EP0716707A1

EP0716707A1 - Promoters

Info

Publication number: EP0716707A1
Application number: EP94926238A
Authority: EP
Inventors: Reinhard TÖPFER; Jaqueline Bautor; Hendrick Bothmann; Elke Filsak; Christa HÖRICKE-GRANDPIERRE; Barbara Klein; Norbert Martini; Andreas MÜLLER; Wolfgang Schulte; Michael Voetz; Josef Walek; Jeff Schell
Original assignee: Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Current assignee: Max Planck Gesellschaft zur Foerderung der Wissenschaften eV
Priority date: 1993-09-04
Filing date: 1994-09-05
Publication date: 1996-06-19
Also published as: US6133506A; CA2169093A1; AU7615494A; WO1995007357A2; WO1995007357A3; AU695775B2

Abstract

Promoters and if required other regulatory elements in the 5', non translated region of genes that code for proteins of the de novo biosynthesis of fatty acids are disclosed, as well as alleles and derivatives of said promoters. These promoters and if required other regulatory elements in the 5' non translated region may for example be coupled with foreign genes, forming chimerical genes, and be transmitted to plants in appropriate vector systems.

Description

description

PROMOTORS

The present invention relates to promoters and possibly or other regulatory elements in the 5'-untranslated region of genes which code for proteins of de novo fatty acid biosynthesis, and the alleles and derivatives thereof.

The fatty acid and triacylglyceride biosynthesis can be regarded as separate biosynthetic pathways due to the compartmentalization, but with regard to the end product, as a biosynthetic pathway. The de novo biosynthesis of fatty acids takes place in the plastids and is catalyzed by three enzymes or enzyme systems, these are (1) the acetyl-CoA carboxylase (ACCase), (2) the fatty acid synthase (FAS) and (3) the acyl - [ACP] thioesterase (TE). The end products of this reaction sequence in most organisms are either palmitic, stearic and, after desaturation, oleic acid.

The fatty acid synthase consists of an enzyme complex of dissociable individual enzymes with the individual enzymes acetyl- [ACP] -transacylase, malonyl- [ACP] -transacylase, ß-ketoacyl- [ACP] synthases I, II, III, ß-ketoacyl- [ACP] -Reductase,

Hydroxyacyl [ACP] dehydratase, enoyl [ACP] reductase and ACP

Acyl carrier protein.

In the so-called "Kennedy Pathway", the triacylglyceride biosynthesis from glycerol-3-phosphate and fatty acids, which are present as acyl-CoA substrates, then takes place in the cytoplasm on the endoplasmic reticulum. The expression of genes of fatty acid biosynthesis is significantly regulated by their upstream promoters. They control the tissue-specific, development-specific or the level of expression induced by external stimuli of the genes that follow them.

A large number of plant promoters, including seed-specific promoters, have been isolated and characterized in recent years. Some examples are the HMW- (.S. Robert et al, Plant Cell 1, pages 569-578 (1989), V. Colot et al, Mol.Gen.Genet. 216, pages 81-90 (1989)), Bäumlein et. al, The Plant Journal, 2, pages 233 to 239, 1992, Zein- (AJM Matzke et al, Plant.Mol.Biol. 14./ pages 323-332 (1990)), Lectin- (P. Guerche et al, Mol.Gen.Genet. Pages 306-314 (1990)), USP- (H. Bäumlein et al, Mol.Gen.Genet. 225. Pages 459-467 (1991)), Napin (M. Stayton et al, Aust.J. Plant Physiol. 1 £, pages 507-517 (1991)), oleosin (JS Keddie et al, Plant.Mol.Biol., 19, pages 443-453 (1992)) or the ACP promoter (J. de Silva et. Al, Plant. Mol. Biol. 18, pages 1163-1172 (1992)). To what extent they are suitable for the expression of a particular gene and what differences they have in relation to the desired phenotype cannot be predicted. The investigations of their specificity have often been carried out on plant species other than the crop of interest. Investigated in oilseed rape and proven to be suitable for changes in the fatty acid metabolism are Napin (JC Kridl et al, Seed Sci.Res. 1, pages 209-219 (1991), DS Knutzon et al, Proc.Natl.Acad.Sci. 19, pages 2624-2628 (1992)) and an ACP promoter (Knutzon et al, DE Scherer e_t al, Plant.Mol.Biol. 9, pages 127-134 (1987)).

The object of the present invention is primarily to provide promoters with which foreign genes can be expressed in plants with high efficiency or can be specifically expressed in certain tissues or cell types. The object is achieved with the promoters and, if appropriate, or other regulatory elements in the 5 'untranslated region according to claim 1.

The invention relates to promoters and possibly or other regulatory elements in the 5 'untranslated region of genes which code for proteins of de novo fatty acid biosynthesis, and the alleles and derivatives of these promoters.

The invention further relates to genomic clones which contain a gene which codes for a protein of de novo fatty acid biosynthesis, and the alleles and derivatives of this gene, the gene comprising the promoter, the structural gene or at least parts thereof and other regulatory sequences.

The invention also relates to a process for the production of transgenic plants, plant parts and plant products, in which a promoter and possibly or other regulatory elements in the 5 'untranslated region of genes which code for proteins of de novo fatty acid biosynthesis with a desired one expressing gene is coupled and then transferred in a suitable vehicle.

The invention also relates to plants, parts of plants and plant products which have been produced by the above process.

Finally, the invention relates to the use of a promoter and, if appropriate, or other regulatory elements in the 5'-untranslated region of genes which code for proteins of de novo fatty acid biosynthesis, for the production of plants with modified gene expression.

The subclaims relate to preferred embodiments of the invention. The figures serve to explain the invention. Show it:

Figure 1 shows the restriction maps of the genomic clones

BnACCaseg3, BnACCaseglO and BnACCasegl;

Figure 2 shows the restriction map of the genomic clone

ClACPgl;

Figure 3 shows the restriction maps of the genomic clones

ClKASIg2, ClKASIgβ, ClKASIg4, ClKASIgl3, ClKASIgl9 and ClKASIg20;

Figure 4 shows the restriction maps of the genomic clones

ClKRg2, ClKRgl2 and ClKRg3;

Figure 5 shows the restriction maps of the genomic clones

ClERg5, ClERg7, ClERg9, ClERglO and ClERg20;

Figure 6 shows the restriction maps of the genomic clones

CITEgl, ClTEg4, ClTEg7 and ClTEglδ;

Figure 7 shows a Northern blot with RNAs from different

Plant tissues hybridized with a gene-specific probe for CITEgl;

Figure 8 shows a Northern blot with RNAs from different

Plant tissues hybridized with the C1TE13 cDNA corresponding to the gene from ClTEg7; and

Figure 9 shows a Northern blot with RNAs from different

Plant tissues hybridized with a specific ACP cDNA probe.

It goes without saying that allelic variants and derivatives of the invention are also within the scope of the invention Promoters and other regulatory elements are detected in the 5 'untranslated area, provided that these modified units have the desired activity. The allelic variants and derivatives include, for example, deletions, substitutions, insertions, inversions or additions of the promoters according to the invention. The same applies to the genomic clones that contain the above-mentioned units.

The isolation of the promoters and, if applicable, or of the other regulatory elements in the 5 'untranslated region takes place via the isolation of the genes connected downstream. The genes for the proteins of fatty acid biosynthesis are present in all plants and can therefore also be isolated from them. In the present invention, rapeseed (Brassica napus) and lanceolate leaved quiver flower or hump flower (Cuphea lanceolata) have proven to be particularly suitable plant material.

The isolation of genes from fatty acid biosynthesis was carried out with specific hybridization probes. Based on polyA ⁺ RNA, these were prepared from approximately two to three weeks old, immature seeds from Brassica napus or from approximately two weeks old embryos from Cuphea lanceolata, after a cDNA first strand synthesis by means of polymerase chain reaction (PCR). The synthetic oligonucleotide primers required for this will be described later. In this way, the promoters of the gene families of the acetyl-CoA carboxylase (ACCase) of the acyl carrier protein (ACP), the ß-ketoacyl [ACP] synthasel (KASI), the ß-ketoacyl [ACP] reductase ( KR), the enoyl [ACP] reductase (ER) and the acyl [ACP] thioesterase (TE) are isolated.

The sizes (in bp) of the PCR products for isolation for the gene families mentioned above are in Table 1 below specified.

Table 1

The promoters according to the invention and other regulatory units in the 5 'untranslated region are described as follows. As a basis for the promoter and other regulatory sequences in the non-translated 5 'region, the DNA sequences are taken into account, which are in front of the start codon, i.e. before the start of translation of the respective structural genes. The specified transcription start points describe only one of several transcription start points. It is generally known that several transcription start points can be determined for one gene.

Promoters of Genes from the Acetyl-CoA Carboxylase (ACC) Family

Using the PCR product shown in Table 1, 15 genomic clones were isolated from a library of Brassica napus genomic DNA. Restriction mapping of nine clones revealed three distinct classes of genes (approximately 20 kb) by clones BnACCaseg3, BnACCaseglO ⁽¹⁵ ^kb) _l ind BnACCasegl (15 kb) are represented. The restriction maps of these genomic clones are shown in Figure 1. The black bars show the regions hybridizing with the PCR product, during which the white bars comprise the DNA fragments that were sequenced.

The DNA sequence of the promoter region and parts of the DNA sequence of the structural gene of the ACC gene from the genomic clone BnACCaseg3 are shown as SEQ ID NO: 1 in the sequence listing. This sequence comprises 2505 bp of the promoter region and approximately 700 bp of the structural gene. The start codon "ATG" of the ACCase gene is located at position 2506 of the DNA sequence. The start codon in position 2506 with the neighboring nucleotides shows good agreement with the plant consensus motif for translation initiation areas (G. Heidecker and J. Messing, Annual Review Plant Physiology 3_7, pages 439-466 (1986))

(H.A. Lütcke et al, EMBO J. £, pages 43-48 (1987), C.P. Joshi et al, Nucl. Acids Res. 15, pages 6643-6653, (1987)). At a distance of 41 nucleotides upstream there is a motif which acts as a start of transcription, since it comes very close to the consensus motif (CTCATCA) according to Joshi, supra

(Position 2456). If the adenine in position 2456 is assumed to be the first nucleotide of an mRNA based on 5'-RACE experiments, then there is a possible TATA box at a suitable distance of 36 nucleotides (positions 2416 to 2422). A CAAT box (positions 2283 to 2286) is further 130 nucleotides away. Thus the most important elements of a promoter and 5 'untranslated region are present.

The DNA fragments described below from the two other genomic clones BnACCaseglO and BnACCasegl also contain the promoter region of the ACC gene and parts of the structural gene. A 4450 bp DNA fragment from the BnACCl clone (SEQ ID NO: 2 in the sequence listing) contains the before the start of translation with the start codon "ATG" (position 4089) Promoter sequence and other 5 'regulatory units of the ACC gene with 4088 bp. The protein-coding region of the ACC extends to position 4421. The 5 'untranslated region is interrupted by an intron and, based on 5'-RACE data, begins at position 3367 (start of transcription). This intron ranges from position 3493 to 4078. The promoter sequence of the ACC gene is located in a 3350 bp DNA fragment of the BnACCaseglO clone (SEQ ID NO: 3 in the sequence listing) before the start of translation with the start codon at position 2611 protein-coding sequence of the ACC goes up to position 3341 and is interrupted by an untranslated region (intron), positions 2909 to 3000.

The genomic clone BnACCasegl and the genomic clone BnACCaseglO were deposited under number DSM 8480 and DSM 8481 on August 27, 1993 at the DSM-German Collection of Microorganisms and Cell Cultures GmbH, Mascheroder Weg 1B, D-38124 Braunschweig.

2. Promoters of the Genes of the Acyl Carrier Protein (ACP) Family

Using the PCR product listed in Table 1, a bank of Cuphea lanceolata genomic DNA was examined for genes for the acyl carrier protein. In this way, 20 genomic clones were isolated. With existing class-specific cDNAs, these clones could be divided into three classes as hybridization probes. A distinction is made between classes C1ACP1-1, C1ACP1-2 and C1ACP1-3. The genomic clone ClACPgl was mapped from class C1ACP1-1. The restriction map of the genomic clone ClACPgl can be seen in FIG. 2. The size of the insertion is 15.8 kb for ClACPgl. The promoter region and the corresponding one could be identified within the insertion mentioned Restriction fragment are subcloned. An 8 kb BamHI / SacI fragment was subcloned into pUC19 from ClACPgl, the sequencing of which gave the orientation of the gene. In addition to the structural gene of the ACP, this clone contains the promoter for this gene. The black bar in Figure 2 shows the subcloned DNA fragment of the ClACPgl clone and the white bar the DNA section that was sequenced.

DNA sequence analysis of a 1200 bp DNA fragment of the subcloned DNA fragment from ClACPgl (SEQ ID NO: 4 in the sequence listing) has shown that the promoter region of the ACP gene is contained in this fragment. It is located in front of the protein-coding sequence of the ACP gene, which begins at position 1160 with the start codon "ATG". The TATA signal typical of the promoter region is located at positions 1051 to 1054.

Under the control of the ACP promoter from the genomic clone ClACPgl from Cuphea lanceolata, the GUS gene was expressed in oilseed rape. Measurements of the β-glucuronidase expression of a fusion of the ACP promoter from ClACPgl as a 1.2 kb Pstl-PvuII part. Fragment with the GUS gene showed promoter activity in the examined leaf, flower and immature seed tissues. Northern blot analyzes (see FIG. 9) showed that the corresponding ACP gene in Cuphea lanceolata is expressed in leaf, flower, root and preferably in embryonic tissue.

The genomic clone ClACPgl was deposited under number DSM 8482 on August 27, 1993 with the DSM-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1B, D-38124 Braunschweig. 3. Promoters of the genes of the gene family β-ketoacyl- [ACP] - Svnthasel (KASI)

Using the PCR product listed in Table 1, nine genomic clones were isolated from a Cuphea lanceolata genomic DNA bank and then mapped. Due to the restriction mapping, these nine clones could be divided into six different types. A Southern blot analysis showed that in Cuphea lanceolata the β-ketoacyl [ACP] synthase is encoded by a gene family which probably consists of four classes.

From the isolated genomic clones, the clones ClKASIg2 (12.8 kb), ClKASIgβ (14 leb), ClKASIg4 (12.3 kb), ClKASIgl3 (12 kb), ClKASIgl9 (19.5 kb) and ClKASIg20 (11.8 lb. ) mapped. The restriction maps are shown in Figure 3. The black bars indicate the fragments hybridizing with the probe, the white bars the fragments sequenced for the promoter region, which originate from suitable subclones.

Analysis of the DNA fragments of the 6 genomic clones relating to the promoter region has shown that the clones as a whole have the promoter region in addition to the structural gene or at least parts of the structural gene.

An approximately 2870 bp partial sequence from the genomic clone ClKASIg2 (SEQ ID NO: 5a, 5b, 5c and 5d in the sequence listing) shows the promoter region of the KASI gene which ends at position 1142 (SEQ ID NO: 5d in the sequence listing), after which the Start codon "ATG" at position 1143 follows. About 90 bp of this sequence have not been sequenced (3 gaps).

A 2450 bp partial sequence from the genomic clone ClKASIg4 (SEQ ID NO: 6 in the sequence listing) encompasses the promoter region at 1962 bp, before the putative "ATG" at position 1963 putative intron ranges from positions 2053 to 2242. The beginning of the mature protein is at position 2402.

An approximately 2894 bp partial sequence from the genomic clone ClKASIgδ (SEQ ID NO: 7a, b, c, d, e, f and g in the sequence listing), which is interrupted by a total of approximately 150 bp by 6 non-sequenced smaller gaps the promoter region up to position 65 (SEQ ID NO: 7g in the sequence listing). The putative ATG is at position 66. This is followed by an incomplete transit peptide.

Parts of the promoter region are contained in a 1350 bp partial sequence from the genomic clone ClKASIgl3 (SEQ ID NO: 8 in the sequence listing). It covers 472 bp up to the start codon "ATG" (positions 473 to 475). The start of the mature protein is at position 1075. In front of it is the transit peptide, which is interrupted by an intron that cannot be precisely defined.

An 1141 bp fragment from the genomic clone ClKASIgl9 (SEQ ID NO: 9 in the sequence listing) contains the promoter region in a 520 bp fragment. The putative ATG is located at position 521. The start of the mature protein is at position 956. The transit peptide, which is interrupted by an intron which cannot be precisely defined, is located in front of this.

The 3750 bp partial sequence from the genomic clone ClKASIg20 contains the promoter region as a 3067 bp DNA fragment. The putative "ATG" is at position 3068. The mature protein begins at position 3661. In front of it is the transit peptide, which is interrupted by an intron that cannot be precisely defined.

So far, seven exons have been identified for the gene from ClKASIg4, which code for the mature protein. they were derived from the high homology to ß-ketoacyl [ACP] synthase of barley. The mature protein showed 86.4% homology (with an identity level of 77.4%). Due to the low homology in the area of the transit peptide, its exon / intron limits can be assumed. The structural gene extends over a length of approximately 2.3 kb without regulatory elements. In comparison to the sequence of the barley genomic clone (S. Kauppinen, J.Biol.Chem. 267, pages 23999-24006 (1992)), the distribution of the exons and introns is very similar. In contrast to barley, the first KASI exon is likely to be interrupted by another intron.

The sequencing of the clone ClKASIgδ showed that the nucleotide sequence of the structural gene to ClKASIg4 has an identity of 98%. The derived protein to ClKASIg4 also has an identity of 98%. The ClKASIg2 promoter region is also very similar to ClKASIg4. The close relationship between ClKASIg2, ClKASIg4 and ClKASIgδ among themselves is not only clear at the sequence level, but also at the restriction map level. These three genes could be alleles, each with significant sequence differences in the promoter region.

On August 27, 1993, the genomic clone ClKASg2 under the number DSM 8484, the genomic clone ClKASgδ under the number DSM 8485, the genomic clone ClKASgl3 under the number DSM 8486, the genomic clone ClKASgl9 under the number DSM 8487 and the genomic clone ClKASg20 the number DSM 8488 with the DSM-German Collection of Microorganisms and Cell Cultures GmbH, Mascheroder Weg 1B, D-38124 Braunschweig. These are the genomic clones initially designated with "I" in each case.

4. Promoters of the genes of the gene family β-ketoacyl- [ACP] Reductase (KR)

The specific PCR product listed in Table 1 was initially used to isolate cDNAs from Cuphea lanceolata. Among other things, two types of cDNAs, C1KR10 and C1KR27, which are also different from one another at the amino acid level, were identified (B. Klein et al., Plant Lipids, pages 156-59 (1992)). The cDNAs were 1295 and 1276 bp in size (with polyA residue) and each code for an open reading frame of 326 and 320 amino acids including the transit peptides of 69 and 63 amino acids. The proteins derived from the DNA sequence have a molecular weight of 27 kDa.

Expression of the cDNA C1KR27 from nucleotide 210 as a fusion with the glutathione-S-transferase in vector pGEX-KG resulted in the purification of a fusion protein of 53 kDa. This fusion protein was used for enzyme determination for ß-ketoacyl- [ACP] reductase with acetoacetyl-CoA. The measured values showed that the cDNA C1KR27 codes for a NADPH-dependent KR, which can be specifically inhibited by phenylglyoxal (Klein, supra).

A Southern blot analysis showed that there is a gene family in Cuphea lanceolata with probably three classes of β-ketoacyl [ACP] reductase genes. With the cDNA C1KR27 as probe, eight genomic clones were isolated from a gene bank of genomic DNA from Cuphea lanceolata, which could be divided into three classes. One representative from each class is shown in FIG. 4 using the restriction maps. These are the restriction maps of the genomic clones ClKRg2 (13.4 kb), ClKRgl2 (13.1 kb) and ClKRg3 (14 kb). The black bars indicate the areas hybridizing with the cDNA C1KR27. The white bars represent subcloned fragments. From ClKRg2 a 4.0 kb Kpnl / Smal- Fragment, an 8.5 kb Sall / Xbal fragment from ClKRgl2 and a 6.7 kb Sall / Xbal fragment from ClKRg3 subcloned and then sequenced for their identification.

The promoter region of the ClKRg2 gene is located on a 1570 bp DNA fragment (SEQ ID NO: 11 in the sequence listing). It comprises 1511 bp with a non-translatable area. The protein coding sequence of the KR gene begins with the start codon "ATG" from position 1512. The TATA signal is located at positions 1412 to 1429, the putative transcription start at position 1445 (see above).

The promoter region of the ClKRg3 gene is located on a 926 bp DNA fragment (SEQ ID NO: 12 in the sequence listing). At 915 bp, it encompasses the area in front of the start codon "ATG" at position 916. The region of the TATA box is at positions 827 to 838, the putative transcription start is at position 864 (see above).

The complete gene is contained in ClKRgl2. It was sequenced in double strands and the exon and intron regions were determined. The promoter region of this gene is located on a 1450 bp DNA fragment (SEQ ID NO: 13 in the sequence listing). It is in a range of 1420 bp before the start codon "ATG" at position 1421. The range of the TATA box extends from positions 1327 to 1343 and the putative transcription start is at position 1369 (see above).

The promoter regions of the three KR genes show TATA box motifs which correspond to the consensus sequence for plants according to Joshi (1987), supra, TCACTATATATAG: ClKRg2 is correct in lδ positions (items 1412-1429), ClKRgl2 in 16 positions (item . 1327-1343) and ClKRg3 in 12 positions (pos. 827-836). The translation initiation sequence also shows high homo- on the known consensus sequence motifs (Kozak (1984), supra, Joshi (1987), supra, Lütcke et al (1987), sup¬ ra). The promoters of the ClKRgl2 and ClKRg3 genes show very high agreement with one another, with the exception of an approximately 500 bp insertion in the ClKRgl2 promoter. This insertion has numerous "inverted repeats" with unknown function.

5. Promoters of the genes of the gene family Enoyl- [ACP] -reductase (ER)

Using the PCR product listed in Table 1 as a probe, eight cDNAs from Cuphea lanceolata were isolated, which can be divided into two classes due to greater differences. A cDNA, CLER18, is 1533 bp in length and encodes a 391 amino acid protein including 75 amino acids for a transit peptide. The mature protein has a calculated molecular weight of 33.4 kDa and shows 83.3% identical amino acids with the ER from Brassica napus. To determine the cosubstrate specificity, the cDNA C1ER7 from nucleotide 297 was fused with the glutathione S-transferase, expressed in E. coli and the suitable fusion protein was subjected to a determination of the enzyme activity with crotonyl-CoA as substrate and NADH or NADPH as cosubstrate. Due to the higher activity with NADH as cosubstrate it could be demonstrated that the cDNA C1ER7 (= type A) codes for a NADH-dependent enoyl [ACP] reductase.

Five genomic ER clones were isolated from a λ genomic bank of Cuphea lanceolata DNA using the PCR product as a probe. 5 shows the restriction maps of the genomic clones ClERgδ (12.5 kb), ClERg7 (14.4 kb), ClERg9 (16.4 kb), ClERglO (12 kb) and ClERg20 (11.8 kb). The black bars show the one hybridizing with the probe Area, the white bars the DNA sections sequenced for the promoter area.

The gene ClERg9 could be assigned to type B by hybridization with specific oligonucleotides that go back to cDNA C1ER8. Sequencing of the hybridizing Sall fragment of the ClERg5 gene revealed differences in the deduced amino acid sequence from the two identified classes of enoyl [ACP] reductases and thus represents the third class of E genes, type C.

The genomic structure of the coding region for the mature protein from ClERg5 was identified. The mature protein has 11 exons. A 1800 bp partial sequence of the gene from ClERg5 (SEQ ID NO: 14 in the sequence listing) shows parts of the promoter with regulatory units other than 1763 bp DNA sequence. The CAAT box (1335 to 1338) and the TATA box (1362 to 1367) are located in this area. The start of transcription is at position 1415, based on 5'RACE. An intron in the non-coding 5 'area is located at positions 1560 to 1741. Translation begins with the start codon "ATG" at position 1764.

Fusions of the promoter region with the GUS gene showed marked activity in the examined tissues (leaf and flower) of transgenic oilseed rape plants.

Further analyzes of DNA sequence regions of the genomic clones ClERg7, ClERg9, ClERglO and ClERg20 lying in the 5 region of the ER genes have shown that these partial regions or the entire region of the promoter sequences and sequences of other regulatory elements. An 890 bp DNA fragment from ClERg7 (SEQ ID NO: 15a and 15b in the sequence listing) contains the CAAT box and TATA box at positions 199 to 202 and 236 to 241 (SEQ ID NO: 15b in the sequence listing). The courage- Dimensional transcription start is at position 279 (see above). There is a non-sequenced gap of approximately 1200 bp between SEQ ID NO: 15a and SEQ ID NO: 15b. At position 418 is the start of an intron in the 5 'untranslated region.

An approximately 870 bp DNA fragment from ClERg9 (SEQ ID NO: 16a and 16b in the sequence listing) contains, as an approximately 690 bp DNA segment, other regulatory elements in the 5 'untranslated region. The transcription start is assumed at position 1 after 5'RACE. An incomplete intron in the untranslated area extends to position 329 (SEQ ID NO: 16b in the sequence listing). The translated area begins with the start codon "ATG" at position 367 (SEQ ID NO: 16b in the sequence listing). A non-sequenced area of approximately 160 bp is between SEQ ID NO: 16a and 16b.

Parts of the promoter and other regulatory elements are located on an approx. 2800 bp DNA fragment from ClERglO (SEQ ID NO: 17a and 17b in the sequence listing). This region comprises approximately 2709 bp and contains an intron in the 5 'untranslated region at positions 251 to 448 (SEQ ID NO: 17b in the sequence listing). The translation start begins with the start codon "ATG" at position 472 (SEQ ID NO: 17b in the sequence listing). A non-sequenced area of approximately 78 bp is between SEQ ID NO: 17a and 17b.

A part of the promoter and other regulatory elements are contained in an approx. 1060 bp DNA fragment from ClERg20 (SEQ ID NO: 18a and 18b in the sequence listing). This area comprises approx. 912 bp and contains the CAAT box (items 159 to 162) (SEQ ID NO: 18a in the sequence listing) and the TATA box (positions 211 to 215) (SEQ ID NO: 18a in the sequence listing) - an intron at positions 309 (SEQ ID NO: 18a) to 567 (SEQ ID NO: 18b). Translation begins with "ATG" at position 598 (SEQ ID NO: 18b in the sequence listing). A short, non-sequenced range of approximately 5 bp lies between SEQ ID NO: 17a and 18b.

On August 27, 1993, the genomic clone ClERg7 under the number DSM 8489, the genomic clone ClERg9 under the number DSM 8490, the genomic clone ClERglO under the number DSM 8491 and the genomic clone ClERg20 under the number DSM 8492 at the DSM-German Collection by microorganisms and cell cultures GmbH, Mascheroder Weg 1B, D-38124 Braunschweig.

6. Acyl [ACP] thioesterase (TE) gene promoters

Corresponding cDNAs from maturing embryos from Cuphea lanceolata were used with the help of the PCR product listed in Table 1. One of the cDNAs obtained, C1TE13, has a length of 1404 bp and codes for a protein with 414 amino acids including a transit peptide with 111 amino acids. The molecular weight of the mature protein is 34 kDa. In addition to the cDNA C1TE13, other but incomplete cDNAs were isolated. One of these cDNAs, C1TE5, which lacks 34 amino acids of the transit peptide, has been included in the comparison of derived sequences of mature proteins from previously known plant TEs. The C1TE5 also shows a greater similarity to medium-chain-specific TEs than to long-chain-specific TEs.

When searching a Cuphea lanceolata genomic DNA library with C1TE5 as probe, 23 genomic clones were found be isolated. Restriction mapping revealed four different classes of genes.

Figure 6 shows restriction maps of the genomic clones CITEgl, ClTEg4, ClTEg7 and ClTEgl6. The black bars show the areas hybridizing with the probe, the white bars mark the DNA sections sequenced for the promoter area.

The clones presented contain the full gene of acyl [ACP] thioesterase. A 3350 bp partial sequence of the gene with the promoter region from CITEgl6 (SEQ ID NO: 22 in the sequence listing) shows the promoter region with other regulatory elements as a DNA sequence with 3290 bp. The areas of the CAAT box and the TATA box are at positions 2914 to 2918 and 3035 to 3038, respectively. The transcription start is probably at position 3068 (see above). Exon and intron areas are located at positions 3068 to 3107 (exon I), 310δ to 3280 (intron I) and 3281 to 3350 (exon II, incomplete). The legumin box can be recognized at positions 3120 to 3132. The translation begins at position 3291 with the start codon "ATG".

An 1850 bp partial sequence of the gene from CITEgl (SEQ ID NO: 19 in the sequence listing) comprises the promoter and other 5 'regulatory units of the TE gene in the untranslated region as a DNA sequence with 1796 bp. The CAAT box and the TATA box are located in the promoter area at positions 1428 to 1432 and 1553 to 1556. The mapped transcription start is at position 1585. This is followed by exon and intron areas at positions 1585 to 1629 (exon I ), 1630 to 1786 (intron I) and 1787 to 1850 (exon II, incomplete). The legumin box is located at position 1642 to 1657. The translation start begins with the start codon "ATG" at position 1797. A 2750 bp partial sequence of the gene from ClTEg4 (SEQ ID NO: 20 in the sequence listing) contains the promoter and other 5 'regulatory units in the untranslated region of the TE gene as a DNA sequence with 2636 bp. An exon (exon I) ends at position 2193 and an intron (intron I) and another exon (exon II, incomplete) are located at positions 2194 to 2626 and 2627 to 2750. The translation start begins with the start codon "ATG" at position 2637.

An 850 bp partial sequence of the gene from ClTEg7 (SEQ ID NO: 21 in the sequence listing) shows the promoter and other 5 'regulatory units in the untranslated region of the TE gene as a DNA sequence with 782 bp. Exon and intron regions are at positions 143 to 190 (exon I, possibly incomplete), 191 to 772 (intron I) and 773 to 850 (exon II, incomplete). The translation start begins with the start codon "ATG" at position 783.

In contrast to the 5'-untranslated areas of CITEgl and CITEgl6, the legumin box for seed-specific expression (Bäumlein et al. Supra 1992) is missing in the corresponding regions of ClTEg4 and ClTEg7. Based on experimental data with regard to the specificity of the promoters, it can be assumed that the promoters of the genes from the genomic clones CITEgl and CLTEglδ are seed-specific, while the promoters of the genes from the genomic clones ClTEg4 and ClTEg7 are little active in the embryo, all the more in the other examined tissues with a maximum in the flowers and at least two differently long transcript species.

Northern blot analysis with polyA ⁺ RNA from various tissues of Cuphea lanceolata shows very large amounts of specific RNA in embryos with a specific probe for the gene from CITEgl (see FIG. 7, the same applies to ClTEgl6, not shown), while none specific transcript in roots, leaves and flowers. In contrast, in the same experimental approach very large amounts of specific RNA in flowers and less RNA in leaves, roots, embryos and seeds were detected with the cDNA C1TE13 corresponding to the gene from ClTEg7 as a probe (see FIG. 8, the same applies to ClTEg4, not shown) .

The promoters of the genes from the clones CITEgl and CITEgl6 according to the invention are therefore suitable, for example, for the directed expression of chimeric genes in embryo-specific plant tissue, and the promoters of the genes from the clones ClTEg4 and ClTEg7 according to the invention, for example, for an extraordinarily strong expression of chimeric genes in flowers.

On August 27, 1993, the genomic clone ClTEg4 under the number DSM 8493 and the genomic clone ClTEg7 under the number DSM 8494 was deposited with the DSM-German Collection of Microorganisms and Cell Cultures GmbH, Mascheroder Weg 1B, D-38124 Braunschweig. The two other genomic clones CITEgl and ClTEgl6 were plasmids in which parts of these genomic clones are present under the numbers DSM 8477 (pNBM99-TEgl) and DSM 8478 (pNBM99-TEgl6) on August 27, 1993 at the DSM-Deutsche Sammlung von Microorganisms and cell cultures GmbH, Mascheroder Weg 1B, D-38124 Braunschweig.

On the basis of these extensive analyzes, clonable 5 'regulatory DNA fragments can be produced from the genomic clones, which, in combination with any desired gene, specifically induce their expression in any plants. The following Table 2 shows examples of clonable fragments from the investigated genomic clones with the possible fusions. Table 2

genomiconclonable size translational-transcriptional clone 5'-regulatory cationic fragment fragment fusion fusion

BnACCl Clal / BamHI 5.6 +

BnACC3 Sall / Smal 3.2 +

BnACCl0 Sall / Smal 3.3 +

ClACPgl Pstl / PvuII 1/2 +

ClKASg2 BamHI / NcoI 3.4 +

ClKASg4 Smal / Ncol 2.4 +

ClKASgδ BamHI / NcoI 3.6 +

ClKASgl3 Ncol / Ncol 3.4 +

ClKASgl9 Spel / Ncol 4.4 +

ClKASg20 Ncol / Ncol 3.3 +

ClKRg2 Sall / Ncol 1.5 +

ClKRg3 Pstl / Ncol 0.9 +

ClKRgl2 Pεtl / Ncol 1.4 +

ClERg5 Sall / BamHI 3.2 +

ClERg7 EcoRI / Sall 4.0 +

ClERg9 EcoRI / Hindlll 4.4 +

ClERglO Sall / BamHI 4.4 +

ClERg20 BamHI / HindiII 3.2 +

CITEgl EcoRI / BbvI 2.8 +

ClTEg4 BamHI / Bbvl 3.7 +

ClTEg7 Sall / Bbvl 0.8 +

CITEgl6 Sall / Bbvl 3.0 +

It is within the skill of the person skilled in the art to use the clonable 5'-regulatory elements shown in Table 2 by suitable enzymatic manipulations to produce transcriptional promoter-gene fusions. For example, cutting off the sticky ends of the Ncol site of the fragments of the KR clones, e.g. B. with Sl nuclease, the production of transcriptional fusions.

The cloning of regulatory important parts of the promo- tors and other regulatory elements, for example the introns in the 5 'untranslated region, can be used to construct chimeric promoter / expression units.

The promoters according to the invention can be transferred with any desired gene to form chimeric genes in a suitable vehicle in plants with the formation of transgenic plants by genetic engineering. The genes in question can be expressed constitutively or induced. The induced expression can be development-specific, externally induced (biotic / abiotic) or cell type-specific. Such genes include, in particular, selectable marker genes for the transformation of plants, resistance genes (herbicide resistance, pathogen resistance), regulatory genes and genes which are used for the seed-specific expression of genes of fatty acid metabolism, carbohydrate metabolism, amino acid metabolism, secundum metabolism, such as for example polyhydroxybutyrate. Synthesis are responsible.

Suitable gene transfer vehicles are, for example, binary vectors of the pPCV 002 series (Konz and Schell, Mol.Gen.Genet. 204. Pages 383-396 (1986)) and vectors of the pRT series for direct DNA transfer (Töpfer et al, Methods in Enzymology ed. R. Wu, Academic Press Inc., New York 217, pages 66-78 (1993)), and viral vectors.

The expression of foreign genes in transgenic plants can thus be controlled with the promoters according to the invention. This means that either the gene expression can be significantly increased or inhibited (by endogenous genes) or a targeted expression can be caused in certain tissues of plants. The examples serve to explain the invention.

First, the materials and methods used are listed.

1. Chemicals and enzymes

Unless expressly specified, chemicals and fine chemicals were obtained from Merck AG (Darmstadt), Serva Feinbiochemika GmbH & Co KG (Heidelberg) and Sigma Chemie GmbH (Deisenhofen) in pro analysi or higher quality. In addition, Amersham Buchler GmbH & Co. KG (Braunschweig) supplied radiochemicals, Difco Laboratories (Detroit, USA) yeast extract and bacto-trypton as well as Biozym Diagnostik GmbH (Hameln) FMC Seakem-Agarose. Restriction endonucleases and nucleic acid modifying or synthesizing enzymes were developed by Boehringer Mannheim GmbH (Mannheim), GIBCO-BRL (Eggenstein), New England Biolabs GmbH (Schwalbach), Perkin Elmer Cetus (Norwalk, USA), Pharmacia Biotech GmbH (Freiburg) and Stratagene GmbH ( Heidelberg) related.

2. Cleaning, analysis and science kits

A number of methods for cleaning, analysis or synthesis are facilitated and accelerated by prefabricated or compiled materials with specific application protocols, so-called "kits". The following list provides an overview of the kits used, which were used according to the manufacturer's protocols:

mRNA isolation Oligotex dT mRNA kit (Diagen) cDNA synthesis cDNA-ZAP ^® II synthesis kit

(Stratagene)

Plasmid purification Quiagen Plasmid Kit (Diagen) DNA-Fraαment Elution Geneclean II ^® Kit (Bio 101 Inc.,

USA, La Jolla) DNA sequencing ^τ7 Sequencing Kit ^® (Pharmacia)

Production of Deletion-ExoIII / Mung Deletion Kit clone (Stratagene) radioactive DNA labeling Multiprime DNA labeling system

(Amersha) non-radioactive DIG-Luminescent Detection Kit DNA labeling (Boehringer)

3. Laboratory materials

Hybond N ^® membrane filters and Amersham Buchler GmbH & Co. KG (Braunschweig) were used for Southern and Northern blots as well as for the screening of cDNA and genomic DNA banks. X-Omat X-ray films from Kodak (Rockland, USA) for autoradiographs, Sephadex G 50 columns and NAP 25 columns from Pharmacia Biotech GmbH (Freiburg) for the cleaning of radioactively labeled hybridization probes and for cleaning synthetic oligonucleotides, Dynabeads ^® 01igo (dT) ₂₅ from Dynal (Oslo, Norway) for the polyA * insulation, films type 52 and type 55 for Polaroid flat film cassettes model 545 from Polaroid (Cambridge, USA), Quiagen-tip 100 from Diagen GmbH (Hilden) for DNA isolations and 3MM paper from Whatman (Maidstone, USA) in the screening of cDNA and genomic DNA banks.

4. Plant material

The investigations were carried out with plant material of the species Brassica napus (Cruciferae) (oilseed rape) and Cuphea lanceolata (Lythraceae) (lancet-leaved quiver flower or hump flower). The AKELA rapeseed (winter rape, ++ quality) was used and C. lanceolata material was used in addition to the wild type, the mutant C. lanceolata K ^" (Hirsinger et al, Zuchtungsforsch. J35_, pages 275-286 (1980)). Plasmid and vector systems

Plasmid pBluescript ^® II SK (-) (. No. 212206 Stratagene), pUC19, pUC18 (C. Yanisch-Perron et al, Gene 4J, pages 103-119 (1985).). PKlδ (RD Pridmore, Gene 56, pages 309- 312 (1987)) pGEX-KG (KL Guan et al, Anal. Biochem. 192, pages 262-267 (1991))

Lambda-ZAP ^® II (Stratagene) phage vector FIX ^® II (Stratagene)

Helper phage R408, ExAssist ® (Stratagene)

binary PGSC1706A (Van Rompaey, vectors unpublished) pREl, pRE9 (modified in the present invention from pGSC1706A)

6. Bacterial strains a) Escherichia coli for cloning

XLl-Blue (Stratagene) endAl, hsdR17, supE44, thi-1, recAl, gyrA96, relAl, lac, [F'pro AB, lacl ^q ZΔM15, TnlO (tet ^r )]

DH5α (Hanahan, J.Mol.Biol. SupE44, ΔlacU / 69, (801acZ

166, pages 557-580 M15), hsdR17, recAl, endAl,

(1983)) gyrA96, thi-1, relAl Sure ^® (Stratagene) el4 (mσrA), Δ (mcrCB-hsdSMR- mrr) 171, end AI, supE44, thi-1, gyrA96, relAl, lac, recB, recJ, sbcC, umuC: Tn5 (kan ^r ), uvrC, [F'proAB, lacl ^q ZΔM15, Tnl0 (tet ^r )]

b) Escherichia coli for the lambda phase multiplication

K803 (HGWood, Ann.Rev. Rk ^" , mk ^" , gal ^" , met ^" Biochem. 46, pages 385-413 (1977)) PLKF (Stratagene) recA, hsdR, hsdM ⁺ , rk ^" , mk ^" , mcrA, mcrB, gal, supE, lac, [F'proAB, lacl ^q , lacZΔM15] XLl-Blue (see above)

The molecular biological work was carried out according to standard methods as described by J. Sambrook et _. al., A laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1989).

7. cDNA and enomic DNA libraries

A cDNA library from C. lanceolata (wild type) was produced using the cDNA ZAP ^® synthesis ^kit according to the manufacturer's instructions. The starting material for the synthesis of the cDNAs was mRNA from isolated, immature embryos about two to three weeks old. The cDNA library obtained has a size of 9.6 × 10 ⁵ recombinant phages with a proportion of approximately 50% of clones, the insertions of which exceed 500 bp.

Similarly, the genomic DNA libraries were created with the Lambda FIX ^® II vector system from DNA of B. napus (cv AKELA) and C. lanceolata K ~. The size of the rapeseed genomic DNA bank is 7.5 x 10 ⁵ recombinant phages (with Insertions of 15 kb on average) and thus represents 3.6 times the rapeseed genome (the size of the rapeseed genome is 3.1 x 10 ⁶ kb; C. Hallden et al, J. Mol. Vol. 25, pages 318-323 (1987 )). The size of the C. lanceolata genomic DNA library is 3.5 × 10 ⁵ recombinant phages (with insertions of about 15 kb on average) and thus comprises about 17 times the genome of this plant, the genome of which is 3 × 10 ⁵ kb owns.

8. DNA sequencing

To determine the sequence of a DNA fragment pK18 order pUClδ appropriate subclones and deletion clones prepared from these starting means Exonnuklease III (Stratagene) were Proc.Natl.Acad by cloning into pBluescript ^®, which et by the method of F. Sanger al. Sci. 74, pages 5463-5467 (1977). The DNA sequencing was partially radioactive using the ^τ7 sequencing kit or using a "Pharmacia Automated Laser Fluorescent ALF ^® " DNA sequencer. The sequences were analyzed using the computer software from the University of Wisconsin Genetics Computer Group (J. Devereux et al, Nucl.Acids Res. .12., Pages 367-395 (1984)).

9. Determination of environmental activities

The β-glucuronidase activity was determined fluorometrically with 4-methylumbelliferylglucuronide or histochemically with 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-gluc, Clontech Laboratories, Palo Alto) (RA Jefferson et al., EMBO J 6, pages 3901-3907 (1987)).

example 1

Production of specific hybridization probes a) Derivation of degenerate oligonucleotides Polymerase chain reactions (PCR) were carried out with various synthetic oligonucleotides (called primers for short). As specified below, they were derived on the basis of sequence comparisons and synthesized on an Applied Biosystems DNA synthesizer (Model 380B). A summary of the successfully used primer combinations is shown in Table 3 below.

Table 3

a) Acetyl-CoA carboxylase

5 ^' Primer number 3455 3- Primer number 3464

G Y P V l / M 1 K A H 0 K V / 1 V / 1 E E A

5 ^' GGI TAT CCI GTI ATI ATA AAA GC 3 "GTA GTT TTT TAI TAI CTT CTT CG CCGGCCCCCC

T

b) acyl carrier protein

5 ^' Primer number 1488 3- Primer 1489

5 ^' TCTAGACGTGAGTAACGACC ATG GCG 3- GTCTTACTTAATACTTAAGAGCTC

5 ^" primer number 3098 3 ~ primer number 3240

Q A K P E T V A V M G L E E E F

5 ^' CAA GCI AAA CCI GAA ACl GTI GC 3 ^' CAC TAC CCA AAI CTT CTT CTT AA GGGGGCCC

c) β-ketoacyl- [ACP] synthase I

5 ^' Primer number 2763 3 ^* Primer number 2762

K R V V 1 T G M G N Y S 1 S T A C A

5 AAA AGI GTI GTI ATA ACl GGI ATG GG 3 ^' TTA ATA AGI TAA AGI TGI CGI ACA CG GCCGG TC G TC GTT

d) β-ketoacyl- [ACP] reductase

5 ^' Primer number 2189 3- Primer number 2187

T A V D A W G N 1 N V N A / A

5- ACl GCI GTI GAC GCI TGG GG 3 ^' TTA TAA TTA CAI TTA CGI TAA CG

T G G G G G

T T

e) Enoyl- [ACP] reductase

5 ^' Primer number 3389 3 ^* Primer number 3391

D D N A / G Y G W A M E t K K V Y P

5 ^' GAC GAC AAC GCI TAC GGI TGG GC 3 ^" C CTC TAA TTC TTC CAI ATA GG TTTGTTGTTG

T

f) Acyl [ACP] thioesterase

5 ^' Primer number 3532 3 ^' Primer number 2740

W N D L D V N 0

5 ^' TGG AAC GAC CTI GAC GTI AAC GA 3 ^" T CGAAGGATCCAAGCTTGTCGACT TTTTT 18 Acetyl-CoA carboxylase: Specific primers for acetyl-CoA carboxylase were compared by comparing different biotin-containing proteins, including the ACCase from chicken and the ACCase (more precisely the biotin carboxylase) from E. coli in the publication by Kondo et al, Proc. Natl.Acad.Sci. 8 _. , Pages 9730-9733 (1991) derived from conserved sections of the sequences. Due to the degenerate genetic code and the possible variability in the amino acid sequence at individual positions, degenerate oligonucleotides were produced, ie different bases were incorporated at individual positions in the oligonucleotide primer, for example C or T or A or G in primer 3464. Inosine ( I) inserted, which can interact with all nucleotides and is therefore to be regarded as a non-specific base. The sequence of the synthesized oligonucleotide primers (3455 and 3464) is based on the amino acids of the regions 304 to 311 and 383 to 390 based on the amino acid sequence of the rat ACCase (Kondo et. Al, supra).

Acyl Carrier Protein: Degenerate oligonucleotides for the N-terminus of the C. lanceolata acyl carrier protein were derived from N-terminal amino acid sequence data, kindly provided by F. Spener (Munster) prior to publication (Kopka ^ t al, Planta 191, pages 102 -111 (1993)). This amino acid sequence together with the conserved VMGLEEEF motif from acyl carrier proteins (e.g. Souciet and Weil 1992, Kopka et al 1993) were used to synthesize the primers listed in Table 2 (3098 and 3240).

β-ketoacyl [ACP] synthase I: A comparison of β-ketoacyl [ACP] synthase I from barley with that from E. coli shows only a few areas with greater homology (Siggaard-Anderson et al, Proc.Ntl. Acad. Sci .88., Pages 4114-4118 (1991)). A was used to synthesize a specific pair of primers (Table 2) Sequence section located at the N-terminal (item 13 to 21 for primer 2763) and the region around the cysteine binding the inhibitor cerulenin (item 71 to 79 for primer 2762) (Siggaard-Anderson et aj-, supra). The KAS sequence from barley was kindly provided by P. von Wettstein-Knowles prior to publication (Siggaard-Anderson e_t al, supra).

β-Ketoacyl [ACP] reductase: A sequence comparison of two typical fragments of the β-ketoacyl [ACP] reductase from avocado with the sequence of the nodG protein from Rhizobium meliloti in the publication by Sheldon et al, Biochem.J. 271, pages 713-729 (1990) has short areas of high homology between the two proteins. The two oligonucleotide primers 2189 and 2187 were synthesized based on the fragmentary sequences of the β-ketoacyl- [ACP] reductase from avocado and the homology to nodG given in this publication (Table 2).

Enoyl [ACP] reductase: To obtain a specific primer pair (Table 2), amino acid sequence sections of the enoyl [ACP] reductase from rapeseed (Kater et al. Plant. Mol. Biol. 37, pages 895-909 (1991)) selected with a relatively little degenerate genetic code. The selected sequences correspond to amino acid positions 101 to 108 (primer 3389) and 153 to 160 (primer 3391). (Table 2)

Acyl- [ACP] thioesterase: The publication by Voelker et al, Science 257, pages 72-74 (1992) shows the first sequence of a plant acyl- [ACP] thioesterase. Since it is also the sequence of a medium-chain-specific enzyme, some areas of the sequence whose derived DNA sequence is as little as possible degenerate. Oligonucleotide primers derived and synthesized. The primer 3532 (Table 2), which is the amino acids 277 to 264 of the acyl [ACP] thioesterase from Umbellularia California, was found to be suitable for amplification in PCR reactions in connection with primer number 2740 (a modified oligo-dT primer with interfaces for the restriction endonucleases BstBI, BamHI, Hindlll and Sall) a specific hybridization probe.

b) Polymerase chain reaction (PCR)

Starting from 1 μg polyA ⁺ RNA, reverse transcriptase (Boehringer Mannheim GmbH) from Avian Myeloblastosis Virus (AMV) was used to carry out a cDNA synthesis at 37 ° C. for 30 minutes. For this purpose, the 3'-oligonucleotide primers shown in Table 3 were used for the synthesis of a specific hybridization probe. After inactivation of the reverse transcriptase by heating for 5 min at 95 ° C and four units of Ampli Taq ^® polymerase (Perkin Elmer Cetus) was dissolved in the same reaction mixture, the PCR reaction with 50 pmol final concentration each primer (3 see Table) is performed. The reactions were carried out under the following conditions: a) Buffer conditions: 10 mM Tris-HCl, pH 8.0; 50 mM KC1; 1.5 mM MgCl ₂ ; 0.01% gelatin and 5 mM dNTPs, b) reaction time and temperatures: 3 minutes at 92 ° C for the first denaturation, then 25 to 30 temperature cycles with: 2 minutes at 92 ° C for the denaturation, 2 minutes for the in Table 4 specified temperature for annealing the oligonucleotides and 2.5 minutes at 72 ° C for amplification of the DNA and finally 7 minutes at 72 ° C to achieve a complete synthesis of the last synthesis products. Table 4

J Oligonucleotide specific for 5 ^' Primer No. 3 ^' Primer No. Annealing at

Acetyl-CoA carboxylase (ACC) '3455 3464 51 ° C

Acyl carrier protein, rapeseed (ACP) 1488 1489 48 ° C

Acyl carrier protein, Cuphea (ACP) ι 3098 3240 48 ° C! β-ketoacyl [ACP] synthase 1 (KAS 1) j 2763 2762 48 ° C | β-ketoacyl [ACP] reductase (KR) 2189 2187 48 ^U C

Enoyl [ACP] reductase (ER) '3389 3391 49 ° C

Thioesterase (TE) '3532 2740 50 ^U C

c) Cloning the amplification products

Supernatant single-stranded DNA of the PCR products was filled in using Klenow polymerase and then phosphorylated using polynucleotide kinase (Sambrook et al, supra). The PCR products were purified according to standard protocols according to Sambrook et al, supra, by agarose gel electrophoresis, gel elution, extraction with phenol / chloroform and the final precipitation with

Isopropanol. The thus purified DNA was ligated into Smal digested pBluescript ^® vector DNA and sequenced. Example 2

Manufacture of promoters

The PCR products described in Example 1 were used for the isolation of the genomic clones. This was done either directly by using the PCR product as a probe for searching a bank of genomic DNA or via a cDNA as a probe, which was used by using the PCR product as a suitable probe for searching cDNA banks. The genomic clones found were sequenced in a conventional manner and characterized with regard to the promoter regions.

If molecular biological work has not been adequately described in any way, it was carried out according to standard methods, as described in Sambrook et al, A Laboratory Manual, 2nd edn. (1989).

Claims

1. Promoters and possibly or other regulatory elements in the 5 'untranslated region of genes which code for proteins of de novo fatty acid biosynthesis, and the alleles and derivatives of these promoters and other regulatory elements in the 5' untranslated region.

2. Promoters and possibly or other regulatory elements in the 5 'non-translated area according to claim 1, characterized in that they are isolated from plants.

3. promoters and possibly or other regulatory elements in the 5'-untranslated region according to claim 2, characterized in that they originate from Brassica napus and / or Cuphea lanceolata.

4. Promoters and optionally or other regulatory elements in the 5'-untranslated region according to one of claims 1 to 3, characterized in that the genes belong to the gene family of the acetyl-CoA carboxylase.

5. promoters and possibly or other regulatory elements in the 5'-untranslated region according to one of claims 1 to 3, characterized in that the genes belong to the gene family of the acyl carrier protein.

6. promoters and possibly or other regulatory elements in the 5 'untranslated region according to one of claims 1 to 3, characterized in that the genes belong to the gene family of the β-ketoacyl [ACP] synthase I.

7. promoters and optionally or other regulatory elements in the 5'-untranslated region according to one of claims 1 to 3, characterized in that the genes belong to the gene family of the β-ketoacyl- [ACP] reductase. δ. Promoters and possibly or other regulatory elements in the 5 'untranslated region according to one of Claims 1 to 3, characterized in that the genes belong to the gene family of the enoyl [ACP] reductase.

9. Promoters and possibly or other regulatory elements in the 5 'untranslated region according to one of claims 1 to 3, characterized in that the genes belong to the gene family of the acyl [ACP] thioesterase.

10. Genomic clones which contain a gene which codes for a protein of de novo fatty acid biosynthesis and the alleles and derivatives of this gene, the gene comprising the promoter, the structural gene or at least parts thereof, and other regulatory elements.

11. Genomic clones according to claim 10, characterized in that they are isolated from plants.

12. Genomic clones according to claim 11, characterized in that they originate from Brassica napus and / or Cuphea lanceolata.

13. Genomic clones according to one of claims 10 to 12, characterized in that they contain the promoter and possibly or other regulatory elements in the 5 'untranslated region for the expression of an acetyl-CoA carboxylase.

14. Genomic clones according to one of claims 10 to 12, characterized in that they contain the promoter and possibly or other regulatory elements in the 5 'untranslated region for the expression of an acyl carrier protein. 15. Genomic clones according to one of claims 10 to 12, characterized in that they contain the promoter and possibly or other regulatory elements in the 5 'untranslated region for the expression of a β-keto acyl [ACP] synthase I. .

16. Genomic clones according to one of claims 10 to 12, characterized in that they contain the promoter and possibly or other regulatory elements in the 5 'untranslated region for the expression of a β-keto acyl [ACP] reductase.

17. Genomic clones according to one of claims 10 to 12, characterized in that they contain the promoter and possibly or other regulatory elements in the 5 'untranslated region for the expression of an enoyl [ACP] reductase.

18. Genomic clones according to one of claims 10 to 12, characterized in that they contain the promoter and possibly or other regulatory elements in the 5 'untranslated region for the expression of an acyl [ACP] thioesterase.

19. Genomic clones BnACCasegl (DSM 8480), BnACCaseglO (DSM 8481), ClACPgl (DSM 8482), ClKASg2 (DSM 8484), ClKASgβ (DSM 6485), ClKASgl3 (DSM 8466), ClKASgl9 (DSMAS4820) ), ClERg7 (DSM 8489), ClERg9 (DSM 8490), ClERglO (DSM 8491), ClERg20 (DSM 8492), ClTEg4 (DSM 8493), ClTEg7 (DSM 8494).

20. Plasmids pNBM99-TEgl (DSM 8477) and pNBM99-TEgl6 (DSM 8478). 21. A process for the production of transgenic plants, plant parts and plant products, in which a promoter and possibly or other regulatory elements in the 5 'untranslated region according to one of claims 4 to 9 or a promoter originating from the genomic clones or plasmids and optionally or other regulatory elements in the 5 'untranslated area according to one of claims 13 to 20 is coupled with a desired gene to be expressed and then transferred in a suitable vehicle.

22. Plants, parts of plants and plant products produced by a process according to claim 21.

23. Use of a promoter and possibly or other regulatory elements in the 5'-untranslated region according to one of claims 4 to 9 or a promoter originating from the genomic clones or plasmids and possibly or other regulatory elements in the 5'-untranslated region Area according to one of claims 13 to 20 for the production of plants with modified gene expression.