EP0666922A1 - Plants with reduced susceptibility to plant-parasitic nematodes - Google Patents

Plants with reduced susceptibility to plant-parasitic nematodes

Info

Publication number
EP0666922A1
EP0666922A1 EP93924590A EP93924590A EP0666922A1 EP 0666922 A1 EP0666922 A1 EP 0666922A1 EP 93924590 A EP93924590 A EP 93924590A EP 93924590 A EP93924590 A EP 93924590A EP 0666922 A1 EP0666922 A1 EP 0666922A1
Authority
EP
European Patent Office
Prior art keywords
plant
nematode
gene
cell
plants
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP93924590A
Other languages
German (de)
French (fr)
Inventor
Peter Christiaan Sijmons
Oscar Johannes Maria Goddijn
Petrus Josephus Maria Van Den Elzen
Frederique Marianne Van Der Lee
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Mogen International NV
Original Assignee
Mogen International NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Mogen International NV filed Critical Mogen International NV
Priority to EP93924590A priority Critical patent/EP0666922A1/en
Publication of EP0666922A1 publication Critical patent/EP0666922A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y106/00Oxidoreductases acting on NADH or NADPH (1.6)
    • C12Y106/02Oxidoreductases acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
    • C12Y106/02004NADPH-hemoprotein reductase (1.6.2.4), i.e. NADP-cytochrome P450-reductase
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8285Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for nematode resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0008Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0012Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0036Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6)
    • C12N9/0038Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on NADH or NADPH (1.6) with a heme protein as acceptor (1.6.2)
    • C12N9/0042NADPH-cytochrome P450 reductase (1.6.2.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y102/00Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/01Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with NAD+ or NADP+ as acceptor (1.2.1)
    • C12Y102/01009Glyceraldehyde-3-phosphate dehydrogenase (NADP+) (1.2.1.9)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • TECHNICAL FIELD This invention concerns plants with reduced susceptibility to plant-parasitic nematodes and methods for obtaining same involving recombinant DNA technology.
  • Plant-parasitic nematodes are obligate parasites. Nematodes such as cyst and root-knot nematodes are completely dependent on the formation of proper feeding structures inside the plant root. These feeding structures arise from single root cells that are selected by the nematode after invasion of the root. In the case of cyst nematodes, the IFC (initial feeding cell) develops into a syncytium through digestion of cell walls and hypertrophy. After infection with a root-knot nematode, the IFC develops into a giant cell through several nuclear divisions without cytokinesis and
  • SUBSTITUTE SHEET becomes etabolically very active.
  • the infective juvenile nematode becomes immobile and loses the ability to move to other feeding sites, illustrating their dependence on the induced nematode feeding structure (NFS) .
  • NFS induced nematode feeding structure
  • the invention provides recombinant DNA which comprises in sequence: -a promoter that is capable of driving expression of a downstream gene specifically in an initial feeding cell and/or a nematode feeding structure,
  • -a gene encoding a product that is inhibitory to an endoge ⁇ such gene encoding a protein or polypeptide selected from the group consisting of ATP synthase, adenine nucleotide trans ⁇ locator, tricarboxylate translocator, dicarboxylate trans ⁇ locator, 2-oxo-glutarate translocator, cytochrome C, pyruvate kinase, glyceraldehyde-3P-dehydrogenase, NADPH-cytochrome p450 reductase, fatty acid synthase complex, glycerol-3P- acyltransferase, hydroxymethyl-glutaryl CoA reductase, aminoacyl transferase, a transcription initiation factor, and a transcription elongation factor, and optionally -a transcription terminator and a polyadenylation signal sequence,
  • SUBSTITUTE SHEET wherein the said gene is expressed in said initial feeding cell or nematode feeding structure upon infection by the said nematode.
  • Preferred according to the invention is a recombinant DNA according to the invention, wherein said product comprises a RNA transcript that is complementary or partially complementary to the said endogenous gene tran ⁇ script.
  • a preferred nematode feeding structure-specific promoter according to the invention is one obtainable from the Delta-0.3TobRB7-5A promoter, joined to said inhibitory gene such that, upon infection of a plant parasitic nematode, the inhibitory gene is expressed specifically or predominant ⁇ ly in said nematode feeding structure.
  • the invention further provides a replicon comprising a recombinant DNA according to the invention, such as a Ti- or Ri-plasmid of an A ⁇ robacterium species or a replicon capable of replication in E. coli and A ⁇ robacteriu species, a so- called binary vector system, as well as bacterium species, such as, A ⁇ robacterium species, comprising a said replicon according to the invention.
  • a plant genome which comprises a recombinant DNA according to the invention, as well as plant cells comprising same.
  • plants comprising a cell or cells according to the invention. More preferred are plants regenerated from a cell according to the invention.
  • An especially preferred embodiment is a plant which, as a result of expression of a gene encoding a product that is inhibitory to an endogenous gene, shows reduced susceptibil ⁇ ity to a plant parasitic nematode, preferably one which belongs to the family Solanaceae. more preferably the one is Solanum tuberosum. as well as plant material, such as flowers, fruit, leaves, pollen, seeds, or tubers, obtainable from a plant according to the invention.
  • the invention also-provides a method for obtaining a plant with reduced susceptibility to a plant parasitic nematode, comprising the steps of
  • SUBSTITUTE SHEET (3) identifying a transformed plant with reduced susceptibil ⁇ ity to ,said plant parasitic nematode.
  • a method for reducing damage to a crop due to plant parasitic nematodes, by growing plants according to the invention.
  • reduced susceptibility to plant parasitic nematodes is engineered in tobacco, potato and Arabidopsis plants by interfering with the autonomous, primary metabolism of cells comprising the feeding structure.
  • the inven ⁇ tion is outlined in somewhat more detail through antisense expression of the homologous gene coding for essential steps in primary metabolic pathways.
  • potato the example is given for a gene coding for the mitochondrial adenine nucleotide translocator (Winning et al. 1992 Plant J. 2.' 763- 773) .
  • Arabidopsis the example is described for NADPH- cytochrome P450 reductase ATR2 (Mignote-Vieux et al.
  • Disrupter genes may be selected from such genes as formed by the group consisting of (a) genes encoding ribozymes against an endogenous RNA transcript, (b) genes which when transcribed produce RNA transcripts that are complementary or at least partially complementary to RNA transcripts of endogenous genes that are essential for cell viability, a method known as antisense inhibition of gene expression (disclosed in EP-A 240 208), or (c) genes that when transcribed produce RNA transcripts that are identical or at least very similar to transcripts of endogenous genes that are essential for cell viability, an as yet unknown way of inhibition of gene expression referred to as co-suppression (disclosed by Napoli C. et al., 1990, The Plant Cell 2 , 279-289).
  • antisense genes to inhibit expression of endoge ⁇ nous genes essential for cell viability, which genes are expressed in the nematode feeding structures by virtue of a suitable nematode-specific promoter fused upstream to the said antisense gene.
  • Target genes for antisense disrupter genes are selected from those coding for enzymes that are essential for cell viability, also called housekeeping enzymes, and should be nuclear encoded, preferably as single copy genes, although a small size gene family would also be suitable for the purpose of the invention.
  • the effect of antisense expression of said genes must not be nullified by diffusion or translocation from other cells or organelles of enzyme products normally synthesized by such enzymes.
  • genes coding for membrane-translocating enzymes are chosen as
  • SUBSTITUTE SHEET these are involved in establishing chemical gradients across organellar membranes. Inhibition of such proteins by anti ⁇ sense expression can not, by definition, be cancelled by diffusion of substrates across the membrane in which these proteins reside.
  • the translocated compound is not limited to organic molecules but can be of inorganic nature; e. ⁇ . P, H, OH or electrons.
  • the membrane-translocating enzymes should be present in organelles that increase in numbers during para- sitism, thereby illustrating the essential role that such organelles have in cells comprising the NFS.
  • organelles are mitochondria, endoplasmic reticulum and plas odesmata (Hussey et al. 1992 Protoplasma 167;55-65. Magnusson & Golinowski 1991 Can. J. Botany 69;44- 52).
  • a list of target enzymes is given in Table 1 by way of example but the invention is not limited to the enzymes mentioned in this table. More detailed listings can be assembled from series as Biochemistry of Plants (Eds. Stumpf & Conn, 1988-1991, Vols. 1-16 Academic Press) or Encyclopedia of Plant Physiology (New Series, 1976, Springer-Verlag, Berlin) .
  • ATP synthase mitochondrion adenine nucleotide translocator mitochondrion phosphate translocator mitochondrion tricarboxylate translocator mitochondrion dicarboxylate translocator mitochondrion 2-oxo-glutarate translocator mitochondrion cytochrome C mitochondrion pyruvate kinase glycolysis glyceraldehyde-3P-dehydrogenase glycolysis
  • NADPH-cytochrome P450 reductase lipid metabolism fatty acid synthase complex lipid metabolism glycerol-3P-acyltransferase lipid metabolism hydroxymethyl-glutaryl CoA reductase mevalonic acid pathway aminoacyl transferase nucleic acid metabolism transcription factors nucleic acid metabolism elongation factors nucleic acid metabolism
  • homologous genes genes obtainable from the same plant species as the plant host.
  • Heterologous for the purpose of this specication shall mean obtainable from a different plant or non-plant species.
  • Heterologous shall also comprise synthetic analogs of genes, modified in their mRNA encoding nucleic acid sequence to diverge at least 5% of the host gene.
  • house ⁇ keeping genes are in general highly conserved, heterologous probes from other (plant) species can be used to isolate the corresponding gene from the crop species that is to be made resistant. Such gene isolations are well within reach of those skilled in the art and, in view of the present teaching require no undue experimentation.
  • promoter-sequences can be isolated from genomic DNA and used for cloning in front of a
  • SUBSTITUTE SH ⁇ - marker gene such as GUS (Jefferson et al. 1987 EMBO J. £,-3901-3907) ..This expression construct can then be and integrated into the plant genome. Regenerated plants can then be infected with PPN and used for histochemical GUS analysis of entire plants and the feeding structures in particular.
  • Alternative disrupter genes may be selected on the basis of the availability of mutants in unicellular eukaryotes such as yeast or Chlamvdomonas can be used as indication. If for a particular enzyme, a large number of mutants are available then it is likely that this enzyme is redundant, present as multi-copy gene families, or that alternative pathways are available to circumvent the mutated enzyme (Strathern, Jones & Broach (Eds.) 1981 The molecular biology of the yeast Saccharomvces cerevisiae. Cold Spring Harbor Laboratory Press, New York) . Such genes are less suitable for the methods described in this invention.
  • the following promoter sequence can be used as nematode feeding site specific promoter; a truncated version of a tobacco root-specific promoter ⁇ .3TobRB7 (Yamamoto et al. 1991 Plant Cell 3.; 371-382) .
  • the full length sequence of the TobRB7 promoter is highly active inside NFS and this activity becomes more specific for the NFS when the truncated ⁇ 0.3 version of the promoter is used (Taylor et al. 1992, Proc. 31st Ann. Meeting Amer. Soc. Nematologists, Vancouver Canada) .
  • Terminator sequences include any such sequence func ⁇ tioning as such in plants, the choice of which is within the level of skill of the average skilled person in the art.
  • SUBSTITUTE SHEET example of such sequences is the 3 * flanking region of the nopaline synthase (nos) gene of A ⁇ robacterium tumefaciens (Bevan, 1984, Nucl. Acids Res. 12, 8711-8721) .
  • a suitable promoter can be isolated via genes that are expressed at increased levels inside the NFS during nematode infection. Such genes can be isolated through differential screening of cDNA clones made from mRNA extracted from infected and healthy roots as was demonstrated for potato (Gurr S.J. et al. 1991, Mol. Gen. Genet. 226. 361-366). Although such promoters have never been described in detail, they can be selected and isolated in a well known manner from a plant by:
  • the infected roots used for mRNA isolation should be enriched for NFS e. ⁇ . by synchronous infection (Hammond- Kosack et al. 1989 Physiol. Mol. Plant. Pathol. 25, 495-506) or through direct isolation of feeding structures from plants in which NFS are visible at low magnification.
  • feeding-structures that develop inside Arabidopsis roots can be seen at low magnification and are easy to isolate with a minimum of contaminating cells (Sijmons et al. 1991, Plant J. 1 , 245-254) .
  • This allows the isolation, preferably using molecular enrichment procedures (Dickinson et al.. 1991 Adv. Mol. Gen. Plant-Microbe Interact.
  • SUBSTITUTE SHEET for use in a similar strategy as described in this invention.
  • Upstream sequences of identified genomic clones can be fused to a gene for insertion in a suitable expression vector for plant transformation such as pMOG22 or pMOG23.
  • suitable promoters for expression of can be isolated via interposon tagging (Topping et al.. 1991, Developm. 112, 1009-1019) .
  • interposon tagging Topping et al.. 1991, Developm. 112, 1009-1019
  • a number of different transgenic plants are regenerated after transform ⁇ ation with T-DNA from A ⁇ robacterium carrying promoterless GUS constructs such as described by Topping et al. (1991, De ⁇ velopm. 112. 1009-1019) or pMOG452 as described in the Examples.
  • Plant Mol. Biol. 12 / 151-153 Once suitable regulatory sequences are identified or genes that are transcribed inside NFS, they can be used as probes for the isolation of homologous sequences from other plant species. In turn, these sequences from other species can be fused to a disrupter gene for insertion in a suitable vector for plant transformation.
  • the application of this invention is not restricted to the plant species that are shown by way of demonstration. The choice of the plant species is primarily determined by the amount of damage through PPN infections estimated to occur in agriculture and the amenability of the plant species to transformation. Plant genera which are damaged during agri- cultural practice by PPN and which can be made significantly less susceptible to PPN by ways of the present invention include but are not limited to the genera mentioned in Table 2.
  • SUBSTITUTE SHEET present invention belong to the superfamily Heteroderoidea and are divided among the families Heteroderidae and Meloi- do ⁇ vnidae and include, but are not limited to the species mentioned in Table 2.
  • the choice of the plant species is primarily determined by the amount of damage through PPN infections estimated to occur in agriculture and the amenability of the plant species to transformation.
  • Plant genera which are damaged during agricultural practice by PPN and which can be made signifi- cantly less susceptible to PPN by ways of the present inven ⁇ tion include but are not limited to the genera mentioned in Table 2.
  • Nematode species as defined in the context of the present invention include all plant-parasitic nematodes that modify host cells into specially adapted feeding structures which range from migratory ectoparasites (e. ⁇ . Xiphinema spp.) to the more evolved sedentary endoparasites (e. ⁇ . Heteroderidae, Meloido ⁇ vnae or Rotylenchulinae) .
  • migratory ectoparasites e. ⁇ . Xiphinema spp.
  • sedentary endoparasites e. ⁇ . Heteroderidae, Meloido ⁇ vnae or Rotylenchulinae
  • the methods according to the invention to combat damage to crops due to nematode invasion is likewise applicable with non-nematode pests and pathogens, whenever said pathogen or- pest locally down-regulates plant promoters at the site of infestation (e. ⁇ . in fungi-induced haustoria or aphid-induced galling) .
  • the principle of effecting the production of a neutralizing sxibstance in all or most of the non-infestated plant parts to neutralize a cell disruptive substance the production of which is effected in at least the site of infestation, is independent of the type or species of the pathogen or pest.
  • a plant is said to show reduced susceptibility to PPN if a statistically signi ⁇ ficant decrease in the number of mature females developing at the surface of plant roots can be observed as compared to control plants.
  • Susceptible / resistance classification according to the number of maturing females is standard practice both for cyst- and root-knot nematodes (e. ⁇ . LaMon- dia, 1991, Plant Disease 15. ⁇ 453-454; Omwega et al.. 1990, Phytopathol. .80 / 745-748).
  • the basic principle of reducing the plant s susceptibi ⁇ lity to plant parasitic nematodes according to the invention is the manipulation of the nematode feeding structure.
  • Manipulation of the nematode feeding structure for the purpose of this description of the invention shall include both preventing or retarding NFS formation as well as disrup-
  • a disruptive gene is under the control of a promoter that drives expression of the disrupter gene in a more advanced stage of NFS formation causing the NFS to decline or to collapse. Either of these two extremes will provide the infected plant with decreased susceptibility towards the invading nematode.
  • the expression "disruption of the NFS” shall include retardation of NFS formation, decline of NFS formation once formed, or in the process of being formed, as well as total collapse of the NFS formed.
  • Reduced susceptibility to a plant parasitic nematode may be the result of a reduction of the number of NFS of the infected plant root, a reduction in the advancement of NFS formation, or a combination of both effects.
  • a nematode feeding structure shall include an initial feeding cell, which shall mean the cell or a very limited number of cells destined to become a nematode feeding structure, upon induction of the invading nematode.
  • a NFS disruptive effect according to the invention is not limited to adverse effects on the NFS only; also disrup ⁇ tive effects are contemplated that in addition have an adverse effect on nematode development by way of direct interaction.
  • SUBSTITUTE SHEET methods transformation systems involving vectors are widely available, such as viral vectors (e.g. from the Cauliflower Mosaic Virus (CaMV) and bacterial vectors (e.g. from the genus A ⁇ robacterium) (Potrykus, 1990, Bio/Technol. 8., 535- 542).
  • viral vectors e.g. from the Cauliflower Mosaic Virus (CaMV)
  • bacterial vectors e.g. from the genus A ⁇ robacterium
  • the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art (Horsch et al.. 1985, Science 225, 1229-1231) .
  • the choice of the transformation and/or regeneration techniques is not critical for this invention.
  • binary vector system (disclosed in EP-A 120 516) in which A ⁇ robacterium strains are used which contain a helper plasmid with the virulence genes and a compatible plasmid, the binary vector, containing the gene construct to be transferred.
  • This vector can repli ⁇ cate in both E.coli and in A ⁇ robacterium; the one used here is derived from the binary vector Binl9 (Bevan, 1984, Nucl. Acids Res. 12 . , 8711-8721) .
  • the binary vectors as used in this example contain between the left- and right-border sequences of the T-DNA, an identical NPTII-gene coding for kanamycin resistance (Bevan, 1984, Nucl. Acids Res. 12., 8711-8721) and a multiple cloning site to clone in the required gene con ⁇ structs.
  • the transformation and regeneration of monocotyledonous crops is not a standard procedure. However, recent scientific progress shows that in principle monocots are amenable to transformation and that fertile transgenic plants can be regenerated from transformed cells. The development of reproducible tissue culture systems for these crops, together with the powerful methods for introduction of genetic materi ⁇ al into plant cells has facilitated transformation.
  • SUBSTITUTE SHEET into embryogenic cells of a maize suspension culture by microparticle..bombardment (Gordon-Kamm, 1990, Plant Cell, 2 , 603-618) .
  • the introduction of genetic material into aleurone protoplasts of other monocot crops such as wheat and barley has been reported (Lee, 1989, Plant Mol. Biol. 13., 21-30).
  • Wheat plants have been regenerated from embryogenic suspensi ⁇ on culture by selection only the aged compact and nodular embryogenic callus tissues for the establishment of the embryogenic suspension cultures (Vasil, 1990 Bio/Technol. 8., 429-434) .
  • the combination with transformation systems for these crops enables the application of the present invention to monocots. These methods may also be applied for the transformation and regeneration of dicots.
  • Suitable selectable marker genes may be selected from any one of the following non-limitative list: neomycin phosphotranspherase genes conferring resistance to kanamycin (EP-B 131 623) , the hygromycin resistance gene (EP 186 425 A2) the Glutathione-S-transferase gene from rat liver confer- ring resistance to glutathione derived herbicides (EP-A 256 223) , glutamine synthetase conferring upon overexpression resistance to glutamine synthetase inhibitors such as phosp ⁇ hinothricin (WO87/05327) , the acetyl transferase gene from Streptomvces viridochromo ⁇ enes conferring resistance to the selective agent phosphinothricin (EP-A 275 957) , the gene encoding a 5-enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N-phospho
  • EPSPS 5-enolshikim
  • the marker gene and the gene of interest do not necessa ⁇ rily have to be linked, since co-transformation of unlinked genes (U.S. Patent 4,399 r 216) is also an efficient process in plant transformation.
  • the binary vector pMOG23 is a derivative of vector Binl9 (Bevan, 1984, Nucl. Acids Res. 12, 8711-8721).
  • the vector Binl9 is changed in a way not essential for the present invention, using techniques familiar to those skilled in the art of molecular biology. First, the positions of the left border (LB) and the right border (RB) are swit ⁇ ched with reference to the neomycine phosphotransferase gene II (NPTII gene) . Secondly, the orientation of the NPTII gene is reversed giving transcription in the direction of LB.
  • Binl9 is replaced by a polylinker with the following restriction enzyme recognition sites: EcoRI, S al, BamHI, Xbal. SacI, Xhol and Hindlll ( Figure 1).
  • a cloning vector pMOG707 is constructed, containing a right border T-DNA sequence, a multiple cloning site and a terminator for the purpose of cloning different promoter/gene combinations on a suitable fragment.
  • This vector is construc- ted in the following manner: in the cloning vector pMTL26 (Chambers et al. 1988 Gene .68. / 139-149) the Xhol site is removed by Xhol digestion, blunt-ended with Klenow polymerase followed by religation, resulting in pMTL26/2.
  • This modified pMTL vector is used to clone the EcoRI - B ⁇ lll fragment from pMOG23, containing the multiple cloning site and the right border sequences, resulting in pMOG584bis.
  • the polylinker sequence is extended by inserting a synthetic linker between the BamHI and Xhol site, thus creating additional Ncol, Xhol and Xbal sites. Subsequently, the nopaline synthase trans-
  • SUBSTITUTE SHEET cription terminator is isolated as a BamHI/Hindlll fragment from the plasmid ROK1 (Baulcombe et al. 1986, Nature 321; 446) , ligated to a synthetic adaptor such that the Hindlll site is not recovered and an EcoRI site is introduced and subsequently cloned into the extended pMOG584bis as a BamHI - EcoRI fragment, resulting in plasmid pMOG707( Figure 2).
  • HB101 (containing plasmid RK2013) (Ditta et al.. 1980, Proc.
  • a binary vector system was used to transfer gene constructs into Arabidopsis plants.
  • the helper plasmid conferring the A ⁇ robacterium tumefaciens virulence functions was derived from the octopine Ti-plasmid pTiB6.
  • MOGlOl is a A ⁇ robacterium tumefaciens strain carrying a non-oncogenic Ti-plasmid (Koekman et al. 1982, Plasmid 1_, 119-132) from which the entire T-region was deleted and substituted by a bacterial Spectinomycin resistance marker from transposon Tn 1831 (Hooykaas et al.. 1980 Plasmid 4., 64-75) .
  • the Ti-plasmid pTiB6 contains two adjacent T-regions, TL (T-left) and TR (T-right) .
  • Plasmid pMOG579 is a pBR322 derivative, which contains the 2 Ti-plasmid fragments that are located to the left and right, outside the T-regions ( Figure 3) .
  • the 2 fragments (shown in dark) are seperated in pMOG579 by a 2.5 kb BamHI - Hindlll fragment from transposon Tnl831 (Hooykaas et al.. 1980 Plasmid 4., 64-75) carrying the spectinomycin
  • SUBSTITUTE SHEET resistance marker ( Figure 4) .
  • EXAMPLE III Isolation of a promoter fragment DeltaO.3TobRB7 from tobacco
  • the DeltaO.3TobRB7-5A promoter sequence (Yamamoto et al. 1991, Plant Cell 3.: 371-382) was isolated by a two-step PCR on genomic DNA isolated from tobacco. In the first PCR reaction, part of the TobRB7-5A gene is being isolated using the following primers: 5' primer: 5' CTCCAAATACTAGCTCAAAACC 3' (SEQIDNO:l)
  • 5' primer 5' CTTGAATTCTAGATAAGCTTATCTAAAC 3' (SEQIDNO:3)
  • NADPH-cytochrome P450 reductase ATR1 (EMBL accession number X66016) is isolated from Arabidopsis tha- liana var. Landsberg erecta using PCR technology on cDNA made of mRNA from this species.
  • the primer set 5' GGCGGATCGGAGCGG- GGAGCTGAAG 3' (SEQIDNO:5) and 5" GATACCATGGATCACCAGACATCTCTG 3' (SEQIDN0:6) is used to amplify the sequence of interest. This introduces a Ncol site on the N-terminus of the PCR fragment.
  • the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707.
  • the truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 2? 371-382) , isolated as described in Example Illm, can then be inserted as a Xbal - Ncol fragment.
  • the entire sequence is then cloned into the binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restriction enzymes, resulting in binary vector pMOG711 ( Figure 5) .
  • Arabidopsis is transformed by cocultivation of plant tissue with A ⁇ robacterium tumefaciens strain MOGlOl contain- ing the binary vector pMOG711. Transformation is carried out using cocultivation of Arabidopsis thaliana (ecotype C24) root segments as described by Valvekens et al. (1988, Proc. Nat. Acad. Sci. USA £5, 5536-5540) . Transgenic plants are regenerated from shoots that grow on selection medium (50 mg/1 kanamycin) , rooted and transferred to germination medium or soil. Young plants can be grown to maturity and allowed to self-pollinate and set seed.
  • selection medium 50 mg/1 kanamycin
  • NADPH-cytochrome P450 reductase ATR2 (EMBL accession number X66017) is isolated from Arabidopsis tha- liana var. Landsberg erecta using PCR technology on cDNA made of mRNA from this species.
  • the primer set 5' GGTTCTGGGGATCCA- AAACGTGTCGAG 3' (SEQIDNO:7) and 5 1 GGCTTCCATGGTTTCGTTACCATACATC 3 1 (SEQIDNO:8) is used for amplification. This introduces both a BamHI and a Ncol flanking the PCR fragment.
  • the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707.
  • the truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 2»" 371-382) , isolated as described in Example Illm, can then be inserted as a Xbal - Ncol fragment.
  • the entire sequence is then cloned into the binary vector pMOG23 after digestion with Xhol and partial digestion with EcoRI or, alternatively, after digestion with Xbal and partial digestion with EcoRI, resulting in binary vector pM0G712 ( Figure 5) .
  • pMOG445 is a pUC18 derivative that contains, by insertion of an oligo adaptor in the multiple cloning site, the extra restriction sites Clal.
  • Illm is then inserted as a Xbal - Ncol fragment.
  • the entire sequence is then cloned into the binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restric ⁇ tion enzymes, resulting in binary vector pMOG7l3 ( Figure 5) .
  • Arabidopsis is transformed by cocultivation of plant tissue with A ⁇ robacterium tumefaciens strain MOGlOl contain- ing the binary vector pM0G712. Transformation is carried out using cocultivation of Arabidopsis thaliana (ecotype C24) root segments as described by Valvekens et al. (1988, Proc. Nat. Acad. Sci. USA 85_ / 5536-5540). Transgenic plants are regenerated from shoots that grow on selection medium (50
  • the clone for the mitochondrial adenine nucleotide translocator (PANT1, EMBL accession number X57557; Winning et al. 1992 Plant J. 2.; 763-773) is isolated from Solanum tuberosum using PCR technology on cDNA made of mRNA from this species.
  • the primer set 5 ⁇ GCTAGCCGGATCCATCTGAGCTCCAG 3 ' (SEQIDNO:ll) and 5' GACGTCCATGGCTGAATTAGCCACCACCG3 • (SEQIDNO:12) is used for amplification. This introduces both a BamHI and a Ncol flanking the PANT1 clone.
  • the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707.
  • the truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 2' 371-382) , isolated as described in Example Illm, is then be inserted as a Xbal - Ncol fragment.
  • the entire sequence is then cloned into the . binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restriction sites, resulting in binary vector pMOG714 ( Figure 5) .
  • Potato is transformed by cocultivation of plant tissue with A ⁇ robacterium tumefaciens strain LBA4404 containing the binary vector pMOG714. Transformation is carried out using cocultivation of potato (Solanum tuberosum var. Desiree) tuber disks as described by Hoekema et al. 1989, Bio/Techn. 2 273-278) . Transgenic plants are regenerated from shoots that grow on selection medium (100 mg/1 kanamycin) , rooted,
  • EXAMPLE VIII Clonin ⁇ of chimaeric DNA sequences of the DeltaO.3 TobRB7 promoter and the antisense ATP svnthase gene for specific repression of the nematode-induced feeding structures in tobacco.
  • the clone for the beta subunit of ATP synthase (Boutry & Chua 1985 EMBO J. 4_; 2159-2165) is isolated from tobacco (Nicotiana plu baginifolia) using PCR technology on cDNA made of mRNA from this species.
  • CCCTCCAGGATCCCTTCTCGGAGGCTTC 3' (SEQIDNO:13) and 5 » GAAAAGAAAGCCATGGAACTTTATAATC 3' (SEQIDNO: 14) is used for amplification. This introduces both a BamHI and a Ncol flanking the ATP synthase clone. Subsequently, the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707. The truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al.
  • Tobacco is transformed by cocultivation of plant tissue with Agrobacterium tumefaciens strain LBA4404 (Hoekema et al. 1983, Nature 303. 179-180) containing the binary vector pMOG715 Transformation is carried out using cocultivation of tobacco (Nicotiana tabacum SRI) leaf disks as described by Horsch et al. 1985, Science 227. 1229-1231) .
  • Transgenic plants are regenerated from shoots that grow on selection medium (100 mg/1 kanamycin), rooted and transferred to soil.
  • Transgenic Arabidopsis plants can be assayed both in vitro or in soil for resistance against M. incognita or the cyst nematode H. schachtii.
  • seeds are surface sterilized, grown and inoculated as described by Sijmons et al. (1991, Plant J. l ⁇ 245-254) .
  • seedlings are germinated on kanamycin-containing medium (10 mg/ml) and kanamycin-resistant seedlings are transferred to soil/sand mixtures (1:3 v/v) in 1x1x6 cm transparent plastic tubes. Once the rozettes are well devel ⁇ oped (ca. 14 days) the containers are inoculated with ca.
  • SPPN Transgenic potato plants can be assayed for resistance against M. incognita using soil that is preinfected with M. incognita egg masses mixed with sand (1:3 w/w) , growing the potato plants in that soil mixture for 6 weeks and , after removing the soil, count the developed number of galls on a root system.
  • a closed container is used to assay for resistance against Globodera ssp.
  • three replicate 2-4 cm tubers are transferred to soil which is pre-inoculated with cysts from G. rostochiensis or G. pallida in transparent containers.
  • the peripheral root systems can be analyzed visually 7-8 weeks after germination
  • SUBSTITUTESHEET for the presence of cysts.
  • a genotype will be scored as resistant if one of the three replicates had cysts and susceptible if at least one of the three replicates shows cysts.
  • M. incognita egg masses For anlysis of nematode resistance, the soil is preinfected with M. incognita egg masses. This inoculum can be produced by maintaining a stock culture of M. incognita on soil grown celery plants (Apium graveolens) under standard greenhouse conditions, below 25°C. Mature celery root systems, contain ⁇ ing a high number of root knots and mature females of M_j_ incognita, are carefully dusted off to remove the soil, homogenized briefly in a Waring blendor (2 seconds) and weighed in portions of 60 gram. These root samples are mixed with 1 kg sand:potting soil (1:1) mixtures and used for growth of transgenic tobacco transformants.
  • primary kanamycin resistant transformants are used as control plants. Per construct, 100 primary transformants are grown in infected soil for 6 weeks. The soil/sand mixture is washed away carefully and the number of galls / root system is counted with a binocular. Control plants have a mean of 25 ⁇ 11 galls. A genotype is considered resistant when the mean number of galls is reduced to 2 per root system. The primary transformants meet this requirement, can than be used for a rapid multiplication cycle by placing transformed leaves again on media that allows shoot regene- ration (Horsch et al. 1985, Science 227. 1229-1231) or the plants can be grown to maturity and allowed to flower and seed setting and used for more extensive testing of nematode resistance using 100 plants of each genotype.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The present invention provides recombinant DNA containing a plant expressible gene which comprises in sequence: a promoter that drives expression of a downstream gene specifically in an initital feeding cell and/or a nematode feeding structure, a gene encoding a product that is inhibitory to an endogenous gene encoding a protein or polypeptide selected from the group consisting of ATP synthase, adenine nucleotide translocator, tricarboxylate translocator, dicarboxylate translocator, 2-oxo-glutarate translocator, cytochrome C, pyruvate kinase, glyceraldehyde-3P-dehydrogenase, NADPH-cytochrome p450 reductase, fatty acid synthase complex, glycerol-3P-acyltransferase, hydroxymethyl-glutaryl CoA reductase, aminocyl transferase, a transcription initiation factor, and a transcription elongation factor, a transcription terminator and a polyadenylation signal sequence, and wherein the said gene is expressed in said initial feeding cell or nematode feeding structure upon infection by the said nematode. The invention further provides plasmids, bacterial cells, recombinant plant genomes, as well as plant cells, plants and parts thereof, still harbouring recombinant genomes. The invention further provides plants with reduced susceptibilitiy against plant parasitic nematodes, as well as methods for obtaining same. Growing plants according to the invention in the field reduces yield losses due to nematode attack and/or reduces nematode populations in the soil.

Description

PLANTS WITH REDUCED SUSCEPTIBILITY TO PLANT-PARASITIC
NEMATODES
TECHNICAL FIELD This invention concerns plants with reduced susceptibility to plant-parasitic nematodes and methods for obtaining same involving recombinant DNA technology.
BACKGROUND OF THE INVENTION Plant-parasitic nematodes worldwide cause diseases of nearly all crop plants of economic importance with estimated losses of about $ 5.8 billion/yr in the Unites States alone (Sasser and Freckman, 1987, World prospective on nematology In: Vistas on Nematology, Eds. Veech & Dickson. Hyatts Will, Maryland, pp. 7-14) . While in tropical regions losses caused by nematodes are due mainly to root-knot nematodes (Meloido- cryne) , in Europe cyst nematodes of the genera Globodera and Heterodera are regarded as serious pests and important limiting factors in e.g. potato, rapeseed and sugarbeet cultivation, respectively. Only a small number of resistant crop varieties have emerged from breeding programmes for e.g. potato, sugarbeet, tomato, soybean and oil radish (Dropkin, 1988, Ann. Rev. Phytopath. 26., 145-161; Trudgill, 1991, Ann. Rev. Phytopath. 29_, 167-192) . The resistance is often based on single R-genes (Rick & Fobes, 1974, Tomato Gen. Coop. 24, 25; Barone et al. 1990, Mol. Gen. Genet. 224. 177-182) and leads to breakdown of resistance after several generations (Shidu & Webster, in: Plant Parasitic Nematodes, Vol. Ill, 1981, Zuckerman et al. (eds.) Acad. Press, New York, pp 61- 87; Turner, 1990, Ann. Appl. Biol. 117. 385-397).
Plant-parasitic nematodes are obligate parasites. Nematodes such as cyst and root-knot nematodes are completely dependent on the formation of proper feeding structures inside the plant root. These feeding structures arise from single root cells that are selected by the nematode after invasion of the root. In the case of cyst nematodes, the IFC (initial feeding cell) develops into a syncytium through digestion of cell walls and hypertrophy. After infection with a root-knot nematode, the IFC develops into a giant cell through several nuclear divisions without cytokinesis and
SUBSTITUTE SHEET becomes etabolically very active. During establishment of the feeding structure, the infective juvenile nematode becomes immobile and loses the ability to move to other feeding sites, illustrating their dependence on the induced nematode feeding structure (NFS) .
Recent published methods to engineer nematode resistance (PCT WO92/04453) involve the modification of a gene that is specifically induced in the NFS after nematode infection. The local expression of phytotoxic genes would inhibit the development of the feeding structures, thus making a plant essentially resistant. This approach is strictly dependent on the availability of a promoter that is highly specific for nematode-induced feeding structures (NFS) . Any promoter activity outside this structure will have adverse effects on plant development and crop yield. A highly NFS-specific promoter has been disclosed by Taylor et al. (1992, Proc. 31st Annual Meeting Amer. Soc. Nematologists, Vancouver Canada) and involves a truncated version of a root specific regulatory sequence (Δ0.3 TobRB7 as described in Yamamoto, 1991 Plant Cell 2; 371-382) .
SUMMARY OF THE INVENTION
The invention provides recombinant DNA which comprises in sequence: -a promoter that is capable of driving expression of a downstream gene specifically in an initial feeding cell and/or a nematode feeding structure,
-a gene encoding a product that is inhibitory to an endoge¬ nous gene encoding a protein or polypeptide selected from the group consisting of ATP synthase, adenine nucleotide trans¬ locator, tricarboxylate translocator, dicarboxylate trans¬ locator, 2-oxo-glutarate translocator, cytochrome C, pyruvate kinase, glyceraldehyde-3P-dehydrogenase, NADPH-cytochrome p450 reductase, fatty acid synthase complex, glycerol-3P- acyltransferase, hydroxymethyl-glutaryl CoA reductase, aminoacyl transferase, a transcription initiation factor, and a transcription elongation factor, and optionally -a transcription terminator and a polyadenylation signal sequence,
SUBSTITUTE SHEET and wherein the said gene is expressed in said initial feeding cell or nematode feeding structure upon infection by the said nematode. Preferred according to the invention is a recombinant DNA according to the invention, wherein said product comprises a RNA transcript that is complementary or partially complementary to the said endogenous gene tran¬ script. A preferred nematode feeding structure-specific promoter according to the invention is one obtainable from the Delta-0.3TobRB7-5A promoter, joined to said inhibitory gene such that, upon infection of a plant parasitic nematode, the inhibitory gene is expressed specifically or predominant¬ ly in said nematode feeding structure.
The invention further provides a replicon comprising a recombinant DNA according to the invention, such as a Ti- or Ri-plasmid of an Aσrobacterium species or a replicon capable of replication in E. coli and Aαrobacteriu species, a so- called binary vector system, as well as bacterium species, such as, Aσrobacterium species, comprising a said replicon according to the invention. Another embodiment of the invention is a plant genome which comprises a recombinant DNA according to the invention, as well as plant cells comprising same. Also preferred embodiments are plants comprising a cell or cells according to the invention. More preferred are plants regenerated from a cell according to the invention.
An especially preferred embodiment is a plant which, as a result of expression of a gene encoding a product that is inhibitory to an endogenous gene, shows reduced susceptibil¬ ity to a plant parasitic nematode, preferably one which belongs to the family Solanaceae. more preferably the one is Solanum tuberosum. as well as plant material, such as flowers, fruit, leaves, pollen, seeds, or tubers, obtainable from a plant according to the invention.
The invention also-provides a method for obtaining a plant with reduced susceptibility to a plant parasitic nematode, comprising the steps of
(1) transforming a recipient plant cell with recombinant DNA according to the invention,
(2) generating a plant from a transformed plant cell,
SUBSTITUTE SHEET (3) identifying a transformed plant with reduced susceptibil¬ ity to ,said plant parasitic nematode.
According to another aspect of the invention a method is provided for reducing damage to a crop due to plant parasitic nematodes, by growing plants according to the invention.
The meaning of the expressions used herein, as well as the application and the advantages of the invention will become clear from the following detailed description of the invention.
BRIEF DESCRIPTION OF THE FIGURES Figure 1. Binary vector pMOG23
Figure 2. Plasmid pMOG707, intermediate vector constructed for cloning purposes. Figure 3. Restriction map of fragment from Ti-plasmid pTiB6 Figure 4. Intermediate vector pMOG579
Figure 5. Binary vectors pMOG711 - pMOG715. These plasmids are derivatives of pMOG23 and contain a truncated Δ0.3 TobRB7 promoter and an antisense construct of a gene that is essential for cell viability.
DETAILED DESCRIPTION
In the examples accompanying this description of the invention reduced susceptibility to plant parasitic nematodes is engineered in tobacco, potato and Arabidopsis plants by interfering with the autonomous, primary metabolism of cells comprising the feeding structure. In particular, the inven¬ tion is outlined in somewhat more detail through antisense expression of the homologous gene coding for essential steps in primary metabolic pathways. For potato, the example is given for a gene coding for the mitochondrial adenine nucleotide translocator (Winning et al. 1992 Plant J. 2.' 763- 773) . For Arabidopsis, the example is described for NADPH- cytochrome P450 reductase ATR2 (Mignote-Vieux et al. 1992 EMBL accession number X66017) . For tobacco, the example is described using a gene coding for the beta subunit of the mitochondrial ATP-synthase (Boutry & Chua, 1985 EMBO J. 4.; 2159-2165) . The examples are described using the regulatory promoter sequence Δ0.3 (Taylor et al. 1992, Proc. 31st Ann.
SUBSTITUTE SHEET Meeting Amer. Soc. Nematologists, Vancouver Canada) of the TobRB7 gene (Yamamoto et al. 1991, Plant Cell 3 ~ 371-382) to ensure that expression is limited to the feeding structure. Although exemplified in somewhat more detail for three plant species, the invention is not limited to any plant or nematode species.
Interference with autonomous primary metabolism brought about by disrupting genes inhibitory to an endogenous gene that encodes a protein or polypeptide product that is essen- tial for cell viability. Disrupter genes according to the invention may be selected from such genes as formed by the group consisting of (a) genes encoding ribozymes against an endogenous RNA transcript, (b) genes which when transcribed produce RNA transcripts that are complementary or at least partially complementary to RNA transcripts of endogenous genes that are essential for cell viability, a method known as antisense inhibition of gene expression (disclosed in EP-A 240 208), or (c) genes that when transcribed produce RNA transcripts that are identical or at least very similar to transcripts of endogenous genes that are essential for cell viability, an as yet unknown way of inhibition of gene expression referred to as co-suppression (disclosed by Napoli C. et al., 1990, The Plant Cell 2 , 279-289).
According to a preferred embodiment of the invention use is made of antisense genes to inhibit expression of endoge¬ nous genes essential for cell viability, which genes are expressed in the nematode feeding structures by virtue of a suitable nematode-specific promoter fused upstream to the said antisense gene. Target genes for antisense disrupter genes are selected from those coding for enzymes that are essential for cell viability, also called housekeeping enzymes, and should be nuclear encoded, preferably as single copy genes, although a small size gene family would also be suitable for the purpose of the invention. Furthermore, the effect of antisense expression of said genes must not be nullified by diffusion or translocation from other cells or organelles of enzyme products normally synthesized by such enzymes. Preferably, genes coding for membrane-translocating enzymes are chosen as
SUBSTITUTE SHEET these are involved in establishing chemical gradients across organellar membranes. Inhibition of such proteins by anti¬ sense expression can not, by definition, be cancelled by diffusion of substrates across the membrane in which these proteins reside. The translocated compound is not limited to organic molecules but can be of inorganic nature; e.σ. P, H, OH or electrons.
Preferably, the membrane-translocating enzymes should be present in organelles that increase in numbers during para- sitism, thereby illustrating the essential role that such organelles have in cells comprising the NFS. Specific examples for such organelles are mitochondria, endoplasmic reticulum and plas odesmata (Hussey et al. 1992 Protoplasma 167;55-65. Magnusson & Golinowski 1991 Can. J. Botany 69;44- 52). A list of target enzymes is given in Table 1 by way of example but the invention is not limited to the enzymes mentioned in this table. More detailed listings can be assembled from series as Biochemistry of Plants (Eds. Stumpf & Conn, 1988-1991, Vols. 1-16 Academic Press) or Encyclopedia of Plant Physiology (New Series, 1976, Springer-Verlag, Berlin) .
Although only in some cases, the genes coding for these enzymes have been isolated and, therefore, the number of gene copies are not known, the criteria that have to be met are described in this invention.
SUBSTITUTE SHEE- TABLE 1 EXAMPLES OF TARGET ENZYMES FOR ANTISENSE EXPRESSION
enzyme pathway/orσanelle
ATP synthase mitochondrion adenine nucleotide translocator mitochondrion phosphate translocator mitochondrion tricarboxylate translocator mitochondrion dicarboxylate translocator mitochondrion 2-oxo-glutarate translocator mitochondrion cytochrome C mitochondrion pyruvate kinase glycolysis glyceraldehyde-3P-dehydrogenase glycolysis
NADPH-cytochrome P450 reductase lipid metabolism fatty acid synthase complex lipid metabolism glycerol-3P-acyltransferase lipid metabolism hydroxymethyl-glutaryl CoA reductase mevalonic acid pathway aminoacyl transferase nucleic acid metabolism transcription factors nucleic acid metabolism elongation factors nucleic acid metabolism
To maximize the antisense effects in a plant host, the use of homologous genes is preferred. With homologous is meant genes obtainable from the same plant species as the plant host. Heterologous, for the purpose of this specication shall mean obtainable from a different plant or non-plant species. Heterologous shall also comprise synthetic analogs of genes, modified in their mRNA encoding nucleic acid sequence to diverge at least 5% of the host gene. As house¬ keeping genes are in general highly conserved, heterologous probes from other (plant) species can be used to isolate the corresponding gene from the crop species that is to be made resistant. Such gene isolations are well within reach of those skilled in the art and, in view of the present teaching require no undue experimentation.
To differentiate between possible target genes and select favourable candidates to engineer nematode resistance, the following procedure can be applied by those skilled in the art: via the gene of interest, promoter-sequences can be isolated from genomic DNA and used for cloning in front of a
SUBSTITUTE SHΞΞ- marker gene such as GUS (Jefferson et al. 1987 EMBO J. £,-3901-3907) ..This expression construct can then be and integrated into the plant genome. Regenerated plants can then be infected with PPN and used for histochemical GUS analysis of entire plants and the feeding structures in particular.
Alternative disrupter genes may be selected on the basis of the availability of mutants in unicellular eukaryotes such as yeast or Chlamvdomonas can be used as indication. If for a particular enzyme, a large number of mutants are available then it is likely that this enzyme is redundant, present as multi-copy gene families, or that alternative pathways are available to circumvent the mutated enzyme (Strathern, Jones & Broach (Eds.) 1981 The molecular biology of the yeast Saccharomvces cerevisiae. Cold Spring Harbor Laboratory Press, New York) . Such genes are less suitable for the methods described in this invention. By contrast, mutations in enzymes that are usually lethal for the recipient cell and therefor rarely available, indicate that an antisense deregu¬ lation of such genes will inhibit the proper development of that cell and can be used for the approach to engineer reduced susceptibility to PPN as disclosed in this invention. Gene disruption methods are available to test if a gene is essential for cell viability in which case the disruption event will be lethal (Rothstein, 1983 Methods Enzym. 101; 202-211) . The homologous gene can then be isolated from the target crop with the yeast gene as a probe. Alterna¬ tively, the following promoter sequence can be used as nematode feeding site specific promoter; a truncated version of a tobacco root-specific promoter Δθ.3TobRB7 (Yamamoto et al. 1991 Plant Cell 3.; 371-382) . The full length sequence of the TobRB7 promoter is highly active inside NFS and this activity becomes more specific for the NFS when the truncated Δ0.3 version of the promoter is used (Taylor et al. 1992, Proc. 31st Ann. Meeting Amer. Soc. Nematologists, Vancouver Canada) .
Other regulatory sequences such as terminator sequences and polyadenylation signals include any such sequence func¬ tioning as such in plants, the choice of which is within the level of skill of the average skilled person in the art. An
SUBSTITUTE SHEET example of such sequences is the 3 * flanking region of the nopaline synthase (nos) gene of Aσrobacterium tumefaciens (Bevan, 1984, Nucl. Acids Res. 12, 8711-8721) .A suitable promoter can be isolated via genes that are expressed at increased levels inside the NFS during nematode infection. Such genes can be isolated through differential screening of cDNA clones made from mRNA extracted from infected and healthy roots as was demonstrated for potato (Gurr S.J. et al. 1991, Mol. Gen. Genet. 226. 361-366). Although such promoters have never been described in detail, they can be selected and isolated in a well known manner from a plant by:
1. searching for a mRNA which is present primarily (although not necessarily exclusively) in infected root tissue,
2. isolating this mRNA
3. preparing a cDNA from this mRNA
4. using this cDNA as a probe to identify the regions in the plant genome which contain DNA coding for this specific mRNA
5. identifying and isolating the upstream (51) sequences from the DNA coding for this specific mRNA and that contains the promoter region.
Preferably, the infected roots used for mRNA isolation should be enriched for NFS e.σ. by synchronous infection (Hammond- Kosack et al. 1989 Physiol. Mol. Plant. Pathol. 25, 495-506) or through direct isolation of feeding structures from plants in which NFS are visible at low magnification. For example feeding-structures that develop inside Arabidopsis roots can be seen at low magnification and are easy to isolate with a minimum of contaminating cells (Sijmons et al. 1991, Plant J. 1 , 245-254) . This allows the isolation, preferably using molecular enrichment procedures (Dickinson et al.. 1991 Adv. Mol. Gen. Plant-Microbe Interact. 1 276-279) of genes corre- sponding to these RNA's and subsequent isolation of upstream promoter elements. Once identified, similar genes can be isolated from other plant species when the identified gene is used as a probe as in step 4. Species-specific upstream sequences can than be isolated from these other plant species
SUBSTITUTE SHEET for use in a similar strategy as described in this invention. Upstream sequences of identified genomic clones can be fused to a gene for insertion in a suitable expression vector for plant transformation such as pMOG22 or pMOG23. Alternatively, suitable promoters for expression of can be isolated via interposon tagging (Topping et al.. 1991, Developm. 112, 1009-1019) . In this approach, a number of different transgenic plants are regenerated after transform¬ ation with T-DNA from Aσrobacterium carrying promoterless GUS constructs such as described by Topping et al. (1991, De¬ velopm. 112. 1009-1019) or pMOG452 as described in the Examples. After infection with a root-knot or cyst nematode and allowing some development of the NFS, roots can be stained for GUS activity. The random integration of the T-DNA enables the identification of promoter sequences that are active exclusively in the NFS. This type of interposon tagging of promoter sequences is especially well established in Arabidopsis (Kertbundit et al.. 1991, Proc. Nat. Acad. Sci. USA 88.. 5212-5216) and tobacco (Topping et al.. 1991, Developm. 112, 1009-1019). The 5* upstream sequences respon¬ sible for GUS expression can be isolated with inverted polymerase chain reaction (inverted PCR) (Does et al. 1991. Plant Mol. Biol. 12/ 151-153). Once suitable regulatory sequences are identified or genes that are transcribed inside NFS, they can be used as probes for the isolation of homologous sequences from other plant species. In turn, these sequences from other species can be fused to a disrupter gene for insertion in a suitable vector for plant transformation. The application of this invention is not restricted to the plant species that are shown by way of demonstration. The choice of the plant species is primarily determined by the amount of damage through PPN infections estimated to occur in agriculture and the amenability of the plant species to transformation. Plant genera which are damaged during agri- cultural practice by PPN and which can be made significantly less susceptible to PPN by ways of the present invention include but are not limited to the genera mentioned in Table 2.
Nematode species as defined in the context of the
SUBSTITUTE SHEET present invention belong to the superfamily Heteroderoidea and are divided among the families Heteroderidae and Meloi- doσvnidae and include, but are not limited to the species mentioned in Table 2. The choice of the plant species is primarily determined by the amount of damage through PPN infections estimated to occur in agriculture and the amenability of the plant species to transformation. Plant genera which are damaged during agricultural practice by PPN and which can be made signifi- cantly less susceptible to PPN by ways of the present inven¬ tion include but are not limited to the genera mentioned in Table 2.
Nematode species as defined in the context of the present invention include all plant-parasitic nematodes that modify host cells into specially adapted feeding structures which range from migratory ectoparasites (e.σ. Xiphinema spp.) to the more evolved sedentary endoparasites (e.σ. Heteroderidae, Meloidoσvnae or Rotylenchulinae) . A list of parasitic nematodes are given in Table 2, but the invention is not limited to the species mentioned in this table. More detailed listings are presented in Zuckerman et al. (eds., in: Plant Parasitic Nematodes, Vol. I 1971, New York, pp. 139-162) .
The methods according to the invention to combat damage to crops due to nematode invasion is likewise applicable with non-nematode pests and pathogens, whenever said pathogen or- pest locally down-regulates plant promoters at the site of infestation (e.σ. in fungi-induced haustoria or aphid-induced galling) . The principle of effecting the production of a neutralizing sxibstance in all or most of the non-infestated plant parts to neutralize a cell disruptive substance the production of which is effected in at least the site of infestation, is independent of the type or species of the pathogen or pest.
SUBSTITUTE SHEET TABLE 2
EXAMPLES OF PLANT-PARASITIC NEMATODES AND THEIR PRINCIPAL HOST PLANTS Nematode Species Principal Host Plants
Meloidoσyne M. hapla wide range M. incognita wide range M. exigua coffee, tea, Capsicum, Citrullus M. indica Citrus M. javanica wide range M. africana coffee M. graminis cereals, grasses M. graminicola rice M. arenaria wide range
Heterodera & Globodera
H. mexicana Lycopersicon esculentum, Solanum spp. H. punctata cereals, grasses G. rostochiensis Solanum tuberosum, Solanum spp, Lycoper¬ sicon esculentum Solanum tuberosum Nicotiana tabacum, Nicotiana spp. Cajanus cajan, Vigna sinensis Glycine max, Glycine spp. Oryza sativa Beta spp, Brassica spp, Trifolium spp. cereals, grasses Daucus carota Cruciferae Pisum sativum, Vicia spp.
Within the context of this invention, a plant is said to show reduced susceptibility to PPN if a statistically signi¬ ficant decrease in the number of mature females developing at the surface of plant roots can be observed as compared to control plants. Susceptible / resistance classification according to the number of maturing females is standard practice both for cyst- and root-knot nematodes (e.σ. LaMon- dia, 1991, Plant Disease 15.ι 453-454; Omwega et al.. 1990, Phytopathol. .80/ 745-748).
The basic principle of reducing the plant s susceptibi¬ lity to plant parasitic nematodes according to the invention is the manipulation of the nematode feeding structure. Manipulation of the nematode feeding structure for the purpose of this description of the invention shall include both preventing or retarding NFS formation as well as disrup-
SUBSTITUTE SHEE' tion once formation of the NFS is in an advanced stage. It is preferred to prevent or retard formation of the NFS, i.e. during the first stages of nematode invasion; to that end the NFS disruptive gene must be under the control of a promoter that drives expression at the onset of NFS formati¬ on.
However, in principle, it will also be acceptable if a disruptive gene is under the control of a promoter that drives expression of the disrupter gene in a more advanced stage of NFS formation causing the NFS to decline or to collapse. Either of these two extremes will provide the infected plant with decreased susceptibility towards the invading nematode. For the purpose of this invention the expression "disruption of the NFS" shall include retardation of NFS formation, decline of NFS formation once formed, or in the process of being formed, as well as total collapse of the NFS formed.
Reduced susceptibility to a plant parasitic nematode may be the result of a reduction of the number of NFS of the infected plant root, a reduction in the advancement of NFS formation, or a combination of both effects.
A nematode feeding structure according to the present invention shall include an initial feeding cell, which shall mean the cell or a very limited number of cells destined to become a nematode feeding structure, upon induction of the invading nematode.
A NFS disruptive effect according to the invention is not limited to adverse effects on the NFS only; also disrup¬ tive effects are contemplated that in addition have an adverse effect on nematode development by way of direct interaction.
Several techniques are available for the introduction of recombinant DNA containing the DNA sequences as described in the present invention into plant hosts. Such techniques include but are not limited to transformation of protoplasts using the calcium/polyethylene glycol method, electroporation and microinjection or (coated) particle bombardment (Potry- kus, 1990, Bio/Technol. 8., 535-542).
In addition to these so-called direct DNA transformation
SUBSTITUTE SHEET methods, transformation systems involving vectors are widely available, such as viral vectors (e.g. from the Cauliflower Mosaic Virus (CaMV) and bacterial vectors (e.g. from the genus Aσrobacterium) (Potrykus, 1990, Bio/Technol. 8., 535- 542). After selection and/or screening, the protoplasts, cells or plant parts that have been transformed can be regenerated into whole plants, using methods known in the art (Horsch et al.. 1985, Science 225, 1229-1231) . The choice of the transformation and/or regeneration techniques is not critical for this invention.
According to a preferred embodiment of the present invention use is made of so-called binary vector system (disclosed in EP-A 120 516) in which Aσrobacterium strains are used which contain a helper plasmid with the virulence genes and a compatible plasmid, the binary vector, containing the gene construct to be transferred. This vector can repli¬ cate in both E.coli and in Aσrobacterium; the one used here is derived from the binary vector Binl9 (Bevan, 1984, Nucl. Acids Res. 12., 8711-8721) . The binary vectors as used in this example contain between the left- and right-border sequences of the T-DNA, an identical NPTII-gene coding for kanamycin resistance (Bevan, 1984, Nucl. Acids Res. 12., 8711-8721) and a multiple cloning site to clone in the required gene con¬ structs. The transformation and regeneration of monocotyledonous crops is not a standard procedure. However, recent scientific progress shows that in principle monocots are amenable to transformation and that fertile transgenic plants can be regenerated from transformed cells. The development of reproducible tissue culture systems for these crops, together with the powerful methods for introduction of genetic materi¬ al into plant cells has facilitated transformation. Present¬ ly, preferred methods for transformation of monocots are microprojectile bombardment of explants or suspension cells, and direct DNA uptake or electroporation (Shimamoto, et al. 1989, Nature 338. 274-276). Transgenic maize plants have been obtained by introducing the Streptomyces hygroscopicus bar gene, which encodes phosphinothricin acetyltransferase (an enzyme which inactivates the herbicide phosphinothricin) ,
SUBSTITUTE SHEET into embryogenic cells of a maize suspension culture by microparticle..bombardment (Gordon-Kamm, 1990, Plant Cell, 2 , 603-618) . The introduction of genetic material into aleurone protoplasts of other monocot crops such as wheat and barley has been reported (Lee, 1989, Plant Mol. Biol. 13., 21-30). Wheat plants have been regenerated from embryogenic suspensi¬ on culture by selection only the aged compact and nodular embryogenic callus tissues for the establishment of the embryogenic suspension cultures (Vasil, 1990 Bio/Technol. 8., 429-434) . The combination with transformation systems for these crops enables the application of the present invention to monocots. These methods may also be applied for the transformation and regeneration of dicots.
Suitable selectable marker genes that can be used to select or screen for transformed cells, may be selected from any one of the following non-limitative list: neomycin phosphotranspherase genes conferring resistance to kanamycin (EP-B 131 623) , the hygromycin resistance gene (EP 186 425 A2) the Glutathione-S-transferase gene from rat liver confer- ring resistance to glutathione derived herbicides (EP-A 256 223) , glutamine synthetase conferring upon overexpression resistance to glutamine synthetase inhibitors such as phosp¬ hinothricin (WO87/05327) , the acetyl transferase gene from Streptomvces viridochromoσenes conferring resistance to the selective agent phosphinothricin (EP-A 275 957) , the gene encoding a 5-enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N-phosphonomethylglycine, the bar gene conferring resistance against Bialaphos (e.σ. WO91/02071) , and the like. The actual choice of the marker is not crucial as long as it is functional (i.e. selective) in combination with the plant cells of choice.
The marker gene and the gene of interest do not necessa¬ rily have to be linked, since co-transformation of unlinked genes (U.S. Patent 4,399r216) is also an efficient process in plant transformation.
The following examples are given only for purposes of illustration and do not intend to limit the scope of the invention. Unless otherwise stated in the Examples, all procedures for manipulating recombinant DNA were carried out
SUBSTITUTE SHEET by using standard procedures as described in Sambrook e al. (Molecular Cloning, A laboratory Manual 2nd Edition, Cold Spring Harbor Laboratory (1990) .
EXAMPLE I
Construction of cloninσ vectors a) Construction of binary vector pMOG23
In this example the construction of the binary vector pMOG23 (in E. coli K-12 strain DH5, deposited at the Centraal Bureau voor Schimmel-cultures on January 29, 1990 under accession number CBS 102.90) is described.
The binary vector pMOG23 is a derivative of vector Binl9 (Bevan, 1984, Nucl. Acids Res. 12, 8711-8721). To obtain pMOG23, the vector Binl9 is changed in a way not essential for the present invention, using techniques familiar to those skilled in the art of molecular biology. First, the positions of the left border (LB) and the right border (RB) are swit¬ ched with reference to the neomycine phosphotransferase gene II (NPTII gene) . Secondly, the orientation of the NPTII gene is reversed giving transcription in the direction of LB.
Finally the polylinker of Binl9 is replaced by a polylinker with the following restriction enzyme recognition sites: EcoRI, S al, BamHI, Xbal. SacI, Xhol and Hindlll (Figure 1).
b) Construction of cloninσ vector PMOG707
A cloning vector pMOG707 is constructed, containing a right border T-DNA sequence, a multiple cloning site and a terminator for the purpose of cloning different promoter/gene combinations on a suitable fragment. This vector is construc- ted in the following manner: in the cloning vector pMTL26 (Chambers et al. 1988 Gene .68./ 139-149) the Xhol site is removed by Xhol digestion, blunt-ended with Klenow polymerase followed by religation, resulting in pMTL26/2. This modified pMTL vector is used to clone the EcoRI - Bσlll fragment from pMOG23, containing the multiple cloning site and the right border sequences, resulting in pMOG584bis. The polylinker sequence is extended by inserting a synthetic linker between the BamHI and Xhol site, thus creating additional Ncol, Xhol and Xbal sites. Subsequently, the nopaline synthase trans-
SUBSTITUTE SHEET cription terminator is isolated as a BamHI/Hindlll fragment from the plasmid ROK1 (Baulcombe et al. 1986, Nature 321; 446) , ligated to a synthetic adaptor such that the Hindlll site is not recovered and an EcoRI site is introduced and subsequently cloned into the extended pMOG584bis as a BamHI - EcoRI fragment, resulting in plasmid pMOG707(Figure 2).
c) Mobilisation of binary vectors into Aσrobacterium tumefa- ciens The binary vectors described in Example IV-VIII are mobilized in a triparental mating with E. coli K-12 strain
HB101 (containing plasmid RK2013) (Ditta et al.. 1980, Proc.
Nat. Acad. Sci. USA 11_, 7347-7351) , into Aσrobacterium tu efaciens strains MOGlOl (Example II) or LBA4404 (Hoekema et al. 1983, Nature 303, 179-180) that contains a plasmid with the virulence genes necessary for T-DNA transfer to plants.
EXAMPLE II
Construction of Aσrobacterium strain MOGlOl A binary vector system was used to transfer gene constructs into Arabidopsis plants. The helper plasmid conferring the Aσrobacterium tumefaciens virulence functions was derived from the octopine Ti-plasmid pTiB6. MOGlOl is a Aσrobacterium tumefaciens strain carrying a non-oncogenic Ti-plasmid (Koekman et al. 1982, Plasmid 1_, 119-132) from which the entire T-region was deleted and substituted by a bacterial Spectinomycin resistance marker from transposon Tn 1831 (Hooykaas et al.. 1980 Plasmid 4., 64-75) .
The Ti-plasmid pTiB6 contains two adjacent T-regions, TL (T-left) and TR (T-right) . To obtain a derivative lacking the TL- and TR-regions, we constructed intermediate vector pMOG579. Plasmid pMOG579 is a pBR322 derivative, which contains the 2 Ti-plasmid fragments that are located to the left and right, outside the T-regions (Figure 3) . The 2 fragments (shown in dark) are seperated in pMOG579 by a 2.5 kb BamHI - Hindlll fragment from transposon Tnl831 (Hooykaas et al.. 1980 Plasmid 4., 64-75) carrying the spectinomycin
SUBSTITUTE SHEET resistance marker (Figure 4) . The plasmid was introduced into Aσrobacterium tumefaciens strain LBA1010 [C58-C9 (pTiB6) = a cured C58 strain in which pTiB6 was introduced (Koekman et al. 1982, Plasmid 1_, 119-132), by triparental mating from E.coli, containing pRK2013 as a helper. Transconjugants were selected for resistance to Rifampicin (20 mg/1) and spectino¬ mycin (250 mg/1) . A double recombination between pMOG579 and pTiB6 resulted in loss of carbenicillin resistance (the pBR322 marker) and deletion of the entire T-region. Of 5000 spectinomycin resistant transconjugants replica plated onto carbenicillin (100 mg/1) 2 were found sensitive. Southern analysis showed that a double crossing over event had deleted the entire T-region (not shown) . The resulting strain was called MOGlOl. This strain and its construction is analogous to strain GV2260 (Deblaere et al. 1985, Nucl. Acid Res. JL3., 4777-4788) .
EXAMPLE III Isolation of a promoter fragment DeltaO.3TobRB7 from tobacco The DeltaO.3TobRB7-5A promoter sequence (Yamamoto et al. 1991, Plant Cell 3.: 371-382) was isolated by a two-step PCR on genomic DNA isolated from tobacco. In the first PCR reaction, part of the TobRB7-5A gene is being isolated using the following primers: 5' primer: 5' CTCCAAATACTAGCTCAAAACC 3' (SEQIDNO:l)
3* primer: 5' CCTCACCATGGTTAGTTCTC 3' (SEQIDNO:2) .- The resulting PCR product is used to isolate the DeltaO.3Tob- RB7-5A fragment using the following primers:
5' primer: 5' CTTGAATTCTAGATAAGCTTATCTAAAC 3' (SEQIDNO:3)
3' primer: 5« CCTCACCATGGTTAGTTCTC 3' (SEQIDNO:4). The resulting PCR product is purified out of gel, blunt ended and subcloned into pUC9 (Vieira & Messing 1982 Gene 19; 259- 268) which is then linearised with Smal. Digestion of the resulting plasmid with Xbal and partially with Ncol yields the correct DeltaO.3TobRB7-5A fragment for cloning in Examples IV-VIII.
SUBSTITUTE SHEET EXAMPLE IV Cloninσ of chimaeric DNA sequences of the DeltaO.3 TobRB7 promoter and the antisense NADPH-Cvtochrome P450 ATR1 σene for specific repression of the nematode-induced feeding structures in Arabidopsis.
a) cloninσ antisense NADPH-Cvtochrome P450 ATR1 and construc¬ tion of binary vector PMOG711
The clone for NADPH-cytochrome P450 reductase ATR1 (EMBL accession number X66016) is isolated from Arabidopsis tha- liana var. Landsberg erecta using PCR technology on cDNA made of mRNA from this species. The primer set 5' GGCGGATCGGAGCGG- GGAGCTGAAG 3' (SEQIDNO:5) and 5" GATACCATGGATCACCAGACATCTCTG 3' (SEQIDN0:6) is used to amplify the sequence of interest. This introduces a Ncol site on the N-terminus of the PCR fragment. Subsequently, the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707. The truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 2? 371-382) , isolated as described in Example Illm, can then be inserted as a Xbal - Ncol fragment. The entire sequence is then cloned into the binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restriction enzymes, resulting in binary vector pMOG711 (Figure 5) .
b) expression of the DeltaO.3 TobRB7/antisense NADPH- Cvtochrome P450 ATR1 construct in Arabidopsis
Arabidopsis is transformed by cocultivation of plant tissue with Aσrobacterium tumefaciens strain MOGlOl contain- ing the binary vector pMOG711. Transformation is carried out using cocultivation of Arabidopsis thaliana (ecotype C24) root segments as described by Valvekens et al. (1988, Proc. Nat. Acad. Sci. USA £5, 5536-5540) . Transgenic plants are regenerated from shoots that grow on selection medium (50 mg/1 kanamycin) , rooted and transferred to germination medium or soil. Young plants can be grown to maturity and allowed to self-pollinate and set seed.
SUBSTITUTE SHEET EXAMPLE V Cloninσ of chimaeric DNA sequences of the DeltaO.3 TobRB7 promoter and the antisense NADPH-Cvtochrome P450 ATR2 σene for specific repression of the nematode-induced feedinσ structures in Arabidopsis.
a) cloninσ antisense NADPH-Cvtochrome P450 ATR2 and construc¬ tion of binary vector pM0G712
The clone for NADPH-cytochrome P450 reductase ATR2 (EMBL accession number X66017) is isolated from Arabidopsis tha- liana var. Landsberg erecta using PCR technology on cDNA made of mRNA from this species. The primer set 5' GGTTCTGGGGATCCA- AAACGTGTCGAG 3' (SEQIDNO:7) and 51 GGCTTCCATGGTTTCGTTACCATACATC 31 (SEQIDNO:8) is used for amplification. This introduces both a BamHI and a Ncol flanking the PCR fragment. Subsequently, the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707. The truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 2»" 371-382) , isolated as described in Example Illm, can then be inserted as a Xbal - Ncol fragment. The entire sequence is then cloned into the binary vector pMOG23 after digestion with Xhol and partial digestion with EcoRI or, alternatively, after digestion with Xbal and partial digestion with EcoRI, resulting in binary vector pM0G712 (Figure 5) .
b) expression of the DeltaO.3 TobRB7/antisense NADPH- Cytochrome P450 ATR2 construct in Arabidopsis Arabidopsis is transformed by cocultivation of plant tissue with Aσrobacterium tumefaciens strain MOGlOl contain¬ ing the binary vector pMOG712. Transformation is carried out using cocultivation of Arabidopsis thaliana (ecotype C24) root segments as described by Valvekens et al. (1988, Proc. Nat. Acad. Sci. USA fi5_, 5536-5540) . Transgenic plants are regenerated from shoots that grow on selection medium (50 mg/1 kanamycin) , rooted and transferred to germination medium or soil. Young plants can be grown to maturity and allowed to self-pollinate and set seed.
SUBSTITUTE SHEET EXAMPLE VI Cloning of chimaeric DNA sequences of the DeltaO.3 TobRB7 promoter and the antisense σlvcerol-3-phosphate acyltransferase σene for specific repression of the nematode- induced feedinσ structures in Arabidopsis.
a) cloninσ antisense σlvcerol-3-phosphate acyltransferase and construction of binary vector PMOG713
The clone for glycerol-3-phosphate acyltransferase ATS1(EMBL accession number D00673) is isolated from
Arabidopsis thaliana using PCR technology on cDNA made of mRNA from this species. The primer set 5 ' GCCCGGGATCCGGTTTATCCACTCG 3' (SEQIDNO:9) and 5' GAGTATTTTCCATGGATTGTGTTTGTG 3* (SEQIDNO:10) is used for amplification. This introduces both a Smal, BamHI and a Ncol flanking the ATS1 clone. Subsequently, the PCR fragment is digested with Smal - Ncol and as such subcloned into pMOG445. (pMOG445 is a pUC18 derivative that contains, by insertion of an oligo adaptor in the multiple cloning site, the extra restriction sites Clal. Ncol and Bσlll between EcoRI and SstI) . Subsequently, the ATS1 clone is isolated after Ncol and partial BamHI digestion and subcloned antisense before the nopaline synthase terminator into pMOG707. The truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 3_; 371-382) , isolated as described in Example
Illm, is then inserted as a Xbal - Ncol fragment. The entire sequence is then cloned into the binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restric¬ tion enzymes, resulting in binary vector pMOG7l3 (Figure 5) .
b) expression of the DeltaO.3 TobRB7/antisense NADPH- Cvtochrome P450 ATR2 construct in Arabidopsis
Arabidopsis is transformed by cocultivation of plant tissue with Aσrobacterium tumefaciens strain MOGlOl contain- ing the binary vector pM0G712. Transformation is carried out using cocultivation of Arabidopsis thaliana (ecotype C24) root segments as described by Valvekens et al. (1988, Proc. Nat. Acad. Sci. USA 85_/ 5536-5540). Transgenic plants are regenerated from shoots that grow on selection medium (50
SUBSTITUTE SHEET mg/1 kanamycin) , rooted and transferred to germination medium or soil. Young- plants can be grown to maturity and allowed to self-pollinate and set seed.
EXAMPLE VII
Cloninσ of chimaeric DNA sequences of the DeltaO.3 TobRB7 promoter and the antisense adenine nucleotide translocator σene for specific repression of the nematode-induced feedinσ structures in potato.
a) cloninσ antisense adenine nucleotide translocator and construction of binary vector pM0G7l4
The clone for the mitochondrial adenine nucleotide translocator (PANT1, EMBL accession number X57557; Winning et al. 1992 Plant J. 2.; 763-773) is isolated from Solanum tuberosum using PCR technology on cDNA made of mRNA from this species. The primer set 5 GCTAGCCGGATCCATCTGAGCTCCAG 3 ' (SEQIDNO:ll) and 5' GACGTCCATGGCTGAATTAGCCACCACCG3 • (SEQIDNO:12) is used for amplification. This introduces both a BamHI and a Ncol flanking the PANT1 clone. Subsequently, the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707. The truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 2' 371-382) , isolated as described in Example Illm, is then be inserted as a Xbal - Ncol fragment. The entire sequence is then cloned into the . binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restriction sites, resulting in binary vector pMOG714 (Figure 5) .
b) expression of the DeltaO.3 TobRB7/antisense adenine nucleotide translocator construct in potato
Potato is transformed by cocultivation of plant tissue with Aσrobacterium tumefaciens strain LBA4404 containing the binary vector pMOG714. Transformation is carried out using cocultivation of potato (Solanum tuberosum var. Desiree) tuber disks as described by Hoekema et al. 1989, Bio/Techn. 2 273-278) . Transgenic plants are regenerated from shoots that grow on selection medium (100 mg/1 kanamycin) , rooted,
SUBSTITUTE SHEET multiplied axenically by meristem cuttings and transferred to soil to produce tubers.
EXAMPLE VIII Cloninσ of chimaeric DNA sequences of the DeltaO.3 TobRB7 promoter and the antisense ATP svnthase gene for specific repression of the nematode-induced feeding structures in tobacco.
a) cloning antisense ATP svnthase and construction of binary vector PMOG715
The clone for the beta subunit of ATP synthase (Boutry & Chua 1985 EMBO J. 4_; 2159-2165) is isolated from tobacco (Nicotiana plu baginifolia) using PCR technology on cDNA made of mRNA from this species. The primer set 5*
CCCTCCAGGATCCCTTCTCGGAGGCTTC 3' (SEQIDNO:13) and 5» GAAAAGAAAGCCATGGAACTTTATAATC 3' (SEQIDNO: 14) is used for amplification. This introduces both a BamHI and a Ncol flanking the ATP synthase clone. Subsequently, the PCR fragment is digested with BamHI - Ncol and cloned antisense before the nopaline synthase terminator into pMOG707. The truncated promoter sequence DeltaO.3TobRB7-5A (Yamamoto et al. 1991, Plant Cell 3_; 371-382) , isolated as described in Example Illm, is inserted as a Xbal - Ncol fragment. The entire sequence is then cloned into the binary vector pMOG23 after digestion with EcoRI and one of the remaining unique restriction sites, resulting in binary vector pMOG7l5 (Figure 5).
b) expression of the DeltaO.3 TobRB7/antisense ATP svnthase construct in tobacco
Tobacco is transformed by cocultivation of plant tissue with Agrobacterium tumefaciens strain LBA4404 (Hoekema et al. 1983, Nature 303. 179-180) containing the binary vector pMOG715 Transformation is carried out using cocultivation of tobacco (Nicotiana tabacum SRI) leaf disks as described by Horsch et al. 1985, Science 227. 1229-1231) . Transgenic plants are regenerated from shoots that grow on selection medium (100 mg/1 kanamycin), rooted and transferred to soil.
SUBSTITUTE SHEET EXAMPLE IX Analysis of transgenic Arabidopsis plants for susceptibility to SPPN
Transgenic Arabidopsis plants can be assayed both in vitro or in soil for resistance against M. incognita or the cyst nematode H. schachtii. For in vitro analysis, seeds are surface sterilized, grown and inoculated as described by Sijmons et al. (1991, Plant J. l± 245-254) . For soil-grown plants, seedlings are germinated on kanamycin-containing medium (10 mg/ml) and kanamycin-resistant seedlings are transferred to soil/sand mixtures (1:3 v/v) in 1x1x6 cm transparent plastic tubes. Once the rozettes are well devel¬ oped (ca. 14 days) the containers are inoculated with ca. 300 hatched J2 of H. schachtii each. Eighteen days after inocula- tion, the roots are carefully removed from the soil/sand mixture and stained with acid fuchsin (Dropkin, 1989 in: Introduction to plant nematology, 2nd edition, Wiley & Sons, New York) . In this assay, susceptible plants score a mean of 17 cysts per root system (range 4-40 cyst per root system) . Similarly, plants can be inoculated with hatched J2 of M. incognita or with egg-masses that are mixed through the soil/sand mixture. The plants can than be scored for the presence of galls which are clearly visible once the roots are washed clear of the soil/sand mixture.
EXAMPLE X Analysis of transgenic potato plants for susceptibility to
SPPN Transgenic potato plants can be assayed for resistance against M. incognita using soil that is preinfected with M. incognita egg masses mixed with sand (1:3 w/w) , growing the potato plants in that soil mixture for 6 weeks and , after removing the soil, count the developed number of galls on a root system. Alternatively, to assay for resistance against Globodera ssp. a closed container is used. For this assay, three replicate 2-4 cm tubers are transferred to soil which is pre-inoculated with cysts from G. rostochiensis or G. pallida in transparent containers. The peripheral root systems can be analyzed visually 7-8 weeks after germination
SUBSTITUTESHEET for the presence of cysts. A genotype will be scored as resistant if one of the three replicates had cysts and susceptible if at least one of the three replicates shows cysts.
EXAMPLE XI Analysis of transgenic tobacco plants for susceptibility to
SPPN For anlysis of nematode resistance, the soil is preinfected with M. incognita egg masses. This inoculum can be produced by maintaining a stock culture of M. incognita on soil grown celery plants (Apium graveolens) under standard greenhouse conditions, below 25°C. Mature celery root systems, contain¬ ing a high number of root knots and mature females of M_j_ incognita, are carefully dusted off to remove the soil, homogenized briefly in a Waring blendor (2 seconds) and weighed in portions of 60 gram. These root samples are mixed with 1 kg sand:potting soil (1:1) mixtures and used for growth of transgenic tobacco transformants. As control plants, primary kanamycin resistant transformants (transgenic for pMOG23) are used. Per construct, 100 primary transformants are grown in infected soil for 6 weeks. The soil/sand mixture is washed away carefully and the number of galls / root system is counted with a binocular. Control plants have a mean of 25 ± 11 galls. A genotype is considered resistant when the mean number of galls is reduced to 2 per root system. The primary transformants meet this requirement, can than be used for a rapid multiplication cycle by placing transformed leaves again on media that allows shoot regene- ration (Horsch et al. 1985, Science 227. 1229-1231) or the plants can be grown to maturity and allowed to flower and seed setting and used for more extensive testing of nematode resistance using 100 plants of each genotype.
SUBSTITUTE SHEET SEQUENCE LISTING
(1) GENERAL INFORMATION: (i) APPLICANT:
(A) NAME: MOGEN International N.V.
(B) STREET: Einsteiπ eg 97
(C) CITY: IEIDEN
(D) STATE: Zuid-Holland (E) COUNTRY: ϊhe Netherlands
(F) POSTAL CODE (ZIP) : N] 2333 CB
(G) ELEFHONE: (0)31.71.258282 (H) TELEFAX: (0)31.71.221471 (I) TELEX: -
(ii) TITLE OF INVENTION: PLANTS WITH REDUCED SUSCEPTIBILITY
TO PLANT-PARASΠTC NEMATODES
(iii) NUMBER OF SEQUENCES: 14
(iv) CCMEUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk
(B) CCMTOTER: IEM PC compatible
(C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25
(EPO)
(v) CURRENT APPLICATION DATA:
APPLICATION NUMBER: EP 92203378.
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOLOGY: linear
(ii) MDIECUIE TYPE: cENA (iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
CTCCAAAIAC TAGCTCAAAA CC 22
(2) INPOEMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGIH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single (D) TOPOLOGY: linear
(ii) MDLECULE TYPE: cENA
SUBSTITUTE SHEET (iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
CCTC CC TG GΓTAGΓΓCΓC 20
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CΗARACIERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single (D) TOPOIOGY: linear
(ii) MOLECULE TYPE: cENA
(iii) HYPC HEΠCAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: CTIGAATΓCT AGAIAAGCTT ATCTAAAC 28
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOIOGY: linear (ii) MOLECULE TYPE: ENA (genαmic) (iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ 3D NO: 4:
CCTCACCATG GTTAGTTCTC 20 (2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) IENGTH: 25 base pairs
(B) TYPE: nucleic acid (C) STRANDEENESS: single
(D) TOPOLOGY: linear
(ii) M31ECULE TYPE: cENA (iii) HYPOTHETICAL: YES
SUBSTITUTE SHEET ( i) SEQUENCE DESCRIPTION: SEQ ID NO: 5: GGCGGATOGG AGCGGGGAGC TGAAG 25 (2) ΩTCORMAIION FOR SEQ ID NO: 6:
(i) SEQUENCE (-HARACIERISTICS:
(A) IENGIH: 27 base pairs
(B) TYPE: nucleic acid (C) STRANDEENESS: single
(D) TOPOIOGY: linear
(ii) MDIECUIE TYPE: cENA (iii) HYPOTHETICAL: ES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:
GAIACCATGG ATCACCAGAC ATCTCTG 27
(2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cENA (iii) HYPC0-HETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: GGTICTGGGG ATCCAAAACG TGTCGAG 27
(2) INPOFMAITON FOR SEQ ID NO: 8:
(i) SEQUENCE CHARACTERISTICS: (A) IENGIH: 28 base pairs (B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOIOGY: linear
(ii) MOLECULE TYPE: cENA (iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPπCN: SEQ ID NO: 8:
GGCΓΓCCATG GΓTΓOΞTTAC CMΆCATC 28
SUBSTITUTE SHEET (2) INFORMATION FOR SEQ ID NO: 9*.
(i) SEQUENCE aiARACTERISTT.CS: (A) IENGTH: 25 base pairs (B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOIOGY: linear
(ii) MDIECUIE TYPE: cENA (iii) HYPOTHETTCAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:
GCCCGGGATC CGGTTTATCC ACTCG 25
(2) INPOEMATION FOR SEQ ID NO: 10:
(i) SEQUENCE <_ΗARACTERISTICS:
(A) IENGIH: 27 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single (D) TOPOIOGY: linear
(ii) MDIECUIE TYPE: cENA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: GAGTAITTTC CAIGGAITGT GITTGTG 27
(2) INFORMATION FOR SEQ ID NO: 11:
(i) SEQUENCE CHARACTERISTICS: (A) IENGTH: 26 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOIOGY: linear (ii) MOLECULE TYPE: cENA
(iii) HYPOTHETICAL: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:
GCTAGCCGGA TC-CftTCIGAG CTCCAG 26 (2) INPORMATi i FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS: (A) IENGTH: 29 base pairs
SUBSTITUTE SHEET (B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOIOGY: linear (ii) MDIECUIE TYPE: cENA
(iii) HYPOTHETICAL: YES
( i) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
GΆOCTCCATC GCDGAATTAG CCACCACCG 29 (2) INFOEMATI ^ FOR SEQ ID NO: 13 :
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs
(B) TYPE: nucleic acid (C) STRANDEENESS: single
(D) TOPOIOGY: linear
(ii) MOLECULE TYPE: cENA (iii) HYPOTHETICAL: YES
( i) SEQUENCE DESCRIPTION: SEQ ID NO: 13: CCCTCCAGGA TX_XX3TCTCG GAGGCTTC 28
(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS: (A) IENGTH: 28 base pairs
(B) TYPE: nucleic acid
(C) STRANDEENESS: single
(D) TOPOIOGY: linear (ii) MDIECUIE TYPE: cENA
(iii) HYPOTHETICAL: YES
( i) SEQUENCE DESCRIPTION: SEQ ID NO: 14:
GAAAAGAAAG CCAIGGAACT TTATAATC 28
SUBSTITUTE SHEET

Claims

1. A recombinant DNA containing a plant expressible gene which comprises in sequence:
-a promoter that is capable of driving expression of a down- stream gene specifically in an initial feeding cell and/or a nematode feeding structure,
-a gene encoding a product that is inhibitory to an endogenous gene encoding a protein or polypeptide selected from the group consisting of ATP synthase, adenine nucleotide
translocator, tricarboxylate translocator, dicarboxylate translocator, 2-oxo-glutarate translocator, cytochrome C, pyruvate kinase, glyceraldehyde-3P-dehydrogenase, NADPH- cytochrome p450 reductase, fatty acid synthase complex, glycerol-3P-acyltransferase, hydroxymethyl-glutaryl CoA reductase, aminoacyl transferase, a transcription initiation factor, and a transcription elongation factor, and optionally -a transcription terminator and a polyadenylation signal sequence,
and wherein the said gene is expressed in said initial feeding cell or nematode feeding structure upon infection by the said nematode.
2. A recombinant DNA according to claim 2, wherein said product comprises a RNA transcript that is complementary or partially complementary to the said endogenous gene transcript.
3. A recombinant DNA according to claim 1 or 2, wherein the said promoter is obtainable from the Delta-0.3TobRB7-5A promoter.
4. A replicon comprising a recombinant DNA according to any one of the claims 1 to 3.
5. The replicon of claim 4, which is a Ti- or Ri-plasmid of an Agrobacterium species.
6. The replicon of claim 4, which is capable of replication in E. coli and Agrobacterium species.
7. An Agrobacterium species comprising a replicon according to any. one of. claims 5 or 6.
8. A plant genome which comprises a recombinant DNA according to any one of the claims 1 to 3.
9. A plant cell comprising a plant genome according to claim 8.
10. A plant comprising a cell or cells according to claim 9.
11. A plant regenerated from a cell according to claim 9.
12. A plant according to claim 10 or 11, which, as a result of expression of said gene encoding a product that is inhibitory to an endogenous gene, shows reduced susceptibility to a plant parasitic nematode.
13. A plant according to claim 10, which plant belongs to the family Solanaceae.
14. A plant according to claim 13, which plant is Solanum tuberosum.
15. A plant according to any one of the claims 10 to 14, wherein said plant parasitic nematode is a Meloidogyne
species.
16. Plant material, such as flowers, fruit, leaves, pollen, seeds, or tubers, obtainable from a plant according to any one of the claims 10 - 15.
17. A method for obtaining a plant with reduced susceptibility to a plant parasitic nematode, comprising the steps of (1) transforming a recipient plant cell with recombinant DNA according to any one of the claims 1 - 3,
(2) generating a plant from a transformed plant cell,
(3) identifying a transformed plant with reduced susceptibility to said plant parasitic nematode.
18. A method for reducing damage to a crop due to piant parasitic nematodes, by growing plants according to any one of the claims 10-15.
EP93924590A 1992-11-02 1993-11-02 Plants with reduced susceptibility to plant-parasitic nematodes Withdrawn EP0666922A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP93924590A EP0666922A1 (en) 1992-11-02 1993-11-02 Plants with reduced susceptibility to plant-parasitic nematodes

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP92203378 1992-11-02
EP92203378 1992-11-02
EP93924590A EP0666922A1 (en) 1992-11-02 1993-11-02 Plants with reduced susceptibility to plant-parasitic nematodes
PCT/EP1993/003091 WO1994010320A1 (en) 1992-11-02 1993-11-02 Plants with reduced susceptibility to plant-parasitic nematodes

Publications (1)

Publication Number Publication Date
EP0666922A1 true EP0666922A1 (en) 1995-08-16

Family

ID=8211016

Family Applications (1)

Application Number Title Priority Date Filing Date
EP93924590A Withdrawn EP0666922A1 (en) 1992-11-02 1993-11-02 Plants with reduced susceptibility to plant-parasitic nematodes

Country Status (4)

Country Link
EP (1) EP0666922A1 (en)
AU (1) AU5420594A (en)
CA (1) CA2148451A1 (en)
WO (1) WO1994010320A1 (en)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4420782C1 (en) 1994-06-15 1995-08-17 Fluegge Ulf Ingo Prof Dr New DNA encoding a 2-oxoglutarate-malate translocator
US6262344B1 (en) 1995-06-13 2001-07-17 Syngenta Mogen B.V. Nematode-inducible plant gene promoter
GB9515161D0 (en) * 1995-07-24 1995-09-20 Zeneca Ltd Production of male sterile plants
DE19600357C1 (en) * 1996-01-08 1997-02-13 Fluegge Ulf Ingo Prof Dr DNA sequence encoding a phosphoenolpyruvate phosphate translocator, plasmids, bacteria, yeasts and plants containing this transporter
HUP9903512A3 (en) * 1996-06-04 2000-04-28 Syngenta Mogen Bv Nematode-inducible plant gene promoter
ZA9710270B (en) * 1996-11-18 1998-06-10 Mogen Internat Nv Nematode-inducible regulatory DNA sequences.
WO1998031822A1 (en) * 1997-01-20 1998-07-23 Plant Genetic Systems, N.V. Pathogen-induced plant promoters
US6392119B1 (en) 1997-01-24 2002-05-21 Dna Plant Technology Corporation Two component plant cell lethality methods and compositions
GB9706381D0 (en) * 1997-03-27 1997-05-14 Cambridge Advanced Tech Improvements relating to the specificity of gene expression
WO1999028483A2 (en) * 1997-11-27 1999-06-10 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw. Isolation and characterization of plant regulatory sequences
BR9910408B1 (en) * 1998-05-13 2012-03-06 A method for producing a transgenic plant that exhibits increased starch content, use of nucleic acid molecules encoding a plastid atp / adp translocator, and a modified starch production method.
JP2003509055A (en) * 1999-09-15 2003-03-11 ビーエーエスエフ プランド サイエンス ゲーエムベーハー Plant with modified amino acid content and method for producing the same
US7572950B2 (en) 2002-07-04 2009-08-11 Sungene Gmbh & Co. Kgaa Methods for obtaining pathogen resistance in plants
ATE529523T1 (en) 2006-02-23 2011-11-15 Basf Plant Science Gmbh PLANT METABOLITE EXPORTER GENE PROMOTORS
CN115838742B (en) * 2022-10-18 2024-06-21 华中农业大学 North-south root-knot nematode demethylase Mi-NMAD-1/2 gene and application thereof

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL81737A (en) * 1986-03-28 1992-11-15 Calgene Inc Regulation of gene expression in plant cells
WO1990002172A1 (en) * 1988-08-18 1990-03-08 Calgene, Inc. Plant elongation factor, promoters, coding sequences and uses
EP0548197B1 (en) * 1990-09-10 1998-06-03 Advanced Technolgies (Cambridge) Limited Plant parasitic nematode control
US5306862A (en) * 1990-10-12 1994-04-26 Amoco Corporation Method and composition for increasing sterol accumulation in higher plants
GB9104617D0 (en) * 1991-03-05 1991-04-17 Nickerson Int Seed Pest control
WO1992021757A1 (en) * 1991-05-30 1992-12-10 Plant Genetic Systems, N.V. Nematode-responsive plant promoters

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9410320A1 *

Also Published As

Publication number Publication date
AU5420594A (en) 1994-05-24
WO1994010320A1 (en) 1994-05-11
CA2148451A1 (en) 1994-05-11

Similar Documents

Publication Publication Date Title
US5866777A (en) Method for obtaining plants with reduced susceptibility to plant-parasitic nematodes
US6037522A (en) Agrobacterium-mediated transformation of monocots
AU689311B2 (en) Plant transcription regulators from circovirus
US5530187A (en) Transgenic plants containing multiple disease resistance genes
EP2531601B1 (en) Soybean transformation using HPPD inhibitors as selection agents
US4970168A (en) Virus-resistant plants
US5391724A (en) Pinosylvine synthase genes
WO1996006932A1 (en) Plant transcription regulators from circovirus
EP0666922A1 (en) Plants with reduced susceptibility to plant-parasitic nematodes
Devoto et al. The promoter of a gene encoding a polygalacturonase-inhibiting protein of Phaseolus vulgaris L. is activated by wounding but not by elicitors or pathogen infection
AU2010267655B2 (en) Expression of transcription regulators that provide heat tolerance
NZ235265A (en) Regulatory gene from 5&#39; untranslated region of a plant chitinase gene, recombinant dna, vectors, hosts, transgenic plants (including some expressing chitinase), and method of repelling chitin-containing pathogens
WO2005074357A2 (en) Regulation of gene expression in plant cells
CA2270872C (en) Nematode-inducible regulatory dna sequences
AU707563B2 (en) Nematode-inducible plant gene promoter
US6262344B1 (en) Nematode-inducible plant gene promoter
US6951971B1 (en) Method of making water stress or salt stress tolerant transgenic cereal plants
US7094952B1 (en) Method for obtaining transgenic plants expressing a protein with activity producing hydrogen peroxide by transformation by agrobacterium rhizogenes
CA2198723C (en) Plant transcription regulators from circovirus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19950321

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20000404

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20000531