EP0770086A1 - Facteur-3 inhibiteur de la migration des macrophages - Google Patents

Facteur-3 inhibiteur de la migration des macrophages

Info

Publication number
EP0770086A1
EP0770086A1 EP94923875A EP94923875A EP0770086A1 EP 0770086 A1 EP0770086 A1 EP 0770086A1 EP 94923875 A EP94923875 A EP 94923875A EP 94923875 A EP94923875 A EP 94923875A EP 0770086 A1 EP0770086 A1 EP 0770086A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
mif
polynucleotide
dna
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP94923875A
Other languages
German (de)
English (en)
Other versions
EP0770086A4 (fr
Inventor
Haodong L1
Lisa M. Fitzgerald
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of EP0770086A1 publication Critical patent/EP0770086A1/fr
Publication of EP0770086A4 publication Critical patent/EP0770086A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • This invention relates to newly identified polynucleotides, polypeptide ⁇ encoded by such polynucleotides, the use of such polynucleotides and polypeptide ⁇ . as well as the production of such polynucleotides and polypeptide ⁇ . More particularly, the polypeptide of the present invention is Macrophage Migration Inhibitory Factor-3 (MIF-3). The invention also relates to inhibiting the action of such polypeptides.
  • MIF-3 Macrophage Migration Inhibitory Factor-3
  • lympho ines that play an important role in immunoregulation, inflammation and effector mechanisms of cellular immunity.
  • MIF migration inhibitory factor
  • MIF activity is correlated with a variety of inflammatory responses including delayed hypersensitivity and cellular immunity (Rocklin, R.E. et al.. New Engl. J. Med., 282:1340-1343 (1970); allograft rejection (Al-Askari, S. et al., Nature, 205:916-917 (1965); and rheumatoid polyarthritic synovialis (Odink et al., Nature, 330:80-82 (1987).
  • MIF is a lymphokine known to be produced by activated T cells. MIF is a major secreted protein released by the anterior pituitary cells. A large number of publications have reported the isolation and identification of putative MIF molecules. For example, MIF-1 was purified to homogeneity from the serum-free culture supernatant of a human T cell hybridoma clone called F5. Oki, S., Lymphokine Cytokine Res., 10:273-80 (1991). Also, an MIF-2, which is more hydrophobic than MIF-1, was purified to homogeneity from the same clone, (Hirose, S., et al., M, Microbiol. Immunol., 35:235-45 (1991)). The polypeptide of the present invention, MIF-3, is structurally related to the MIF family.
  • polypeptide of the present invention is of human origin.
  • polynucleotides (DNA or RNA) which encode such polypeptide ⁇ .
  • antagonist/inhibitor ⁇ to such polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of septic shock, lethal endotoxaemia and ocular inflammation.
  • Figure 1 depict ⁇ the polynucleotide sequence and corresponding deduced amino acid sequence of MIF-3.
  • the polypeptide encoded by the amino sequence shown is the preprotien form of the polypeptide, and the standard one letter abbreviation for amino acids is used.
  • nucleic acid which encode ⁇ for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited a ⁇ ATCC Deposit No. 75712 on March 18, 1994.
  • the polynucleotide of this invention wa ⁇ di ⁇ covered from a cDNA library derived from human T cell ⁇ . It is structurally related to the human MIF family. It contains an open reading frame encoding a protein of approximately 118 amino acid residues. The protein exhibits the highest degree of homology to human MIF with 34 % identity and 78 % similarity over the entire amino acid sequence.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double- stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sen ⁇ e) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein ⁇ equence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding ⁇ equence 5' and/or 3 ' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove de ⁇ cribed polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotide ⁇ encoding the ⁇ ame mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variant ⁇ of such polynucleotide ⁇ which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variants include deletion variants, substitution variants and addition or in ⁇ ertion variant ⁇ .
  • the polynucleotide may have a coding ⁇ equence which i ⁇ a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a sub ⁇ titution, deletion or addition of one or more nucleotide ⁇ , which doe ⁇ not ⁇ ub ⁇ tantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa- hi ⁇ tidine tag supplied by a pQE-9 vector to provide for p ..fication of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, i ⁇ u ⁇ ed.
  • the HA tag correspond ⁇ to an epitope derived from the influenza hemagglutinin protein (Wil ⁇ on, I., et al.. Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there i ⁇ at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides .
  • ⁇ tringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polypeptide ⁇ which retain substantially the same biological function or activity a ⁇ the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
  • the deposit(s) referred to herein will be maintained under the terms of the Budape ⁇ t Treaty on the International Recognition of the Deposit of Micro-organis ⁇ for purposes of Patent Procedure. These deposits are provided merely a ⁇ convenience to those of ⁇ kill in the art and are not an admission that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
  • the present invention further relates to a MIF-3 polypeptide which has the deduced amino acid ⁇ equence of Figure 1 or which ha ⁇ the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, means a polypeptide which retains essentially the ⁇ ame biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a ⁇ ynthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the depo ⁇ ited cDNA may be (i) one in which one or more of the amino acid re ⁇ idue ⁇ are substituted with a conserved or non-conserved amino acid re ⁇ idue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residue ⁇ include ⁇ a ⁇ ub ⁇ tituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acid ⁇ are fused to the mature polypeptide, such a ⁇ a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • Such fragments, derivatives and analogs are deemed
  • polypeptide ⁇ and polynucleotide ⁇ of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material i ⁇ removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally- occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptide ⁇ could be part of a compo ⁇ ition, and ⁇ till be i ⁇ olated in that such vector or composition is not part of its natural environment.
  • the present invention also relates to vectors which include polynucleotide ⁇ of the pre ⁇ ent invention, ho ⁇ t cell ⁇ which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Ho ⁇ t cells are genetically engineered (transduced or transformed or transfected) with the vector ⁇ of this invention which may be, for example, a cloning vector or an expre ⁇ ion vector.
  • the vector may be, for example, in the
  • SUBSTITUTE SHEET (RULE 261 form of a plasmid, a viral particle, a phage, etc.
  • the engineered ho ⁇ t cell ⁇ can be cultured in conventional nutrient media modified a ⁇ appropriate for activating promoter ⁇ , ⁇ electing transformants or amplifying the MIF genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the ho ⁇ t cell ⁇ elected for expre ⁇ ion, and will be apparent to the ordinarily ⁇ killed artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expres ⁇ ing a polypeptide.
  • Such vectors include chromosomal, nonchromo ⁇ omal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmid ⁇ ; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenoviru ⁇ , fowl pox viru ⁇ , and pseudorabie ⁇ .
  • any other vector may be used as long a ⁇ it i ⁇ replicable and viable in the ho ⁇ t.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate re ⁇ triction endonuclease site( ⁇ ) by procedures known in the art. Such procedure ⁇ and other ⁇ are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence( ⁇ ) (promoter) to direct mRNA synthe ⁇ i ⁇ .
  • promoter promoter
  • a ⁇ repre ⁇ entative example ⁇ of such promoter ⁇ there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contain ⁇ a ribo ⁇ ome binding ⁇ ite for tran ⁇ lation initiation and a tran ⁇ cription terminator.
  • the vector may also i: .lude appropriate sequences for amplifying expre ⁇ ion.
  • the exp spion vector ⁇ preferably contain one or more selectable mar; er genes to provide a phenotypic trait for selection of transformed ho ⁇ t cells such as dihydrofolate reductase or neomycin resi ⁇ tance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well a ⁇ an appropriate promoter or control ⁇ equence, may be employed to tran ⁇ form an appropriate ho ⁇ t to permit the ho ⁇ t to expre ⁇ the protein.
  • a ⁇ repre ⁇ entative example ⁇ of appropriate ho ⁇ ts there may be mentioned: bacterial cell ⁇ , such as E. coli. Strepto vces. Salmonella typhimuriu : fungal cells, such a ⁇ yeast; insect cells such as Drosophila and Sf9 animal cell ⁇ ⁇ uch a ⁇ CHO, COS or Bowe ⁇ melanoma; plant cell ⁇ , etc.
  • bacterial cell ⁇ such as E. coli. Strepto vces. Salmonella typhimuriu
  • fungal cells such a ⁇ yeast
  • insect cells such as Drosophila and Sf9 animal cell ⁇ ⁇ uch a ⁇ CHO, COS or Bowe ⁇ melanoma
  • plant cell ⁇ etc.
  • the selection of an appropriate host i ⁇ deemed to be within the scope of those skilled in the art from the teachings herein.
  • the present invention also includes recombinant constructs comprising one or more of the sequence ⁇ a ⁇ broadly de ⁇ cribed above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a ⁇ equence of the invention ha ⁇ been in ⁇ erted, in a forward or rever ⁇ e orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • suitable vector ⁇ and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example.
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
  • any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter region ⁇ can be ⁇ elected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are PKK232-8 and PCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoter ⁇ include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter i ⁇ well within the level of ordinary ⁇ kill in the art.
  • the pre ⁇ ent invention relate ⁇ to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such a ⁇ a yea ⁇ t cell, or the ho ⁇ t cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M. , Battey, I., Basic Methods in Molecular Biology, (1986)).
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cell ⁇ under the control of appropriate promoter ⁇ .
  • Cell-free tran ⁇ lation ⁇ y ⁇ tem ⁇ can also be employed to produce ⁇ uch protein ⁇ using RNAs derived from the DNA con ⁇ truct ⁇ of the pre ⁇ ent invention.
  • Appropriate cloning and expre ⁇ ion vector ⁇ for u ⁇ e with prokaryotic and eukaryotic ho ⁇ t ⁇ are de ⁇ cribed by Sambrook, et al.. Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are ci ⁇ -acting element ⁇ of DNA, ually about from 10 to 300 bp that act on a promoter to increase it ⁇ tran ⁇ cription.
  • Example ⁇ including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyo a enhancer on the late side of the replication origin, and adenovirus enhancer ⁇ .
  • recombinant expre ⁇ ion vector ⁇ will include origin ⁇ of replication and ⁇ electable marker ⁇ permitting transformation of the ho ⁇ t cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expre ⁇ ed gene to direct transcription of a down ⁇ tream ⁇ tructural ⁇ equence.
  • a promoter derived from a highly-expre ⁇ ed gene to direct transcription of a down ⁇ tream ⁇ tructural ⁇ equence can be derived from operon ⁇ encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ⁇ -factor, acid pho ⁇ phatase, or heat shock pr ins, among other ⁇ .
  • PGK 3-phosphoglycerate kinase
  • ⁇ -factor acid pho ⁇ phatase
  • heat shock pr ins among other ⁇ .
  • heterologou ⁇ ⁇ tructural ⁇ equence i ⁇ assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterxal use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination ⁇ ignal ⁇ in operable reading phase with a functional promoter.
  • the vector will compri ⁇ e one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the ho ⁇ t.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimuriu and variou ⁇ species within the genera Pseudo ona ⁇ , Streptomyce ⁇ , and Staphylococcu ⁇ , although others may also be employed a ⁇ a matter of choice.
  • u ⁇ eful expre ⁇ ion vector ⁇ for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available pla ⁇ mids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017).
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, PKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, I, USA).
  • the selected promoter i ⁇ induced by appropriate mean ⁇ e.g., temperature ⁇ hift or chemical induction
  • cell ⁇ are cultured for an additional period.
  • Cell ⁇ are typically harve ⁇ ted by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expres ⁇ ion of protein ⁇ can be di ⁇ rupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell ly ⁇ ing agent ⁇ , ⁇ uch method ⁇ are well know to tho ⁇ e skilled in the art.
  • mammalian cell culture sy ⁇ tem ⁇ can al ⁇ o be employed to expre ⁇ recombinant protein.
  • Example ⁇ of mammalian expre ⁇ ion ⁇ ystems include the COS-7 lines of monkey kidney fibroblasts, de ⁇ cribed by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expre ⁇ sing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expres ⁇ ion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding ⁇ ite ⁇ , polyadenylation ⁇ ite, ⁇ plice donor and acceptor ⁇ ite ⁇ , transcriptional termination sequence ⁇ , and 5' flanking nontranscribed sequences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • the MIF-3 polypeptide can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, pho ⁇ phocellulo ⁇ e chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. It is preferred to have low concentrations (approximately 0.15-5 mM) of calcium ion pre ⁇ ent during purification. (Price et al., J. Biol. Chem., 244:917 (1969)). Protein refolding ⁇ tep ⁇ can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification step ⁇ .
  • HPLC high performance liquid chromatography
  • the polypeptide ⁇ of the pre ⁇ ent invention may be a naturally purified product, or a product of chemical ⁇ ynthetic procedure ⁇ , or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, in ⁇ ect and mammalian cell ⁇ in culture).
  • a prokaryotic or eukaryotic host for example, by bacterial, yeast, higher plant, in ⁇ ect and mammalian cell ⁇ in culture.
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • Polypeptides of the invention may also include an initial methionine amino acid residue.
  • MIF-3 proteins of the pre ⁇ ent invetion have displayed biological activitie ⁇ which indicate it ⁇ role as a general activator or several different acrophage functions. Further, MIF-3 both inhbiti ⁇ the migration of human macrophage ⁇ and ⁇ timulate ⁇ the activity of macrophages.
  • the MIF-3 polypeptides of the present invention may be employed as an anti-tumor agent. Activated macrophages alone or in combination with specific anti-tumor monoclonal antibodies have considerable tumoricidal capacity. Similarly, the ability of MIF-3 to promote macrophage- mediated killing of certain pathogens indicates the use of this molecule in treating various infections, including tuberculosis, Hunsen di ⁇ ea ⁇ e and Candida.
  • MIF-3 may be exploited in a therapeutic agent for treating wounds.
  • Local application of MIF-3 at the site of injury may result in increased numbers of activated macrophages concentrated within the wound, thereby increasing the rate of healing of the wound.
  • MIF-3 may be used as a general immune stimulus to increase the immunity generated against specific vaccines.
  • MIF proteins have the ability to enhance macrophages to present antigens to T cells. Therefore, MIF-3 may be emplyed to potentiate the immune response to different antigens. This is extremely important in cases such as AIDS or AIDS related complex.
  • MIF-3 may also be employed to enhance the detoxification function of the liver.
  • a protein having MIF activity in the rat liver links the chemical and immunological detoxification system ⁇ . This protein actuate ⁇ both glutothione S-tran ⁇ fera ⁇ e (GSTs) and MIF activity.
  • GSTs glutothione S-tran ⁇ fera ⁇ e
  • the MIF polypeptide ⁇ may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • DNA or RNA polynucleotide
  • cell ⁇ may be engineered by procedure ⁇ known in the art by u ⁇ e of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cell ⁇ may be engineered in vivo for expre ⁇ ion of a polypeptide in vivo by, for example, procedure ⁇ known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the pre ⁇ ent invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo .
  • the expression vehicle for engineering cells may be other than a retroviru ⁇ , for example, an adenoviru ⁇ which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • the polypeptides of the present invention may be employed in combination with a ⁇ uitable pharmaceutical carrier.
  • a ⁇ uitable pharmaceutical carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered ⁇ aline, dextro ⁇ e, water, glycerol, ethanol, and combination ⁇ thereof.
  • a carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered ⁇ aline, dextro ⁇ e, water, glycerol, ethanol, and combination ⁇ thereof.
  • the formulation should ⁇ uit the mode of administration.
  • the invention also provide ⁇ a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a ⁇ ociated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or ⁇ ale of pharmaceutical ⁇ or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compound ⁇ .
  • the pharmaceutical compo ⁇ ition ⁇ may be admini ⁇ tered in a convenient manner ⁇ uch a ⁇ by the topical, intravenou ⁇ , intraperitoneal, intramu ⁇ cular, subcutaneous, intranasal or intradermal routes.
  • the amounts and dosage regimens of MIF and administered to a subject will depend on a number of factors ⁇ uch as the mode of administration, the nature of the condition being treated and the judgment of the prescribing physician.
  • the do ⁇ age is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptom ⁇ , etc.
  • sequences of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphism ⁇ ) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes as ⁇ ociated with di ⁇ ea ⁇ e.
  • ⁇ equence ⁇ can be mapped to chromo ⁇ ome ⁇ by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the cDNA is u ⁇ ed to rapidly select primer ⁇ that do not ⁇ pan more than one exon in the genomic DNA, thu ⁇ complicating the amplification proce ⁇ . These primers are then used for PCR ⁇ creening of ⁇ omatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategie ⁇ that can ⁇ imilarly be u ⁇ ed to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosome ⁇ and preselection by hybridization to construct chromo ⁇ ome ⁇ pecific-cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a cDNA clones to a metapha ⁇ e chromo ⁇ omal ⁇ pread can be u ⁇ ed to provide a precise chromosomal location in one step.
  • This technique can be u ⁇ ed with cDNA as short as 500 or 600 bases; however, clones larger t.*"an 2,000 bp have a higher likelihood of binding to a unique cnromo ⁇ omal location with ⁇ ufficient ⁇ ignal intensity for simple detection.
  • FISH requires use of the clones from which the EST was derived, and the longer the better.
  • a cDNA preci ⁇ ely localized to a chromo ⁇ omal region a ⁇ ociated with the di ⁇ ea ⁇ e could be one of between 50 and 500 potential causative genes. (This as ⁇ umes 1 megabase mapping re ⁇ olution and one gene per 20 kb).
  • Compari ⁇ on of affected and unaffected individual ⁇ generally involve ⁇ first looking for structural alteration ⁇ in the chromo ⁇ ome ⁇ , ⁇ uch as deletions or tran ⁇ locations that are visible from chromosome spreads or detectable using PCR based on that cDNA sequence. Ultimately, complete sequencing of genes from several individual ⁇ i ⁇ required to confirm the presence of a mutation and to di ⁇ tingui ⁇ h mutation ⁇ from polymorphi ⁇ m ⁇ .
  • the polypeptide ⁇ , their fragments or other derivatives, or analogs thereof, or cells expres ⁇ ing them can be u ⁇ ed as an immunogen to produce antibodie ⁇ thereto.
  • the ⁇ e antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also include ⁇ chimeric, ⁇ ingle chain, and humanized antibodies, as well as Fab fragment ⁇ , or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated again ⁇ t the polypeptide ⁇ corre ⁇ ponding to a ⁇ equence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptide ⁇ itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodie ⁇ can then be u ⁇ ed to i ⁇ olate the polypeptide from tissue expressing that polypeptide.
  • Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV- hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodie ⁇ and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
  • Thi ⁇ invention if further related to a method for identification of MIF-3 receptor ⁇ .
  • the gene encoding a receptor can be identified by expre ⁇ ion cloning, which comprises preparing polyadenylated RNA from a cell responsive to MIF-3 and a cDNA library created from this RNA i ⁇ divided into pools and used to tran ⁇ fect COS cells or other cells that are not respon ⁇ ive to MIF-3. Tran ⁇ fected cell ⁇ which are grown on glas ⁇ ⁇ lide ⁇ are expo ⁇ ed to labeled MIF-3.
  • MIF- 3 can be labeled by a variety of mean ⁇ including iodidation or inclu ⁇ ion of a recognition ⁇ ite for a ⁇ ite- ⁇ pecific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and retran ⁇ fected using an iterative sub-pooling and rescreening proce ⁇ , eventually yielding a ⁇ ingle clone that encode ⁇ the putative receptor.
  • labeled MIF-3 can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cros ⁇ -linked material is resolved by PAGE and exposed to x-ray film.
  • the labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein micro ⁇ equencing.
  • the amino acid ⁇ equence obtained from microsequencing would be used to design a set of generate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.
  • This invention also provides a method of screening drugs to identify those which enhance (agonists) or block (antagonist ⁇ ) interaction of MIF-3 to it ⁇ receptor.
  • An agonist is a compound which increases the natural biological functions of MIF-3, while an antagoni ⁇ t eliminates ⁇ uch function ⁇ .
  • a mammalian cell or membrane preparation expre ⁇ ing an MIF-3 receptor would be incubated with labeled MIF-3 in the presence of drug. The ability of drug to enhance or block this interaction could then be measured.
  • the response of a known second messenger sy ⁇ tem following interaction of ligand and receptor would be mea ⁇ ured compared in the pre ⁇ ence or absence of drug.
  • Such second messenger sy ⁇ tems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydroly ⁇ i ⁇ .
  • the pre ⁇ ent invention i ⁇ al ⁇ o directed to antagoni ⁇ t/inhibitor molecule ⁇ of the polypeptides of the present invention and their use to inhibit or eliminate the function of the polypeptide.
  • an antagonist is an antibody against the MIF-3 polypeptide or, in some ca ⁇ es, an oligonucleotide which bind ⁇ to the polypeptide.
  • An antagonist may also be be a peptide derivate of MIF-3 which recognizes and binds to MIF-3 receptor sites but has no biological function thereby effectivfely blocking the receptor ⁇ .
  • An example of an inhibitor is an anti ⁇ en ⁇ e construct prepared using antisense technology. Anti ⁇ en ⁇ e technology can be u ⁇ ed to control gene expre ⁇ ion through triple-helix formation or anti ⁇ en ⁇ e DNA or RNA, both of which method ⁇ are ba ⁇ ed on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide ⁇ equence, which encode ⁇ for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in tran ⁇ cription (triple helix - ⁇ ee Lee et al., Nucl. Acid ⁇ Re ⁇ ., 3:173 (1979); Cooney et al. Science, 241:456 (1988); and Dervan et al.. Science, 251: 1360 (1991)), thereby preventing transcription and the production of MIF-3.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks tran ⁇ lation of the mRNA molecule into the MIF-3 (antisen ⁇ e - Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotide ⁇ a ⁇ Anti ⁇ en ⁇ e Inhibitor ⁇ of Gene Expression, CRC Press, Boca Raton, FL (1988)).
  • the oligonucleotide ⁇ described above can also be delivered to cells ⁇ uch that the anti ⁇ en ⁇ e RNA or DNA may be expre ⁇ sed in vivo to inhibit production of MIF-3.
  • the antagonist/inhibitors may be employed to protect again ⁇ t lethal endotoxaemia and septic shock.
  • Cytokines including Macrophage Migration Inhibitory Proteins, are critical in the often fatal cascade of events that causes septic shock.
  • An endotoxin is a lipopolysaccharide (LPS) moiety of gram-negative bacillary cell walls. This endotoxin cause ⁇ vaso-constriction of small arteries and veins, which leads to increa ⁇ ed peripheral vascular re ⁇ i ⁇ tance and decreased cardiac output. These are the symptom ⁇ of lethal endotoxaemia which lead ⁇ to ⁇ eptic shock.
  • Anterior pituitary cells specifically release MIF proteins in response to the presence of LPS. These pituitary-derived MIF proteins contribute to circulating MIF proteins which are already pre ⁇ ent in the po ⁇ t-acute phase of endotoxaemia.
  • the antagonist/inhibitors may also be used to treat ocular inflammations since partial sequencing of ⁇ mall len ⁇ proteins has identified an MIF protein in the calf lens. Accordingly, MIF proteins may act as intercellular mes ⁇ enger ⁇ or part of the machinery of cellular differentiation, whereby over-expre ⁇ ion of MIF protein ⁇ may lead to ocular inflammation.
  • the antibodie ⁇ to MIF-3 may be employed for diagno ⁇ ing disease progression and efficacy of therapeutic intervention since the level of MIF-3 in circulation may correlate with the ⁇ tate of a disease.
  • the antagonist/inhibitors may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinabove described.
  • the present invention also relates to an assay for identifying potential antagonist/inhibitors specific to MIF- 3.
  • An example of such an assay combines MIF-3 and a potential antagonist/inhibitor with membrane-bound MIF-3 receptors or recombinant MIF-3-receptors under appropriate conditions for a competitive inhibition as ⁇ ay.
  • MIF-3 can be labeled, ⁇ uch a ⁇ by radioactivity, ⁇ uch that the number of MIF-3 molecule ⁇ bound to the receptor can determine the effectivene ⁇ of the potential antagoni ⁇ t/inhibitor.
  • “Pla ⁇ mid ⁇ ” are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the ⁇ tarting plasmids herein are either commercially available. publicly available on an unrestricted basi ⁇ , or can be con ⁇ tructed from available pla ⁇ mids in accord with published procedures.
  • equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • For analytical purpose ⁇ typically 1 ⁇ g of pla ⁇ mid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid con ⁇ truction typically 5 to 50 ⁇ g of DNA are dige ⁇ ted with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 * C are ordinarily used, but may vary in accordance with the supplier's instruction . After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated. “Ligation” refers to the process of forming phosphodie ⁇ ter bond ⁇ between two double stranded nucleic acid fragments (Maniatis, T., et al..
  • ligation may be accomplished u ⁇ ing known buffers and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amounts of the DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • Example 1 Bacterial Expres ⁇ ion and Purification of MIF-3
  • the 5' oligonucleotide primer has the sequence CCCGCATGCCGTTCCTGGAGCTGG contains an Sph I restriction enzyme site and 19 nucleotide ⁇ of MIF-3 coding ⁇ equence starting from the initiation codon.
  • the 3' sequence CCCAGATCTTAAAAAAGTCATGACCGT contains complementary sequence ⁇ to a Bgl II site and i ⁇ followed by 18 nucleotide ⁇ preceeding the termination codon of MIF-3.
  • the re ⁇ triction enzyme sites correspond to the Sph I and Bam HI restriction enzyme sites on the bacterial expression vector pQE-70 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311).
  • pQE-70 encode ⁇ antibiotic resistance (Amp r ), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), and puts the His tag to the 3' end of the gene.
  • pQE-70 was then digested with Sph I and Bam HI.
  • the amplified sequences were ligated into pQE-70 and were inserted in frame with the sequence encoding for the histidine tag.
  • Figure 2 shows a schematic representation of this arrangement.
  • the ligation mixture wa ⁇ then u ⁇ ed to tran ⁇ form E. coli ⁇ train M15/rep 4 available from Qiagen under the trademark M15/rep 4 by the procedure de ⁇ cribed in Sambrook, J. et al.. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989).
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expres ⁇ es the lad repressor and also confers kanamycin resistance (Kan r ).
  • Transformant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin re ⁇ istant colonies were selected. Plasmid DNA wa ⁇ isolated and confirmed by restriction analysi ⁇ . Clone ⁇ containing the desired construct ⁇ were grown overnight (0/N) in liquid culture in LB media ⁇ upplemented with both Amp (100 ug/ l) and Kan (25 ug/ml) . The O/N culture i ⁇ u ⁇ ed to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cells were grown to an optical density 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG Isopropyl-B-D-thiogalacto pyranoside
  • IPTG induces by inactivating the lad repressor, clearing the P/0 leading to increased gene expression.
  • Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine HC1.
  • ⁇ olubilized MIF-3 wa ⁇ purified from this solution by chromatography on a Nickel-Chelate column under condition ⁇ that allow for tight binding by protein ⁇ containing the 6-Hi ⁇ tag. Hochuli, E. et al., J. Chromatography 411:177-184 (1984). MIF-3 (95 % pure) was eluted from the column in 6 molar guanidine HC1 pH 5.0.
  • Protein renaturation out of GnHCl can be accomplished by several protocols. (Jaenicke, R. and Rudolph, R. , Protein Structure - A Practical Approach, IRL Press, New York (1990)). Initially, step dialysis is utilized to remove the GnHCL. Alternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and i ⁇ ⁇ ub ⁇ equently eluted with a buffer containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tri ⁇ -HCl pH 7.5 and 10% Glycerol. Finally, ⁇ oluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate. The purified protein was analyzed by SDS-PAGE. See Figure 3.
  • plasmid, MIF-3 HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resi ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire MIF-3 precur ⁇ or and a HA tag fu ⁇ ed in frame to it ⁇ 3' end i ⁇ cloned into the polylinker region of the vector, therefore, the recombinant protein expre ⁇ ion i ⁇ directed under the CMV promoter.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously de ⁇ cribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
  • the infusion of HA tag to the target protein allows ea ⁇ y detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid construction strategy is described as follows:
  • the DNA sequence encoding for MIF-3, ATCC # 75712, is constructed by PCR on the original EST cloned u ⁇ ing two primers: the 5' primer CCCAAGCTTATGCCGTTCCTGGAACTG contains a Hind III site followed by 18 nucleotides of MIF-3 coding sequence starting from the initiation codon; the 3' sequence CGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTATAAAAAAGTCATGACCGTC contains complementary sequences to an Xba I site, translation stop codon, HA tag and the last 19 nucleotides of the MIF-3 coding sequence (not including the stop codon).
  • the PCR product contains a Hind III site, MIF-3 coding ⁇ equence followed by HA tag fu ⁇ ed in frame, a translation termination stop codon next to the HA tag, and an Xba I site.
  • the PCR amplified DNA fragment and the vector, pcDNAI/Amp are digested with Hind III and Xba I restriction enzymes and ligated.
  • the ligation mixture is transformed into E. coli strain SURE (available from Stratagene Cloning System ⁇ , 11099 North Torrey Pine ⁇ Road, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates and resistant colonies are selected.
  • Cells are labelled for 8 hours with 3S S-cysteine two days post transfection. Culture media are then collected and cells are lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I. et al.. Id. 37:767 (1984)). Both cell ly ⁇ ate and culture media are precipitated with a HA ⁇ pecific monoclonal antibody. Protein ⁇ precipitated are analyzed on 15% SDS-PAGE gels.
  • RIPA buffer 150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50mM Tris, pH 7.5.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • MOLECULE TYPE PROTEIN
  • Ser lie Ser Ser lie Gly Val Val Gly Thr Ala Glu A ⁇ p A ⁇ n Arg
  • Trp Gin lie Gly Lys lie Gly Thr Val Met Thr Phe Leu

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Communicable Diseases (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention se rapporte au facteur-3 inhibiteur de la migration des macrophages (MIF-3) et à l'ADN (ARN) codant ce polypeptide. L'invention se rapporte également à un procédé de production de ce polypeptide à l'aide de techniques de recombinaison et d'anticorps et d'antagonistes/inhibiteurs contre ce polypeptide; à des procédés d'utilisation, à des fins thérapeutiques, dans le traitement du cancer, d'infections, de l'accélération de la cicatrisation, dans la stimulation du système immun, et par exemple, dans le traitement de l'endotoxémie léthale, l'inflammation oculaire et dans le diagnostic de maladies immunes.
EP94923875A 1994-05-16 1994-05-16 Facteur-3 inhibiteur de la migration des macrophages Withdrawn EP0770086A4 (fr)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1994/005385 WO1995031468A1 (fr) 1994-05-16 1994-05-16 Facteur-3 inhibiteur de la migration des macrophages

Publications (2)

Publication Number Publication Date
EP0770086A1 true EP0770086A1 (fr) 1997-05-02
EP0770086A4 EP0770086A4 (fr) 1998-07-15

Family

ID=22242566

Family Applications (1)

Application Number Title Priority Date Filing Date
EP94923875A Withdrawn EP0770086A4 (fr) 1994-05-16 1994-05-16 Facteur-3 inhibiteur de la migration des macrophages

Country Status (4)

Country Link
EP (1) EP0770086A4 (fr)
JP (1) JPH10500301A (fr)
AU (1) AU7394294A (fr)
WO (1) WO1995031468A1 (fr)

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6174995B1 (en) 1994-08-23 2001-01-16 Haodong Li Human chemokines, CKβ4 and CKβ10/MCP-4
US6391589B1 (en) 1994-08-23 2002-05-21 Human Genome Sciences, Inc. Human chemokine beta-10 mutant polypeptides
US6458349B1 (en) 1995-06-02 2002-10-01 Human Genome Sciences, Inc. Chemokine β-4 polypeptides
US6290948B1 (en) * 1996-05-14 2001-09-18 Smithkline Beecham Corporation Method of treating sepsis and ARDS using chamohine beta-10
US6812327B1 (en) 1996-10-25 2004-11-02 Human Genome Sciences, Inc. Neutrokine-alpha polypeptides
US8212004B2 (en) 1999-03-02 2012-07-03 Human Genome Sciences, Inc. Neutrokine-alpha fusion proteins
CA2407910C (fr) 2000-06-16 2013-03-12 Steven M. Ruben Anticorps se liant de maniere immunospecifique a un stimulateur de lymphocyte b
US7879328B2 (en) 2000-06-16 2011-02-01 Human Genome Sciences, Inc. Antibodies that immunospecifically bind to B lymphocyte stimulator
US20030091565A1 (en) 2000-08-18 2003-05-15 Beltzer James P. Binding polypeptides and methods based thereon
WO2002020758A2 (fr) * 2000-09-05 2002-03-14 Curagen Corporation Nouvelles proteines et acides nucleiques codant pour ces proteines
CA2484121A1 (fr) 2002-05-01 2003-11-13 Human Genome Sciences, Inc. Anticorps a liaison specifique avec la chimiokine beta-4 (ck-b4)
US9168286B2 (en) 2005-10-13 2015-10-27 Human Genome Sciences, Inc. Methods and compositions for use in treatment of patients with autoantibody positive disease
US8211649B2 (en) 2006-03-31 2012-07-03 Human Genome Sciences, Inc. Methods of diagnosing and prognosing hodgkin's lymphoma
SG10201509499RA (en) 2010-11-19 2015-12-30 Eisai R&D Man Co Ltd Neutralizing anti-ccl20 antibodies
US9958456B2 (en) 2011-10-07 2018-05-01 Baxalta Incorporated OxMIF as a diagnostic marker
WO2013184209A1 (fr) * 2012-06-04 2013-12-12 Ludwig Institute For Cancer Research Ltd. Mif destiné à être utilisé dans des méthodes de traitement de sujets atteints d'une maladie neurodégénérative

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
S. HIROSE ET AL.: "Macrophage Migration Inhibitory Factor äMIFü produced by a human T cell hybridoma clone" MICROBIOLOGY AND IMMUNOLOGY, vol. 35, no. 3, 1991, pages 235-245, XP000672573 *
See also references of WO9531468A1 *

Also Published As

Publication number Publication date
WO1995031468A1 (fr) 1995-11-23
AU7394294A (en) 1995-12-05
EP0770086A4 (fr) 1998-07-15
JPH10500301A (ja) 1998-01-13

Similar Documents

Publication Publication Date Title
AU696764C (en) Vascular endothelial growth factor 2
EP0792278B1 (fr) Polypeptide gamma appartenant a la famille des facteurs de necrose tumorale (fnt)
EP0735818B1 (fr) PROTEINES INFLAMMATOIRES MACROPHAGES MIP-3, MIP-4 ET MIP-1gamma
US6521227B1 (en) Polynucleotides encoding prostatic growth factor and process for producing prostatic growth factor polypeptides
EP0741578A1 (fr) Hormone de croissance humaine
WO1995024414A1 (fr) Facteur-10 de croissance du fibroblaste
EP0763045A1 (fr) Facteur de maturation hematopoietique
WO1996005856A1 (fr) Polypeptides de type chemokine humaine
US5986060A (en) Macrophage Migration Inhibitory Factor-3
WO1995031468A1 (fr) Facteur-3 inhibiteur de la migration des macrophages
US5556767A (en) Polynucleotide encoding macrophage inflammatory protein γ
WO1996001896A1 (fr) Facteur-2 de croissance des tissus conjonctifs
EP0799311A1 (fr) Chemokine beta 9 humaine
WO1996018730A1 (fr) Facteur de croissance prostatique
US20020048784A1 (en) Prostatic growth factor
US5641657A (en) DNA encoding an interleukin-6 splice variant
EP0750626A1 (fr) Proteines des corpuscules de stannius, la stanniocalcine
WO1995031539A1 (fr) Vehicule de neurotransmetteur
WO1995024474A1 (fr) Proteine 10 osseuse morphogenique
WO1995031537A9 (fr) OXALYL-CoA DECARBOXYLASE HUMAINE
EP0764204A1 (fr) OXALYL-CoA DECARBOXYLASE HUMAINE
AU684539C (en) Macrophage inflammatory proteins-3, -4 and -1 Gamma
EP0783509A1 (fr) Facteur iia de transcription humain
US20030166863A1 (en) Macrophage migration inhibitory factor-3
EP0777494A1 (fr) Polypeptides de type chemokine humaine

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19961212

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): BE CH DE FR GB IT LI NL

RHK1 Main classification (correction)

Ipc: C12N 15/00

A4 Supplementary search report drawn up and despatched

Effective date: 19980602

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): BE CH DE FR GB IT LI NL

17Q First examination report despatched

Effective date: 19991102

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20000613