cells and in western immunoblots, and the ability of the p53as peptide to block blinding of p53as antibody but not block the binding other p53 antibodies (PAb421 and PAb246) which bind to epitopes distinct from the unique region of p53as.
  • ELISA enzyme linked immunosorbent assay
  • the polyclonal anti-peptide antibody is produced in rabbits as described in General Procedures below.
  • Hybridoma cell lines have been produced by fusion of spleen cells from BALBc mice immunized with mouse p53as peptide. The procedure is found in General Procedures below.
  • the monoclonal antibodies from each hybridoma cell line producing specific antibody as determined by ELISA is to be tested for reactivity with mouse cellular p53as by immunoprecipitation, western immunoblotting and immunofluorescence as described for polyclonal antibody to mouse p53as above. Specificity is determined by competition with mouse p53as peptide.
  • a peptide unique to human p53as will be synthesized and used to immunize rabbits following the procedures used to generate polyclonal antibody to mouse p53as, described in the manuscript provided and in General Procedures.
  • An example of such a peptide selected based upon similarities with mouse p53as unique peptide is the following 20 amino acid peptide encoded by human intron 10 sequences: REKGHRPSHSCDVISPPCFC (Sequence ID # 5).
  • a peptide unique to human p53as determined as described above, will be synthesized and used to immunize mice following the procedures used for polyclonal antibody to mouse p53as described above, and in General Procedures below.
  • each antibody will be determined; that is, for example, testing of whether an antibody generated to mouse p53as peptide also binds human p53as and whether antibody to human p53as binds mouse p53as protein will be performed.
  • the procedures to be used are based on standard procedures for generating monoclonal antibodies.
  • the p53as peptide of mouse or human origin is stored protected from light and oxygen until use. It is reconstituted just prior to injection. Unmodified peptide is used as immunogen initially because this was successful in the generation of polyclonal antibodies to mouse p53as protein.
  • Alternatives which will be used if necessary to improve immunization include conjugation to another protein (for example, ovalbumin), or use of full length p53as protein generated in insect cells using a baculovirus vector system. Such vectors containing p53as cDNA have already been made in this laboratory for production of mouse p53as protein.
  • the emulsion is injected into BALB/c female mice (weighing approximately 20g each) intradermally at multiple sites along the dorsum and intraperitoneally. (If necessary to improve the immunization response, an alternative mouse strain will be used.)
  • mice Four weeks later, boosting of the mice with an intraperitoneal injection of 100 ⁇ l (20 ⁇ g peptide) mixed with Freund's incomplete adjuvant is performed.
  • the best responder is reboosted with an intravenous injection of 100 ⁇ l (20 ⁇ g peptide) without adjuvant.
  • Myeloma cells are thawed from liquid nitrogen and placed in culture one week prior to the fusion. The cells are grown in order to reach a cell density of 5 x 10 5 cells/ml one day before the fusion. On the morning of the fusion, 10 ml of cultured cells are diluted with an equal volume of CMEM.
  • CMEM Complete Media Preparation
  • the mouse is sacrificed and the spleen is aseptically removed. Contaminating tissues are dissected and discarded.
  • the spleen is ground on a stainless steel mesh to release the cells.
  • the splenocytes are washed twice with 10 ml of medium without serum and the cells counted.
  • Myeloma cells are washed once and resuspended in medium without serum.
  • the myeloma cells and splenocytes (1:10) are combined in medium without serum. These cells are centrifuged together at 800 g for 5 min.
  • the supernatant is removed and the cells resuspended in 30 ml HAT media.
  • HAT medium is prepared the same as CMEM but 1.0 ml aminopterin stock solution and 1.0 ml glycine stock solution are added before bringing media to a total volume of 100 ml.
  • the cells are transferred from the 96-well plate to the well of the 24-well plate containing the same medium. After the 24-well plate culture becomes dense, it is transferred to 100-mm dish. Freeze the cells at the 100-mm dish stage.
  • a spleen cell suspension is prepared according to the procedure described in the fusion technique above. 10 3 spleen cells per well are plated into a 96-well plate (using one drop per well). A minimum of 10 5 proliferative hybridoma cells from a 25 cm 2 flask are used for cloning.
  • hybridoma cells are subcultured 24-48 hours before cloning by diluting an actively growing culture 1:1 with fresh media. Cells in mid-log phase are used for the limiting dilution.
  • Cell number is adjusted to 10 5 viable sells per ml (cell viability of >70%).
  • Serial 10-fold dilutions are made (e.g. 10 4 , 10 3 per ml.)
  • Clones are assayed for anti-p53 as activity by ELISA when they cover 25% of the well. Positive clones are transferred to 24 well plates, to 100-mm dishes, then hybridoma cells are cryopreserved in Nunc cryotubes.
  • mice 8 week old BALB/c mice are injected with 0.4 ml of pristane intraperitoneally.
  • mice After 2-3 weeks, the mice are sacrificed and the ascitic fluid harvested.
  • Ascites is centrifuged at 1000 g for 10 min, the middle layer is collected and kept at -20°C.
  • Monoclonal antibodies are tested by ELISA, indirect immunofluorescence, immunoprecipitation and western immunoblotting for specificity to p53as in appropriate cells (mouse or human).
  • ability of the antibody reactivity to be competitively blocked by the peptide used to generate it is tested.
  • the procedures to be used are based on standard procedures for generating polyclonal antibodies.
  • the p53as peptide of mouse or human origin is stored protected from light and oxygen until use. It is reconstituted just prior to injection. As noted above for monoclonal antibody production, unmodified peptide is used as immunogen initially but, if necessary, conjugation to another protein will be done or full length p53as protein will be used. New Zealand white female rabbits (6-8 lb.) (4) are used for immunizations.
  • Basal (pre-immune) serum is collected 1 wk. before immunization.
  • Polyclonal antibody is affinity purified by complexing with the appropriate peptide (human or mouse p53as) coupled to an AminoLink column (see manuscript provided) through amino groups or a column in which peptide is bound through cysteine. Approximately 7 mg of peptide is required for binding to the column and antibody from approximately 25 ml of serum is purified per run. The column is reconstituted according to manufacturer's directions and reused. Affinity purified antibody is tested by ELISA, indirect immunofluorescence, immunoprecipitation and western immunoblotting for specificity to p53as. Ability of the antibody reactivity to be competitively blocked by the peptide used to generate it is tested.
  • p53as a physiological variant of the tumor suppressor protein p53, has been detected in mammalian epidermal cells containing the wt. p53 gene.
  • endogenous wild type p53as protein has not been detected in cells before may be due to a number of factors including the previous failure to recognize its possible existence, its low abundance and lack of reactivity with anti-p53 monoclonal antibody PAb421. It was previously shown that the wt.
  • p53as mRNA is present in normal mouse tissues and in cultured mouse fibroblasts at 25 to 33% of the major p53 RNA form (Han et al., (b), Alternatively spliced p53 RNA in transformed and normal cells of different tissue types, Nucleic Acids Res., 20(8), 1979-1981).
  • the p53as protein exists in cells, that it is nuclear in location in normal epidermal and carcinoma cells, is differentially expressed in proliferating compared to differentiating normal cells and is inducible along with PAb421- and PAb246-reactive p53 by the DNA damaging agent actinomycin D.
  • epidermal cell populations are composed of proliferating and differentiating or growth-arrested cells, reflecting the balance of growth and differentiation strictly maintained in epidermis.
  • M-8 p53 cDNA sequence has a nucleotide substitution at nt 395 resulting in a change from cysteine-132 to phenylalanine.
  • Eliyahu et al. (1990) "Meth a fibrosarcoma cells express two transforming mutant p53 species", Oncogene 3, 313-321), reported that plasmids containing the M-8 p53 cDNA had transforming activity in transfected cells.
  • regions of the p53 protein which mediate binding to other cellular proteins such as heat shock protein (Hainaut et al., supra) or mdm2 (Momand et al. (1992), "The mdm -2 oncogene product forms a complex with the p53 protein and inhibits p53-mediated transactivation", Cell 69, 1237-1245), conceivably could be directly or indirectly altered.
  • p53 may prove to be within the class of transcription factors which generate two functionally distinct proteins by alternative splicing (Foulkes et al., (1992), "More is better: activators and repressors from the same gene", Cell 68, 411-414).
  • mTFE3 factor which regulates immunoglobulin transcription by binding to promoter and enhancer regions
  • amino acids predicted to form an amphipathic helix are absent and transcriptional activation activity is affected.
  • the ability of such factors to heterodimerize amplifies the possibilities for regulation of expression of target genes.
  • mutant p53 into the mutant conformation uncovered its potential as a dominant negative transforming gene (Milner, 1984, supra.; and Milner et al., (a) (1991), "Cotranslation of activated mutant p53 with wild type drives the wild-type p53 protein into the mutant conformation", Cell 65, 765-774). Yet mutant p53 itself has transforming activity in cells which have no wt. p53, suggesting direct activities of p53 in the regulation of proliferation (Wolf et al., (1984) , "Reconstitution of p53 expression in a nonproducer Ab-MuLV-transformed cell line by transfection of a functional p53 gene", Cell 38, 119-126).
  • the strain 291 was derived from neonatal BALB/cROS mouse epidermis (West Seneca Laboratory, Roswell Park Cancer Institute) and is "normal" with respect to differentiation and morphology in vitro and in vivo (Kulesz-Martin et al., (1985) supra; Kulesz-Martin et al., (1991), "Tumor progression of murine epidermal cells after treatment in vitro with 12-0-tetradecanoylphorbol-13-acetate or retinoic acid", Cancer Research 51, 4701-4706; Schneider et al., (1993), "7, 12-dimethylbenz[ ⁇ ]anthracene-induced mouse keratinocyte transformation without Harvey ras protooncogene mutations", J.
  • the cells were grown in Eagle's minimum essential medium with Earle's salts without CaCl 2 (GIBCO, Grand Island, NY), supplemented with 5% (v/v) fetal calf serum treated with chelex-100 resin (Bio-Rad, Rockville Center, NY) to reduce CA 2+ concentration, non-essential amino acids, 10% (v/v) mouse dermal fibroblast conditioned medium, 10ng/ml EGF (UBI, Lake Placid, NY), 1% (v/v) antibiotic-antimycotic (100 ⁇ /ml Penicillin, 100 ⁇ /ml Streptomycin sulfate and 0.25 ⁇ g/ml Amphotericin B Solution, GIBCO, Grand Island, NY) and 0.02-0.04 mM Ca 2+ (designated as LC).
  • Tumor cell derivatives of 291 (291.03RAT and 291.05RAT) were isolated from squamous cell carcinomas following exposure of 291 cells to 7,12-dimethylbenz[ ⁇ ]anthracene in vitro as described (Kulesz-Martin et al., (1986), "Retinoic acid enhancement of an early step in the transformation of mouse epidermal cells in vitro ", Carcinogenesis 7, 1425-1429; Kulesz-Martin et al., (1991) supra; Kulesz-Martin et al., (1983) supra. Tumor cells were grown in minimum essential medium as above except without conditioning or EGF and with native fetal calf serum and 1.4 mM Ca 2+ (designated as HC).
  • Clone 119 was derived by transfection of carcinoma 291.03RAT with a plasmid containing a genomic clone of mutant p53 (pmMTval135-23), obtained from Dr. Moshe Oren. It expresses predominantly wt. p53 conformation at 37°C (unpublished results).
  • Mouse monoclonal antibodies to p53 were PAb421, PAb240 and PAb246 (Oncogene Science, Uniondale, NY). Isotype IgG 2a (PAb421 and PAb240) and IgG 1 (PAb246, Becton/Dickinson, Mountain View, CA) were used as sera controls. Rabbit polyclonal antibody CM5 was a gift from Dr. David Lane. Anti-peptide antibody to the terminal 17 amino acids unique to p53as (see Fig. 1B) was generated as follows: The 17 amino acid peptide to p53as was synthesized by the RPCI Biopolymer Facility and determined to be 90 to 95% pure by HPLC and mass spectroscopy and accurate by amino acid sequencing.
  • New Zealand White female rabbits were immunized by intradermal injection of 500 ⁇ g peptide plus Freund's complete adjuvant (FCA) at multiple sites, concurrent with intramuscular injection of Pertussis vaccine (RPCI Springville Laboratories). After 3 weeks, an additional 250 ⁇ g of peptide was administered with Freund's incomplete adjuvant (FIA) at weekly intervals for 3 weeks.
  • FCA Freund's complete adjuvant
  • FIA Freund's incomplete adjuvant
  • the p53as anti-peptide serum was affinity-purified by coupling 4.4 mg p53as peptide to an AminoLink column (Pierce, Rockford, IL) according to manufacturers instructions. Ammonium sulfate (40%)-precipitated pre-immune serum was used as a control.
  • Competition assays were performed by incubation of antibodies (1:1 ratio by weight) with p53as peptide or an unrelated peptide (sequence: GRNDCIIDKIRRKNCD (Sequence ID # 6)) for 2h at room temperature prior to the immunoreaction with cells or peptide in ELISA assays.
  • Nunc-Immuno MaxiSorb 96 well plates (Nunc, Denmark) were coated with 50 ng/well p53as peptide in 15 mM sodium carbonate buffer, pH 9.6. After blocking with 2% BSA (KPL, Gaithersburg, MD) in PBS at 37°C for 1h, anti-p53 monoclonal antibodies, anti-p53as antibody (affinity-purified to peptide) or pre-immune serum control (pre-I) were diluted 1/50 to 1/640,000 and added to the wells in 100 ⁇ volume. Secondary antibody was peroxidase-conjugated goat anti-rabbit immunoglobulin (DAKO, Carpinteria, CA) at 1/1000.
  • DAKO peroxidase-conjugated goat anti-rabbit immunoglobulin
  • TMB peroxidase substrate system solution (KPL, Gaithersburg, MD) was added and color development was terminated after 4 minutes using 4M H 2 SO 4 . Absorbence at 450nm was detected using a BioTek plate reader (Winooski, VT).
  • Affinity purified rabbit polyclonal anti-p53as or ammonium sulfate-fractionated pre-immune serum as control was used at 7 ⁇ g/ml followed by 1/300 Texas Red-conjugated goat anti-rabbit immunoglobulin (Oncogene Science). FluorSave aqueous mountant (Calbiochem, LaJolla, CA) was used to attach coverslips to slides. The fluorescence was viewed using a Nikon Labophot microscope equipped with epiilluminescence. Photomicrographs were taken the a Nikon UFX-IIA automatic camera system.
  • Preconfluent cultured cells (approximately 5-10 x 10 6 cells/100mm petri dish) were incubated with 200 ⁇ Ci of L-[ 35 S]methionine (1120 Ci/mmol) for 4h at 37°C in methionine-free minimum essential medium containing 2% (v/v) dialyzed calf serum. Labeled cells were lysed in buffer containing 1% (v/v) nonidet P-40, 150mM NaCl, 50mM Tris pH 8, 1mM phenylmethylsulfonyl fluoride for 30 minutes at 4°C and centrifuged at 10,000 x g for 10 minutes.
  • the supernatant was precleared with formalin-fixed Staphylococcus aureus cells (Immunoprecipitin, BRL, Gaithersburg, MD) or with protein A-Sepharose (Pharmacia, Piscataway, NJ). Lysate volumes corresponding to equal amount of radioactivity (2 x 10 7 cpm) were incubated in NET/Gel buffet (150mM NaCl, 5mM EDTA, 50mM Tris pH 7.4, 0.05% NP-40, 0.025 NaN 3 and 0.25% gelatin) for 16h at 4°C with antibodies to murine p53 or isotype or serum controls.
  • NET/Gel buffet 150mM NaCl, 5mM EDTA, 50mM Tris pH 7.4, 0.05% NP-40, 0.025 NaN 3 and 0.25% gelatin
  • Immune complexes were precipitated with Immunoprecipitin or 5mg of protein-A SepharoseCL-4B (Pharmacia) for 2h at 4°C, centrifuged at 10,000 x g for 10 minutes. The pellets were washed with NET/Gel buffer and eluted in loading buffer (2% (w/v) SDS, 10% (v/v) glycerol, 125 mM Tris-Cl, pH 6.8, 0.001% (w/v) bromophenol blue) by heating at 85°C for 5 to 15 minutes and centrifugation at 10,000 x g for 10 minutes.
  • loading buffer 2% (w/v) SDS, 10% (v/v) glycerol, 125 mM Tris-Cl, pH 6.8, 0.001% (w/v) bromophenol blue
  • Supernatants were loaded on a denaturing polyacrylamide gel composed of 4% stacking gel (125mM Tris-Cl, pH 6.8, 0.1% (w/v) SDS) and 10% separating gel (375mM Tris-Cl, pH 8.8, 0.1% (w/v) SDS), and subjected to electrophoresis at 35mA in running buffer (125mM Tris-Cl, pH 8.3, 192mM glycine, 0.1% (w/v) SDS).
  • Cells on coverslips were treated with 0.25nM or 0.5nM actinomycin D (Sigma, St. Louis, MO) or 0.2% acetone for 48 h, beginning 24h after plating and stained by indirect immunofluorescence as described above.
  • 0.25nM or 0.5nM actinomycin D Sigma, St. Louis, MO
  • 0.2% acetone 0.2% acetone for 48 h, beginning 24h after plating and stained by indirect immunofluorescence as described above.
  • For flow cytometry or isolation of cellular RNA approximately 2 to 4 x 10 6 cells/cm 2 were seeded in 150mm plates, grown to 70% confluence, treated with 0.5mM actinomycin D for 48h before harvest.
  • Table 1 shows response of 291.05RAT carcinoma cells to actinomycin D as detected by indirect immunofluorescence in situ. Two experiments (numbered) are shown. Cells were plated on coverslips, exposed to actinomycin D at the concentration indicated (nM) or solvent (0.2% acetone) for 48h, then stained with p53 antibodies. Estimates of positive cells as a percentage of total cells were made based on viewing all cells per slip (10 control, 8 to 10 treated slips per experiment for p53as; 4 control, 2 to 4 treated per experiment for PAb421; 2 control and 2 treated per experiment for PAb246, pre-immune and IgG controls. The range of percent positive cells is shown for 2 independent experiments.
  • Table 2 shows cell cycle distribution of mouse epidermal cells according to p53 antibody reactivities.
  • Cells were exposed to 0.5 nM actinomycin D or solvent for 2 days, harvested and stained as described in Fig. 7 and Experimental Procedures. The data shown are the mean and Std. Dev. of percentages of cells positive for each antibody based on 2 x 10 6 stained cells in 12 separate tubes (R4 negative cells or total cells), 6 tubes (anti-p53as) or 3 tubes each (PAb421 and PAb246). The results are representative of 2 separate experiments and 2 stainings of the same cell preparation. The percentage of cells in G0/G1 vs. G2/M and >G2/M were consistent among experiments within a cell type.
  • Plasmids for in vitro transcription and translation of p53as and p53 proteins Plasmids for in vitro transcription and translation of p53as and p53 proteins.
  • Plasmids containing the cDNA sequence unique to p53as are included in this invention.
  • One such plasmid is pBSp53as which contains full length alternatively spliced p53 cDNA.
  • pBSp53as was constructed from p53 cDNA beginning at nt -111 of the (where 1 is the first ATG encoding methionine) and ending at nt 1539, cloned into the EcoRI and BamHI sites of pBluescript SK under the control of a T3 phage promoter.
  • the N-terminal fragment of wt p53 was amplified by reverse transcriptase/polymerase chain reaction (RT-PCR) from a mouse epidermal cell RNA template and the C-terminal fragment of p53as was amplified by PCR from plasmid p6.4 (which contains an alternatively spliced p53 cDNA; Han and Kulesz-Martin, Nucl. Acids Res. 20: 1979-81, 1992) using primers which contained a StuI restriction site at the 5' end of the sense primer (AGTCAGGCCTTAGAGTTAAAGGATGCCCATGCTACAGA) (Sequence ID # 7) and a BamHI site at the 5' end of the antisense primer.
  • RT-PCR reverse transcriptase/polymerase chain reaction
  • pBSp53 was made from pBSp53as by replacement of the StuI/BamHI C-terminal fragment of p53as cDNA with the StuI/BamHI segment of wild type p53 cDNA from plasmid pLSVNc51 (ref. Oren).
  • cDNA for the N-terminus of p53 (nt -111 to 1090) was made using template RNA from 291 nontransformed epidermal cells by means of a reverse transcriptase reaction, amplified by PCR and cloned into the EcoRI and BamHI sites of pBluescript SK under the control of a T3 phage promoter to create plasmid pBSRS13.
  • the primers used for PCR were: sense, AGTCGAATTC ATTGGGACCATCCTGGCT (Sequence ID # 8), antisense, AGTCGGATCC TGGAGTGAGCCCTGCTGTCT (Sequence ID # 9). These primers contained an EcoRI restriction site at the 5' end of the sense primer and a BamHI site at the 5' end of the antisense primer (denoted by underlining).
  • the C-terminal p53 cDNA (nt 1028 to 1539) was amplified by PCR from plasmid p6.4 (which contains an alternatively spliced p53 cDNA) using primers which contained a StuI restriction site at the 5' end of the sense primer (AGTCAGGCCTTAGAGTTAAAGGATGCCCATGCTACAGA (Sequence ID # 7)) and a BamHI site at the 5' end of the antisense primer (as in Han and Kulesz-Martin, Nucl. Acids Res. 20: 1979-81, 1992).
  • the StuI to BamHI segment of this PCR reaction product was then ligated to the StuI and BamHI sites of plasmid pBSRS13 to create plasmid pBSp53as, containing a full length alternatively spliced p53 cDNA.
  • the StuI and BamHI fragment from wt p53 cDNA was substituted for the StuI and BamHI fragment of the p53as cDNA in pBSp53as.
  • plasmid pBSp53as or pBSp53 was linearized by BamHI and transcribed with 20 Units T3 RNA polymerase for immunoprecipitation studies and DNA binding studies.
  • the in vitro translation was performed according to a standard protocol (Promega) by incubating 3 ⁇ g RNA with 35 ⁇ l of rabbit reticulocyte lysate.
  • 4 ⁇ l (40 ⁇ Ci) 35 S-methionine was used for labeling of proteins.
  • an equal amount of each RNA was incubated with rabbit reticulocyte lysate (Promega).
  • Immunoprecipitation was performed by incubating 5 ⁇ l 35 S-labeled protein with 1 ⁇ g PAb421, ApAs or PAb246 at 4°C overnight. Protein A-Sepharose 4B was then added with gentle mixing at 4°C for 2 hr. After centrifugation, the pellets were washed three times with Net-gel buffer. The pellets were suspended in 2x sample buffer containing 100mM DTT and separated by electrophoresis in a 7.5% SDS-polyacrylamide minigel. The gel was enhanced, dried and exposed overnight to Kodak X film. Two lysate reactions are shown, p53 or p53as RNA - see labels at top. Antibodies used to immunoprecipitate protein from each lysate reaction are indicated.
  • RNA binding assay 3 ⁇ g of sense RNA for p53 or p53as was added to 35 ⁇ l reticulocyte lysate and adjusted to a total volume of 50 ⁇ l for translation in vitro . For cotranslations, half the amount of each RNA was used.
  • p53as protein would be active for binding to DNA.
  • DNA binding of the major p53 form is considered essential for its function as a cell cycle control gene.
  • DNA binding is required for its activity as a transcription factor which controls the expression of other genes.
  • the interaction of p53 with other proteins is of intense interest in the scientific community because such p53-associated factors may control the activity of p53 by affecting its binding to DNA.
  • the data presented herein demonstrates that p53as protein binds to DNA, and that p53as and p53 protein associate with each other, suggesting that p53as is a newly discovered p53-associated protein.
  • the p53as protein has lost basic amino acids but has retained acidic amino acids important for oligomerization.
  • sequence-specific DNA binding activity of p53as protein translated in vitro was studied in an attempt to answer the following questions: 1) does p53as protein, like the major p53 form, have sequence-specific DNA binding activity? and 2) does p53as protein interact with p53, modulating its ability to form a complex with DNA?
  • electrophoretic mobility shift assays were performed using a 32 P-labeled double-stranded oligonucleotide probe corresponding to the p53 binding sequence shown in Table 4.
  • p53as protein translated in vitro gave a strong signal representing a shift from free probe (dark signal at bottom of figure) to a higher molecular weight complex composed of protein and the labeled DNA probe.
  • the p35as protein bound specifically to the p53 binding sequence, as shown by loss of the band with unlabeled competing DNA probe (wt) being included in the reaction but not with unlabeled oligonucleotide corresponding to the mutated p53 binding sequence (mut).
  • the identity of the shifted band as a complex containing p53as is shown by supershifting of the p53as/DNA complex by anti-p53as antibody (ApAs) but not by preimmune serum (Pre) or anti-p53 antibody PAb421.
  • the supershift of p53as protein by ApAs resulted in two higher molecular weight bands. Further verification of the ApAs reactive protein as a product of the p53 gene is provided in Fig. 13 by loss of the signal in the presence of anti-p53 antibodies PAb246 and CM5, which react with both p53 and p53as proteins.
  • Fig. 14 demonstrates that the major p53 form translated in vitro is not active for DNA binding but required activation by PAb421. Activated p53 bound to DNA and resulted in a supershift of a single high molecular weight complex.
  • p53as protein exhibited the antibody binding properties of wild type p53 protein, PAb246+, PAb240-, but lacked the C-terminal epitope reactive with PAb421.
  • p53as protein translated in vitro was activated for binding to a p53 DNA binding sequence.
  • the major p53 protein in contrast, required activation for DNA binding (by monoclonal antibody PAb421).
  • PAb421 monoclonal antibody
  • pVL1393Asp baculovirus vector (containing p53as cDNA) was constructed by replacement of the StuI/BamHI C-terminal fragment of p53as cDNA (Han and Kulesz-Martin, Nucl. Acids Res. 1992) with the BamHI/StuI fragment of the pVL1393BGB53 vector (see above).
  • Sf9 cells were cotransfected with linear AcMNPV DNA and the transfer vector containing p53as and grown for 3 days. Recombinant viruses were identified by plaque assays or serial dilutions.
  • p53 and p53as baculovirus constructions will be cotransfected with linearized (PharMingen) virus DNA which allows propagation of only recombinant virus.
  • Virus stocks which resulted in p53as expression in insect cells were expanded and used to infect insect cells for the flow cytometry studies.
  • Baculovirus pVL1393Asp stock was added to insect cell cultures at 3 x 10 6 cells/60 mm dish. After several (2 to 4) days, cells were harvested by trypsinization and stained with anti-p53as antibody and analyzed by flow cytometry as detailed in the original patent application.
  • Plasmids for expression of p53as in mammalian cells were constructed. An example is given of the full length p53as cDNA under the control of a metallothionein promoter. However, other promoters which may increase or decrease expression in given cell types, such as the cytomegalovirus promoter, will be used as appropriate.
  • pmMTBGB containing the full length wild type p53 cDNA beginning at -67 nt (where nucleotide 1 is the first nucleotide of the first ATG codon) was constructed by replacement of the BgIII/BamHI fragments of plasmid pmMTval53cG (from M.
  • the pmMTAsp plasmid was constructed by firstly, replacement of the XhoI/BamHI fragment of pmMTBGB with the XboI/BamHI fragment of pVL1393Asp and secondly, introduction of a BamHI fragment from plasmid BCMGNeo (Karasuyama and Melchers, 1988) containing the splicing signals and polyA tail of the rabbit B-globin gene.
  • Mouse squamous cell carcinoma cells (291.05RAT) were plated in culture medium at 2 to 3 x 10 6 per 60mm dish and transfected with plasmid pmMTAsp when 40 to 60% confluent using Lipofectin GIBCO BRL. 10 ⁇ g of plasmid diluted in 100 ⁇ l ddH 2 O was mixed with 30 ⁇ l Lipofectin adjusted to 1 ml with serum-free culture medium, incubated with the cell cultures for 20 hr, then removed and replaced with culture medium with serum. 24 hr later CdCl 2 was added to the cells to stimulate transcription of p53as mRNA from the plasmid DNA and enhance the expression of p53as protein. Two days later, cells were harvested by trypsinization, stained with anti-p53as antibody and analyzed by flow cytometry as described in the original patent application.
  • mouse carcinoma cells transfected with the plasmid containing p53as cDNA were preferentially distributed in the G2 phase of the cell cycle or in a "tail" representing cells containing >G2 DNA content (Fig. 9).
  • mouse p53as cDNA is claimed for the purposes of gene expression in mammalian cells and nonmammalian cells for research purposes, including human cells, and for gene therapy in humans.
  • a purified plasmid construct containing the human p53as homologue of mouse p53as, defined by insertion of human intron 10 sequences into a sequence containing wt p53 DNA is claimed for research purposes in mammalian and nonmammalian cells, and for gene therapy in humans.
  • Table 3 shows reactivities of antibodies against p53 proteins.
  • Mouse p53 has 390 amino acids; human p53 393 amino acids. All antibodies are mouse monoclonals commercially available from Oncogene Science, Cambridge MA, except ApAs rabbit polyclonal specific for p53as protein which was made in Dr. Kulesz-Martin's laboratory, RPCI. Sources: Oncogene Science Catalogue, p. 8, 1992; Vajtesek et al., J. of Immunolog. Methods 151:237-244, 1992, a Wade-Evans, A. and Jenkins, J. R.
  • Table 4 shows p53 DNA Binding Sequences used for assay of p53as protein binding activity.
  • Table 5 shows Activation of 50-2 Muscle Creatinin Kinase Reporter Plasmid by p53as in Mouse Cells.
  • Spontaneously arising immortalized murine BALB/c embryo fibroblast (10) 1 is a p53 negative cell line which was transfected with 2 ⁇ g pSV- ⁇ -gal plasmid (Promega), 3 ⁇ g 50-2 plasmid (Dr. Levine) which contains 2 copies of a 50 bp sequence corresponding to p53 binding site in muscle creatinine kinase promoter-enhancer upstream of a basic CAT reporter plasmid, and 5 ⁇ g pCMVp53as, pCMVp53r or pCMV vector control. Transfection was done using the calcium phosphate method. The cells were harvested 48 hours post-transfection and lysed by three freeze-thaw cycles. The supernatant was assayed for CAT activity using diffusion.
  • Table 6 shows activation of PG 13 CAT Plasmid by p53as in Human Saos-2 Cells.
  • the human osteosarcoma Saos-2 cells were transfected with 3 ⁇ g of PG13CAT plasmid, which contains 13 repeats of p53-binding site upstream of a CAT reporter gene with a basal promoter and 5 ⁇ g pCMVp53as plasmid, pCMVp53r or pCMV vector control plasmid. Transfection was done using the calcium phosphate method and the total transfected DNA per plate was adjusted to 10 ⁇ g with herring sperm DNA. The cells were harvested 48 hours post-transfection and lysed by three freeze-thaw cycles. Cell debris was removed by centrifugation and the supernatant was assayed for CAT activity using the diffusion method.
  • Tables 5 and 6 demonstrate that p53as has transcriptional activity. Plasmids containing p53as, or p53 as a control, were introduced into mouse or human cells along with a plasmid containing a p53 binding site upstream of a reporter gene. The reporter was activated by p53as, with p53 as a positive control, but not by the vector without p53as. By comparison, the background activity of the reporter plasmid alone was low.
  • the reporter sequences 50-2 and PG13 are a promoter-enhancer sequence (Zambetti et al., Genes Dev.
  • p53as was active on mouse (50-2) or human (PG13) p53 binding sequences, and in both mouse and human cells.
  • Table 7 shows Activation of the WAF-1 Promoter by p53as in Mouse Cells.
  • Cells of mouse fibroblast line Dr. Levine (10)l were transfected with 2 ⁇ g pSVCAT (Promega).
  • 3 ⁇ g WWP-1 (Dr. B. Vogelstein) which contains the WAF-1 promoter upstream of a luciferase reporter gene and 5 ⁇ g of pCMVp53as, pCMVp53r or pCMV vector control were transfected using the calcium phosphate method.
  • Table 7 demonstrates that p53as activates transcription from an endogenous promoter region of a growth inhibitory gene, WAF-1, cipl, sdi, p21 (El-Deiry et al., Cell 75, 817-825, 1993; Gu et al., Nature 366, 707-710, 1993; Harper et al., Cell 75, 805-816, 1993; Xiong et al., Nature 366, 701-704, 1993; and Serranto et al., Nature 366, 704-705, 1993) recently reported to be a target gene of p53 in cells and a cell cycle control gene.
  • the activity of p53as for the WAF-1 promoter is therefore strong evidence that p53as has transcriptional activity in vivo for genes functional in cell cycle control.
  • p53 and p53as act as tumor suppressors, both activate transcription and both form tetramers which bind specifically to DNA.
  • the differences between p53as and p53 are that the p53 protein is activated under conditions in which p53 requires activation, p53as is associated with a different cell cycle stage compared to p53 and therefore have different functions or different regulation of activity.
  • plasmids containing p53as and the antibodies for p53as have utility as described herein and that utility may be different in some respects from that of plasmids containing p53.
  • tumor cells which express different ratios of p53as and p53, as detected at the RNA level, or at the protein level by anti-p53as antibodies may have different characteristics or different sensitivity to anti-cancer treatments. Different characteristics identifiable by reactivity with p53as antibodies could aid in the diagnosis of cancer, prognosis for individual patients with tumors and decisions about treatment based on the competency of the p53as functions in the tumor.
  • Antibodies to p53 are being used clinically in diagnosis of human cancers because expression of p53 at detectable levels has been found to correlate with cancer prognosis for a variety of human tumor types. It is known that tumors with defective p53 genes (more than 50% of all human cancers) fail to control cell cycle progression normally.
  • tumor typing using specific p53as antibodies and specific anti-p53 antibodies may increase the value of typing individual tumors according to their expression of tumor suppressor gene products such as p53. Such tumor typing may provide useful information in the diagnosis, prognosis, and treatment strategy of individual patient cancers.
  • Plasmids or vectors containing the p53as sequence of mouse or human may be useful for gene therapy approaches, based on the ability of plasmids containing mouse p53as to act as a tumor suppressor and to activate transcription of p53 target genes.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Toxicology (AREA)
  • Oncology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP97107696A 1996-05-10 1997-05-12 Protéine p53as et anticorps correspondant Ceased EP0806478A3 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US644456 1996-05-10
US08/644,456 US5747650A (en) 1993-08-02 1996-05-10 P53AS protein and antibody therefor
US644289 1996-05-10
US644291 1996-05-10
US08/644,289 US7238523B1 (en) 1993-08-02 1996-05-10 p53as protein and antibody therefor
US08/644,291 US5726024A (en) 1993-08-02 1996-05-10 p53as protein and antibody therefor

Publications (2)

Publication Number Publication Date
EP0806478A2 true EP0806478A2 (fr) 1997-11-12
EP0806478A3 EP0806478A3 (fr) 1999-06-09

Family

ID=27417725

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97107696A Ceased EP0806478A3 (fr) 1996-05-10 1997-05-12 Protéine p53as et anticorps correspondant

Country Status (1)

Country Link
EP (1) EP0806478A3 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999046403A1 (fr) * 1998-03-11 1999-09-16 Exonhit Therapeutics S.A. Criblage differentiel qualitatif
WO2000022127A1 (fr) * 1998-10-09 2000-04-20 The Brigham And Women's Hospital, Inc. Compositions et procedes bases sur p35, un isoforme de p53
WO2000023082A1 (fr) * 1998-10-19 2000-04-27 Yeda Research And Development Co. Ltd. Traitement du lupus erythemateux systemique par regulation negative de la reponse auto-immune a des autoantigenes
US6881571B1 (en) 1998-03-11 2005-04-19 Exonhit Therapeutics S.A. Qualitative differential screening

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0652232B1 (fr) * 1993-08-02 2003-10-29 Health Research, Inc. Protéine P53as et des plasmids et vécteurs viraux contenant de l'ADNc complementaire de l'ADN le codant
US5688918A (en) * 1993-08-02 1997-11-18 Health Research, Inc. p53as protein and antibody therefor

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YAMANASHI ET AL: "Differential responses of p56lyn and p53lyn, products of alternatively spliced lyn mRNA, on stimulation of B-cell antigen receptor", CELL REGULATION, vol. 2, December 1991 (1991-12-01), pages 979 - 987 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999046403A1 (fr) * 1998-03-11 1999-09-16 Exonhit Therapeutics S.A. Criblage differentiel qualitatif
FR2775984A1 (fr) * 1998-03-11 1999-09-17 Bioscreen Therapeutics Sa Criblage differentiel qualitatif
US6251590B1 (en) 1998-03-11 2001-06-26 Exonhit Therapeutics S.A. Differential Qualitative screening
US6881571B1 (en) 1998-03-11 2005-04-19 Exonhit Therapeutics S.A. Qualitative differential screening
US8003375B2 (en) 1998-03-11 2011-08-23 Exonhit Therapeutics S.A. Qualitative differential screening
WO2000022127A1 (fr) * 1998-10-09 2000-04-20 The Brigham And Women's Hospital, Inc. Compositions et procedes bases sur p35, un isoforme de p53
WO2000023082A1 (fr) * 1998-10-19 2000-04-27 Yeda Research And Development Co. Ltd. Traitement du lupus erythemateux systemique par regulation negative de la reponse auto-immune a des autoantigenes
EP1150688A4 (fr) * 1998-10-19 2004-06-16 Yeda Res & Dev Traitement du lupus erythemateux systemique par regulation negative de la reponse auto-immune a des autoantigenes

Also Published As

Publication number Publication date
EP0806478A3 (fr) 1999-06-09

Similar Documents

Publication Publication Date Title
Kulesz-Martin et al. Endogenous p53 protein generated from wild-type alternatively spliced p53 RNA in mouse epidermal cells
WO1999035170A2 (fr) Compositions et methodes pour le traitement des tumeurs
EP0536350B1 (fr) Identification d'un nouveau gene humain recepteur de tyrosine kinase
KR19980702369A (ko) 신규 단백질 및 그 제조방법
US7125969B1 (en) ETS-related gene overexpressed in human breast and epithelial cancers
US6326482B1 (en) SH2 domain-containing peptides
US5986078A (en) DNA sequence encoding the tumor suppressor gene ING1
WO1999016790A1 (fr) Utilisation du gene suppresseur de tumeur p33ing1 pour moduler l'activite de la p53 et diagnostiquer une tumeur
EP0652232B1 (fr) Protéine P53as et des plasmids et vécteurs viraux contenant de l'ADNc complementaire de l'ADN le codant
EP1109833A2 (fr) Compositions et methodes de traitement des tumeurs
CA2353775A1 (fr) Compositions et methodes de traitement d'une tumeur
US6025480A (en) Isolated nucleic acid molecules encoding P57KIP2
US5688918A (en) p53as protein and antibody therefor
US20040053231A1 (en) Transcription transactivator protein
US5747650A (en) P53AS protein and antibody therefor
US6965009B1 (en) p53 as protein and antibody therefor
US6891022B1 (en) NSP molecules
US5726024A (en) p53as protein and antibody therefor
CA2170627A1 (fr) Nouveau gene suppresseur des tumeurs de la prostate et du colon situe sur le chromosome humain 8
NZ278745A (en) Tumour suppressor gene encoding retinoblastoma binding protein
AU776063B2 (en) Compositions and methods for the treatment of tumor
US5965398A (en) DNA sequence encoding a tumor suppressor gene
US7238523B1 (en) p53as protein and antibody therefor
AU741133B2 (en) SH2 domain-containing peptides
US6747133B1 (en) Antibodies against the tumor suppressor gene ING1

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): BE CH DE DK FR GB LI NL SE

PUAL Search report despatched

Free format text: ORIGINAL CODE: 0009013

AK Designated contracting states

Kind code of ref document: A3

Designated state(s): BE CH DE DK FR GB LI NL SE

17P Request for examination filed

Effective date: 19991119

17Q First examination report despatched

Effective date: 20020326

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20031004