EP0754195A1

EP0754195A1 - Btf2 complex proteins and uses thereof

Info

Publication number: EP0754195A1
Application number: EP95918639A
Authority: EP
Inventors: Jean-Marc Egly; Sandrine Humbert; Vincent Moncollin
Original assignee: Association Pour Le Developpement de la Recherche En Genetique Moluculaire (aderegem)
Current assignee: Association Pour Le Developpement de la Recherche En Genetique Moluculaire (aderegem)
Priority date: 1994-04-25
Filing date: 1995-04-25
Publication date: 1997-01-22
Also published as: WO1995029245A2; FR2720748B1; WO1995029245A3; FR2720748A1

Abstract

BTF2 complex proteins, particularly proteins p44 and p34, and the use thereof for diagnosing DNA repair process deficiencies, are disclosed.

Description

_P R _O TEINS OF THE BTF7 COMPLEX AND THEIR APPLICATIONS

The present invention relates to new proteins, their preparation process and their use in the field of biology, in particular in the diagnosis of disorders in the DNA repair system.

More particularly, the present invention relates to two proteins which constitute subunits of the human transcription factor BTF2 (TFIIH).

BTF2 / TFIIH is an essential class II transcription factor which has been shown to play a role in nucleotide repair / excision (NER) (Schaeffer et al., 1993). This factor participates in the formation of complexes, pre-initiation, transcription which include TFIIA, TFIID, TFIIB, TFIIE and TFIIF as basic transcription factors and TARN polymerase II (B) on a minimal promoter (containing the TATA box and the site cap) (Conaway and Conaway, 1991; Zawel and Reinberg, 1992). BTF2, along with its rat factor δ counterpart and yeast factor b, is necessary for the in vitro transcription of most protein-coding genes. Little is known about the role of BTF2 in the transcription reaction, with the exception of a kinase activity which is capable of phosphorylating the carboxy-terminal domain (CTD) of the large TARN polymerase II subunit and a DNA-dependent ATPase activity which has been found in association with BTF2 and its counterparts in rats and yeast (Bunick et al., 1 82; Sawadogo and Roeder, 1984; Conaway and Conaway, 1988; Feaver et al., 1991; Dahmus and Dynan, 1992; Lu et al., 1992; Serizawa et al., 1992).

The role of BTF2 in NER was recently suggested when one of the subunits (the 89 kd polypeptide; p89) was identified as the product of the ERCC3 gene, a helicase believed to be associated with the repair of DNA (Weeda et al., 1990; Schaeffer et al., 1993; van Vuuren et al., 194). Mutations in this gene confer sensitivity to solar radiation (UV) and a predisposition to skin cancer manifested by a group B xeroderma pigmentosum (XP-B), a severe form of deficient repair syndrome, which also presents clinical symptoms of another DNA repair disorder, Cockayne syndrome. Experiments using both in vivo micro-injection repair tests and an in vitro NER system using cell-free extracts (Wood et al., 1988), confirmed that p89 / ERCC3, a subunit of BTF2, was directly involved in the repair / excision reaction (van Vuuren et al., 1994). More recent results show that ERCC2 (an 80 kD polypeptide) is also associated with the BTF2 complex, although, it seems, less closely than for p89.

The present invention relates more particularly to two new proteins called p34 and p44 and which constitute subunits of the BTF2 complex.

More particularly, the present invention relates to proteins characterized in that they comprise all or part of the sequence of the p44 protein or of the p34 protein as represented in FIG. 1 for p34 and in FIG. 2 for p44, the variants of these proteins having at least one epitope recognized by an anti-p44 or anti-p34 antibody according to FIG. 1 or FIG. 2.

Preferably, the proteins comprise the entire sequence of p44 or p34, they may then be hybrid proteins although the proteins themselves are more particularly advantageous. Among the deleted variants, mention should be made in particular of proteins having more than 80% of the sequences of p34 or p44.

The above definition relates, of course, to hybrid proteins which would only comprise one of the epitopes of the p44 or p34 proteins or else deleted proteins which would only comprise one epitope.

The present invention also relates to the DNA sequences coding for said proteins, whether they are proteins themselves or variant proteins mentioned above.

These DNA sequences can be both genomic sequences and cDNAs.

Finally, the present invention relates to the antibodies directed against one of the proteins mentioned above, in particular the anti-p34 and anti-p44 antibodies.

As previously mentioned, and as will be demonstrated below, these proteins are involved in the complex of DNA repair, their absence or a possible incorrect structure of these proteins can lead to the development of cancerous processes, in particular cutaneous melanomas but also xeroderms as well as Cockayne syndromes. This is why the present invention relates to a method for diagnosing deficiencies in the process of DNA repair in humans, characterized in that in vitro measurement in a biological sample the level of p34 and / or p44 or their corresponding epitopes and that a lowering of the level of p34 or p44 or of the corresponding epitopes is detected in particular compared to the normal level.

The diagnostic method includes a protein assay according to known processes, for example by ELISA type technologies using anti-p34 or anti-p44 monoclonal or polyclonal antibodies, as will be described below. An abnormal level of p34 and / or p44 may also be an indication of other disorders, in particular at the level of skin pigmentation or sensitivity to certain radiations.

The invention also relates to a diagnostic kit, in particular for implementing the method according to the invention, characterized in that it comprises at least: a monoclonal or polyclonal antibody corresponding to a protein as described above, and a protein as previously described.

The present invention also relates to a method for diagnosing a deficiency in the DNA repair process in humans, characterized in that the absence of a normal DNA sequence coding for p34 and / or is detected. p44 or the presence of an abnormal sequence of the same DNA.

The detection of a DNA sequence can be carried out by any known process, whether it is a process using probes specific for the normal sequence or else a sequence specific for the presence of a sequence abnormal, or methods using amplification processes, PCR for example, highlighting the presence of one of the two sequences using corresponding primers according to technologies which are now well known to those skilled in the art.

The present invention also relates to the use of these DNA sequences, either alone in the form of naked DNA, or included in a vector comprising the elements ensuring the expression of the coding sequences and capable of expressing the proteins mentioned above. This vector, which can be of any type, plasmid, self-replicating or integrative, in particular of viral type or not, in particular of adenovirus type, defective retrovirus, Herpes virus for example, or synthetic viruses capable, by injection, of expressing proteins p34 and / or p44 of correct structure within the cells, or else to replace by integration in order to provide the correct protein information.

This is why these sequences and vectors can be used as medicaments.

The present invention also relates to transformed cells capable of overexpressing the p34 or p44 proteins or their variants as described above, which cells can be used for the production of proteins by culture in an appropriate medium and recovery of the protein, and / or in order to be reimplanted for the production of said proteins in vivo, in particular as a medicament.

The proteins themselves can be used in the context of replacement therapy, possibly in combination with the other proteins of the BTF2 complex.

Although the present proteins as well as their DNA sequences are more particularly interesting in the detection of precancerous states or cancer risks, as well as in possible anticancer therapies, it should be understood that these proteins are involved, in the same way that the other proteins of the BTF2 complex, in the general process of DNA repair, that their use can be beneficial in very diverse pathologies, even in certain cases associated with processes in which the vital processes are not involved. Other characteristics and advantages of the present invention will appear on reading the examples below which will be made with reference to Figures 1 and 2.

Figure 1 shows schematically the amino acid structure of the protein p34 according to the invention as well as the corresponding DNA sequence.

Figure 2 shows schematically the amino acid structure of the p44 protein according to the invention as well as the corresponding DNA sequence.

MATERIALS AND METHODS

Isolation and sequencing of cDNA clones

The techniques used for the microsequencing of the p34 and p44 polypeptides, the screening of the cDNA library originating from Hela and constructed in λZAP-II vectors (Stratagene) and the sequencing of positive clones have been described in Sambrook et al., (1989 ). The 1.2 kb cDNA corresponding to p44 was obtained by PCR using the following oligonucleotides:

5TGAAACATATGGATGAAGAACCTGTAAAGAACT3 'and

5'GACCGGATCCr ⁽ _AAACACCTGAAGGAGCTGGA3 '. The PCR fragments obtained are inserted into the NdeI- site

BamHI from pETl la (Novagene).

To subclone the open reading frame (ORF) of p34, the plasmid pET3d (Novagene) cut by NcoI-BamHI was ligated to an adapter

NcoI-BstEII-BamHI. The 1038 bp NcoI-BstEII fragment containing the entire open reading frame of p34 was cloned into modified pET3d digested with

NcoI-BstEII.

Expression of the recombinants p44 and p34

The E. coli BL2 l (DE3) (Novagene) strain containing the plasmid pET1 la-p44 or pET3d-p34 is grown in LB medium supplemented with ampicillin (100 μg / ml) at 37 ° C. Cultures are induced with isopropyl β-D-thiogalactopyranoside (0.4 mM) up to an optical density at 600 nm of 0.6. After 2 hours at 37 ° C the cells are harvested by centrifugation and the pellet is resuspended in a 50 mM tris-HCl pH 8 medium; 1 mM EDTA pH 8; 100 mM KCl. The cells are then frozen, thawed and lysed by ultrasound on ice. The soluble fraction is separated from the non-soluble fraction by centrifugation. The renaturation of the recombinant polypeptides is carried out as described (Hager and Burgess, 1980). Antibody production

Monoclonal antibodies against the recombinant proteins rp44 (1H5) and rp34 (2B1) are produced as described (Fischer et al., 1992). Antibodies against p44 are obtained against the amino acid polypeptide 1 to 17. For p34, the whole protein which was overexpressed in E. coli was used. The antibodies directed against the p62 subunit are described in Fischer et al. (1992). The monoclonal antibodies are purified from the ascites fluid by treatment with caprilic acid and precipitation with ammonium sulfate. Immunoprecipitation

The heparin fraction BTF2 was incubated for 2 hours at 4 ° C with the antibodies and then 1 hour with the protein A-Sepharose F.F. (Pharmacia) in 50 mM tris-HCl pH 7.9; 10% glycerol; 0.1 mM EDTA; 150 mM KCl (TG10EK150); 1 mg / ml of BSA. The beads are washed twice with TG10EK150 containing 0.1% NP40 and 1 mg / ml of BSA, again with TG10EK150 containing 0.15% NP40, and resuspended in an SDS / PAGE loading buffer. After electrophoresis in SDS / PAGE buffer and transfer to nitrocellulose, the different polypeptides are detected with the corresponding antibodies. Other techniques

The purification of BTF2 and all the other transcription factors necessary for carrying out the transcription tests have already been described (Gérard et al., 1991). In vitro NER tests have been described (Weeda et al. 1990). The mutants 27.1 (ERCC3-) and UV140 (ERCC4-) have been described (Wood and Burki, 1982). EXAMPLE 1

The transcription factor BTF2 / TFIIH was purified as described previously (Gérard et al., 1991). A fraction concentrated on hydroxyapatite was subjected to an electrophoresis on SDS polyacrylamide gel (SDS / PAGE) and electrotransferred on a PVDF membrane. The 34 kD (p44) protein of 34 kD (p34) was directed with trypsin before being resolved by reverse phase chromatography. The amino acid sequences obtained by tryptic digestion of p34 and p44 were used to synthesize the degenerate oligonucleotides intended for the screening of a HeLa cDNA library in λ-ZAPII. Multiple positive clones were obtained and the sequencing reveals that for each of them a clone contains the entire open reading frame (ORF). The cDNAs of p44 and p34 have an open reading frame of 1185 and 909 base pairs respectively which code for proteins of 395 and 303 amino acids with calculated molecular weights of 44,451 D and 33,920 D respectively, which is in good agreement with the estimated molecular weights of the proteins purified on SDS gel (43 and 35 kD respectively; Gérard et al., 1991). On the other hand, when overexpressed in E. coli, the two recombinant polypeptides (rp44 and rp34) exhibit the same electrophoretic mobility on SDS / PAGE as the polypeptides p44 and p34 of endogenous BTF2. In both cases, the microsequenced peptides are observed with the expected amino acid sequence confirming the identity of the clones (FIGS. 1 and 2). EXAMPLE 2 The example below studies more particularly the properties of the proteins p34 and 44.

The p44 protein has a structural analogy with the yeast protein SSL1. SSL1 is a protein with a zinc-finger structure identified as being the product of a suppressor gene associated with translation initiation (Yoon et al., 1992). In terms of amino acids, p44 and SSL1 have a similarity of 58% and an identity of 40%. p44 as SSL1 contain Tyr-X-Cys-X _2- Cys-X ₃ -Phe-X ₈ -His-X ₂ - Leu-His (amino acids 358 to 380) motifs which are characteristic of a protein "zinc- finger "similar to TFIIIA which has been presented as interacting with DNA (Jacobs, 1992; Berg, 1993). We notice also that p44 like SSL1 has a repeated motif Cys-X ₂ -Cys-X -Cys / His- X ₅ -Cys-X ₂ -Cys interrupted by Cys-X ₂ -Cys-X ι ₁ / X ₂₂ -CVS- X ₂ -CVS domain. Surprisingly the first type is also present in p34.

The alignment of the three sequences in this region (FIG. 1C) highlights the conservation of the cysteines among the three polypeptides, which suggests that p44 and ρ34 must have some common functions, for example interaction with DNA. Preliminary results indicated that p44 interacts with the promoter's DNA. No other known reasons have been identified. It should be noted that p34 is rich in leucine and isoleucine (20% over the entire sequence) which gives it a very hydrophobic character.

Upon overexpression with E. coli, the polypeptides p44 and p34 remain in insoluble form and can be partly dissolved by denaturation-renaturation with guanidine hydrochloride. It is this small solubilized fraction which has been used in what follows.

The recombinant polypeptides p44 and p34 cannot replace the total activity of BTF2, even when added to the other two subunits of BTF2, namely p62 and p89, in an in vitro transcription system; although this is to be expected since the purification shows the existence of at least one additional polypeptide in BTF2.

The proteins p44 and p34 show no kinase, ATPase or helicase activity.

However, additional tests have demonstrated that both p44 and p34 are BTF2 / TFIIH subunits.

First, anti-p44 (Ab-p44) and anti-p34 (Ab-p34) monoclonal antibodies recognize the 44 kD and 34 kD polypeptides which are co-fractionated with the transcriptional activity of BTF2 and the helicase activity. by PAH chromatography. Additional tests have demonstrated that the proteins p44 and p34 are closely associated with the p62 and p89 subunits of BTF2 as well as with all the enzymatic activities presented by BTF2. Finally, the antibodies were tested for their capacity to block the transcriptional activity of BTF2 in in vitro tests. The tests showed that the transcription was reduced as a function of the concentration of the antibodies added, whereas this was not modified when a control antibody was added.

Comparable tests have made it possible to demonstrate the in vitro inhibition of NER activity by anti-p44 and anti-p34 antibodies.

The HeLa cell extracts that have been screened with anti-p34 antibodies show a clear reduction in their repair activity compared to the same non-screened extracts.

It was thus able to demonstrate unequivocally that these two polypeptides were subunits of BTF2.

REFERENCES

Berg J.M. (1993) Current Opinion in Structural Biology, 3, 11-16

Bunick D., Zandomeni R., Ackermann S. and Weinmann R. (1982) Cell, 29, 877- 886

Conaway J.W. and Conaway R.C. (1988) J. Biol. Chem., 263, 2962-2968

Conaway R.C. and Conaway J.W. (1989) Proc. Natl. Acad. Sci. USA, 86, 7356-7360

Conaway J.W. and Conaway R.C. (1991) J. Biol. Chem., 266, 17721-17724

Dahmus M.E and Dynan W.S. in Transcription Régulation, Phosphorylation of RNA (McKnight S.L and Yamamoto K.R., ed. 1992), p.109

Feaver W.J., Gileadi O. and Kornberg R.D. (1991) Cell, 67, 1223-1230

Fischer L, Gérard M., Chalut C, Lutz Y., Humbert S., Kanno M., Chambon P. and Egly J.M. (1992) Science, 257, 1392-1395

Gérard M., Fischer L, Moncollin V., Chipoulet J.M., Chambon P. and Egly J.M. (1991) J. Biol. Chem., 266, 20940-20945

Hager D.A. and Burgess R.R. (1980) Anal. Biochem., 109, 76-86

Jacobs G.H. (1992) EMBO J., 11, 4507-4517

Lu H., Zawel L, Fischer L, Egly J.M. and Reinberg D. (1992) Nature, 358, 641- 645

J. Sambrook, EF Fritsch & T. Maniatis (1989). Molecular cloning: a laboratory manual. Second edition. Cold Spring Harbor Laboratory Press, New York. Sawadogo M., Roeder RG (1984) J. Biol. Chem., 259, 5321-5236

Schaeffer L, Roy R., Humbert S., Moncollin V., Vermeulen W., Hoeijmakers J.H.J., Chambon P. and Egly J.M. (1993) Science, 260, 58-63

Serizawa H., Conaway R.C. and Conaway J.W. (1992) Proc. Natl. Acad. Sci. USA, 89, 7476-7480

van Vuuren A.J., Vermeulen W., Ma, L Weeda G., Appeldoorn R, Jaspers N.G.J., van der Eb, A.J., Bootsma D. and Hoeijmakers J.H.J. , and Humbert S., Schaeffer L and Egly J.M. (1994) EMBO J.

Weeda G., van Ham R.C.A., Masurel R., Westerveld A., Odijk H., de Wit J., Bootsma D., van der Eb A.J. and Hoeijmakers J.H.J. (1990) Mol. Cell. Biol., 10, 2570-2581

Wood R.D., Robins P. and Iindahl T. (1988) Cell, 53, 97-106

Yoon H., Miller S.P., Pabich RK. & Donahue T.F. (1992) Gène & Dev., 6, 2463-2477

Zawel L and Reinberg D. (1992) Curr. Biol., 4, 488-495

Claims

1) Protein characterized in that it comprises all or part of the sequence of the p44 protein or of the p34 protein as represented in FIG. 1 for p34 and in FIG. 2 for p44, the variants of these proteins having at least an epitope recognized by an anti-p44 or anti-p34 antibody according to FIG. 1 or FIG. 2.

2) Protein according to claim 1, characterized in that it comprises the entire sequence of the p44 protein or of the p34 protein according to FIG. 1 or 2.

3) Protein according to claim 2, characterized in that it is the p44 protein or the p34 protein.

4) Protein according to one of claims 1 to 3, characterized in that it comprises at least 80% of the sequence of p44 or p34. 5) DNA sequence coding for a protein according to one of claims 1 to 4.

6) DNA sequence according to claim 5, characterized in that it is the genomic sequence.

7) DNA sequence according to claim 5, characterized in that it is a cDNA.

8) Monoclonal or polyclonal antibody corresponding to a protein according to one of claims 1 to 4.

9) Anti-p34 or anti-p44 monoclonal antibody.

10) Method for diagnosing the deficiency of the DNA repair process in human beings, characterized in that the level of p34 and / or p44 is measured in vitro in a biological sample and that is detected in particular a lowering of the rate of p34 or p44 compared to the normal rate.

11) Diagnostic kit in particular for implementing the method according to claim 10, characterized in that it comprises at least: an antibody according to one of claims 8 and 9, and a protein according to one of claims 1 to 4.

12) Method for diagnosing the deficiency of the DNA repair process in humans, characterized in that the absence of a normal DNA sequence corresponding to p34 and / or p44 is detected. 13) Method according to claim 12, characterized in that the DNA sequence corresponding to the DNA coding for p34 and / or p44 is amplified.

14) DNA vector characterized in that it comprises a coding sequence according to one of claims 5 to 7.

15) Vector according to claim 14, characterized in that it comprises the elements ensuring the expression of the coding sequences in a determined host cell.

16) Vector according to one of claims 14 and 15, characterized in that it consists in part of a virus.

17) Vector according to claim 16, characterized in that the virus is chosen from adenoviruses, defective retroviruses, Herpes viruses.

18) Cell characterized in that it is transformed by a vector according to one of claims 14 to 17 and expresses a protein according to one of claims 1 to 4.

19) As a medicament, a protein according to one of claims 1 to 4.

20) As a medicament, a DNA sequence according to one of claims 6 or 7 or a vector according to one of claims 14 to 17.

21) As a medicament, a cell according to claim 18.

22) Method for preparing a protein according to one of claims 1 to 4, characterized in that a cell according to claim 18 is cultured in a culture medium and the protein is recovered.