EP0759978A1 - Vehicule de neurotransmetteur - Google Patents

Vehicule de neurotransmetteur

Info

Publication number
EP0759978A1
EP0759978A1 EP94917383A EP94917383A EP0759978A1 EP 0759978 A1 EP0759978 A1 EP 0759978A1 EP 94917383 A EP94917383 A EP 94917383A EP 94917383 A EP94917383 A EP 94917383A EP 0759978 A1 EP0759978 A1 EP 0759978A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
ntt
polynucleotide
dna
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP94917383A
Other languages
German (de)
English (en)
Other versions
EP0759978A4 (fr
Inventor
Yi Li
Robert D. Fleischmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
Original Assignee
Human Genome Sciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc filed Critical Human Genome Sciences Inc
Publication of EP0759978A1 publication Critical patent/EP0759978A1/fr
Publication of EP0759978A4 publication Critical patent/EP0759978A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70571—Receptors; Cell surface antigens; Cell surface determinants for neuromediators, e.g. serotonin receptor, dopamine receptor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/04—Centrally acting analgesics, e.g. opioids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/20—Hypnotics; Sedatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/24—Antidepressants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/26—Psychostimulants, e.g. nicotine, cocaine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptide of the present invention is a neurotransmitter transporter and the polypeptide of the present invention is herein sometime referred to as "NTT" . The invention also relates to inhibiting the action of such polypeptides.
  • synaptic transmission An essential property of synaptic transmission is the rapid termination of action following neurotransmitter release.
  • neurotransmitters including catecholamines, serotonin, and certain amino acids (e.g., 7-aminobutyric acid (GABA), glutamate, and glycine)
  • GABA 7-aminobutyric acid
  • glutamate glutamate
  • glycine 7-aminobutyric acid
  • Inhibition or stimulation of neurotransmitter uptake provides a means for modulating the strength of the synaptic action by regulating the available levels of endogenous transmitters.
  • Neurotransmitter transporters are membrane-bound polypeptides which uptake neurotransmitters into the pre-synaptic neuron after the neurotransmitters have crossed the synaptic cleft and acted upon the post-synaptic neuron.
  • Neurotransmitters can be excitatory, such as glutamate, or inhibitory such as GABA.
  • Affinity neurotransmitter transport is thought to terminate the overall process of synaptic transmission (Iver ⁇ en, L.L., Br. J. Pharmacol. 41:571-591 (1971)). Recently, cDNAs encoding more than ten different neurotransmitter transporters have been cloned and seguenced. The family of these genes could be divided into three subfamilies, including the GABA and taurine transporters (Liu, Q.R., et al., Proc. Natl. Acad. Sci.
  • the amino acid sequence of each member is 60-80% identical to the other members within a subfamily and about 40% identical to members between the two subfamilies (Liu, Q.R., et al., Proc. Natl. Acad. Sci. USA, 89:6639-6643 (1992)).
  • Amino acid transporters such as the glycine transporter and proline transporter, share about 40-45% homology with all members of the neurotransmitter transporter ⁇ uperfamily. Sequence homology among the members of the neurotransmitter transporter family give clear indication that they evolved from a common ancestral gene. Moreover, partial genomic cloning of several neurotransmitter transporters reveal that in all of them the first intron in the reading frame is located in an identical position (id. ) .
  • a GABA A transporter was the first neurotransmitter system to be cloned and expressed (Guastella, J., et al., Science 249:1303-1306 (1990)) and is one of a family of neurotransmitter transporters cloned within the last year. Recently, a serotonin transporter cDNA has been disclosed in PCT WO 93/08261.
  • NTT novel mature polypeptide which is herein referred to as NTT, as well as fragments, analogs and derivatives thereof.
  • the polypeptide of the present invention is of human origin.
  • polynucleotides (DNA or RNA) which encode such polypeptides.
  • a process for producing such polypeptide by recombinant techniques there is provided.
  • agonists which increase the affinity of NTT for its substrate, and which may be used to treat Amyotrophic Lateral Sclerosis, pain and stroke.
  • antagonist/inhibitors which may be used to prevent the uptake of neurotransmitters by NTT, which may be used therapeutically, for example, in the treatment of depression, anxiety and epilepsy, as well as other neurologic or psychiatric disorders.
  • Figure 1 shows the cDNA sequence and corresponding deduced amino acid sequence of the mature NTT polypeptide.
  • the standard one-letter abbreviation for amino acids is used.
  • an isolated nucleic acid polynucleotide which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75713 on March 18, 1994.
  • the polynucleotide of this invention was discovered in a cDNA library derived from a human fetal brain. It is structurally related to the neurotransmitter transporter family. It contains an open reading frame encoding a protein of about 727 amino acid residues. The protein exhibits the highest degree of homology to a rat neurotransmitter transporter (NT74) with 94% identity and 96% similarity over the entire amino acid sequence.
  • NT74 rat neurotransmitter transporter
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 or that of the deposited clone or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same, mature polypeptide as the DNA of Figure 1 or the deposited cDNA.
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 or for the mature polypeptide encoded by the deposited cDNA may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 or the same mature polypeptide encoded by the cDNA of the deposited clone as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1 or the polypeptide encoded by the cDNA of the deposited clone.
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 or of the coding sequence of the deposited clone.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides .
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figure 1 or the deposited cDNA.
  • the deposit( ⁇ ) referred to herein will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organi ⁇ m ⁇ for purpo ⁇ e ⁇ of Patent Procedure. These deposit ⁇ are provided merely a ⁇ convenience to tho ⁇ e of ⁇ kill in the art and are not an admi ⁇ ion that a deposit is required under 35 U.S.C. ⁇ 112.
  • the sequence of the polynucleotides contained in the deposited materials, a ⁇ well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein.
  • a license may be required to make, u ⁇ e or ⁇ ell the depo ⁇ ited materials, and no ⁇ uch licen ⁇ e i ⁇ hereby granted.
  • the pre ⁇ ent invention further relate ⁇ to an NTT polypeptide which ha ⁇ the deduced amino acid ⁇ equence of Figure 1 or which has the amino acid sequence encoded by the deposited cDNA, as well a ⁇ fragments, analogs and derivative ⁇ of such polypeptide.
  • fragment when referring to the polypeptide of Figure 1 or that encoded by the deposited cDNA, mean ⁇ a polypeptide which retain ⁇ e ⁇ entially the ⁇ ame biological function or activity as such polypeptide.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • the polypeptide of the . present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of Figure 1 or that encoded by the deposited cDNA may be (i) one in which one or more of the amino acid residues are sub ⁇ tituted with a conserved or non-conserved amino acid re ⁇ idue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residue ⁇ includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acid ⁇ are fused to the mature polypeptide, such a ⁇ a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid re ⁇ idue preferably a conserved
  • polypeptide ⁇ and polynucleotide ⁇ of the pre ⁇ ent invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring) .
  • a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the ⁇ ame polynucleotide or polypeptide, separated from some or all of the coexisting material ⁇ in the natural ⁇ y ⁇ te , is i ⁇ olated.
  • Such polynucleotide ⁇ could be part of a vector and/or ⁇ uch polynucleotide ⁇ or polypeptide ⁇ could be part of a compo ⁇ ition, and still be isolated in that such vector or composition is not part of it ⁇ natural environment.
  • the pre ⁇ ent invention al ⁇ o relate ⁇ to vector ⁇ which include polynucleotide ⁇ of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant technique ⁇ .
  • Ho ⁇ t cell ⁇ are genetically engineered (tran ⁇ duced or tran ⁇ formed or tran ⁇ fected) with the vector ⁇ of thi ⁇ invention which may be, for example, a cloning vector or an expre ⁇ ion vector.
  • the vector may be, for example, in the form of a pla ⁇ mid, a viral particle, a phage, etc.
  • the engineered ho ⁇ t cell ⁇ can be cultured in conventional nutrient media modified a ⁇ appropriate for activating pro oter ⁇ , selecting transformant ⁇ or amplifying the NTT gene ⁇ .
  • the culture condition ⁇ such as temperature, pH and the like, are tho ⁇ e previously used with the host cell ⁇ elected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the pre ⁇ ent invention may be employed for producing polypeptide ⁇ by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expre ⁇ ing a polypeptide.
  • Such vector ⁇ include chromo ⁇ omal, nonchromo ⁇ omal and synthetic DNA ⁇ equence ⁇ , e.g., derivative ⁇ of SV40; bacterial pla ⁇ mid ⁇ ; phage DNA; baculovirus; yeast pla ⁇ mid ⁇ ; vector ⁇ derived from combination ⁇ of pla ⁇ mid ⁇ and phage DNA, viral DNA ⁇ uch a ⁇ vaccinia, adenoviru ⁇ , fowl pox virus, and pseudorabie ⁇ .
  • any other vector may be u ⁇ ed a ⁇ long a ⁇ it i ⁇ replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedure ⁇ .
  • the DNA sequence is in ⁇ erted into an appropriate re ⁇ triction endonuclea ⁇ e ⁇ ite( ⁇ ) by procedures known in the art. Such procedure ⁇ and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expres ⁇ ion vector is operatively linked to an appropriate expres ⁇ ion control sequence(s) (promoter) to direct mRNA ⁇ ynthesis.
  • expres ⁇ ion control sequence(s) promoter
  • a ⁇ representative example ⁇ of ⁇ uch promoter ⁇ there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp. the phage lambda P L promoter and other promoter ⁇ known to control expre ⁇ ion of gene ⁇ in prokaryotic or eukaryotic cells or their viru ⁇ e ⁇ .
  • the expre ⁇ ion vector al ⁇ o contain ⁇ a ribo ⁇ ome binding ⁇ ite for tran ⁇ lation initiation and a tran ⁇ cription terminator.
  • the vector may al ⁇ o include appropriate ⁇ equence ⁇ for amplifying expre ⁇ ion.
  • the expre ⁇ ion vector ⁇ preferably contain one or more ⁇ electable marker gene ⁇ to provide a phenotypic trait for ⁇ election of tran ⁇ formed ho ⁇ t cell ⁇ ⁇ uch a ⁇ dihydrofolate reducta ⁇ e or neomycin re ⁇ i ⁇ tance for eukaryotic cell culture, or ⁇ uch a ⁇ tetracycline or ampicillin re ⁇ i ⁇ tance in E. coli.
  • the vector containing the appropriate DNA ⁇ equence a ⁇ hereinabove described, a ⁇ well as an appropriate promoter or control sequence, may be employed to transform an appropriate ho ⁇ t to permit the host to expres ⁇ the protein.
  • a ⁇ repre ⁇ entative example ⁇ of appropriate ho ⁇ t ⁇ there may be mentioned: bacterial cell ⁇ , ⁇ uch a ⁇ E. coli. Streptomyce ⁇ . Salmonella typhimurium; fungal cell ⁇ , ⁇ uch a ⁇ yea ⁇ t; in ⁇ ect cells such as Drosophila and Sf9; animal cells such a ⁇ CHO, HEK 293, COS or Bowe ⁇ melanoma; plant cell ⁇ , etc.
  • the ⁇ election of an appropriate ho ⁇ t i ⁇ deemed to be within the ⁇ cope of tho ⁇ e ⁇ killed in the art from the teachings herein.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the con ⁇ truct further compri ⁇ e ⁇ regulatory ⁇ equence ⁇ , including, for example, a promoter, operably linked to the sequence.
  • suitable vectors and promoter ⁇ are known to tho ⁇ e of ⁇ kill in the art, and are commercially available.
  • the following vector ⁇ are provided by way of example.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pb ⁇ , pDIO, phage ⁇ cript, p ⁇ iX174, pblue ⁇ cript SK, pb ⁇ k ⁇ , pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia) .
  • any other pla ⁇ mid or vector may be u ⁇ ed a ⁇ long a ⁇ they are replicable and viable in the ho ⁇ t.
  • Promoter region ⁇ can be ⁇ elected from any desired gene using CAT (chloramphenicol tran ⁇ fera ⁇ e) vector ⁇ or other vector ⁇ with ⁇ electable marker ⁇ .
  • Two appropriate vector ⁇ are PKK232-8 and PCM7.
  • Particular named bacterial promoter ⁇ include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retroviru ⁇ , and mou ⁇ e metallothionein-I. Selection of the appropriate vector and promoter i ⁇ well within the level of ordinary ⁇ kill in the art.
  • the present invention relates to ho ⁇ t cell ⁇ containing the above-de ⁇ cribed constructs.
  • the ho ⁇ t cell can be a higher eukaryotic cell, ⁇ uch a ⁇ a mammalian cell, or a lower eukaryotic cell, ⁇ uch as a yea ⁇ t cell, or the ho ⁇ t cell can be a prokaryotic cell, ⁇ uch as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by, for example, calcium pho ⁇ phate tran ⁇ fection, DEAE-Dextran mediated transfection, or electroporation. (Davi ⁇ , L., Dibner, M. , Battey, I., Ba ⁇ ic Method ⁇ in Molecular Biology, (1986)).
  • the con ⁇ truct ⁇ in ho ⁇ t cell ⁇ can be u ⁇ ed in a conventional manner to produce the gene product encoded by the recombinant ⁇ equence.
  • the polypeptide ⁇ of the invention can be ⁇ ynthetically produced by conventional peptide ⁇ ynthe ⁇ izer ⁇ .
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cell ⁇ under the control of appropriate promoter ⁇ .
  • Cell-free tran ⁇ lation ⁇ ystems can al ⁇ o be employed to produce ⁇ uch protein ⁇ u ⁇ ing RNA ⁇ derived from the DNA con ⁇ truct ⁇ of the pre ⁇ ent invention.
  • Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic host ⁇ are de ⁇ cribed by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the di ⁇ clo ⁇ ure of which i ⁇ hereby incorporated by reference.
  • Enhancers are ci ⁇ -acting element ⁇ of DNA, u ⁇ ually about from 10 to 300 bp that act on a promoter to increa ⁇ e it ⁇ transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late ⁇ ide of the replication origin, and adenoviru ⁇ enhancer ⁇ .
  • recombinant expre ⁇ ion vector ⁇ will include origin ⁇ of replication and ⁇ electable marker ⁇ permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • Such promoter ⁇ can be derived from operon ⁇ encoding glycolytic enzyme ⁇ ⁇ uch a ⁇ 3- pho ⁇ phoglycerate kina ⁇ e (PGK), ⁇ -factor, acid pho ⁇ phata ⁇ e, or heat shock proteins, among others.
  • the heterologou ⁇ ⁇ equence can encode a fusion protein including an N-terminal identification peptide imparting de ⁇ ired character- i ⁇ tic ⁇ , e.g., stabilization or simplified purification of expres ⁇ ed recombinant product.
  • Useful expression vectors for bacterial use are constructed by in ⁇ erting a ⁇ tructural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic ho ⁇ t ⁇ for tran ⁇ formation include E. coli.
  • useful expression vectors for bacterial u ⁇ e can compri ⁇ e a ⁇ electable marker and bacterial origin of replication derived from commercially available pla ⁇ mid ⁇ compri ⁇ ing genetic element ⁇ of the well known cloning vector pBR322 (ATCC 37017).
  • Such commercial vector ⁇ include, for example, pKK223-3 (Pharmacia Fine Chemicals, Upp ⁇ ala, Sweden) and GEM1 (Promega Biotec, Madi ⁇ on, WI, USA).
  • the ⁇ e pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the ⁇ elected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cell ⁇ are cultured for an additional period.
  • Microbial cell ⁇ employed in expre ⁇ ion of protein ⁇ can be di ⁇ rupted by any convenient method, including freeze-thaw cycling, ⁇ onication, mechanical di ⁇ ruption, or u ⁇ e of cell lysing agents, such methods are well know to those ⁇ killed in the art.
  • Variou ⁇ mammalian cell culture systems can also be employed to expres ⁇ recombinant protein.
  • mammalian expression ⁇ y ⁇ tem ⁇ include the COS-7 line ⁇ of monkey kidney fibrobla ⁇ t ⁇ , de ⁇ cribed by Gluzman, Cell, 23:175 (1981), and other cell line ⁇ capable of expre ⁇ ing a compatible vector, for example, the C127, 3T3, CHO, HEK 293, HeLa and BHK cell line ⁇ .
  • Mammalian expre ⁇ ion vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequence ⁇ , and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic element ⁇ .
  • the NTT polypeptide ⁇ can be recovered and purified from recombinant cell culture ⁇ by method ⁇ including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxylapatite chromatography and lectin chromatography. Protein refolding ⁇ tep ⁇ can be used, a ⁇ nece ⁇ sary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • the polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedure ⁇ , or produced by recombinant technique ⁇ from a prokaryotic or eukaryotic ho ⁇ t (for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture).
  • a prokaryotic or eukaryotic ho ⁇ t for example, by bacterial, yea ⁇ t, higher plant, in ⁇ ect and mammalian cell ⁇ in culture.
  • the polypeptides of the present invention may be glyco ⁇ ylated or may be non-glyco ⁇ ylated.
  • Polypeptide ⁇ of the invention may al ⁇ o include an initial methionine amino acid re ⁇ idue.
  • the pre ⁇ ent invention al ⁇ o provide ⁇ a method for identifying neurotransmitters which interact with the NTT polypeptides of the pre ⁇ ent invention.
  • the method for determining whether a neurotransmitter is translocated from the synaptic cleft into the pre-synaptic neuron by NTT comprise ⁇ tran ⁇ fecting a cell population with the appropriate vector expre ⁇ ing the NTT ⁇ uch that the cell will now expre ⁇ NTT.
  • Variou ⁇ neurotran ⁇ mitter ⁇ are then radio-labelled, e.g., tritiated, and incubated with the transfected cell to identify which neurotransmitter ⁇ are tran ⁇ ported into the cell.
  • a neurotran ⁇ mitter i ⁇ identified compound ⁇ can be ⁇ creened to identify tho ⁇ e which ⁇ pecifically interact with NTT and either increa ⁇ e NTT' ⁇ affinity to uptake its neurotransmitter, e.g., an agonist, or decrease its ability to uptake a neurotransmitter, e.g., an antagonist/inhibitor.
  • This method comprise ⁇ tran ⁇ forming ho ⁇ t cell ⁇ with a vector of the present invention such that the NTT polypeptide i ⁇ expre ⁇ ed in that ho ⁇ t, incubating the ho ⁇ t cell ⁇ with the natural neurotran ⁇ mitter of NTT which ha ⁇ been labelled by a detectable marker sequence (e.g., radiolabel or a non-isotopic label such as biotin) and the potential compound and determining whether tran ⁇ location of the neurotran ⁇ mitter into the cell i ⁇ either inhibited or increased.
  • a detectable marker sequence e.g., radiolabel or a non-isotopic label such as biotin
  • excitatory or inhibitory neurotransmitter ⁇ have important clinical ⁇ ignificance.
  • glutamate i ⁇ an excitatory neurotran ⁇ mitter and it ⁇ presence in the synaptic cleft can be toxic to neurons. This neuronal toxicity has been found to play a significant role in Amyotrophic Lateral Sclerosis or "ALS".
  • ALS Amyotrophic Lateral Sclerosis
  • glutamate is released into the synaptic cleft and are toxic to neuronal cell ⁇ .
  • an agonist of NTT may be employed to stimulate the uptake of neurotransmitters and therefore alleviate these above-mentioned conditions.
  • the NTT polypeptides of the present invention may be administered by expres ⁇ ion of ⁇ uch polypeptides in vivo , which is often referred to as "gene therapy.”
  • Gene therapy is similar to the application of an NTT agonist, however, in gene therapy a polynucleotide of the present invention is administered such that the cellular machinery of the host expre ⁇ ses the NTT of the pre ⁇ ent invention to facilitate uptake of neurotransmitters where that is desired, for example in ALS, stroke and general pain.
  • cell ⁇ from a patient may be engineered with a polynucleotide . (DNA or RNA) encoding a polypeptide ex vivo , with the engineered cells then being targeted to the neuronal cells of a patient where expre ⁇ ion of NTT and tran ⁇ location of neurotran ⁇ mitters are desired.
  • a polynucleotide DNA or RNA
  • cell ⁇ may be engineered by procedure ⁇ known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expre ⁇ ion of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cell ⁇ in vivo and expression of the polypeptide in vivo .
  • the expres ⁇ ion vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • the present invention is also directed to antagonist/inhibitors of the polypeptides of the present invention, in addition to tho ⁇ e identified by utilizing the above-de ⁇ cribed ⁇ creening method.
  • Antagoni ⁇ t ⁇ include an antibody again ⁇ t the NTT polypeptide or, in some case ⁇ , an oligonucleotide which bind to the NTT making it inacce ⁇ ible to it ⁇ natural neurotran ⁇ mitter allowing the concentration of the neurotran ⁇ mitter in the ⁇ ynaptic cleft to increa ⁇ e.
  • Inhibitor ⁇ include anti ⁇ en ⁇ e construct ⁇ prepared u ⁇ ing antisen ⁇ e technology.
  • Anti ⁇ en ⁇ e technology can be u ⁇ ed to control gene expre ⁇ ion through triple-helix formation or antisen ⁇ e DNA or RNA, both of which methods are ba ⁇ ed on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide ⁇ equence which encode ⁇ the mature polypeptide ⁇ of the present invention, i ⁇ u ⁇ ed to de ⁇ ign an antisen ⁇ e RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is de ⁇ igned to be complementary to a region of the gene involved in tran ⁇ cription (triple helix - see Lee et al. , Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al. , Science, 251: 1360 (1991)), thereby preventing tran ⁇ cription and the production of NTT.
  • the antisen ⁇ e RNA oligonucleotide hybridize ⁇ to the mRNA in vivo and block ⁇ tran ⁇ lation of the mRNA molecule into the NTT (anti ⁇ en ⁇ e - Okano, J. Neurochem.
  • oligonucleotides described above can al ⁇ o be delivered to cell ⁇ ⁇ uch that the anti ⁇ en ⁇ e RNA or DNA may be expre ⁇ ed in vivo to inhibit production of NTT.
  • the antagonist/inhibitors may be u ⁇ ed to treat depre ⁇ sion, anxiety, epilepsy and other neurological and psychiatric disorder ⁇ .
  • Defect ⁇ in neurotran ⁇ mitter tran ⁇ port systems result in increased or decreased concentrations of neurotran ⁇ mitter in the ⁇ ynaptic cleft, re ⁇ ulting in improperly stimulated receptors.
  • depression is a ⁇ ociated with decrea ⁇ ed relea ⁇ e of norepinephrine and/or serotonin in the brain. Therefore, inhibiting NTT from translocating its neurotran ⁇ mitter into the pre ⁇ ynaptic neuron would allow these neurotransmitters to interact more frequently with their receptors.
  • administration of the antagoni ⁇ t/inhibitor ⁇ may be employed to alleviate the condition ⁇ mentioned above.
  • the antagoni ⁇ t/inhibitor ⁇ may be employed in a compo ⁇ ition with a pharmaceutically acceptable carrier.
  • the pre ⁇ ent invention al ⁇ o relate ⁇ to an assay for identifying potential antagonist/inhibitor ⁇ ⁇ pecific to NTT.
  • An example of such an as ⁇ ay compri ⁇ e ⁇ preparing a synaptosomal preparation from the hypothalamu ⁇ of a mammal. Such a preparation i ⁇ a " ⁇ ealed" neuron where the end of the neuron i ⁇ pinched off. The ⁇ ynaptosomal preparation is then incubated with tritiated neurotran ⁇ mitter and a potential antagonist. The degree of uptake of neurotransmitter is then mea ⁇ ured to determine if the antagoni ⁇ t i ⁇ effective.
  • compositions e.g., agonist or antagonist/inhibitor compound ⁇ , of the present invention, may be employed in combination with a suitable pharmaceutical carrier.
  • a suitable pharmaceutical carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier include ⁇ but i ⁇ not limited to ⁇ aline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredient ⁇ of the pharmaceutical compo ⁇ ition ⁇ of the invention.
  • a ⁇ ociated with ⁇ uch container( ⁇ ) can be a notice in the form pre ⁇ cribed by a governmental agency regulating the manufacture, u ⁇ e or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
  • compositions may be administered in an effective amount to effectively increase the affinity of NTT for it ⁇ neurotran ⁇ mitter or inhibit NTT from translocating its neurotransmitter, and thereby alleviate the abnormal conditions as ⁇ ociated with exce ⁇ concentration ⁇ of neurotran ⁇ mitter in the ⁇ ynaptic cleft or concentration ⁇ of neurotransmitter which are too low, as the case may be.
  • the sequence ⁇ of the pre ⁇ ent invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromo ⁇ ome.
  • Few chromo ⁇ ome marking reagent ⁇ ba ⁇ ed on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromo ⁇ ome ⁇ according to the pre ⁇ ent invention i ⁇ an important first ⁇ tep in correlating tho ⁇ e ⁇ equences with genes associated with disease.
  • sequence ⁇ can be mapped to chromo ⁇ ome ⁇ by preparing PCR primer ⁇ (preferably 15-25 bp) from the cDNA.
  • the ⁇ e primer ⁇ are then u ⁇ ed for PCR ⁇ creening of somatic cell hybrids containing individual human chromo ⁇ ome ⁇ . Only those hybrid ⁇ containing the human gene corre ⁇ ponding to the primer will yield an amplified fragment.
  • mapping of somatic cell hybrids is a rapid procedure for as ⁇ igning a particular DNA to a particular chromosome.
  • sublocalization can be achieved with panels of fragments from specific chromosome ⁇ or pool ⁇ of large genomic clones in an analogous manner.
  • Other mapping strategie ⁇ that can ⁇ imilarly be u ⁇ ed to map to it ⁇ chromo ⁇ ome include in situ hybridization, pre ⁇ creening with labeled flow- ⁇ orted chromo ⁇ ome ⁇ and pre ⁇ election by hybridization to con ⁇ truct chromo ⁇ ome ⁇ pecific-cDNA librarie ⁇ .
  • Fluore ⁇ cence in situ hybridization (FISH) of a cDNA clone ⁇ to a metapha ⁇ e chromo ⁇ omal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be u ⁇ ed with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • FISH requires u ⁇ e of the clone ⁇ from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good result ⁇ a rea ⁇ onable percentage of the time.
  • thi ⁇ technique see Verma et al., Human Chromosomes: a Manual of Basic Technique ⁇ , Perga on Press, New York (1988).
  • the phy ⁇ ical position of the sequence on the chromosome can be correlated with genetic map data.
  • genetic map data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through John ⁇ Hopkin ⁇ Univer ⁇ ity Welch Medical Library) .
  • the relationship between genes and di ⁇ ease ⁇ that have been mapped to the same chromosomal region are then identified through linkage analysi ⁇ (coinheritance of physically adjacent genes).
  • a cDNA preci ⁇ ely localized to a chromosomal region as ⁇ ociated with the di ⁇ ea ⁇ e could be one of between 50 and 500 potential causative genes. (This a ⁇ ume ⁇ 1 megaba ⁇ e mapping re ⁇ olution and one gene per 20 kb) .
  • Compari ⁇ on of affected and unaffected individual ⁇ generally involves first looking for ⁇ tructural alteration ⁇ in the chromo ⁇ ome ⁇ , ⁇ uch a ⁇ deletion ⁇ or translocations that are visible from chromosome ⁇ pread ⁇ or detectable u ⁇ ing PCR based on that cDNA sequence. Ultimately, complete sequencing of genes from several individuals is required to confirm the presence of a mutation and to distingui ⁇ h mutations from polymorphisms.
  • the polypeptide ⁇ , their fragment ⁇ or other derivative ⁇ , or analogs thereof, or cell ⁇ expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the pre ⁇ ent invention al ⁇ o include ⁇ chimeric, ⁇ ingle chain, and humanized antibodie ⁇ , a ⁇ well a ⁇ Fab fragments, or the product of an Fab expre ⁇ ion library. Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodie ⁇ generated again ⁇ t the polypeptide ⁇ corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptide ⁇ into an animal or by admini ⁇ tering the polypeptide ⁇ to an animal, preferably a nonhuman.
  • the antibody ⁇ o obtained will then bind the polypeptide ⁇ it ⁇ elf.
  • Such antibodie ⁇ can then be u ⁇ ed to i ⁇ olate the polypeptide from tissue expressing that polypeptide.
  • Example ⁇ include the hybridoma technique (Kohler and Mil ⁇ tein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodie ⁇ (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Lis ⁇ , Inc., pp. 77-96) .
  • “Plasmids” are designated by a lower case p preceded and/or followed by capital letters and/or number ⁇ .
  • the starting pla ⁇ mid ⁇ herein are either commercially available, publicly available on an unre ⁇ tricted ba ⁇ i ⁇ , or can be con ⁇ tructed from available pla ⁇ mid ⁇ in accord with published procedure ⁇ .
  • equivalent pla ⁇ mid ⁇ to those described are known in the art and will be apparent to the ordinarily skilled arti ⁇ an.
  • “Digestion” of DNA refer ⁇ to catalytic cleavage of the DNA with a re ⁇ triction enzyme that act ⁇ only at certain ⁇ equence ⁇ in the DNA.
  • the various re ⁇ triction enzyme ⁇ u ⁇ ed herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan.
  • analytical purpo ⁇ es typically 1 ⁇ g of plasmid or DNA fragment i ⁇ u ⁇ ed with about 2 unit ⁇ of enzyme in about 20 ⁇ l of buffer solution.
  • isolating DNA fragments for plasmid con ⁇ truction typically 5 to 50 ⁇ g of DNA are dige ⁇ ted with 20 to 250 unit ⁇ of enzyme in a larger volume.
  • buffers and sub ⁇ trate amount ⁇ for particular re ⁇ triction enzymes are specified by the manufacturer.
  • Incubation time ⁇ of about 1 hour at 37°C are ordinarily u ⁇ ed, but may vary in accordance with the supplier's in ⁇ truction ⁇ .
  • After dige ⁇ tion the reaction i ⁇ electrophore ⁇ ed directly on a polyacrylamide gel to i ⁇ olate the de ⁇ ired fragment.
  • Oligonucleotides refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strand ⁇ which may be chemically synthesized. Such synthetic oligonucleotide ⁇ have no 5' pho ⁇ phate and thu ⁇ will not ligate to another oligonucleotide without adding a phosphate with an ATP in the pre ⁇ ence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodie ⁇ ter bonds between two double stranded nucleic acid fragment ⁇ (Maniatis, T., et al.. Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to T4 DNA ligase ("ligase”) per 0.5 ⁇ g of approximately equimolar amount ⁇ of the DNA fragment ⁇ to be ligated.
  • ligase T4 DNA ligase
  • the DNA ⁇ equence encoding for NTT ATCC # 75713 i ⁇ initially amplified u ⁇ ing PCR oligonucleotide primer ⁇ corre ⁇ ponding to the 5' and ⁇ equence ⁇ of the proce ⁇ ed NTT protein (minus the signal peptide ⁇ equence) and the vector ⁇ equence ⁇ 3' to the NTT gene. Additional nucleotide ⁇ corre ⁇ ponding to NTT were added to the 5' and 3' ⁇ equence ⁇ re ⁇ pectively.
  • the 5' oligonucleotide primer ha ⁇ the ⁇ equence GACTAAAGCTTGGCATCAATGCCGAAGAAC contain ⁇ a Hind III restriction enzyme site followed by 18 nucleotide ⁇ of NTT coding ⁇ equence.
  • the 3' sequence GAACTTCTAGAGCAGTGGTCACAGCTCAG contains complementary sequences to Xba I site and i ⁇ followed by 18 nucleotide ⁇ of NTT ⁇ equence.
  • the restriction enzyme sites correspond to the re ⁇ triction enzyme ⁇ ites on the bacterial expre ⁇ ion vector pQE-9. (Qiagen, Inc. 9259 Eton Avenue, Chat ⁇ worth, CA, 91311).
  • pQE-9 encode ⁇ antibiotic re ⁇ istance (Amp r ) , a bacterial origin of replication (ori), an IPTG- regulatable promoter operator (P/O), a ribo ⁇ ome binding ⁇ ite (RBS), a 6-Hi ⁇ tag and re ⁇ triction enzyme sites.
  • pQE-9 was then dige ⁇ ted with Hind III and Xba I.
  • the amplified ⁇ equence ⁇ were ligated into pQE-9 and were in ⁇ erted in frame with the ⁇ equence encoding for the hi ⁇ tidine tag and the RBS.
  • the ligation mixture wa ⁇ then u ⁇ ed to tran ⁇ form E.
  • M15/rep4 available from Qiagen under the trademark M15/rep 4 by the procedure de ⁇ cribed in Sambrook, J. et al.. Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Pre ⁇ , (1989). M15/rep4 contain ⁇ multiple copie ⁇ of the pla ⁇ mid pREP4, which expre ⁇ e ⁇ the lad repre ⁇ or and also confers kanamycin resi ⁇ tance (Kan r ) . Tran ⁇ formant ⁇ are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Pla ⁇ mid DNA wa ⁇ i ⁇ olated and confirmed by re ⁇ triction analysis.
  • Clones containing the desired construct ⁇ were grown overnight (0/N) in liquid culture in LB media ⁇ upplemented with both Amp (100 ug/ml) and Kan (25 ug/ml).
  • the O/N culture i ⁇ u ⁇ ed to inoculate a large culture at a ratio of 1:100 to 1:250.
  • the cell ⁇ were grown to an optical den ⁇ ity 600 (O.D. 600 ) of between 0.4 and 0.6.
  • IPTG "I ⁇ opropyl-B-D- thiogalacto pyranoside" wa ⁇ then added to a final concentration of 1 mM. IPTG induce ⁇ by inactivating the lad repre ⁇ or, clearing the P/0 leading to increased gene expre ⁇ ion.
  • NTT wa ⁇ eluted from the column in 6 molar guanidine HCI pH 5.0 and for the purpo ⁇ e of renaturation adjusted to 3 molar guanidine HCI, lOOmM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in thi ⁇ solution for 12 hour ⁇ the protein wa ⁇ dialyzed to 10 mmolar ⁇ odium pho ⁇ phate.
  • the expre ⁇ sion of plasmid, NTT HA is derived from a vector pcDNAl/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resi ⁇ tance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation ⁇ ite.
  • the HA tag correspond to an epitope derived from the influenza hemagglutinin protein a ⁇ previou ⁇ ly de ⁇ cribed (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767).
  • the infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
  • the plasmid con ⁇ truction ⁇ trategy is described as follows:
  • the DNA sequence encoding for NTT was constructed by PCR on the original EST cloned using two primers: the 5' primer GACTAAGATCTGCCACCATGCCGAAGAACAGCAAAGTG contains a Bgl II site followed by 21 nucleotides of NTT coding ⁇ equence starting from the initiation codon; the 3' sequence GAACTGATATCGCAGTGGTCACAGCTCAG contains complementary sequence ⁇ to EcoR V site, tran ⁇ lation ⁇ top codon, and the last 18 nucleotides of the NTT coding sequence. Therefore, the PCR product contains a Bgl II site, NTT coding sequence followed by a tran ⁇ lation termination ⁇ top codon, and an EcoR V site.
  • the ligation mixture was tran ⁇ formed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonie ⁇ were ⁇ elected. Pla ⁇ mid DNA was isolated from transformant ⁇ and examined by re ⁇ triction analysis for the presence of the correct fragment.
  • RNAzolTM B sy ⁇ tem Biotecx Labora- torie ⁇ . Inc. 6023 South Loop Ea ⁇ t, Houston, TX 77033.
  • the labeled DNA wa ⁇ purified with a Select-G-50 column. (5 Prime - 3 Prime, Inc. 5603 Arapahoe Road, Boulder, CO 80303).
  • the filter wa ⁇ then hybridized with radioactive labeled full length MIP-2 gene at 1,000,000 cpm/ml in 0.5 M NaP0 4 , pH 7.4 and 7% SDS overnight at 65°C.
  • the filter wa ⁇ After wa ⁇ h twice at room temperature and twice at 60"C with 0.5 x SSC, 0.1% SDS, the filter wa ⁇ then expo ⁇ ed at -70°C overnight with an inten ⁇ ifying ⁇ creen.
  • ADDRESSEE CARELLA, BYRNE, BAIN, GILFILLAN,
  • CCGTGTCCTA CAAGAAGGCC CGCATGATGA AGGACATCTC CAACCTGGAG GAGAACGATG 2280
  • a ⁇ p A ⁇ n Val lie Met Thr Val Ly ⁇ Glu A ⁇ p Gin Phe Ser Ala Leu

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Neurology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Psychiatry (AREA)
  • Pain & Pain Management (AREA)
  • Biophysics (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Anesthesiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cardiology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne une protéine véhicule de neurotransmetteur et l'ADN (ARN) codant ladite protéine. Elle concerne également un procédé de production de polypeptide au moyen de techniques recombinantes. Elle concerne encore le procédé de production d'antagonistes/inhibiteurs contre ledit polypeptide. On peut utiliser ces antagonistes/inhibiteurs, afin d'inhiber l'action de la protéine véhicule de neurotranmetteur dans le traitement de la dépression, de l'anxiété ou de l'épilepsie.
EP94917383A 1994-05-16 1994-05-16 Vehicule de neurotransmetteur Withdrawn EP0759978A4 (fr)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US1994/005363 WO1995031539A1 (fr) 1994-05-16 1994-05-16 Vehicule de neurotransmetteur

Publications (2)

Publication Number Publication Date
EP0759978A1 true EP0759978A1 (fr) 1997-03-05
EP0759978A4 EP0759978A4 (fr) 1997-12-29

Family

ID=22242563

Family Applications (1)

Application Number Title Priority Date Filing Date
EP94917383A Withdrawn EP0759978A4 (fr) 1994-05-16 1994-05-16 Vehicule de neurotransmetteur

Country Status (4)

Country Link
EP (1) EP0759978A4 (fr)
JP (1) JPH10500299A (fr)
AU (1) AU6912594A (fr)
WO (1) WO1995031539A1 (fr)

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6084084A (en) * 1996-02-21 2000-07-04 Nps Pharmaceuticals, Inc. Human metabotropic glutamate receptor
EP0881290A3 (fr) * 1997-05-27 1999-12-22 Smithkline Beecham Plc Véhicule de neurotransmetteur
WO2001019854A2 (fr) * 1999-09-15 2001-03-22 Smithkline Beecham P.L.C. Nouveaux composes
CN1307007A (zh) * 2000-01-21 2001-08-08 上海博道基因技术有限公司 一种新的多肽——人钠－神经传递素协同转运蛋白8,43和编码这种多肽的多核苷酸
GB2365432A (en) * 2000-05-19 2002-02-20 Glaxo Group Ltd Neurotransmitter transporter polypeptide
US20020031800A1 (en) * 2000-09-05 2002-03-14 Zhenya Li Isolated human transporter proteins, nucleic acid molecules encoding human transporter proteins, and uses thereof
AU2001293863A1 (en) * 2000-10-05 2002-04-15 Bayer Aktiengesellschaft Regulation of human sodium-dependent monoamine transporter
WO2002029048A2 (fr) * 2000-10-05 2002-04-11 Bayer Aktiengesellschaft Regulation du transporteur du neurotransmetteur humain induit par le sodium
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ADAMS, M. D. ET AL.: "Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence" NATURE, vol. 377, no. supplement, 28 September 1995, page 3-17 XP002042918 *
See also references of WO9531539A1 *

Also Published As

Publication number Publication date
WO1995031539A1 (fr) 1995-11-23
JPH10500299A (ja) 1998-01-13
AU6912594A (en) 1995-12-05
EP0759978A4 (fr) 1997-12-29

Similar Documents

Publication Publication Date Title
AU696764C (en) Vascular endothelial growth factor 2
EP0822984A1 (fr) Recepteurs du facteur de necrose tumorale chez l'homme
EP0735818A1 (fr) PROTEINES-3, -4 ET 1 Sg(g) INFLAMMATOIRES MACROPHAGES
EP0763045A1 (fr) Facteur de maturation hematopoietique
WO1996039515A9 (fr) Facteur de croissance endotheliale vasculaire 2 humain
WO1995024466A1 (fr) Facteur transformant de croissance alpha h1
EP0792278A1 (fr) Polypeptide gamma appartenant a la famille des facteurs de necrose tumorale (fnt)
WO1996013603A1 (fr) PROTEASE-3 ET 4 D'APOPTOSE DE TYPE ENZYME DE CONVERSION D'INTERLEUKINE-1 $g(b)
WO1995024414A1 (fr) Facteur-10 de croissance du fibroblaste
WO1996028546A1 (fr) Recepteur humain du facteur de necrose tumorale
WO1996001896A1 (fr) Facteur-2 de croissance des tissus conjonctifs
EP0770086A1 (fr) Facteur-3 inhibiteur de la migration des macrophages
EP0759978A1 (fr) Vehicule de neurotransmetteur
EP0750626A1 (fr) Proteines des corpuscules de stannius, la stanniocalcine
EP0770141A1 (fr) PROTEASE-1 ET 2 D'APOPTOSE DE TYPE ENZYME DE CONVERSION D'INTERLEUKINE-1 $g(b)
EP0764204A1 (fr) OXALYL-CoA DECARBOXYLASE HUMAINE
WO1995024474A1 (fr) Proteine 10 osseuse morphogenique
WO1995031537A9 (fr) OXALYL-CoA DECARBOXYLASE HUMAINE
US5759854A (en) Neurotransmitter transporter
EP0783510A1 (fr) Proteines humaines 1 et 2 des canaux potassiques
WO1996006862A1 (fr) Sous-unite epsilon de recepteur gaba¿a?
EP0787149A1 (fr) POLYNUCLEOTIDE CODANT UN RECEPTEUR C5a
AU684539C (en) Macrophage inflammatory proteins-3, -4 and -1 Gamma
WO1996011259A1 (fr) ACTIVINE 1 ET ACTIVINE 3, DE LA FAMILLE DES RECEPTEURS DU FACTEUR TRANSFORMANT DE CROISSANCE TGF-β1
WO1996015222A1 (fr) MutT2 HUMAIN

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19961212

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): BE CH DE FR GB IT LI NL

RHK1 Main classification (correction)

Ipc: C12N 15/00

A4 Supplementary search report drawn up and despatched

Effective date: 19971107

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): BE CH DE FR GB IT LI NL

17Q First examination report despatched

Effective date: 20000825

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20011201