EP0637337A1 - Antigene de recombinaison contenant dans sa sequence un domaine immunostimulant heterologue- son utilisation comme vaccin - Google Patents

Antigene de recombinaison contenant dans sa sequence un domaine immunostimulant heterologue- son utilisation comme vaccin

Info

Publication number
EP0637337A1
EP0637337A1 EP93906579A EP93906579A EP0637337A1 EP 0637337 A1 EP0637337 A1 EP 0637337A1 EP 93906579 A EP93906579 A EP 93906579A EP 93906579 A EP93906579 A EP 93906579A EP 0637337 A1 EP0637337 A1 EP 0637337A1
Authority
EP
European Patent Office
Prior art keywords
antigen
recombinant
acid sequence
sequence
domain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP93906579A
Other languages
German (de)
English (en)
Inventor
Luigi Villa
Paolo Ghiara
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GSK Vaccines SRL
Original Assignee
Biocine SpA
Biocine Sclavo SpA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biocine SpA, Biocine Sclavo SpA filed Critical Biocine SpA
Publication of EP0637337A1 publication Critical patent/EP0637337A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/255—Salmonella (G)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/545—IL-1
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to recombinant peptide antigens for use as vaccines which display improved immunogenicity.
  • the antigens comprise an immunostimulatory domain inserted within the peptide sequence of the recombinant antigen.
  • adjuvants are known in the art which increase the antigenicity of peptide antigens.
  • One of the most commonly-used adjuvants is Freund's Incomplete Adjuvant, a water-in-oil emulsion into which the antigen is introduced
  • This emulsion is resistant to dispersal within an organism and functions to release the antigen slowly, leading to prolonged antigen stimulation.
  • killed bacterial material provides enhanced adjuvanticity by stimulating macrophages to produce factors which enhance the immune system's response to antigens. For example, heat-killed Mycobacterium tuberculosis is included in Freund's Complete Adjuvant.
  • Freund's Adjuvant is unsuitable for use in humans as it has a number of well-known side-effects.
  • Other adjuvants such as aluminium salts which are approved for human vaccination, are inefficient and not devoid of unwanted side-effects (Pineau et al . , 1992, Toxicology, 73 . , 117) .
  • New generation adjuvants which contain muramyl dipeptide (MDP) derivatives such as N-acetyl-muramyl-L-threonyl-D- isoglutamine (thr-MDP) , disclosed in U.S. patent No. 4,606,918, N-acety1-normuramyl-L-alany1-D-isoglutamine (nor- MDP) and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine- 2-(1*-2*dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)- ethylamine (MTP-PE) are currently under investigation for use in humans.
  • MDP muramyl dipeptide
  • immunostimulatory cytokines such as interleukin 1 or tumour necrosis factor ⁇ , which are natural stimulators of the immune response.
  • cytokines such as interleukin 1 or tumour necrosis factor ⁇
  • Such agents are well-known to have potent toxic and proinflammatory effects which limit their practical applications in humans (Staruch and Wood, 1983, J. Immunol., 130. 2191-2194; Ghiara et al. , 1987, J. Immunol., 139, 3676-3679; Reed et al., 1989, J. Immunol., 142, 2067- 2071) .
  • This nonapeptide has been proposed as an adjuvant for use with poorly immunogenic antigens (Nencioni et al., 1987, J. Immunol., 137. 800-804) both in admixture with the antigen (Tagliabue et al., 1989, Lymphokine Res., 8., 311- 315) and coupled to the end of an antigenic peptide (Rao and Nayak, 1990, PNAS, 82 5519-5522).
  • IL-l3-derived nonapeptide may have a very short half-life in vivo which limits its utility or requires its use at very high concentrations (Pessina et al . , 1990, Lymphokine res., , 371) .
  • the recombinant peptide antigen of the invention does not require an additional adjuvant for use as a vaccine (although one may be added as the clinical context requires) but carries within it an immunostimulatory domain acting to enhance the immune response to the peptide antigen.
  • the peptide antigen may include one or more heterologous immunostimulatory domain which may be the same or different. Furthermore, the peptide antigen may comprise one or more antigenic peptide which may be homologous or heterologous.
  • the immunostimulatory domain may be located within the amino acid sequence of any single peptide or between the amino acid sequences of any two peptides.
  • TITUTE SHEET Furthermore, it will be understood that when an antigen is formed by incorporation of an epitope into a carrier peptide (Newton et al . , 1989, Science, 240. 70) the heterologous immunostimulatory domain may be incorporated into the carrier part of the antigen.
  • heterologous immunostimulatory domain it is intended to denote any amino acid sequence heterologous to the antigen which is capable, directly or indirectly, of increasing the immunogenic properties of the antigen.
  • the immunostimulatory domain is derived from a cytokine.
  • cytokines include interleukins 1 through 12, tumour necrosis factors, interferons, TGFs and chemotactic cytokines such as MIPs, MAPs and NAPs.
  • the immunostimulatory domain may be derived from IL-13. It has been found that the nonapeptide VQGEESNDK spanning residues 163-171 of IL-10 has immunostimulatory properties but is not responsible for conferring the toxic, pyrogenic or inflammatory properties of this cytokine.
  • the nonapeptide VQGEESNDK is incorporated within the amino acid sequence of a recombinant peptide antigen.
  • the site of insertion of the immunostimulatory domain is selected to enhance its activity in the hybrid molecule while leaving at least one antigenic epitope of the antigen intact.
  • the immunostimulatory domain is inserted at a predetermined location with in the molecular, structure of the antigen.
  • the immunostimulatory domain is integrated into the structure of the peptide antigen in order to form an integral part thereof.
  • the immunostimulatory domain is not merely attached to the antigen such that it cannot be separated therefrom: rather, it is integrated into the antigen and becomes a novel domain thereof, increasing its immunogenic activity while retaining its antigenic specificity.
  • Suitable sites for insertion of the immunostimulatory domain may be determined by any one of the various methods available to those skilled in the art, including peptide structure analysis and structure/function prediction methods. Certain sites are likely to suggest themselves as suitable locations for the insertion of a domain. For example, hypervariable regions of protein sequence are unlikely to be involved in the structure of a protein which is determinative of conserved antigenic epitopes and are thus strong candidates for insertion of a domain.
  • loops and connecting sequences which are distal to the main structure of the antigen may provide exposed sites for insertion of a domain where the structure of the antigen is not affected.
  • the site of insertion of the immunostimulatory domain is selected according to at least one of the following features:
  • tolerance of an alteration in amino acid sequence it is intended to denote that the area of the protein structure being considered may have amino acid residues added, removed or deleted without affecting the overall structure and function of the peptide, as described below. It is especially preferred, however, that the sequence should be tolerant of even non-conservative amino acid changes.
  • Sequences which "function as joining sequences between structural elements of the antigen" are those sections of the peptide sequence which are found between the helices and j ⁇ -sheets which comprise the structural parts of the protein. For example, these sequences may be in the form of loops, often exposed, between such helices or sheets.
  • Exposed areas of the antigen structure are sequences, such as the loops described above, which are accessible from the outside of the protein in physiological solution. They are frequently in the form of exposed loops, but may also be located in structural elements of the peptide or in other areas. It is intended to ensure that the immunostimulatory
  • SUBSTITUTE SHEET domain is accessible to the agents of the immune system through which immunostimulation is effected.
  • the peptide antigen may be any peptide capable of eliciting an immune response in a human or animal subject.
  • the peptide antigen is derived from a pathogen against which it is desired to protect the subject.
  • antigens include the proteins of pathogenic viruses, such as hepatitis A, B and C, polio, papilloma and influenza.
  • bacterial toxins such as pertussis toxin, tetanus toxin, diphtheria toxin, the toxins of Vibrio . ⁇ iiolerae, Escherichia coli, P ⁇ eudomonas aeruginosa, Shigella enterolytica, Bacillus anthracis and Clostridium botulinu ⁇ ⁇ the 130 kDa cytotoxin of Helicobacter pylori and any further bacterial toxins which may be used to vaccinate against infection by the bacterium.
  • the toxin-derived antigens are preferably modified to reduce or eliminate their toxicity.
  • suitable antigens include CRM-197 (Giannini et al . , NAR, 12., 4063), or heat-shock protein conjugates with polysaccharides of Meningococcus group A, B or C (Men A, Men B and Men C respectively) or with polysaccharides of Pneumococcus or Haemophilus influenzae. Also included are the surface antigens of parasitic or infectious organisms, such as the MOMP of Chlamydia and the surface proteins of the circumsporozoites of malarial Plasmodium .
  • the antigen need not be derived from an infectious pathogen. It could be, for example, an aberrant version of an endogenous peptide produced in the pathogenesis of a disease, such as a tumour antigen.
  • the invention may be applied to recombinant antiidiotipic antibodies, T cell receptors and other agents which may be used to treat or immunise against tumours, autoimmune diseases and other disorders having a
  • a polynucleic acid sequence encoding a recombinant antigen according to the first aspect of the invention.
  • the polynucleic acid sequence encoding the antigen is derived from a genomic or cDNA clone isolated from a natural source.
  • the polynucleic acid sequence encoding the antigen may be chemically synthesised. Methods are well known in the art for the isolation of genomic or cDNA clones and for chemical synthesis of nucleic acids.
  • the polynucleic acid sequence comprises a polynucleic acid sequence encoding a peptide antigen, into which has been inserted a polynucleic acid sequence encoding a heterologous immunostimulatory domain, in the correct reading frame. Expression of this polynucleic acid sequence leads to the production of a recombinant antigen as defined above.
  • the polynucleic acid sequence encoding a heterologous immunostimulatory domain preferably encodes an immunostimulatory domain as hereinbefore described.
  • this domain is the IL-13 derived nonapeptide VQGEESNDK.
  • the sequence encoding the domain is preferably
  • the present invention further comprises a nucleic acid
  • SUBSTITUTE SHEET vector comprising the polynucleic acid sequence defined above. It is envisaged that the vector may be maintained within the host cell of choice in an episomal state, or alternatively integrated into the host genome. Preferably, therefore, the vector will comprise sequences effective to promote either of these modes of maintenance.
  • a host cell transformed with a vector as defined above.
  • Host cells of prokaryotic or eukaryotic origin may be used in connection with the vectors of the invention, depending on the type of vector selected. Suitable expression systems comprising both vectors and host cells are set forth below.
  • a method for producing a recombinant peptide antigen comprising a heterologous immunostimulatory domain comprising a heterologous immunostimulatory domain, as hereinbefore described, provided that the antigen is not an interleukin-1 inhibitor, comprising the steps of: engineering a polynucleic acid sequence encoding an antigen, the sequence having inserted within it in the correct reading frame a polynucleic acid sequence encoding a heterologous immunostimulatory domain; inserting the engineered polynucleic acid sequence into an expression system; expressing the engineered polynucleic acid sequence to produce an antigen having within its molecular structure a heterologous immunostimulatory domain and collecting the antigen.
  • the invention further comprises the use of a recombinant peptide antigen comprising the amino acid sequence of a
  • EET peptide antigen within which is comprised the amino acid sequence of a heterologous immunostimulatory domain, in the manufacture of a composition for use as a vaccine.
  • a method for formulating a vaccine comprising bringing into association the recombinant antigen as hereinbefore described and a pharmaceutically acceptable carrier.
  • the vaccine may contain an adjuvant in order to maximise the immunogenicity of the antigen, especially in the case of subjects already suffering from a compromised immune system.
  • the inclusion of a plurality of antigens in a single vaccine formulation or indeeed in a single peptide antigen is envisaged.
  • a method for preventing or treating a disease in a human or animal subject comprising administering to the subject an effective amount of a vaccine comprising the recombinant antigen described hereinbefore.
  • Figure 1(a) is a schematic representation of Human ferritin H Chain showing the five helices (A-E) and the insertion point of the sequence VQGEESNDK;
  • Figure 1(b) is a schematic representation of the flagellin peptide from Salmonella muenchen showing the insertion point of the sequence VQGEESNDK inside the hypervariable region;
  • Figure 2(a) is a ribbon-type representation of ferritin ⁇ - helices showing the location of the VQGEESNDK sequence
  • SUBSTITUTE SHEET Figure 2 (b) is a schematic diagram of ferritin H chain polymer, with the location of VQGEESNDK marked by an asterisk;
  • Figure 3 shows the ability of an anti-IL-1/3 antibody to distinguish between ferritin and flagellin with and without VQGEESNDK insertions.
  • Lanes 1 and 2 Coomassie-blue staining of ferritins run on denaturing 10% SDS-PAGE. Lanes 3 through 6: Immunoblot analysis of the purified ferritins. After separation in 10% SDS-PAGE and blotting onto nitrocellulose, the proteins were assayed with polyclonal anti-ferritin antibody (lanes 3, 4) or with monoclonal anti-IL-1/3 (lanes 5, 6) . Lanes 1, 3 and 5: purified Fer83 (wild-type ferritin); lanes 2, 4 and 6: purified Ferl03 (ferritin containing VQGEESNDK) . Protein size marker is indicated in kDa in the left margin.
  • Lanes 1 and 2 Coomassie-blue staining of flagellins run on denaturing 10% SDS-PAGE. Lanes 3 through 6: Immunoblot analysis of the purified flagellins. Purified flagellin were separated in 10% SDS-PAGE, transferred to nitrocellulose and detected in Western blots with anti- Salmonella flagellar d antibody (lanes 3 and 4) or polyclonal anti-IL-13 antibody (lanes 5 and 6) . Lanes 1, 3 and 5: purified Fla408 (wild-type flagellin) ; lanes 2, 4 and 6: purified Fla449 (flagellin containing VQGEESNDK) . Protein size markers are indicated in kDa in the left margin;
  • Figure 4 shows the results of an assay comparing the immunogenicity of ferritin and flagellin with and without VQGEESNDK insertions.
  • A Anti-ferritin PFC assay. Mice were inoculated i.p. with different doses of Fer83 (closed bars) or Ferl03 (striped bars) and after 4 days their spleens were assayed using, as indicator, SRBC conjugated to Fer83. Background PFC/spleen was 550 ⁇ 37.
  • B Anti-flagellin PFC assay. Mice were
  • Figure 5(a) shows the results of an experiment in which the levels of anti-ferritin IgG were assayed after inoculation of mice with both wild-type and recombinant ferritin;
  • Figure 5(b) shows the results of a similar experiment conducted over a period of 40 days with wild type and recombinant flagellin.
  • Recombinant peptide antigens and immunostimulatory domains that can be used in the present invention include those polypeptides mentioned above and polypeptides with minor
  • SHEET amino acid variations from the natural amino acid sequence of the protein in particular, conservative amino acid replacements are contemplated.
  • a significant advantage of producing the recombinant peptide antigens by recombinant DNA techniques rather than by isolating and purifying a protein from natural sources is that equivalent quantities of the protein can be produced by using less starting material than would be required for isolating the protein from a natural source.
  • Producing the protein by recombinant techniques also permits the protein to be isolated in the absence of some molecules normally present in cells. Indeed, protein compositions entirely free of any trace of human protein contaminants can readily be produced because the only human protein produced by the recombinant non-human host is the recombinant protein at issue.
  • polynucleotide intends a polynucleotide of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature, (2) is linked to a polynucleotide other than that to which it is linked in nature, or (3) does not occur in nature.
  • polynucleotide refers to a polymeric form of a nucleotide of any length, preferably deoxyribonucleotides, and is used interchangeably herein with the terms “oligonucleotide” and “oligomer.”
  • oligonucleotide and “oligomer.”
  • the term refers only to the primary structure of the molecule. Thus, this term includes double- and single-stranded DNA, as well as antisense polynucleotides.
  • genomic is meant a collection or library of DNA molecules which are derived from restriction fragments that have been cloned in vectors. This may include all or part of the genetic material of an organism.
  • cDNA is meant a DNA sequence which is complementary to
  • oligomer refers to both primers and probes and is used interchangeably herein with the term “polynucleotide.”
  • the term oligomer does not connote the size of the molecule.
  • typically oligomers are no greater than 1000 nucleotides, more typically are no greater than 500 nucleotides, even more typically are no greater than 250 nucleotides; they may be no greater than 100 nucleotides, and may be no greater than 75 nucleotides, and also may be no greater than 50 nucleotides in length. It is to be understood, however, that they may be of any size greater than a single nucleotide in length.
  • primer refers to an oligomer which is capable of acting as a point of initiation of synthesis of a polynucleotide strand when used under appropriate conditions.
  • the primer will be completely or substantially complementary to a region of the polynucleotide strand to be copied. Thus, under conditions conducive to hybridization, the primer will anneal to the complementary region of the analyte strand.
  • suitable reactants e.g., a polymerase, nucleotide triphosphates, and the like
  • the primer will be extended by the polymerizing agent to form a copy of the analyte strand.
  • the primer may be single-stranded or alternatively may be partially or fully double-stranded.
  • analyte polynucleotide and “analyte strand” refer to a single- or double-stranded nucleic acid molecule which is suspected of containing a target sequence, and which may be present in a biological sample.
  • probe refers to a structure comprised of a polynucleotide which forms a hybrid structure with a target sequence, due to complementarity of at least one sequence in the probe with a sequence in the target region.
  • the polynucleotide regions of probes may be
  • SUBSTITUTE SHEET composed of DNA, and/or RNA, and/or synthetic nucleotide analogs. Included within probes are “capture probes” and “label probes”.
  • target region refers to a region of the nucleic acid which is to be amplified and/or detected.
  • target sequence refers to a sequence with which a probe or primer will form a stable hybrid under desired conditions.
  • capture probe refers to a polynucleotide probe comprised of a single-stranded polynucleotide coupled to a binding partner.
  • the single-stranded polynucleotide is comprised of a targeting polynucleotide sequence, which is complementary to a target sequence in a target region to be. detected in the analyte polynucleotide.
  • This complementary region is of sufficient length and complementarity to the target sequence to afford a duplex of stability which is sufficient to immobilize the analyte polynucleotide to a solid surface (via the binding partners) .
  • the binding partner is specific for a second binding partner; the second binding partner can be bound to the surface of a solid support, or may be linked indirectly via other structures or binding partners to a solid support.
  • targeting polynucleotide sequence refers to a polynucleotide sequence which is comprised of nucleotides which are complementary to a target nucleotide sequence; the sequence is of sufficient length and complementarily with the target sequence to form a duplex which has sufficient stability for the purpose intended.
  • binding partner refers to a molecule capable of binding a ligand molecule with high specificity, as for example an antigen and an antibody specific therefor.
  • the specific binding partners must bind with sufficient affinity to immobilize the analyte copy/complementary strand duplex (in the case of capture probes) under the isolation conditions.
  • Specific binding partners are known in the art, and include, for example, biotin and avidin or streptavidin, IgG and protein A, the numerous known receptor-ligand couples, and complementary polynucleotide strands.
  • the partners are normally at least about 15 bases in length, and may be at least 40 bases in length; in addition, they have a content of Gs and Cs of at least about 40% and as much as about 60%.
  • the polynucleotides may be composed of DNA, RNA, or synthetic nucleotide analogs.
  • Coupled refers to attachment by covalent bonds or by strong non-covalent interactions (e.g. , hydrophobic interactions, hydrogen bonds, etc.). Covalent bonds may be, for example, ester, ether, phosphoester, amide, peptide, imide, carbon-sulfur bonds, carbon-phosphorus bonds, and the like.
  • support refers to any solid or semi-solid surface to which a desired binding partner may be anchored. Suitable supports include glass, plastic, metal, polymer gels, and the like, and may take the form of beads, wells, dipsticks, membranes, and the like.
  • label refers to any atom or moiety which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a polynucleotide or polypeptide.
  • label probe refers to a polynucleotide probe which is comprised of a targeting polynucleotide sequence which is complementary to a target sequence to be detected in the analyte polynucleotide. This complementary region is of sufficient length and complementarily to the target sequence to afford a duplex comprised of the "label probe” and the "target sequence” to be detected by the label.
  • the label probe is coupled to a label either directly, or indirectly via a set of ligand molecules with high specificity for each other, including multimers.
  • multimer refers to linear or branched polymers of the same repeating single-stranded polynucleotide unit or different single-stranded polynucleotide units. At least one of the units has a sequence, length, and composition that permits it to hybridize specifically to a first single-stranded nucleotide sequence of interest, typically an analyte or a polynucleotide probe (e.g., a label probe) bound to an analyte.
  • a first single-stranded nucleotide sequence of interest typically an analyte or a polynucleotide probe (e.g., a label probe) bound to an analyte.
  • this unit will normally be at least about 15 nucleotides in length, typically no more than about 50 nucleotides in length, and preferably about 30 nucleotides in length; moreover, the content of Gs and Cs will normally be at least about 40%, and at most about 60%.
  • the multimer includes a multiplicity of units that are capable of hybridizing specifically and stably to a second single-stranded nucleotide of interest, typically a labelled polynucleotide or another multimer. These units are generally about the same size and composition as the multimers discussed above. When a multimer is designed to be hybridized to another multimer, the first and second oligonucleotide units are heterogeneous
  • multimers may be label probes, or may be ligands which couple the label to the probe.
  • a “replicon” is any genetic element, e.g., a plasmid, a chromosome, a virus, a cosmid, etc. that behaves as an autonomous unit of polynucleotide replication within a cell; i.e., capable of replication under its own control. This may include selectable markers.
  • PCR refers to the technique of polymerase chain reaction as described in Saiki, et al.. Nature 324:163 (1986); and Scharf et al.. Science (1986) 233:1076-1078; and U.S. 4,683,195; and U.S. 4,683,202.
  • x is "heterologous" with respect to y if x is not naturally associated with y in the identical manner; i.e., x is not associated with y in nature or x is not associated with y in the same manner as is found in nature.
  • “Homology” refers to the degree of similarity between x and y.
  • the correspondence between the sequence from one form to another can be determined by techniques known in the art. For example, they can be determined by a direct comparison of the sequence information of the polynucleotide.
  • homology can be determined by hybridization of the polynucleotides under conditions which form stable duplexes between homologous regions (for example, those which would be used prior to SI digestion) , followed by digestion with single-stranded specific nuclease(s), followed by size determination of the digested fragments.
  • a “vector” is a replicon in which another polynucleotide segment is attached, so as to bring about the replication and/or expression of the attached segment.
  • Control sequence refers to polynucleotide sequences which are necessary to effect the expression of coding sequences to which they are ligated. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence; in eukaryotes, generally, such control sequences include promoters and transcription termination sequence.
  • control sequences is intended to include, at a minimum, all components whose presence is necessary for expression, and may also include additional components whose presence is advantageous, for example. leader sequences and fusion partner sequences.
  • Operaably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner.
  • a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
  • ORF "open reading frame” is a region of a polynucleotide sequence which encodes a polypeptide; this region may represent a portion of a coding sequence or a total coding sequence.
  • a “coding sequence” is a polynucleotide sequence which is translated into a polypeptide, usually via mRNA, when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3 • -terminus.
  • a coding sequence can include, but is not limited to, cDNA, and recombinant polynucleotide sequences.
  • polypeptide refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not refer to or exclude post expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations andthe like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), polypeptides with substituted linkages, as well as other modifications known in the art, both naturally occurring and non-naturally occurring.
  • a polypeptide or amino acid sequence "derived from" a designated nucleic acid sequence refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a portion thereof wherein the portion consists of at least 3-5 amino acids, and more preferably at least 8-10 amino acids, and even more preferably at least 11-15 amino acids, or which is immunologically identifiable with a polypeptide encoded in the sequence.
  • This terminology also includes a polypeptide expressed from a designated nucleic acid sequence.
  • Immunogenic refers to the ability of a polypeptide to cause a humoral and/or cellular immune response, whether alone or when linked to a carrier, in the presence or absence of an adjuvant.
  • Negtralization refers to an immune response that blocks the infectivity, either partially or fully, of an infectious agent.
  • Epitope refers to an antigenic determinant of a peptide, polypeptide, or protein; an epitope can comprise 3 or more amino acids in a spatial conformation unique to the epitope. Generally, an epitope consists of at least 5 such amino acids and, more usually, consists of at least 8-10 such amino acids.
  • Methods of determining spatial conformation of amino acids include, for example, x-ray crystallography and 2- dimensional nuclear magnetic resonance.
  • Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.
  • Treatment refers to prophylaxis and/or therapy (i.e., the modulation of any disease symptoms).
  • An "individual” indicates an animal that is susceptible to infection by bacterium possessing an antigenic capsular polysaccharide or oligosaccharide structure and includes, but is not limited to, primates, including humans.
  • a "vaccine” is an immunogenic, or otherwise capable of eliciting protection against such a bacterium, whether partial or complete, composition useful for treatment of an individual.
  • the conjugate compounds of the invention may be used for producing antibodies, either monoclonal or polyclonal, specific to the proteins.
  • the methods for producing these antibodies are known in the art.
  • Recombinant host cells denote, for example, microorganisms, insect cells, and mammalian cells, that can be, or have been, used as recipients for recombinant vector or other transfer DNA, and include the progeny of the original cell which has been transformed. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. Examples for mammalian host cells include Chinese hamster ovary (CHO) and monkey kidney (COS) cells.
  • CHO Chinese hamster ovary
  • COS monkey kidney
  • cell line refers to a population of cells capable of continuous or prolonged growth and division in vitro. Often, cell lines are clonal populations derived from a single progenitor cell. It is further known in the art that spontaneous or induced changes can occur in karyotype during storage or transfer of such clonal populations. Therefore, cells derived from the cell line referred to may not be precisely identical to the ancestral cells or cultures, and the cell line referred to includes such variants.
  • the term "cell lines” also includes immortalized cells. Preferably, cell lines include nonhybrid cell lines or hybridomas to only two cell types.
  • microorganism includes prokaryotic and eukaryotic microbial species such as bacteria and fungi, the latter including yeast and filamentous fungi.
  • TITUTE SHEET "Transformation”, as used herein, refers to the insertion of an exogenous polynucleotide into a host cell, irrespective of the method used for the insertion, for example, direct uptake, transduction, f-mating or electroporation.
  • the exogenous polynucleotide may be maintained as a non-integrated vector, for example, a plasmid, or alternatively, may be integrated into the host genome.
  • purified and isolated is meant, when referring to a polypeptide or nucleotide sequence, that the indicated molecule is present in the substantial absence of other biological macromolecules of the same type.
  • the term “purified” as used herein preferably means at least 75% by weight, more preferably at least 85% by weight, more preferably still at least 95% by weight, and most preferably at least 98% by weight, of biological macromolecules of the same type present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000, can be present).
  • the appropriate peptide antigen coding sequence can be expressed in a variety of different expression systems; for example those used with mammalian cells, baculoviruses, bacteria, and yeast.
  • a mammalian promoter is any DNA sequence capable of binding mammalian RNA polymerase and initiating the downstream (3') transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiating region, which is usually placed proximal to the 5' end of the coding sequence, and a TATA box, usually located 25-30 base pairs (bp) upstream of the transcription initiation site. The TATA box is thought to direct RNA polymerase II to begin RNA synthesis at the correct site.
  • a mammalian promoter will also contain an upstream promoter element, usually located within 100 to 200 bp upstream of the TATA box. An upstream promoter element determines the rate at which transcription is initiated and can act in either orientation, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed (1989) .
  • Mammalian viral genes are often highly expressed and have a broad host range; therefore sequences encoding mammalian viral genes provide particularly useful promoter sequences. Examples include the SV40 early promoter, mouse mammary tumor virus LTR promoter, adenovirus major late promoter (Ad MLP) , and herpes simplex virus promoter. In addition, sequences derived from non-viral genes, such as the murine metallotheionein gene, also provide useful promoter sequences. Expression may be either constitutive or regulated (inducible) , depending on the promoter can be induced with glucocorticoid in hormone-responsive cells.
  • Enhancer element is a regulatory DNA sequence that can stimulate transcription up to 1000- fold when linked to homologous or heterologous promoters, with synthesis beginning at the normal RNA start site. Enhancers are also active when they are placed upstream or downstream from the transcription initiation site, in either normal or flipped orientation, or at a distance of more than 1000 nucleotides from the promoter, Maniatis et al. , Science 236:1237 (1989); Alberts et al. Molecular Biology of the Cell, 2nd ed (1989) . Enhancer elements derived from viruses may be particularly useful, because they usually have a broader host range.
  • Examples include the SV40 early gene enhancer, Dijkema et al (1985) EMB0 J. 4:761, and the enhancer/promoters derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus, Gorman et al. (1982) Proc. Natl. Acad. Sci. 79:6777, and from human cytomegalovirus, Boshart et al. (1985) Cell 41:5221. Additionally, some enhancers are regulatable and become active only in the presence of an inducer, such as a hormone or metal ion, Sassone-Corsi et al. (1986) Trends Genet. 2:215; Maniatis et al. (1987) Science 236:1237.
  • an inducer such as a hormone or metal ion
  • a DNA molecule may be expressed intracellularly in mammalian cells.
  • a promoter sequence may be directly linked with the DNA molecule, in which case the first amino acid at the N-terminus of the recombinant protein will always be a methionine, which is encoded by the ATG start codon. If desired, the N-terminus may be cleaved from the protein by in vitro incubation with cyanogen bromide.
  • foreign proteins can also be secreted from the cell into the growth media by creating chimeric DNA molecules that encode ⁇ a fusion protein comprised of a leader sequence fragment that provides for secretion of the foreign protein in mammalian cells.
  • a leader sequence fragment that provides for secretion of the foreign protein in mammalian cells.
  • processing sites encoded between the leader fragment and the foreign gene that can be cleaved either in vivo or in vitro.
  • the leader sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the secretion of the protein from the cell.
  • the adenovirus tripartite leader is an example of a leader sequence that provides for secretion of a foreign protein in mammalian cells.
  • transcription termination and polyadenylation sequences recognized by mammalian cells are regulatory regions located 3' to the translation stop codon and thus, together with the promoter elements, flank the coding sequence.
  • the 3' terminus of the mature mRNA is formed by site-specific post-transcriptional cleavage and polyadenylation, Birnstiel et al. (1985) Cell 41:349; Proudfoot and Whitelaw (1988) "Termination and 3' end processing of eukaryotic RNA. In Transcription and splicing (ed. B.D. Hames and D.M. Glover) ; Proudfoot (1989) Trends Biochem. Sci. 14:105.
  • transcription terminator/polyadenylation signals include those derived from SV40, Sambrook et al (1989) , Molecular Cloning: A Laboratory Manual.
  • genes may be expressed more efficiently when introns (also called intervening sequences) are present.
  • introns also called intervening sequences
  • cDNAs have been efficiently expressed from vectors that lack splicing signals (also called splice donor and acceptor sites), see e.g., Gething and Sambrook (1981)
  • Introns are intervening noncoding sequences within a coding sequence that contain splice donor and acceptor sites. They are removed by a process called
  • the above-described components comprising a promoter, polyadenylation signal, and transcription termination sequence are put together into expression constructs.
  • Enhancers, introns with functional splice donor and acceptor sites, and leader sequences may also be included in an expression construct, if desired.
  • Expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as mammalian cells or bacteria.
  • Mammalian replication systems include those derived from animal viruses, which require trans- acting factors to replicate.
  • plasmids containing the replication systems of papovaviruses such as SV40, Gluzman (1981) Cell 23:175, or polyomavirus, replicate to extremely high copy number in the presence of the appropriate viral T antigen.
  • mammalian replicons include those derived from bovine papillomavirus and Epstein-Barr virus.
  • the replicon may have two replication systems, thus allowing it to be maintained, for example, in mammalian cells for expression and in a prokaryotic host for cloning and amplification.
  • mammalian-bacteria shuttle vectors include pMT2, Kaufman et al. (1989) Mol. Cell. Biol. 9:946, and pHEBO, Shimizu et al. (1986) Mol. Cell. Biol. 6:1074.
  • the transformation procedure used depends upon the host to be transformed.
  • Methods for introduction of heterologous polynucleotides into mammalian cells include dextran-mediated transfection, calcium phosphate precipitation, polybrene mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide(s) in liposomes, and direct microinjection of the DNA into nuclei.
  • Mammalian cell lines available as hosts for expression are known in the art and include many immortalized cell lines available from the American Type Culture Collection (ATCC) , including but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS) , human hepatocellular carcinoma cells (e.g., Hep G2) , and a number of other cell lines.
  • ATCC American Type Culture Collection
  • the polynucleotide encoding the protein can also be inserted into a suitable insect expression vector, and is operably linked to the control elements within that vector.
  • Vector construction employs techniques which are known in the art.
  • the components of the expression system include a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome, and a transfer vector, usually a bacterial plasmid, which contains both a fragment of the baculovirus genome,
  • SUBSTITUTE SHEET convenient restriction site for insertion of the heterologous gene or genes to be expressed; a wild type baculovirus with a sequence homologous to the baculovirus- specific fragment in the transfer vector (this allows for the homologous recombination of the heterologous gene in to the baculovirus genome) ; and appropriate insect host cells and growth media.
  • the vector and the wild type viral genome are transfected into an insect host cell where the vector and viral genome are allowed to recombine.
  • the packaged recombinant virus is expressed and recombinant plaques are identified and purified.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, inter alia,
  • an intermediate transplacement construct Prior to inserting the DNA sequence encoding the protein into the baculovirus genome, the above-described components, comprising a promoter, leader (if desired) , coding sequence of interest, and transcription termination sequence, are usually assembled into an intermediate transplacement construct (transfer vector) .
  • This construct may contain a single gene and operably linked regulatory elements; multiple genes, each with its owned set of operably linked regulatory elements; or multiple genes, regulated by the same set of regulatory elements.
  • Intermediate transplacement constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as a bacterium.
  • the replicon will have a replication system, thus allowing it to be maintained in a suitable host for cloning and amplification.
  • pAc373 the most commonly used transfer vector for introducing foreign genes into AcNPV.
  • Many other vectors known to those of skill in the art, have also been designed. These include, for example, pVL985 (which alters the polyhedrin start codon from ATG to ATT, and which introduces a BamHI cloning site 32 basepairs downstream from the ATT; see Luckow and Summers, Virology (1989) 17:31.
  • the plasmid usually also contains the polyhedron polyadenylation signal (Miller et al. (1988) Ann. Rev. Microbiol. , 42:177) and a prokaryotic ampicillin- resistance (amp) gene and origin of replication for selection and propagation in E. coli .
  • Baculovirus transfer vectors usually contain a baculovirus promoter.
  • a baculovirus promoter is any DNA sequence capable of binding a baculovirus RNA polymerase and initiating the downstream (5' to 3') transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a baculovirus transfer vector may also have a second domain called an enhancer, which, if present, is usually distal to the structural gene. Expression may be either regulated or constitutive.
  • Structural genes abundantly transcribed at late times in a viral infection cycle, provide particularly useful promoter sequences. Examples include sequences derived from the gene encoding the viral polyhedron protein, Friesen et al., (1986) "The Regulation of Baculovirus Gene Expression,” in: The Molecular Biology of Baculoviruses (ed. Walter Doerfler) ; EPO Publ. Nos. 127 839 and 155476; and the gene encoding the plO protein, Vlak et al., (1988), J. Gen. Virol. 69:765.
  • DNA encoding suitable signal sequences can be derived from genes for secreted insect or baculovirus proteins, such as the baculovirus polyhedrin gene (Carbonell et al. (1988) Gene, 73:409).
  • the signals for mammalian cell posttranslational modifications such as signal peptide cleavage, proteolytic cleavage, and phosphorylation
  • the signals required for secretion and nuclear accumulation also appear to be conserved between the invertebrate cells and vertebrate cells
  • leaders of non- insect origin such as those derived from genes encoding human ⁇ -interferon, Maeda et al.
  • a recombinant polypeptide or polyprotein may be expressed intracellularly or, if it is expressed with the proper regulatory sequences, it can be secreted.
  • Good intracellular expression of nonfused foreign proteins usually requires heterologous genes that ideally have a short leader sequence containing suitable translation initiation signals preceding an ATG start signal. If desired, methionine at the N-terminus may be cleaved from the mature protein by in vitro incubation with cyanogen bromide.
  • recombinant polyproteins or proteins which are not naturally secreted can be secreted from the insect cell by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provides for secretion of the foreign protein in insects.
  • the leader sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the translocation of the protein into the endoplasmic reticulum.
  • an insect cell host is co-transformed with the heterologous DNA of the transfer vector and the genomic DNA of wild type baculovirus usually by co- transfection.
  • the promoter and transcription termination sequence of the construct will usually comprise a 2-5kb section of the baculovirus genome.
  • the insertion can be into a gene such as the polyhedrin gene, by homologous double crossover recombination; insertion can also be into a restriction enzyme site engineered into the desired baculovirus gene. Miller et al., (1989), Bioessays 4:91.
  • the DNA sequence when cloned in place of the polyhedrin gene in the expression vector, is flanked both 5' and 3' by polyhedrin-specific sequences and is positioned downstream of the polyhedrin promoter.
  • the newly formed baculovirus expression vector is subsequently packaged into an infectious recombinant baculovirus. Homologous recombination occurs at low frequency (between about 1% and about 5%) ; thus, the majority of the virus produced after cotransfection is still wild-type virus. Therefore, a method is necessary to identify recombinant viruses.
  • An advantage of the expression system is a visual screen allowing recombinant viruses to be distinguished.
  • the polyhedrin protein which is produced by the native virus, is produced at very high levels in the nuclei of infected cells at late times after viral infection. Accumulated polyhedrin protein forms occlusion bodies that also contain embedded particles.
  • TITUTE SHEETs These occlusion bodies, up to 15 ⁇ . in size, are highly refractile, giving them a bright shiny appearance that is readily visualized under the light microscope.
  • Cells infected with recombinant viruses lack occlusion bodies.
  • the transfection supernatant is plaqued onto a monolayer of insect cells by techniques known to those skilled in the art. Namely, the plaques are screened under the light microscope for the presence (indicative of wild-type virus) or absence (indicative of recombinant virus) of occlusion bodies.
  • Recombinant baculovirus expression vectors have been developed for infection into several insect cells.
  • recombinant baculoviruses have been developed for, inter alia: Aedes aegypti , Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni (PCT Pub. No. WO 89/046699; Carbonell et al., (1985) J. Virol. 56:153; Wright (1986) Nature 321:718; Smith et al. , (1983) Mol. Cell. Biol. 3:2156; and see generally, Fraser, et al. (1989) In Vitro Cell. Dev. Biol. 25:225) .
  • Cells and cell culture media are commercially available for both direct and fusion expression of heterologous polypeptides in a baculovirus/expression system; cell culture technology is generally known to those skilled in the art. See, e.g., Summers and Smith.
  • the modified insect cells may then be grown in an appropriate nutrient medium, which allows for stable maintenance of the plasmid(s) present in the modified insect host.
  • the expression product gene is under inducible control, the host may be grown to high density, and expression induced.
  • the product will be continuously expressed into the medium and the nutrient medium must be continuously circulated, while removing the product of interest and augmenting depleted nutrients.
  • the product may be purified by such techniques as chromatography, e.g., HPLC, affinity chromatography, ion exchange chromatography, etc. ; electrophoresis; density gradient centrifugation; solvent extraction, or the like.
  • the product may be further purified, as required, so as to remove substantially any insect proteins which are also secreted in the medium or result from lysis of insect cells, so as to provide a product which is at least substantially free of host debris, e.g., proteins, lipids and polysaccharides.
  • host debris e.g., proteins, lipids and polysaccharides.
  • recombinant host cells derived from the transformants are incubated under conditions which allow expression of the recombinant protein encoding sequence. These conditions will vary, dependent upon the host cell selected. However, the conditions are readily ascertainable to those of ordinary skill in the art, based upon what is known in the art.
  • a bacterial promoter is any DNA sequence capable of binding bacterial RNA polymerase and initiating the downstream (3 1 ) transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site.
  • a bacterial promoter may also have a second domain called an operator, that may overlap an adjacent RNA polymerase binding site at which RNA synthesis begins. The operator permits negative regulated (inducible) transcription, as a gene repressor protein may bind the operator and thereby inhibit transcription of a specific gene. Constitutive expression may occur in the
  • a gene activator protein binding sequence which, if present is usually proximal (5') to the RNA polymerase binding sequence.
  • An example of a gene activator protein is the catabolite activator protein (CAP) , which helps initiate transcription of the lac operon in E. coli, Raibaud et al. (1984) Annu. Rev. Genet. 18:173. Regulated expression may therefore be either positive or negative, thereby either enhancing or reducing transcription.
  • CAP catabolite activator protein
  • Sequences encoding metabolic pathway enzymes provide particularly useful promoter sequences. Examples include promoter sequences derived from sugar metabolizing enzymes, such as galactose, lactose (lac) , Chang et al. (1977) Nature 198:1056, and maltose. Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (trp) , Goeddel et al. (1980) Nuc. Acids Res. 8:4057; Yelverton et al. (1981) Nucl. Acids Res. 9:731; U.S. 4,738,921; EPO Publ. Nos. 036 776 and 121 775.
  • sugar metabolizing enzymes such as galactose, lactose (lac) , Chang et al. (1977) Nature 198:1056, and maltose.
  • Additional examples include promoter sequences derived from biosynthetic enzymes such as tryptophan (tr
  • synthetic promoters which do not occur in nature also function as bacterial promoters.
  • transcription activation sequences of one bacterial or bacteriophage promoter may be joined with the operon sequences of another bacterial or bacteriophage promoter, creating a synthetic hybrid promoter, U.S. 4,551,433.
  • the tac promoter is a hybrid trp-lac promoter comprised of both trp promoter and lac operon sequences that is regulated by the lac repressor, Amann et al. (1983) Gene 25:167; de Boer et al. (1983) Proc. Natl. Acad. Sci. 80:21.
  • a bacterial promoter can include naturally occurring promoters of non-bacterial origin that have the
  • SUBSTITUTE SHEET ability to bind bacterial RNA polymerase and initiate transcription A naturally occurring promoter of non-bacterial origin can also be coupled with a compatible RNA polymerase to produce high levels of expression of some genes in prokaryotes.
  • the bacteriophage T7 RNA polymerase/promoter system is an example of a coupled promoter system, Studier et al. (1986) J. Mol. Biol. 189:113; Tabor et al. (1985) Proc Natl. Acad. Sci. 82:1074.
  • a hybrid promoter can also be comprised of a bacteriophage promoter and an E. coli operator region (EPO Publ. No. 267 851) .
  • an efficient ribosome binding site is also useful for the expression of foreign genes in prokaryotes.
  • the ribosome binding site is called the Shine-Dalgarno (SD) sequence and includes an initiation codon (ATG) and a sequence 3-9 nucleotides in lengthy located 3-11 nucleotides upstream of the initiation codon. Shine et al. (1975) Nature 254:34.
  • the SD sequence is thought to promote binding of mRNA to the ribosome by the pairing of bases between the SD sequence and the 3' and of E. Coli 16S rRNA, Steitz et al.
  • a DNA molecule may be expressed intracellularly.
  • a promoter sequence may be directly linked with the DNA molecule, in which case the first amino acid at the N- terminus will always be a methionine, which is encoded by the ATG start codon. If desired, methionine at the N- terminus may be cleaved from the protein by in vitro incubation with cyanogen bromide or by either in vivo on in vitro incubation with a bacterial methionine N-terminal peptidase (EPO Publ. No. 219 237) .
  • SUBSTITUTE Fusion proteins provide an alternative to direct expression.
  • a DNA sequence encoding the N- terminal portion of an endogenous bacterial protein, or other stable protein is fused to the 5* end of heterologous coding sequences.
  • this construct will provide a fusion of the two amino acid sequences.
  • the bacteriophage lambda cell gene can be linked at the 5' terminus of a foreign gene and expressed in bacteria.
  • the resulting fusion protein preferably retains a site for a processing enzyme (factor Xa) to cleave the bacteriophage protein from the foreign gene, Nagai et al. (1984) Nature 309:810.
  • Fusion proteins can also be made with sequences from the lacZ, Jia et al.
  • the DNA sequence at the junction of the two amino acid sequences may or may not encode a cleavable site.
  • a ubiquitin fusion protein is made with the ubiquitin region that preferably retains a site for a processing enzyme (e.g. ubiquitin specific processing-protease) to cleave the ubiquitin from the foreign protein. Through this method, native foreign protein can be isolated. Miller et al. (1989) Bio/Technology 7:698.
  • foreign proteins can also be secreted from the cell by creating chimeric DNA molecules that encode a fusion protein comprised of a signal peptide sequence fragment that provides for secretion of the foreign protein in bacteria, U.S. 4,336,336.
  • the signal sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the secretion of the protein from the cell.
  • the protein is either secreted into the growth media (gram-positive bacteria) or into the periplasmic space, located between the inner and outer membrane of the cell (gram-negative bacteria) .
  • processing sites which can be cleaved either in vivo or in vitro encoded between the signal peptide fragment and the foreign gene.
  • DNA encoding suitable signal sequences can be derived from genes for secreted bacterial proteins, such as the E. Coli outer membrane protein gene (ompA) . Masui et al. (1983) , in: Experimental Manipulation of Gene Expression; Ghrayeb et al. (1984) EMBO J. 3:2437 and the E. Coli alkaline phosphatase signal sequence (phoA) , Oka et al. (1985) Proc. Natl. Acad. Sci. 82:7212.
  • the signal sequence of the alpha-amylase gene from various Bacillus strains can be used to secrete heterologous proteins from B. subtilis. Palva et al. (1982) Proc. Natl. Acad. Sci. USA 79:5582; EPO Publ. No. 244 042.
  • transcription termination sequences recognized by bacteria are regulatory regions located 3 » to the translation stop codon, and thus together with the promoter flank the coding sequence. These sequences direct the transcription of an mRNA which can be translated into the polypeptide encoded by the DNA. Transcription termination sequences frequently include DNA sequences of about 50 nucleotides capable of forming stem loop structures that aid in terminating transcription. Examples include transcription termination sequences derived from genes with strong promoters, such as the trp gene in E. Coli as well as other biosynthetic genes.
  • expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as bacteria.
  • a replicon such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as bacteria.
  • the replicon will have a replication system, thus allowing it to be maintained in a prokaryotic host either for expression or for cloning and amplification.
  • a replicon may be either a high or low copy number plasmid.
  • SUBSTITUTE SHEET will generally have a copy number ranging from about 5 to about 200, and usually about 10 to about 150.
  • a host containing a high copy number plasmid will preferably contain at least about 10, and more preferably at least about 20 plasmids. Either a high or low copy number vector may be selected, depending upon the effect of the vector and the foreign protein on the host.
  • the expression constructs can be integrated into the bacterial genome with an integrating vector.
  • Integrating vectors usually contain at least one sequence homologous to the bacterial chromosome that allows the vector to integrate. Integrations appear to result from recombinations between homologous DNA in the vector and the bacterial chromosome.
  • integrating vectors constructed with DNA from various Bacillus strains integrate into the Bacillus chromosome (EPO Publ. No. 127 328) .
  • Integrating vectors may also be comprised of bacteriophage or transposon sequences.
  • extrachromosomal and integrating expression constructs may contain selectable markers to allow for the selection of bacterial strains that have been transformed.
  • Selectable markers can be expressed in the bacterial host and may include genes which render bacteria resistant to drugs such as ampicillin, chloramphenicol, erythromycin, kanamycin (neomycin) , and tetracycline. Davies et al. (1978) Annu. Rev.Microbiol. 32:469.
  • Selectable markers may also include biosynthetic genes, such as those in the histidine, tryptophan, and leucine biosynthetic pathways.
  • Transformation vectors are usually comprised of a selectable marker that is either maintained in a replicon or developed into an integrating vector.
  • SUBSTITUTE SHEE chromosomal replicons or integrating vectors have been developed for transformation into many bacteria.
  • expression vectors have been developed for, inter alia, the following bacteria: Bacillus subtilis, Palv et al. (1982) Proc. Natl. Acad. Sci. USA 79:5582; EPO Publ. Nos. 036 259 and 063 953; PCT Publ. No. WO 84/04541; E. Coli, Shimatake et al. (1981) Nature 292:128; Amann et al. (1985) Gene 40:183; Studier et al. (1986) J. Mol. Biol. 189:113; EPO Publ. Nos.
  • Methods of introducing exogenous DNA into bacterial hosts are well-known in the art, and usually include either the transformation of bacteria treated with CaC12 or other agents, such as divalent cations and DMSO.
  • DNA can also be introduced into bacterial cells by electroporation. Transformation procedures usually vary with the bacterial species to be transformed. See, e.g., Masson et al. (1989) FEMS Microbiol. Lett. 60:273; Palva et al. (1982) Proc. Natl. Acad. Sci. USA 79:5582; EPO Publ. Nos. 036259 and 063 953; PCT Publ. No. WO 84/04541, for Bacillus; Miller et al. (1988) Proc. Natl.
  • a yeast promoter is any DNA sequence capable of binding yeast RNA polymerase and initiating the downstream (3*) transcription of a coding sequence (e.g. structural gene) into mRNA.
  • a promoter will have a transcription initiation region which is usually placed proximal to the 5' end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site (the "TATA Box") and a transcription initiation site.
  • a yeast promoter may also have a second domain called an upstream activator sequence (UAS) , which, if present, is usually distal to the structural gene.
  • the UAS permits regulated (inducible) expression. Constitutive expression occurs in the absence of a UAS. Regulated expression may be either positive or negative, thereby either enhancing or reducing transcription.
  • Yeast is a fermenting organism with an active metabolic pathway, therefore sequences encoding enzymes in the metabolic pathway provide particularly useful promoter sequences. Examples include alcohol dehydrogenase (ADH) (EPO Publ. No. 284 044) , enolase, glucokinase, glucose-6- phosphate isomerase, glyceraldehyde-3-phosphate- dehydrogenase (GAP or GAPDH) , hexokinase, phosphofructokinase, 3-phosphoglyceratemutase, andpyruvate kinase (PyK) (EPO Publ. No. 329 203).
  • ADH alcohol dehydrogenase
  • GAP or GAPDH glyceraldehyde-3-phosphate- dehydrogenase
  • hexokinase phosphofructokinase
  • 3-phosphoglyceratemutase 3-phosphoglyceratemutase
  • the yeast PH05 gene encoding acid phosphatase, also provides useful promoter sequences, Myanohara et al. (1983) Proc. Natl. Acad. Sci. USA 80:1.
  • synthetic promoters which do not occur in nature also function as yeast promoters.
  • UAS sequences of one yeast promoter may be joined with the transcription activation region of another yeast promoter, creating a synthetic hybrid promoter. Examples of such hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region (U.S. 4,876,197 and U.S. 4,880,734).
  • hybrid promoters include promoters which consist of the regulatory sequences of either the ADH2, GAL4, GAL10, or PH05 genes, combined with the transcriptional activation region of a glycolytic enzyme gene such as GAP or PyK (EPO Publ. No. 164 556).
  • a yeast promoter can include naturally occurring promoters of non-yeast origin that have the ability to bind yeast RNA polymerase and initiate transcription. Examples of such promoters include, inter alia, Cohen et al. (1980) Proc. Natl. Acad. Sci. USA 77:1078; Henikoff et al. (1981) Nature 283:835; Hollenberg et al. (1981) Curr. Topics Microbiol. Immunol.
  • a DNA molecule may be expressed intracellularly in yeast.
  • a promoter sequence may be directly linked with the DNA molecule, in which case the first amino acid at the N- terminus of the recombinant protein will always be a methionine, which is encoded by the ATG start codon. If desired, methionine at the N-terminus may be cleaved from the protein by in vitro incubation with cyanogen bromide.
  • Fusion proteins provide an alternative for yeast expression systems, as well as in mammalian, baculovirus, and bacterial expression systems.
  • SUBSTITUTE SHEET stable protein is fused to the 5* end of heterologous coding sequences. Upon expression, this construct will provide a fusion of the two amino acid sequences.
  • the yeast or human superoxide dismutase (SOD) gene can be linked at the 5' terminus of a foreign gene and expressed in yeast.
  • the DNA sequence at the junction of the two amino acid sequences may or may not encode a cleavable site. See e.g., EPO Publ. No. 196 056.
  • Another example is a ubiquitin fusion protein. Such a fusion protein is made with the ubiquitin region that preferably retains a site for a processing enzyme (e.g.
  • foreign proteins can also be secreted from the cell into the growth media by creating chimeric DNA molecules that encode a fusion protein comprised of a leader sequence fragment that provide for secretion in yeast of the foreign protein.
  • a leader sequence fragment that provide for secretion in yeast of the foreign protein.
  • processing sites encoded between the leader fragment and the foreign gene that can be cleaved either in vivo or in vitro.
  • the leader sequence fragment usually encodes a signal peptide comprised of hydrophobic amino acids which direct the secretion of the protein from the cell.
  • DNA encoding suitable signal sequences can be derived from genes for secreted yeast proteins, such as the yeast invertase gene (EPO Publ. No. 012 873; JPO Publ. No. 62,096,086) and the A-factor gene (U.S. 4,588,684).
  • yeast invertase gene EPO Publ. No. 012 873; JPO Publ. No. 62,096,086) and the A-factor gene (U.S. 4,588,684).
  • leaders of non-yeast origin such as an interferon leader, exist that also provide for secretion in yeast (EPO Publ. No. 060 057).
  • a preferred class of secretion leaders are those that employ a fragment of the yeast alpha-factor gene, which contains both a "pre" signal sequence, and a "pro" region.
  • the types of.alpha-factor fragments that can be employed include the full-length pre-pro alpha factor leader (about 83 amino acid residues) as well as truncated alpha-factor leaders (usually about 25 to about 50 amino acid residues) (U.S. 4,546,083 and U.S. 4,870,008; EPO Publ. No. 324 274).
  • Additional leaders employing an alpha-factor leader fragment that provides for secretion include hybrid alpha- factor leaders made with a presequence of a first yeast, but a pro-region from a second yeast alphafactor. (See e.g., PCT Publ. No. WO 89/02463.)
  • transcription termination sequences recognized by yeast are regulatory regions located 3' to the translation stop codon, and thus together with the promoter flank the coding sequence. These sequences direct the transcription of an mRNA which can be translated into the polypeptide encoded by the DNA. Examples of transcription terminator sequence and other yeast-recognized termination sequences, such as those coding for glycolytic enzymes.
  • expression constructs are often maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as yeast or bacteria.
  • the replicon may have two replication systems, thus allowing it to be maintained, for example, in yeast for expression and in a prokaryotic host for cloning and amplification.
  • yeast-bacteria shuttle vectors include YEp24, Botstein et al. (1979) Gene 8:17- 24; pCl/1, Brake et al. (1984) Proc.
  • a replicon may be either a high or low copy number plasmid.
  • a high copy number plasmid will generally have a copy number ranging from about 5 to about 200, and usually about 10 to about 150.
  • a host containing a high copy number plasmid will preferably have at least about 10, and more preferably at least about 20.
  • a high or low copy number vector may be selected, depending upon the effect of the vector and the foreign protein on the host.
  • the expression constructs can be integrated into the yeast genome with an integrating vector.
  • Integrating vectors usually contain at least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contain two homologous sequences flanking the expression construct. Integrations appear to result from recombinations between homologous DNA in the vector and the yeast chromosome, Orr-Weaver et al. (1983) Methods in Enzymol. 101:228-245.
  • An integrating vector may be directed to a specific locus in yeast by selecting the appropriate homologous sequence for inclusion in the vector.
  • One or more expression construct may integrate, possibly affecting levels of recombinant protein produced, Rine et al. (1983) Proc. Natl. Acad. Sci.
  • the chromosomal sequences included in the vector can occur either as a single segment in the vector, which results in the integration of the entire vector, or two segments homologous to adjacent segments in the chromosome and flanking the expression construct in the vector, which can result in the stable integration of only the expression construct.
  • extrachromosomal and integrating expression constructs may contain selectable markers to allow for the selection of yeast strains that have been transformed.
  • Selectable markers may include biosynthetic genes that can be expressed in the yeast host, such as ADE2, HIS4, LEU2, TRP1, and ALG7, and the G418 resistance gene, which confer resistance in yeast cells to tunicamycin and G418, respectively.
  • a suitable selectable marker may also provide yeast with the ability to grow in the presence of toxic compounds, such as metal. For example, the presence of CUP1 allows yeast to grow in the presence of copper ions. Butt et al. (1987) Microbiol, Rev. 51:351.
  • transformation vectors are usually comprised of a selectable marker that is either maintained in a replicon or developed into an integrating vector.
  • Expression and transformation vectors have been developed for transformation into many yeasts.
  • expression vectors have been developed for, inter alia, the following yeasts: Candida albicans, Kurtz, et al. (1986) Mol. Cell. Biol. 6:142; Candida maltosa, Kunze, et al. (1985) J. Basic Microbiol. 25:141; Hansenula polymorpha, Gleeson, et al. (1986) J. Gen. Microbiol. 132:3459; Roggenkamp et al. (1986) Mol. Gen. Genet. 202:302; Kluyveromyces fragilis, Das, et al. (1984) J. Bacteriol.
  • Methods of introducing exogenous DNA into yeast hosts are well-known in the art, and usually include either the transformation of spheroplasts or of intact yeast cells treated with alkali cations. Transformation procedures usually vary with the yeast species to be transformed. See e.g., Kurtz et al. (1986) Mol. Cell. Biol. 6:142; Kunze et al. (1985) J. Basic Microbiol. 25:141, for Candida; Gleeson et al. (1986) J. Gen. Microbioy. 132:3459; Roggenkamp et al.
  • Each of the recombinant peptide antigens discussed herein may be used as a sole vaccine candidate or in combination with one or more other antigens from other pathogenic sources. These vaccines may either be prophylactic (to prevent infection) or therapeutic (to treat disease after infection) .
  • Such vaccines comprise the peptide antigen usually in combination with "pharmaceutically acceptable carriers", which include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition.
  • Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes) , and inactive virus particles.
  • Such carriers are well known to those of ordinary skill in the art. Additionally, these carriers may function as immunostimulating agents ("adjuvants”) .
  • the antigen may be conjugated to a bacterial toxoid, such as a toxoid from diphtheria, tetanus etc.
  • Preferred adjuvants to enhance effectiveness of the composition include, but are not limited to: (1) aluminum salts (alum) , such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc; (2) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components) , such as for example (a) MF59 (PCT Publ. No.
  • WO 90/14837 containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below) , although not required) formulated into submicron particles using a microfluidizer such as Model HOY microfluidizer (Microfluidics, Newton, MA), (b) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (see below) either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (c) RibiTM adjuvant system (RAS) , (Ribi Immunochem, Hamilton, MT) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL) , trehalose dimycolate (TDM) , and cell wall
  • muramyl peptides include, but are not limited to, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP) , N-acetyl-normuramyl-1-alanyl-d-isoglutamine (nor-MDP) , N-acetylmuramyl-l-alanyl-d-isoglutaminyl-1- a l a n i n e - 2 - ( l ' - 2 ' - d i p a l m i t o y l - s n - g l y c e o - 3 - hydroxyphosphoryloxy) -ethylamine (MTP-PE) , etc.
  • thr-MDP N-acetyl-muramyl-L-threonyl-D-isoglutamine
  • the immunogenic compositions typically will contain diluents, such as water, saline, glycerol, ethanol, etc. Additionally, auxiliary substances, such as wetting or emulsifying agents, pH buffering substances, and the like, may be present in such vehicles.
  • the immunogenic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared.
  • the preparation also may be emulsified or encapsulated in liposomes for enhanced adjuvant effect, as discussed above under pharmaceutically acceptable carriers.
  • Immunogenic compositions used as vaccines comprise an immunologically effective amount of the antigenic polypeptides, as well as any other of the above-mentioned components, as needed.
  • immunologically effective amount it is meant that the administration of that amount to an individual, either in a single dose or as part of a series, is effective for treatment or prevention. This amount varies depending upon the health and physical condition of the individual to be treated, the taxonomic group of individual to be treated (e.g., nonhuman primate, primate, etc.), the capacity of the individual's immune system to synthesize antibodies, the degree of protection desired, the formulation of the vaccine, the treating doctor's assessment of the medical situation, and other relevant factors. It is expected that the amount will fall in a relatively broad range that can be determined through routine trials.
  • the immunogenic compositions are conventionally administered parenterally, e.g., by injection, either subcutaneously or intramuscularly. Additional formulations suitable for other modes of administration include oral and pulmonary formulations, suppositories, and transdermal applications. Dosage treatment may be a single dose schedule or a multiple dose schedule.
  • the vaccine may be administered in conjunction with other immunoregulatory agents.
  • Flagellin has been chosen as an example of a protein of unknown three-dimensional conformation and because of the interest recently raised by this structure as a carrier of heterologous epitopes.
  • the TL-l ⁇ nonapeptide was inserted into the hypervariable region, already shown to be particularly tolerant to insertions (Newton et al., 1989, Science, 240, 70; Wu et al . , 1989, PNAS, 6., 4726; McEwan et al . , 1992, Vaccine 10, 405).
  • Ferritin was selected as a poorly immunogenic peptide whose structure is known in detail.
  • the H chain of human ferritin due to the high sequence homology with murine ferritin, is a poor immunogen in the mouse (Miyazaki et al., 1988, NAR, 16., 10373) .
  • the three-dimensional structure of the human H ferritin homopolymer is known at high resolution (Lawson et al. , 1991, Nature, 349, 541) and a detailed mutagenic analysis has revealed tolerant sites that can accept peptide insertions without harming the general fold of the protein (Luzzago and Cesareni, 1989, EMBO J. , 8., 569; Jappelli et al. , 1992, J. Mol.
  • Ferritin is a heteropolymer consisting of two types of chains (H and L) that assemble in different proportions in different tissues (Arosio et al. , 1978, JBC 253. 4451).
  • the monomer consists of a bundle of 4 antiparallel alpha helices (A-D) connected by loops.
  • ferritin H chain was efficiently expressed in E. coli by using a plasmid vector containing the pi promoter of lambda bacteriophage.
  • the sequence coding for ferritin H chain has been modified by site directed mutagenesis to introduce a unique Smal restriction site in the region connecting D and E helices.
  • VQGEESNDK Two complementary oligonucleotides coding the sequence VQGEESNDK were then introduced in the unique Smal site (see Fig 1 for a schematic representation) . Correct insertion of the sequence was then verified by sequencing the mutated expression vector and by positive staining in western blot of the purified protein with a VQGEESNDK sequence specific monoclonal antibody (Boraschi et al., 1988, J. Exp. Med. , 168. 678) . Wild type or mutated ferritins were purified as previously published (Luzzago and Cesareni, 1989) .
  • Plasmid F83 is an expression plasmid that directs the synthesis of a modified H chain of human ferritin under the control of the pi promoter of bacteriophage ⁇ .
  • F83 contains a unique Smal site in the sequence encoding the loop between helix D and helix E of ferritin-and can be exploited to construct hybrid ferritin genes encoding modified ferritins that display peptide inserts in the D-E loop.
  • F83 was a derivative of p2HFt (Levi et al . , 1987, Gene, 5JL, 269) by defined modifications.
  • the sequence encoding the ferritin protein was first fused to a fragment of the 3-galactosidase gene encoding the ⁇ -peptide gene by oligonucleotide directed mutagenesis (Oligo 122: AATGAAAGCTAGGCCGTCG) .
  • This plasmid (F27) the two genes are separated by a suppressible amber codon.
  • the Lys at position 86 was then changed into a Gin (oligo 172: CAGGATATCCAGAAACCAG) to obtain a plasmid (F2) that directs the synthesis of a ferritin that forms crystals in the presence of calcium (Lawson et al . , 1991).
  • D-E loop of the ferritin produced by plasmid F103 is G 159 GPGVQGEESNDKP 161 GS 163
  • the protein encoded by this plasmid will be hereafter referred to as Ferl03.
  • F120 is an expression plasmid that directs the synthesis of a hybrid ferritin displaying a decapeptide of unrelated sequence that was used as a control in immunizations.
  • the aminoacid sequence of the D-E loop of this latter hybrid protein is GGPGNLLLQTSWGS.
  • the oligonucleotide R27 AACAACGGATGTTTGCAGCAGCAGGTTTCC
  • R31 GGAAACCTGC
  • This double stranded DNA fragment was ligated into the Smal site of plasmid F83 to yield, in one of the two possible orientations, plasmid F120.
  • the encoded protein that contains this unrelated sequence will be referred to as Ferl20. See fig la for a schematic representation of ferritin constructs.
  • Plasmid pLS408 (Newton et al . , Science, 244. 70) was derived from pUC19 plasmid by the insertion of a fragment that includes the Hl-d flagellin gene from Salmonella muenchen from which has been deleted a 48bp fragment between the two EcoRV sites in its hypervariable region. Thus, this plasmid contains a unique EcoRV restriction site between two codons of the Hl-d flagellin gene into which in-frame insertions encoding exogenous sequences can be inserted.
  • the flagellin encoded by pLS408 which expresses no heterologous sequences will be referred to hereinafter as Fla408.
  • Plasmid pLS449 is derived from pLS408 with an insertion, at the EcoRV site, of the two complementary oligonucleotides ATCGTTCAGGGTGAAGAATCCAACGACAAA and TTTGTCGTTGGATTCTTCACCCTGAACGAT which encode the human IL-10 163-171 peptide with an initial extra codon (ATC) regenerating the EcoRV site.
  • the insert thus directs the synthesis of the decapeptide IVQGEESNDK.
  • the flagellin protein encoded by pLS449 will be referred to as Fla449.
  • the flagellin derivative encoded by this plasmid will be referred to as Fla517. See Fig lb for a schematic representation of flagellin constructs. The correct insertion and orientation of plasmid constructs was verified by sequence analysis. All the above constructions were made in E.coli HB101 and used to transform LB5000 strain of Salmonella typhimurium (Newton et al . , 1989).
  • SL5928 is a S.dublin aroA strain which is non-motile because its single flagellin gene was replaced by a gene inactivated by the insertion of transposon TnlO (Newton et al . , 1989).
  • Motility is recovered in transformed SL5928 strains expressing a functional flagellin protein. Motility was assessed by inoculating at the top of Falcon tubes containing 40ml of LB media with 0.4% agar and their ability to grow at the bottom of the tube was assessed after overnight incubation at 37°C.
  • ferritins were produced and purified as previously described (Jappelli et al . , 1992) .
  • the three modified ferritins were all assembled in a soluble and thermo-resistant 24mer.
  • the ferritin protein products, purified from bacteria containing F83 or F103 plasmids were analysed by denaturing SDS-PAGE, blotted onto nitrocellulose and probed either with anti-ferritin or anti IL-1 / 3 (Boraschi et al . , 1989, J. Immunol, 143, 131; Scapigliati et al . , 1991, J. Immunol. Meth. , 138, 31) antibodies.
  • Flagellins were purified as follows: the motile strains were inoculated in 500ml of LB media with lOO ⁇ g/ml of ampicillin and incubated at 37°C overnight. Cells were harvested by centrifugation (10,00Ox g for 20min) and resuspended in 6 ml of PBS and vortexed with glass beads (150-212 ⁇ m) (Sigma, St.Louis, MO) for 5min. Cells were removed by centrifugation at 10,000x g for 20min and the supernatant was filtered through 0.45 ⁇ m filters (Millipore, Molsheim, France) . The filtrate was centrifuged at 100,000x g for 1 hour at 4°C.
  • the pellet containing the flagella was resuspended in 0,5 ml of 0.0IN HCl and was incubated at 0°C for 15 min to allow complete dissociation of the flagella into flagellin subunits. Insoluble material was removed by centrifugation at 100,000x g for 1 hour at 4°C and the supernatant was stored at -20°C. Affinity chromatography was used for the final purification of flagellin. IgG from commercially available anti-Salmonella flagellar antiserum (Difco, Detroit, MI) were purified using Protein-G affinity chromatography (MabTrap purification kit, Pharmacia, Upplsala, Sweden) .
  • the purified IgG were then coupled to Carbolink gel (Pierce, Rockford, IL) through their Fc region using Immunopure Ag/Ab Immobilization kit #3 (Pierce) and affinity chromatography of flagellins was performed according to the manufacturer instructions. The final products were stored in 0.0IN HCl. Flagellins were analyzed by western blotting of reducing SDS-PAGE using anti-flagellin (Difco) or anti-IL-13 (Scapigliati et al., 1991) polyclonal antibodies.
  • VQGEESNDK sequence inserted either in ferritin or in flagellin was determined by the capacity of hybrid constructs to enhance murine in vivo immune response against SRBC (Sclavo Spa, Siena, Italy) as described (Ghiara et al . , 1987, J. Immunol., 139, 676; Nencioni et al . , 1987).
  • mice Female C3H/HeJ mice (Charles River, Calco, Italy) of 6 to 10 weeks of age were injected intraperitoneally (i.p.) with pyrogen-free saline alone or containing different amounts of the recombinant proteins. After 4 days the spleens were removed and assayed for the number of specific Plaque Forming Cells (PFC) against proteins without heterologous sequences (Fer83 or Fla408) coupled to SRBC using CrCl 3 according to a previously published procedure (Sweet and Wellborn, 1971, J. Immunol., 106. 1407).
  • PFC Plaque Forming Cells
  • the number of specific PFC/spleen induced by the immunization was determined after subtraction of the number of background PFC/spleen obtained from mice that received saline alone.
  • Fer83 (lO ⁇ g/ml in PBS pH 7.4 containing 0.02% NaN 3 ) or Fla408 (l ⁇ g/ml in O.IM Na 2 C0 3 , pH 9.6) were adsorbed onto wells of 96 well-plates (Dynatech, Denkedorf, Germany) overnight at room temperature (RT) .
  • Absorbance at 415 nm was determined spectrophotometrically using a Titertek Multiscan (Flow Laboratories, Irvine, Scotland) .
  • Antibody titer (Fig 4b) was expressed as the highest serum dilution, obtained with linear interpolation, giving an adsorbance equal to the double of that observed with the lowest dilution (1:10) of control (unimmunized) sera.
  • Results from PFC assays are expressed as the geometric mean + SEM of PFC/spleen from groups of three mice assayed individually after subtraction of mean spontaneous PFC value obtained from mice immunized with saline alone.
  • Data from ELISA assays are expressed as the mean + SEM of triplicate determinations obtained from pooled sera of groups of 3 to 6 mice. The statistical significance was assessed using Student's t test.
  • Fig 1 shows the schematic representations of the hybrid constructs of both human ferritin H chain (Fig la) and Salmonella flagellin (Fig lb) obtained as described above. Verification of the correct expression of VQGEESNDK sequence into hybrid constructs was accomplished using Western blot analysis of the recombinant purified proteins.
  • Fig 2 shows the location of the VQGEESNDK sequence in three-dimensional rpresentations of the ferritin molecule. Its location in an exposed loop of the sequence at the edge of the structure is clearly indicated.
  • Fig 3a shows the results obtained with ferritins.
  • Lanes 1 and 2 show the Coomassie staining of the Fer83 and Ferl03 respectively; the higher apparent molecular weight observed with Ferl03 (lane 2) accounts for the insertion of VQGEESNDK.
  • Lanes 3 and 4 show the result of the Western blot analysis performed with the polyclonal anti-ferritin antiserum in which it can be seen that both the proteins were able to bind the antibody.
  • the result of Western blot using the anti-IL-13 monoclonal antibody recognizing VQGEESNDK sequence shows that only the chimeric construct Ferl03 was able to bind the antibody.
  • Ferl03 was also recognized by a polyclonal anti-IL-1/3 antibody (Scapigliati et al . , 1991) (data not shown) .
  • Fig 3b shows the results of similar experiments performed with flagellin constructs.
  • the presence of VQGEESNDK sequence within the protein structure of Fla449 accounts for the difference in the apparent molecular weight observed by Coomassie staining (lanes 1 and 2) .
  • Both Fla408 and Fla449 were stained with a polyclonal anti-Salmonella flagellar antibody (lanes 3 and 4) , while Western blot using anti-IL-l? antibody (lanes 5 and 6) shows that only Fla449 could be recognized.
  • the ferritin or flagellin constructs were used as adjuvants to enhance the immune response against SRBC.
  • Table I shows that both Ferl03 (Exp 1) and Fla449 (Exp 2), carrying the human IL-l / S 163-171 sequence, were able to significantly enhance the immune response when injected intravenously (i.v.) along with SRBC, while the two control proteins Fer83 and Fla408 were inactive.
  • the adjuvant effect observed was comparable in both experiments to that observed with lng/kg of synthetic peptide VQGEESNDK.
  • the doses of the proteins (20ng/kg for ferritins and 50ng/kg for flagellins) were selected in order to inject the mice with molar amounts comparable to that of lng/kg of free 163-171 IL-13 sequence.
  • the number of anti-SRBC PFC per spleen was determined as described in Materials and Methods four days after I.V. immunization with SRBC alone or together with recombinant proteins or with the synthetic peptide 163-171 of human
  • mice a not significantly different from saline-treated mice.
  • mice p ⁇ 0.001 vs saline-treated mice.
  • mice c p ⁇ 0.02 vs saline-treated mice.
  • mice were injected i.p. with pyrogen-free saline alone or containing different amounts of the recombinant proteins. After 4 days the spleens were removed and the number of PFC specific for the host proteins coupled to SRBC were determined after subtraction of non-specific plaques observed with mice injected with saline alone (see figure 4 and Table II) .
  • Fig 4a shows the result obtained with ferritin mutants.
  • Mice injected with Ferl03 have a significantly higher number of specific PFC/spleen as compared with mice immunized with Fer83 at doses of 10, 50 or 400 ⁇ g/kg. No increase in immunogenicity was observed when mice were immunized with 2 ⁇ g/kg of the recombinant ferritins.
  • ferritin molecule containing the sequence VQGEESNDK is more immunogenic than the native molecule. Similar results were obtained with flagellin constructs..
  • Fig 3b shows that the hybrid protein induced, at every dose tested, a significantly greater number of flagellin specific PFC/Spleen than the protein without the IL-ljS sequence.
  • Fig 5a shows the result of a representative experiment; the mice immunized with Ferl03, expressing the VQGEESNDK sequence, had an higher amount of anti-ferritin IgG with respect to animals that received the protein Fer83.
  • Fig 5b shows that similar results were obtained with flagellin construct.
  • Groups of 6 mice were immunized intraperitoneally with 240 ⁇ g/kg of either Fla408 or Fla449, and serum anti-flagellin IgG titer was assessed at different times after the immunization.
  • Mice immunized with hybrid flagellin had, 12 days after the treatment, a significantly higher anti-flagellin titer than the mice immunized with the non-chimeric molecule. The difference was still significant even in the sera taken 38 days after the injection.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Cette invention concerne un antigène peptidique de recombinaison dans la séquence d'acides aminés duquel est contenue la séquence d'acides aminés d'un domaine immunostimulant hétérologue, à condition que l'antigène peptidique ne soit pas un inhibiteur de l'interleukine-1. Cette invention concerne également des compositions de vaccin contenant un ou plusieurs antigènes selon cette invention ainsi que des procédés d'utilisation de ces vaccins et des procédés de production d'antigènes peptidiques à l'aide de techniques faisant appel à l'ADN de recombinaison.
EP93906579A 1992-03-23 1993-03-22 Antigene de recombinaison contenant dans sa sequence un domaine immunostimulant heterologue- son utilisation comme vaccin Withdrawn EP0637337A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
ITFI920071A IT1262898B (it) 1992-03-23 1992-03-23 Antigeni ricombinanti proteici ad aumentata immunogenicita' contenenti il peptide rappresentato dalla sequenza vqgeesndk
ITFI920071 1992-03-23
PCT/EP1993/000685 WO1993019185A1 (fr) 1992-03-23 1993-03-22 Antigene de recombinaison contenant dans sa sequence un domaine immunostimulant heterologue- son utilisation comme vaccin

Publications (1)

Publication Number Publication Date
EP0637337A1 true EP0637337A1 (fr) 1995-02-08

Family

ID=11350020

Family Applications (1)

Application Number Title Priority Date Filing Date
EP93906579A Withdrawn EP0637337A1 (fr) 1992-03-23 1993-03-22 Antigene de recombinaison contenant dans sa sequence un domaine immunostimulant heterologue- son utilisation comme vaccin

Country Status (6)

Country Link
EP (1) EP0637337A1 (fr)
JP (1) JPH07507447A (fr)
AU (1) AU3751093A (fr)
CA (1) CA2132420A1 (fr)
IT (1) IT1262898B (fr)
WO (1) WO1993019185A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100535971B1 (ko) 1997-03-07 2006-06-21 디에스엠 아이피 어셋츠 비. 브이 경화 속도가 빠른 방사선-경화성 조성물
CN116916949A (zh) * 2020-10-02 2023-10-20 伊穆农股份有限公司 多核苷酸疫苗及其使用方法

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT1217314B (it) * 1987-02-20 1990-03-22 Sclavo Spa Nonapeptide sintetico ad attivita'adiuvante capace di potenziare in vivo la risposta anticorporale
NZ235315A (en) * 1989-09-19 1991-09-25 Wellcome Found Chimaeric hepadnavirus core antigen proteins and their construction
WO1991017184A1 (fr) * 1990-04-27 1991-11-14 The Upjohn Company Inhibiteurs ameliores d'interleukine-1

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9319185A1 *

Also Published As

Publication number Publication date
ITFI920071A0 (it) 1992-03-23
AU3751093A (en) 1993-10-21
WO1993019185A1 (fr) 1993-09-30
IT1262898B (it) 1996-07-22
CA2132420A1 (fr) 1993-09-24
ITFI920071A1 (it) 1993-09-23
JPH07507447A (ja) 1995-08-24

Similar Documents

Publication Publication Date Title
EP0632727B1 (fr) Composes conjugues obtenus a partir de proteines du choc thermique et d'oligosaccharides ou de polysaccharides
US7700755B2 (en) Helicobacter pylori CAI antigen
CA2127091C (fr) Mutants immunogenes detoxifies de la toxine du cholera et de la toxine lt; leur preparation et leur utilisation pour la preparation de vaccins
EP0643770B1 (fr) Antigen immunodominant associe avec le cytotoxin d'helicobacter pylori utiles pour des vaccins et des diagnostics
CA2268758C (fr) Toxine lt-a d'e. coli mutante detoxiquee immunogene
US20060147474A1 (en) Detection of antibodies against chamydia trachomatis PGP3 antigen in patient sera by enzyme-linked immunoassay
US7872114B2 (en) Immunogenic detoxified mutants of cholera toxin
WO1996033274A1 (fr) Region cagi de helicobacter pylori
WO1997029771A1 (fr) Mutants detoxiques et immunogenes de toxine du cholera
US20070243204A1 (en) Helicobacter pylori proteins useful for vaccines and diagnostics
WO1993019185A1 (fr) Antigene de recombinaison contenant dans sa sequence un domaine immunostimulant heterologue- son utilisation comme vaccin
US20020044939A1 (en) Immunogenic detoxified mutants of cholera toxin

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19941021

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BIOCINE S.P.A.

17Q First examination report despatched

Effective date: 19960423

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19960904