Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4702—Regulators; Modulating activity
  • C07K14/4705—Regulators; Modulating activity stimulating, promoting or activating activity
  • C07K14/4706—Guanosine triphosphatase activating protein, GAP

Definitions

• This invention relates generally to the field of molecular biology, and specifically to rap GAPs (ras proximate guanine iriphosphatase activating proteins); and methods and material(s) for identifying anti-cancer therapeutics using these molecules.
• Rap is a protein capable of reverting ras oncogene transformed cells to a normal cell phenotype.
• Rap GAP is a protein capable of activating the intrinsic GTPase activity of rap. The following presents a background on the ras, rap proteins and their respective GAPs.
• Ras proto-oncogenes encode an evolutionary conserved family of proteins, ras p21 proteins, widely present in eukaryotic cells. Mutant and viral forms of ras p21 have been implicated in many cancers. The ras oncogenes have been implicated in the development of a variety of tumors, and have been shown to be involved in about 10 to 40% of the most common forms of human cancer. ⁇ ££ Varmus, H., 1984, Ann. Rev. Genetics.1&553 and Barbacid, M., 1986, in Important Advances in Oncology.
• ras oncogenes have been consistently identified in carcinomas of the bladder, colon, kidney, liver, lung, ovary, pancreas and stomach. They have also been identified in hematopoietic tumors of lymphoid and myeloid lineage, as well as in tumors of mesenchymal origin. Futhermore, melanomas, teratocarcinomas, neuroblastomas, and gliomas have been shown to possess ras oncogenes.
• Ras p21 (hereinafter also referred to as ras) exhibits both GTP and GDP binding, and GTPase activities. Barbacid, M., 1987, Annal Rev. Biochem..56:779- 827; Takai, Y., sl l, 1988, Progress in Endocrinology. Imura, H. stal (eds.) 2:995- 1000; Elsevier Science Publishers, B.V., Amsterdam). It binds guanine nucleotides and converts bound guanosine triphosphate (GTP) to guanosine diphosphate (GDP) by an intrinsic guanosine triphosphatase (GTPase) activity.
• GTP guanosine triphosphate
• GDP guanosine diphosphate
• GTPase intrinsic guanosine triphosphatase
• GTP-binding proteins There are at least 25 distinct low molecular mass GTP-binding proteins represented in eukaryotic cells. These proteins exhibit homology to ras p21, particularly in regions known to be involved in the binding and hydrolysis of GTP. Examples of these proteins are rap, rho, and G25K. Rap is an acronym for ras- proximate which denotes that it is a ras related GTP binding protein. Rap has been purified. Kawata, M., st l, 1988, J. Biol. Chem.. 263: 1965. Recently, two human cDNAs encoding raps have been isolated and cloned. Pizon, V., si al, 1988, Oncogene.2:201-204.
• rap and ras proteins share many structural properties, for example, rap proteins share amino acid sequence similarities with regions 10 to 17 and 57 to 63 of the ras protein. I$L In fact, the effector regions of ras and rap, regions 32 to 40, are identical. Transfection of ras-transformed cells with human cDNA encoding rap results in the phenotypic reversion of the transformed cells. itayama, H., et al.. 1989, Cell.56: 77-84. The suppression of ras-transformed phenotype by the cDNA encoding rap operates in a mRNA level dependent manner.
• rap GAP GTPase activating protein
• Rap GAP activity has been identified in the cytosols of bovine brain and human platelets.
• Two forms of cystosolic rap GAPs obtained from bovine brain were reported by Kikuchi, A., s al., 1989, J. Bio. Chem..262:9133-9136. According to Kikuchi, ⁇ t al., these rap GAPs stimulated the GTPase activity of rap but not that of c-Ha-ras p21 (another name for rap p21), rho, and smg-25A (smg-25A is also known as rab3). These rap GAPs did not stimulate the dissociation of guanosine 5'-3-0-(thio)triphosphate and GDP from rap. Further, these rap GAPs did not themselves have GTP/GDP binding activity nor GTPase activity.
• the M r of the two rap GAPs are believed to be: 300-400 x 103 and 90-100 x
• One aspect of the invention presents substantially purified rap GAP with a molecular weight of about 88,000.
• two rap GAPs are disclosed: rap GAPm and rap GAPb.
• Another aspect of the invention presents the DNA and predicted amino acid sequences of rap GAP.
• Another aspect of the invention presents antibodies to rap GAP, synthetic peptides for producing the antibodies, and methods for producing the antibodies.
• Another aspect of the invention presents peptides comprising partial amino acid sequences of rap GAP.
• Another aspect of the invention presents methods for purifying rap GAP using successive chromatographic steps.
• Another aspect of the invention presents methods for isolating membrane associated rap GAP from tissue and cell sources.
• Another aspect of the invention presents methods for purifying rap GAP using monoclonal antibodies to rap GAP or to peptides comprising partial amino acid sequences of rap GAP.
• a further aspect of the invention presents methods for identifying anti-cancer therapeutics using material(s) and methods consisting of rap GAP.
• Figure 1 presents an analysis of rap protein purified from human platelet membranes.
• SDS-PAGE gels were either stained for protein with Coomassie Blue (Coo Blue) or subjected to electroblotting. The blots were incubated with antibodies reactive to rap, G25K, rac-1, or p21 as indicated below the panels. 100 ng of each of the purified proteins or 50 ⁇ g of plasma membrane (PM) for HL60 cells were applied to the gel lanes.
• Coomassie Blue Coo Blue
• PM plasma membrane
• Figure 2 presents the association of rap GAP with the plasma membranes from differentiated HL60 cells. The results are expressed as a percentage of the formylpeptide binding or rap GAP activity determined for membranes incubated in buffer only.
• Figure 3 presents the detergent solubilization of rap GAP activity.
• the Rap GAP assays were carried out as described below, except that a 10-fold volume of all components was used. At the indicated times 20 ⁇ l aliquots were removed, diluted and then filtered through nitrocellulose. Percent remaining indicates nonfilterable [ ⁇ - 32 P]GTP relative to buffer control at zero time.
• Extraction buffer (closed symbols); 5 ⁇ l of membrane extract (open symbols).
• Figure 4 presents the elution profiles of rap GAP activities of cytosolic and solubilized membrane rap GAP on size exclusion HPLC.
• Figure 6 presents a Mono Q HR5/5 FPLC column (5 x 50 mm) chromatography.
• Figure 7 presents Hydroxylapatite HPLC.
• Figure 8 presents SEC-250 HPLC.
• Figure 9 presents cation exchange SP-5-PW HPLC of rap GAP purified from bovine brain membranes.
• Figure 10 presents the DNA and the predicted amino acid sequences of HP3-12 and HUB 10A; the amino acid sequences of the peptide for raising polyclonal rabbit antibodies against rap GAP (denoted "S" in the drawing) is also shown.
• Figure 11 presents: A) S-Sepharose chromatogram of AcRG4 infected baculovirus cell lysate. Rap GAP activity ( ); NaCl concentration ( ). 2 ⁇ l of a 1/1,000 dilution of each fraction was assayed for rap GAP activity.
• Figure 12 presents Western blot of rap GAP purified from different sources.
• Lane M contained 15 ⁇ l of rap GAP lysate from the membrane fraction of Spodoptera frugiperda (Sf9) cells infected with AcRG9; Lane C contained 0.3 ⁇ l of rap GAP lysate from the cytosol fraction of Sf9 cells infected with AcRG9; the membrane fractions were resuspended in the same volume as that of the cytosolic fraction.
• Lane "Bov Br” contained 15 ⁇ l of a 0.01 mg ml solution of rap GAP purified from bovine brain membrane.
• the rabbit antibodies used were raised against the synthetic peptide based on a partial rap GAP sequence (indicated by "S” in Figure 10). The antibodies were affinity purified against the synthetic peptide.
• the antibody production and purification was conducted according to the procedure outlined in Example 1.
• the present invention presents substantially purified rap GAPs.
• Rap GAPb was purified from bovine brain membranes, and rap GAPm was purified from plasma membrane of differentiated HL60 cells.
• the purification methods applicable to both native and recombinant rap GAPs which include for example, membrane and cytosolic rap GAPs, are also presented.
• the characterization of the two rap GAPs is also described.
• the invention further presents the partial amino acid sequence of rap GAP, specifically that of rap GAPb. Peptides comprising the partial amino acid sequences of rap GAPb are also presented.
• rap GAPs directed against these rap GAPs or peptides comprising the partial amino acid sequences of rap GAP are also described. Finally, methods for purifying rap GAP using these antibodies is also presented. These rap GAPs, and the fragments derived therefrom are particular useful as therapeutics for cancer.
• rap GAP Since the purified rap GAPs are obtained from crude preparations, the order of discussion of the invention will be: purification, characterization, and sequencing methods for rap GAPm and rap GAPb, respectively; the partial amino acid sequence of rap GAPb; synthesis of antibodies to the rap GAPs; peptides comprising the partial amino acid sequences of rap GAP; purification of rap GAP using monoclonal antibodies to rap GAP or to peptides comprising partial amino acid sequences of rap GAP; the therapeutic uses of rap GAP and their fragments.
• rap GAP may exist as aggregates or multimers under certain conditions, and that these forms are intended to come within the scope of the definition. Moreover, the definition is intended to cover fragments of rap GAP that exhibit activity.
• the precise chemical structure of the native and recombinant rap GAPs, and their fragments may depend on a number of factors.
• proteins contain ionizable amino and carboxyl groups, it is apparent that they may be obtained in acid or basic salt forms, or in neutral forms.
• the primary amino acid sequences may be augmented by derivatization using sugar molecules (glycosylation) or by other chemical derivatizations involving covalent or ionic attachment to the proteins with, for example, lipids, phosphate, acetyl groups and the like, often occurring through association with saccharides. These modifications may occur in vitro or in vivo, the latter being performed by a host cell through post- translational processing systems.
• rap GAPb is defined as rap GAP which is obtained from bovine brain, and is membrane associated.
• rap GAPm is defined as rap GAP which is obtained from differentiated HL60 cells, and is membrane associated.
• rap-GTP is defined as the GTP-bound form of rap.
• rap-GDP is defined as the GDP-bound form of rap.
• rap GAP-rap-GTP is defined as the complex comprising rap GAP bound to rap-GTP.
• the preface "pAcRG” denotes a plasmid containing a particular DNA insert; whereas the preface “AcRG” denotes the virus containing the particular DNA insert.
• chromatography is defined to include application of a solution containing a mixture of compounds to an adsorbent, or other support material which is eluted, usually with a gradient or other sequential eluant. Material eluted from the support matrix is designated eluate.
• the sequential elution is most routinely performed by isolating the support matrix in a column and passing the eluting solution(s), which changes affinity for the support matrix, either stepwise or preferably by a gradient, through the matrix. It will be appreciated that encompassed within the definition "chromatography” is the positioning of the support matrix in a filter and the sequential administering of eluant through the filter, or in a batch-mode.
• Rap GAP activities are found in cell membrane and cytosol.
• a general scheme for rap GAP isolation consists of isolating the molecule from the cytoplasm or membrane of appropriate cells, tissues or organs. More specifically, rap GAP is prepared by isolating the molecule from the cytosol or membrane using any number of techniques including freeze thawing, sonication, mild detergent extraction, and nitrogen cavitation, etc. This procedure is preferably carried out in a physiologically buffered solution containing one or more protease inhibitors. Moreover, to further inhibit protease activity, especially those proteases that rely on metal ions for activity, the extraction solution may contain metal ion chelators.
• the preferred extraction solution is a physiologically balanced salt solution containing the chelat ⁇ r e ⁇ ylenediarninetrichloroacetic acid (EDTA), plus the protease inhibitor phenylmethylsulfonylfluoride (PMSF).
• the metal ion chelator(s), as well as the protease inhibitors) are present at concentrations that effectively inhibit proteolysis, preferably about 1 mM, and 0.2 to 0.5 mM, respectively.
• concentrations that the protease inhibitors or chelators are used at, if indeed used at all will also vary.
• the mixture containing rap GAP is clarified by centrifugation, or in other ways to remove insoluble material from the aqueous fraction. If the aqueous fraction contains low amounts of rap GAP it can be concentrated by any one of several techniques well known to those skilled in the art, including high salt precipitation, for example, with ammonium sulfate, or by ultrafiltration. If rap GAP is concentrated by precipitation, it is preferably subsequently resuspended in a suitable physiologically balanced salt solution containing protease inhibitor(s).
• the first step in isolating the membrane rap GAP constitutes fractionating the source tissues or cells to obtain highly purified plasma membranes. To minimize the risk of degradation by endogenous or exogenous proteolytic activity, this step is carried out quickly in the cold and with the addition of protease inhibitors, such as PMSF, leupeptin, and N-tosyl-L-phenylalanylchloromethyl ketone (TCPK).
• protease inhibitors such as PMSF, leupeptin, and N-tosyl-L-phenylalanylchloromethyl ketone (TCPK).
• soluble proteins that are still associated with the membrane and peripheral membrane proteins may be removed by one or more of the following techniques, including exposing the membrane fraction to the following chemicals: KC1 or NaCl in relatively high concentrations of between 0.15 to 3.0 M; washing with buffers of acid or basic pH, or with sodium carbonate; chelating agents such as EDTA orEGTA up to 10 mM; chaotropic ions (I-, Br, CIO 4 -, SCN-) at high concentrations of between 2 to 4 M; phenolic compounds such as lithium 3, 5-diiodosolicylate; protein-modifying reagents such as p-chloromercuribenzoate, p- chloromercuribenzene sulfonate, and acid anhydries such as succinic or maeic anhydrides; reducing agents such as 2-mercapthoethanol or dithiothreitol (DTT).
• KC1 or NaCl in relatively high concentrations of between 0.15 to 3.0 M
• the mixture is then centrifiiged to recover the membranes.
• the membranes are solubilized with an appropriate detergent to liberate its constituents, lipids, and membrane proteins.
• the following detergents may be used: 1) nonionic detergents such as octylglucoside, Nonidet P-40 (hereinafter referred to as NP-40 and commercially available from Sigma Chem. Co., St.
• the membrane protein can be extracted with organic solvents.
• organic solvents examples include n-butanol, n- pentanol, aqueous phenol, pyridine, chloroform methanol mixture, acetic and formic acid, 2 chloroethanol, etc.
• fractionating methods phase separation, gel filtration, ion-exchange chromatography, affinity chromatography, covalent chromatography, hydrophobic interaction chromatography and HPLC, etc.
• SDS-PAGE sodium dodecyl sulfate- polyacrylamide electrophoresis
• the source tissue or cells are fractionated, preferably the cells are lysed by nitrogen cavitation.
• the membrane rap GAP is isolated in the cold, quickly, and in the presence of PMSF and leupeptin.
• the soluble proteins and peripheral membrane proteins are then removed by a combination of washing with NaCl; chelating agents such as EDTA and reducing agents such as DTT. After an appropriate incubation period, the mixture is centrifuged to recover the membrane fraction.
• the membrane fraction is then solubilized with detergents such as the non-ionic detergent NEMO, and bile salts such as deoxycholate.
• the preferred concentration range of NP-40, deoxycholate, DTT, and PMSF are preferably 0.5 to 1.0%; 0.5 to 1.0%; 0.5 to 1 mM; and 0.2 to 0.5 mM, respectively.
• the EDTA concentration is preferably about 1 mM.
• Detergent solubilized rap GAP either the cytosolic or membrane forms, may be purified as follows. In the preferred embodiment, Method 1 (for example, as used in the purification of rap GAP from bovine brain membrane), insoluble material is first removed and the soluble rap GAP fraction subjected to cation exchange chromatography, a sizing column, and an anion exchange chromatography. The order of the steps can be varied.
• Method 2 for example as employed in the purification of rap GAP from differentiated HL60 cells
• the alternative preferred purification procedure is as follows.
• the soluble rap GAP is subjected to cation and anion exchange chromatography, and hydroxylapatite HPLC (High Eressure Liquid Chromatography) (commercially available from Bio-Rad Laboratories, Richmond CA). Again, the order of the steps can be varied.
• HPLC High Eressure Liquid Chromatography
• Method 1 After detergent solubilization, described supra, a buffer solution is added to the protein mixture containing rap GAP.
• the solution is preferably phosphate buffered, but other buffers, for example, Tris and MES can also be used.
• An ion exchange chromatographic step compatible with the buffer is then used to purify the protein mixture.
• the solution containing rap GAP is purified by cation exchange chromatography.
• the eluate of the cation exchange chromatography is passed through a sizing column appropriate for excluding proteins of molecular size different from rap GAP.
• the fractions exhibiting rap GAP activity are subjected to an anion exchange chromatography followed by a cation exchange chromatography.
• the preferred purification scheme will consist of applying rap GAP in a phosphate buffered solution to a cation exchange chromatography, and eluting rap GAP therefrom, preferably using solutions which alter the pH or conductivity of the solution. More preferably, rap GAP will be eluted by applying either a gradient or non- gradient salt solution, and most preferably will be eluted using a linear gradient of sodium chloride over the range of about 0-0.5 molar.
• the preferred cation exchanger is a S-Sepharose cation exchanger (commercially available from Pharmacia/LKB Upsula Sweden).
• the S-Sepharose cation exchanger is an elastic 3-dimensional network composed of cellulosic backbones cross-linked with vinyl polymer containing pendant sulfopropyl functional groups.
• the matrix is preferably adapted for radial flow passage of the rap GAP solution. The flow rate of the solution through the matrix will depend upon the size and geometry of the matrix used. It will be apparent to those skilled in the art, however, that care should be taken to avoid exceeding the unit capacity of the matrix with rap GAP.
• rap GAP will not be totally retained and excess unretained rap GAP will be present in the effluent.
• the capacity of the matrix to retain rap GAP can be monitored by assaying for rap GAP in the effluent using one of the assays described below.
• the eluant is then passed through a size exclusion column appropriate to exclude proteins of molecular size different from rap GAP.
• the preferred size exclusion column is Sephacryl S-200 to S-300 (commercially available from Pharmacia/LKB, Upsula, Sweden), the latter is more preferred.
• Fractions containing rap GAP are then prepared for the third chromatographic step, the anion exchange chromatography.
• This consists of combining the fractions and adjusting the solution to a pH, and ionic strength compatible with anion exchange chromatography.
• anion exchangers are available, and depending on the type employed, the concentrations of these reagents will vary. The general procedures for preparing and using these matrices are known to those skilled in the art.
• the preferred anion exchanger is Mono Q HR 5/5 FPLC (commercially available from Pharmacia/LKB, Upsula, Sweden). It is prepared by equilibrating it with a solution containing Tris buffer at a pH of 8.5.
• the solution will consist of Tris, pH 8.5 plus a reducing agent, a metal chelator, and a protease inhibitor.
• concentrations of the metal chelator and protease inhibitor will vary depending on how extensively rap GAP is proteolysed, and whether the proteases responsible are activated by metal ions.
• the solution is then passed through the anion exchange matrix whereupon rap GAP binds to the matrix. Rap GAP is subsequently eluted from the matrix using solutions which alter the pH or conductivity.
• the preferred elution method consists of eluting rap GAP using a linear salt gradient ranging from 0-0.5 molar sodium chloride.
• the eluant is further dialysed against cation exchange buffer and passed through a cation exchanger.
• the preferred cation exchange buffer is S-Sepharose, (described in Example 1) buffer at pH 6.5 and the cation exchanger is PW-5 HPLC column (commercially available from Bio-Rad Laboratories, Richmond, California) and the column is eluted with 0-0.5 M NaCl. It should be noted that the above purification steps need not be conducted in the order presented but may be conducted in any order that allows purification to be effectuated.
• Method 2 Similar to Method 1, the step after detergent solubilization in Method 2 also involves the addition of a buffer as described in Method 1, to the protein mixture containing rap GAP. Similarly, a cation exchange chromatography is used. This is followed by an anion exchange chromatography and a hydroxylapatite HPLC (commercially available from Bio-Rad Laboratories, Richmond, California). The preferred cation and anion exchange chromatography is S-Sepharose cation exchanger and Mono Q HR5/5 FPLC, respectively. The general discussion regarding these cations and anion exchange chromatography is similar to Method 1. Finally, it should be noted that while the preferred applications of the ion exchange materials described herein are in a column format, it will be appreciated that they may also be used in batch format as well.
• rap GAP is a protease-sensitive molecule that is broken down into lower molecular weight species having rap GAP activity
• the entire isolation and purification procedure is carried out rapidly in the cold to reduce protease activity.
• this temperature is in a range below 10°C, with a preferred temperature range being about 2-8 ⁇ C. Most preferred is a temperature of about 4 ⁇ C.
• rap GAP The purity and activity of rap GAP obtained by the above purification methods can be monitored by the rap GTPase assay described below, and by electrophoretic procedures using sodium dodecyl sulfate polyacrylamide gel electroph ⁇ resis (hereinafter referred to as SDS-PAGE).
• SDS-PAGE was performed essentially as described in Laemmli, U.K., 1970, Nature.222:680-685. Gels were stained for protein using silver as described in Guilian, G.G., ⁇ tal, 1982, Anal. Biochem.. 122:277-287, or with Coomassie blue.
• a preferred embodiment purification scheme consists of isolating rap GAP from the membranes of HL60 and bovine brain cells, described in the Examples below.
• the starting material for a rap GAP assay is rap protein.
• the rap protein can be obtained from several sources, using methods known in the art, e.g., as described in Kawata, M., 1988, J. Bio. Chem..262:18965.
• the rap protein as used in the assay for the GTPase activating protein herein was purified from human platelet cells.
• the purification method was essentially as described for the purification of rac and G25K (Polakis, P., ⁇ t al, 1989, J. Biol. Chem..264:16383-16389).
• the purification procedure was carried out at 4 ⁇ C. Briefly, a particulate preparation of human platelets was extracted with 1% sodium cholate.
• the extract was chromatographed through DEAE-Sephacel and the GTP-binding activities were assayed as described in Polakis, P., JJ A peak of GTP-binding activity eluting at a lower salt concentration than the major peak was pooled and concentrated. This activity was then chromatographed sequentially through Ultrogel AcA-34, heptylamine-Sepharose, hydroxylapatite and finally DEAE-Fractogel. The resulting preparation is shown in the SDS-PAGE and immunoblots of Figure 1. The electroblotting was carried out at 0.3 Amps for 90 minutes in Tris/glycine (25/192 mM) containing 20% methanol.
• the blots were blocked with a 1% powdered milk solution and reacted overnight with the primary antibodies in Tris buffered saline containing 0.05% Tween 20.
• Anti-mouse and anti-rabbit IgG horse radish peroxidase conjugated secondary antibodies (commercially available from Bio-Rad Laboratories, Richmond, CA) were used at dilutions of 1/10,000 and 1/20,000, respectively.
• the blots were developed using the ECL detection system (Amersham, UK). The gels were either stained for protein with Coomassie blue (Cooblue) or subjected to electroblotting.
• the blots were incubated with antibodies reactive to rap, rac-1, G25K, or ras p21.
• These antibodies are specifically reactive to low molecular mass GTP binding proteins. These antibodies were raised against synthetic peptides corresponding to the following sequences: rap-1 A, DLVRQINRKTPVEKK; rac-1 (described in Polakis, P., si al-, 1989, J. Biol. Chem..264:16383-16389), CPPPVKKKRKRK; and G25K (described in Polakis, P., S al-, 1989, Biochem. Biophvs. Res. Commun..16&25-32), NVFDEAILAALEPPEPK. These antibodies were affinity purified against their respective immobilized peptides essentially as described in Mumby, S., ⁇ l l, 1988, J Biol.
• the anti-ras p21 antibody is a mouse monoclonal IgG raised against a synthetic peptide corresponding to the sequence within residues 29-44 contained in ras p21.
• This antibody has been previously characterized and designated 6B7 in Wong, G., ⁇ I al-, 1986, Cancer Res.. 46:6029. 100 ng of each of the purified protein or 50 ⁇ g of plasma membrane (PM) from HL60 cells were applied to the gel lanes.
• the amino terminal sequence ( Figure IB) was determined from material blotted onto polyvinylidene difluoride using methods described by Matsudaira, P., 1987, in ⁇ .
• the purified protein was also recognized by an antibody specifically reactive to the effector site sequence of p21 ras, which is also contained in rap ( Figure 1A). Also tested were antibodies specifically reactive to two other ras-related proteins found in platelets, G25K andracl (Polakis, P. ⁇ t l, 1989, Biochem. Biophvs. Res. Commun.. 160:25-32: and Polakis, J. Biol. Chem.. 264. supra " ). Neither of these IgGs reacted with the purified rap preparation ( Figure 1 A).
• Rap GAP may be assayed in vitro, and several different types of in vitro assays can be performed.
• an assay may involve measuring the presence of GDP resulting from the hydrolysis of GTP.
• This assay involves combining in an appropriate physiologically buffered aqueous solution, empirically determined optimal amounts of normal cellular rap, and [ ⁇ -32P]GTP, plus rap GAP.
• the solution may also contain protease inhibitors and a reducing agent Also, since cations greatly stimulate rap GAP activity they should be present in an effective amount
• the preferred cation is magnesium chloride.
• the reaction solution is incubated for various times and may be conducted at temperatures typically employed to perform enzymatic assays, preferably 10-40°C, and more preferably at 23°C. At the appropriate times aliquots are removed and assayed for
• 32P]GDP from the other reactants in the solution, particularly free [ ⁇ -32p]GTP.
• This can be achieved by immunoprecipitating rap with antibodies which will precipitate rap. Immune precipitation techniques and antibodies which will precipitate rap are known, and routinely employed by those skilled in the art [ ⁇ -32p]GDP, is released from the immune precipitate preferably by dissolving the sample in a denaturing detergent at an elevated temperature, mere preferably in 1% sodium dodecyl sulfate at 65° C for 5 minutes, and chromatographing the mixture on a suitable thin layer chromatographic plate. The chromatography is preferably carried out on a PEI cellulose plate in 1 M
• IiCl. [ ⁇ -32P]GDP is identified by its mobility relative to a known standard using suitable radiodetection techniques, preferably autoradiography.
• An alternative assay for rap GAP activity is to substitute gamma labelled 32 P-
• GTP for ⁇ -labelled 32P-GTP in the above assay system and assay for free 32 P labelle phosphate using activated charcoal.
• This assay can be carried out as described by Tjia et al., 1980. Cold Spring Harbor Svmp. Quant Biol.. 44:103.
• An additional assay does not involve immune precipitation. Rather, an aliquot from a rap GAP assay reaction mixture described above can be direcdy subjected to PE cellulose chromatography in 1 M LiCl. This assay, however, is most useful for assaying solutions having substantially purified rap GAP.
• the preferred rap GAP assay as used in the Examples described below is as follows, unless specifically modified in the Examples.
• the rap-[ ⁇ - 32 P]GTP complex was formed by adding 10 ⁇ l of purified rap (50 ⁇ g ml in 20 mM Tris, pH 8, 0.1 M NaCl and 0.1% Lubrol) to 20 ⁇ l of 20 mM Tris, pH 7.5, containing 30 ⁇ M MgCl 2 and 0.75 ⁇ M [ ⁇ - 3 2P]GTP (1500 Ci/mmol) (from
• Reactions were stopped by adding 4 ml of ice cold 25 mM Tris, pH 7.5, containing 0.1 M NaCl and 5 mM MgCk and then immediately filtered through nitrocellulose by rapid vacuum filtration. Filters were washed 3 times with 4 ml of the same buffer, dried and the radioactivity quantitated by liquid scintillation counting. Typically, 50,000-200,000 CPM remained associated with rap in the absence of rap GAP activity. The activities are expressed as the percentage of [ ⁇ - 2 P]GTP bound to rap that was hydrolyzed relative to the buffer control.
• Rap GAPb has the following partial amino acid sequences: F(G)VSTKLPFT(W)DXA(Q)QL and FLKKAKA (wherein X denotes unknown residue and parenthesis indicates uncertainty in the residue within the parenthesis). Further experiments were conducted to obtain additional purified rap GAP b and the following partial sequences: IASNFL(P)AYIVVQAENPGTEPP(A)YK; and IASNFLSAYVWQAEGGGPDGXLYKV.
• Rap GAP DNA sequence may be obtained by methods known in the art, preferably by cDNA cloning of RNA isolated and purified from cellular sources or by genomic cloning. Either cDNA or genomic libraries of clones may be prepared from the DNA fragments generated using techniques known in the art. The preferred procedure is to use oligonucleotide probes to screen cDNA libraries. cDNA libraries can be constructed using techniques known in the art, or can be purchased commercially.
• An illustrative procedure for making a cDNA library containing rap GAP sequences may consist of isolating total cytoplasmic RNA from suitable starting material, and further isolating messenger RNA therefrom. The latter can be further fractionated into Poly (A+) messenger RNA, and the messenger RNA can then be reverse transcribed and cloned into a suitable vector to form the cDNA library.
• the starting material i.e., tissue, cells
• a non-ionic detergent such as ethylene oxide, polymer type (NP- 40) is added in an amount to lyse the cellular, but not nuclear membranes, generally about 0.3%.
• Nuclei can then be removed by centrifugation at 1,000 x g for 10 minutes.
• the post-nuclear supernatant is added to an equal volume of TE (10 mM Tris, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.5) saturated phenol/chloroform (1:1) containing 0.5% sodium dodecyl sulfate (SDS) and 10 mM EDTA.
• TE 10 mM Tris, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.5
• SDS sodium dodecyl sulfate
• RNA Polyadenylated (Poly A+) messenger RNA (mRNA) can be obtained from the total cytoplasmic RNA by chromatography on oligo (dT) cellulose (J. Aviv et al, 1972, PNAS. 69:1408-1412).
• RNA is dissolved in ETS (10 mM Tris, 1 mM EDTA, 0.5% SDS, pH 7.5) at a concentration of 2 mg ml. This solution is heated to 65 * C for 5 minutes, then quickly chilled to 4 * C. After bringing the RNA solution to room temperature, it is adjusted to 0.4 M NaCl and slowly passed through an oligo (dT) cellulose column previously equilibrated with binding buffer (500 mM NaCl, 10 mM Tris, 1 mM EDTA, pH 7.5). The flow-through is passed over the column twice more, and the column washed with 10 volumes of ETS (10 mM Tris, 1 mM EDTA, 0.5% SDS, pH 7.5) at a concentration of 2 mg ml. This solution is heated to 65 * C for 5 minutes, then quickly chilled to 4 * C. After bringing the RNA solution to room temperature, it is adjusted to 0.4 M NaCl and slowly passed through an oligo (dT) cellulose column previously e
• Poly (A+) mRNA is eluted with aliquots of ETS, extracted once with TE-saturated phenol chloroform and precipitated by the addition of NaCl to 0.2 M and 2 volumes of 100% ethanol. The RNA is reprecipitated twice, washed once in 70% and then 100% ethanol prior to drying. The poly (A+) mRNA can then be used to construct a cDNA library. cDNA can be made from the enriched mRNA fraction using oligo (dT) priming of the poly A tails and AMV reverse transcriptase employing the method of H. Okayama ⁇ t al-, 1983, Mol. Cell Biol..2:280.
• cDNA libraries are, of course, well known in the art.
• One, now classical, method uses oligo (dT) primer, reverse transcriptase, tailing of the double stranded cDNA with poly (dG) and annealing into a suitable vector, such as pBR322 or a derivative thereof, which has been cleaved at the desired restriction site and tailed with poly (dC).
• a suitable vector such as pBR322 or a derivative thereof, which has been cleaved at the desired restriction site and tailed with poly (dC).
• Clontech cDNA library a lambda gtl 1 human placenta cDNA library made from total poly (A+) messenger RNA (hereinafter referred to as Clontech cDNA library).
• Clontech cDNA library Another useful library is the Stratagene human fetal brain cDNA library (hereinafter referred to as "Stratagene cDNA library”. It is commercially available from Stratagene Cloning
• the Stratagene cDNA library is a ⁇ ZAPTMl 1 human fetal brain cDNA library made from total poly (A+) messenger RNA.
• rap GAP gene can be isolated from rap GAP gene. These methods include, but are not limited to, chemically synthesizing the gene sequence itself from a sequence which may, for example, be derived from the amino acid sequence of rap GAP. Alternatively, in vitro translation of selected mRNA followed by functional or immunological assays of the translation products can be used.
• the identified and isolated gene can then be inserted into an appropriate cloning vector.
• Construction of suitable vectors containing the desired rap GAP coding sequence employs standard ligation and restriction techniques which are well understood in the art Isolated vectors, DNA sequences, or synthesized oligonucleotides are cleaved, tailored, and religated in the form desired.
• Site specific DNA cleavage is performed by treating with suitable restriction enzyme(s) under conditions which are generally understood in the art, and the particulars of which are specified by the manufacturer of these commercially available restriction enzymes. See, e.g., New England Biolabs, Product Catalog. In general, about 1 ⁇ g of plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 ⁇ l of buffer solution. In the examples herein, typically, an excess of restriction enzyme is used to insure complete digestion of the DNA substrate. Incubation times of about 1-2 hours at about 37 * C are workable, although variations can be tolerated.
• protein is removed by extraction with phenol/chloroform, and may be followed by ether extraction, and the nucleic acid recovered form aqueous fractions by precipitation with ethanol followed by chromatography using a Sephadex G-50 spin column.
• size separation of the cleaved fragments may be performed by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in Methods in Enzymology (1980) 65:499-560.
• Restriction cleaved fragments may be blunt ended by treating with the large fragment of £. coli DNA polymerase I, that is, the Klenow fragment, in the presence of the four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20 to 25°C in 50 mM Tris pH 7.6, 50 mM NaCl, 6 mM MgCl 2 , 6 mM DTT and 10 mM dNTPs. After treatment with Klenow, the mixture is extracted with phenol/chloroform and ethanol precipitated. Treatment under appropriate conditions with SI nuclease results in hydrolysis of single-stranded portions.
• dNTPs deoxynucleotide triphosphates
• Ligations are performed in 15-30 ⁇ l volumes under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 33 ⁇ g ml BSA, 10 mM-50 mM NaCl, and 1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14"C for "sticky end” ligation, or for "blunt end” ligations 1 mM ATP was used, and 0.3-0.6 (Weiss) units T4 ligase. Intermolecular "sticky end” ligations are usually performed at 33-100 ⁇ g ml total DNA concentration. In blunt end ligations, the total DNA concentration of the ends is about 1 ⁇ M.
• vector construction employing "vector fragments”
• the vector fragment is commonly treated with bacterial alkaline phosphatase (BAP) in order to remove the 5' phosphate and prevent religation of the vector.
• BAP digestions are conducted at pH 8 in approximately 150 mM Tris, in the presence of Na + and Mg+2 using about 1 unit of BAP per ⁇ g of vector at 60°C for about 1 hour.
• Nucleic acid fragments are recovered by extracting the preparation with phenol/chloroform, followed by ethanol precipitation.
• religation can be prevented in vectors which have been double digested by additional restriction enzyme digestion of the unwanted fragments.
• correct ligations are confirmed by first transforming the appropriate I soli strain with the ligation mixture.
• Successful ttansf ⁇ rmants are selected by resistance to ampicillin, tetracycline or other antibiotics,
• Miniprep DNA can be prepared from the transformants by the method of D. Ish-Howowicz slal, 1981, Nucleic Acids Res.. 9:2989, and analyzed by restriction and or sequenced by the dideoxy method of F. Sanger ⁇ l al, 1977, PNAS (USAV 24:5463 as further described by Messing st al-, 1981 , Nucleic Acids Res..2:309, or by the method of Maxam ⁇ I al, 1980, Methods in Enzy ology. 65:499.
• vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used.
• vectors include, but are not limited to, bacteriophages such as ⁇ derivatives, pGEM vector, or plasmids such as
• PBR322 or pUC plasmid derivatives can be introduced into host cells via transformation, transfection, infection, electroporation, etc. Due to the inherent degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence may be used in the practice of the present invention for the cloning for rap GAP.
• Such alteration of the rap GAP nucleotide sequence include deletion, additions, or substitution of the different nucleotide residues resulting in a sequence substantially similar to the identified sequence that encodes the same or a functionally equivalent gene product or amino acid sequence.
• the gene product may contain deletion, additions, or substitution of amino acid residues within the sequence, which result in a silent change, thus producing a bioactive product.
• amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved.
• negatively charged amino acids include aspartic acids and glutamic acids; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups or nonpolar head groups having similar hydrophilicity values include the following: leucine, phenylalanine, and tyrosine.
• an expression vector/host system In order to express a biologically active, mature form of rap GAP, an expression vector/host system should be chosen which provides not only for high levels of transcription and translation but for the correct processing of the gene product.
• Various animal host expression vector systems i.e., vectors which contain the necessary elements for directing the replication, transcription and translation of the rap GAP coding sequence in an appropriate host cell
• virus expression vector/mammalian host cell systems e.g., cytomegalovirus, vaccinia virus, adenovirus, and the like
• insect virus expression vector/mammalian host cell systems e.g., cytomegalovirus, vaccinia virus, adenovirus, and the like
• insect virus expression vector/mammalian host cell systems e.g., cytomegalovirus, vaccinia virus, adenovirus, and the like
• insect virus expression vector/mammalian host cell systems e.g., cytomegalovirus
• SUBSTITUTE SHEET expression vector/insect cell systems e.g., baculovirus
• nonviral promoter expression systems derived from the genomes of mammalian cells (e.g., the mouse metallothionine promoter).
• the expression elements of these vectors vary in their strength and specificities.
• any one of a number of suitable transcription and translation elements may be used.
• promoters isolated from the genome of mammalian cells e.g., mouse metallothionien promoter
• viruses that grow in these cells e.g., vaccinia virus 5.7 K promoter
• Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted sequences.
• Specific initiation signals are also required for sufficient translation of inserted protein coding sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire rap GAP gene includes its own initiation codon and adjacent sequences are inserted into the appropriate expression vectors, no additional translational control signals may be needed. However, in cases where only a portion of the coding sequence is inserted, exogenous translational control signals, including the ATG initiation codon can be provided. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements, etc.
• Any of the methods previously described for the insertion of DNA fragments into a vector may be used to construct expression vectors containing the rap GAP gene and appropriate transcriptional/translational control signals. These methods may include in vitro recombinant DNA techniques, synthetic techniques and in vivo recombinations (genetic recombination).
• a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers, (e.g., zinc and cadmium ions for metallothionein promoters). Therefore, expression of the genetically engineered rap GAP may be controlled. Appropriate cell lines or host systems can also be chosen to ensure the correct modification and processing of the foreign protein expressed.
• transformation is done using standard techniques appropriate to such cells.
• SUBSTITUTE SHEET Spring Harbor Press, p. 254 was used for procaryotes.
• Transfection of Sf9 cells was achieved using a modification of the calcium phosphate precipitation technique (Graham, F.L. slal, 1973, Virology 52:456) as adapted for insect cells (J. P. Burand Stal, 1980, Virology 101; E. B. Casstens ⁇ t al-, 1980. Virology 101:3111 Additional details regarding transfection of Sf9 cells are described by Summers and Smith in "A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures", Texas A & M Press: 1986.
• the baculovirus transfer vectors employed herein are derived from transfer vectors which have been described by G. E.
• pAc373 has a unique BamHI site 50 base pairs downstream from the polyhedrin cap site, that is to say, 8 base pairs before the polyhedrin ATG translation initiation codon (Luckow and Summers, 1988, Biotechnology.6:47).
• the host cells which contain the recombinant rap GAP coding sequence and which express the biologically active, mature product may be identified by at least four general approaches:
• the presence of the rap GAP coding sequence inserted in the expression vector can be detected by DNA-DNA hybridization using probes comprising nucleotide sequences that are homologous to the rap GAP coding sequence.
• the recombinant expression vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, resistance to methotrexate, transformation phenotype, occlusion body formation in baculovirus, etc.).
• rap GAP coding sequence is inserted within a marker gene sequence of the vector, recombinants containing the receptor coding sequence can be identified by the absence of the marker gene function.
• a marker gene can be placed in tandem with the receptor sequence under the control of the same or different promoter used to control the expression of the rap GAP sequence. Expression of the marker in response to induction or selection indicates expression of the rap GAP coding sequence.
• transcriptional activity for the rap GAP coding region can be assessed by hybridization assays.
• polyadenylated RNA can be isolated and analyzed by Northern blot using a probe homologous to the rap GAP coding sequence or particular portions thereof.
• total nucleic acids of the host cell may be extracted and assayed for hybridization to such probes.
• the expression of the mature protein product can be assessed immunologically, for example by Western blots, immunoassays such as radioimmunoprecipitation, enzyme-linked immunoassays and the like.
• the ultimate test of the success of the expression system involves the detection of the biologically active rap GAP gene product Where the host cell secretes the gene product the cell free media obtained from the cultured transfectant host cell may be assayed for rap GAP activity. Where the gene product is not secreted, cell lysates may be assayed for such activity. Assays such as the assays described herein or the like may be used.
• the clone may be expanded and the rap GAP may be purified as described herein or by using techniques well known in the art. Such methods include affinity purification, chromatographic methods including high performance Uquid chromatography, and the like.
• PCR polymerase chain reaction
• the primers are annealed to denatured DNA acid, followed by extension with a suitable DNA polymerase enzyme, such as the large fragment of DNA polymerase I (Klenow), or preferably a DNA polymerase that is stable in the presence of detergents and nucleotides, which results in newly synthesized plus and minus strands containing the target sequence.
• a suitable DNA polymerase enzyme such as the large fragment of DNA polymerase I (Klenow), or preferably a DNA polymerase that is stable in the presence of detergents and nucleotides, which results in newly synthesized plus and minus strands containing the target sequence.
• a thermostable enzyme may be used which is present in thermostable bacteria.
• the enzyme may be produced using DNA recombinant techniques as described in EP 258,017, published March 2, 1988. Because the newly synthesized sequences are also templates for the primers, repeated cycles of denaturing, primer annealing and extension results in exponential accumulation of the region defined by the primer.
• PCR thus produces discrete nucleic acid duplexes of cDNA inserts having termini corresponding to the ends of the specific primers employed.
• PCR can be performed using a variety of reaction conditions, as described in the references presented above, the preferred reaction conditions are described below in Example 8.
• the "Material and Procedure” section presents the preferred method for isolating and purifying rap GAPm. As discussed in the “Results” section, the preferred method was arrived at by first using different buffers to determine how tightly rap GAPm is membrane associated. Second, various detergents were tested to determine the detergent which provides the highest yields of rap GAP activity extracted from the plasma membrane. Finally, the results of the successive steps of the preferred purification steps are discussed. HL60 cells were grown and differentiated as described in Polakis, P., et al.,
• Membranes were suspended at a protein concentration of 5 mg ml in 20 mM Tris, pH 8.0, containing 0.5% NP-40, 0.5% deoxycholate (Sigma Chemical Co., St. Louis, MO), 1 mM dithiothreitol, 1 mM EDTA, 0.2 mM phenylmehtylsulphonyl fluoride (PMSF), and 1 ⁇ g/ml each of pepstatin and leupeptin. Following a 30 minute incubation at 4 * C the suspension was ultracentrifuged at 2 x 10 5 x g for 60 minutes and the resulting supernatant was adjusted to pH 6.5 with NaH 3 P ⁇ 4 .
• the extract was applied to 10 ml column of S-Sepharose equilibrated in S-Sepharose buffer (50 mM sodium phosphate, pH 6.5, containing 0.1 % NP-40, 1 mM dithiothreitol, 1 mM EDTA and 1 ⁇ g/ml each of leupeptin and pepstatin).
• S-Sepharose buffer 50 mM sodium phosphate, pH 6.5, containing 0.1 % NP-40, 1 mM dithiothreitol, 1 mM EDTA and 1 ⁇ g/ml each of leupeptin and pepstatin.
• the column was washed and eluted with a 150 ml gradient of 0-0.3 M NaCl in the same buffer at a flow rate of 25 ml/hr and fractions of 2.8 ml each were collected.
• the indicated fractions containing rap GAP activity were pooled, concentrated to 3 ml and dialyzed against Mono Q buffer (20 mM Tris, pH 8.5, 0.1% NP-40, 1 mM EDTA, 0.5 mM dithiothreitol, and 1 ⁇ g/ml each of pepstatin and leupeptin). The entire sample was then injected onto a Mono Q HR5/5 FPLC column (5 x 50 mm) (Pharmacia/LKB, Upsula, Sweden) equilibrated in Mono Q buffer.
• the column was washed with 12 ml of buffer and then eluted with a 40 ml gradient of 0-0.3 M NaCl in the same buffer and fractions of 1 ml each were collected at a flow rate of 1 iril/min.
• the peak of rap GAP activity was collected, dialyzed against HAP buffer (20 mM Tris pH 8.0, 0.1 M NaCl, 0.1% NP-40, 0.5 mM dithiothreitol, and 1 ⁇ g/ml each of leupeptin and pepstatin) and then injected onto a hydroxylapatite HPLC column (Bio- Rad Laboratories, Richmond CA) equilibrated in the same buffer.
• the column was developed at a flow rate of 1 rnVmin with a 40 ml linear gradient of 0-0.2 M potassium phosphate in HAP buffer followed by an isocratic elution with 10 ml of 0.3 M potassium phosphate. Fractions of 1 ml each were collected.
• F-MLP F-Met-Leu-Phe
• Plasma membranes 100 g total protein from differentiated HL60 cells were suspended in 20 mM Tris, pH 8.0, or buffer containing: 1 M NaCl; 1 M LiCl + 20 mM EDTA; 3 M urea; or 1% NP-40 and incubated at 4 C for 30 minutes. Samples were centrifuged and the pellets were resuspended in 25 1 Tris buffer and assayed for rap GAP activity and f ⁇ rmylpeptide binding as described in "Materials and Procedures".
• the results are expressed as a percentage of the amount of association of rap GAP with the plasma membrane determined for membranes incubated in Tris buffer only.
• the results showed that the rap GAP activity was quantitatively retained in the membrane following washing with buffered 1 M NaCl or 1 M LiCl containing 20 mM EDTA, but was lost when membranes were treated with 1% NP-40 or 3 M urea ( Figure 2).
• a similar pattern was observed for the binding of radiolabelled F-MLP to these same membrane preparations ( Figure 2).
• various buffered detergent solutions was tested and it was found that a combination of 0.5% NP-40 and 0.5% deoxycholate produced the highest yields of rap GAP activity extracted from the plasma membranes.
• the preferred purification method uses successive steps of column chromatography in the presence of detergent. Due to the inability of most proteins to adsorb to S-Sepharose cation exchange resin at pH 6.5, a high degree of purification of rap GAP was achieved with this first step. Greater than
• the first peak of activity, fractions 10 to 11 from the Mono Q FPLC chromatography eluted during the isocratic wash were pooled for further purification. These fractions were applied to an hydroxylapatite HPLC column. The column was developed with a gradient of potassium phosphate and a single peak of rap GAP activity was eluted (Figure 7A). SDS-PAGE run under reducing conditions revealed the presence of two major polypeptides with molecular weights of approximately 88,000 and 60,000 in the fractions containing the rap GAP activity ( Figure 7B). The rap GAP eluted from the hydroxylapatite column, from fractions 17-19, was combined and applied to an SEC-250 size exclusion HPLC column.
• the rap GAP activity eluted as a single peak which corresponded closely to the elution of the polypeptide of about 88,000 molecular weight ( Figure 8A).
• the commigration of the polypeptide of about 88,000 molecular weight with the rap GAP activity was seen on the hydroxylapatite and SEC-250 column chromatography profiles.
• the purification of rap GAPm was repeated three times and a polypeptide of about 88,000 molecular weight was identified in the final chromatography steps from all three preparations.
• the crude, freshly solubilized rap GAPm has a mobility similar to that of the highly purified rap GAPm on size exclusion chromatography (compare Figures 8A and 4A).
• a minor polypeptide with molecular weight of in fractions 18 and 19 in SDS-PAGE analysis ( Figure 8B).
• the elution pattern of this protein did not correspond closely to the rap GAP activity.
• the protein of about 64,000 molecular weight was not present in the rap GAP fractions eluted from the hydroxylappatite column ( Figure 7B) suggesting that it is generated between chromatography steps or during sample manipulation.
• Rap GAP is a relatively minor protein component in the plasma membrane from HL60 cells.
• GAP is estimated to constitute less than 0.05% of the total membrane protein.
• Rap GAPm is Different From Cytosolic Rap GAP Rap GAP protein found in the plasma membrane is different from that found in the cytosol of the cells. This is demonstrated by subjecting both the freshly prepared membrane derived and cytosolic rap GAP to size exclusion chromatography under identical conditions. The cytosolic preparation was equilibrated in the detergent extraction buffer used to solubilize the rap GAPm prior to its injectiononto the column. The two forms of rap GAP migrated with radically different mobilities on the SEC-250 HPLC column ( Figure 4A). The stokes radii of the cytosolic and membrane derived rap GAPs were estimated to be 54 and 36 , respectively ( Figure 4B). Additionally, the cytosolic rap GAP was purified under conditions identical to those employed for the rap GAPm. Although the cytosolic rap GAP could not be
• the following experiment purified rap GAPb from bovine brain membranes and yielded approximately 40 g of rap GAPb per 8.4 grams of membrane protein used.
• the purified rap GAPb was about 50% homogeneous and has a molecular weight of about 88,000 as determined by reduced SDS-PAGE analysis after the final purification step PW-5 HPLC column. ( Figure 9B).
• the isolation and purification of rap GAPb was carried out as follows.
• the column was washed with 100 ml of this buffer and then eluted at a flow rate of 30 ml/hr with a 500 ml gradient 0-0.5 M NaCl in the same buffer and fractions of 7 ml each were collected.
• the rap GAP activity eluting between 0.17 and 0.25 M NaCl was pooled, concentrated to 15 ml, and then applied to a 500 ml column (2.5 x 100 cm) of Sephacryl S-300 equilibrated in 20 mM Tris, pH 8.0, containing 0.1 % NP-40, 0.1 M NaCl, 1 mM EDTA, 0.5 mM dithiothreitol, and 1 g/ml each of pepstatin and leupeptin.
• the column was eluted at a flow rate of 40 ml/hr and fractions of 7 ml each were collected.
• the rap GAP activity eluted as a single symmetrical peak between 280 and 310 ml of elution buffer.
• the peak fractions (28 ml) were diluted to 84 ml with Mono Q buffer (as described in Example 1) and then loaded onto a Mono Q HR 5/5 FPLC column equilibrated in Mono Q buffer.
• the column was eluted at a flow rate of 1 ml/min with a linear gradient of 0-0.5 M NaCl in Mono Q buffer and fractions of 1 ml each were collected.
• Rap GAPb was isolated and sequenced as follows.
• Proteins resolved by reduced SDS-PAGE were visualized by briefly staining the gels with Coomassie Blue.
• the protein bands corresponding to molecular mass of about 88 kD were excised and following a 5 minute equilibration of the gel slice in electroelution buffer (Tris-glycine (20-192 mM), 0.1% SDS (w/v)), the rap GAP was electroeluted using a Bio-Rad model 422 electro-eluter according to the manufacturers' instructions.
• the eluted rap GAP was precipitated with chloroform and methanol as described in Wessel, P., et al.. 1984, Anal. Biochem.. 138:141-43.
• the rap GAP was dissolved in 50 1 of 70% formic acid containing 30 mg/ml cyanogen bromide and incubated in the dark at room temperature for 24 hours. The formic acid was evaporated and the peptides were dissolved in SDS-PAGE sample buffer and then subjected to SDS-PAGE and electroblotting. The procedures for SDS-PAGE and electroblotting were as described previously under "C. Procedure for Purification of Rap GAP.” and "II. Rap GAP Assay", respectively. The peptides were detected on the electroblots by brief staining with Coomassie blue, and the excised bands were applied directly to an Applied Biosystems mode 470A amino acid sequencer.
• the two peptides derived or generated from rap GAPb have the following amino acid sequences: F(G)VSTKLPFT(W)DXA(Q)QL, and FLKKAKA, respectively, (wherein X denotes an unknown residue and the parenthesis indicate uncertainty in the enclosed residue).
• rap GAP assay used in this study was based on the quantitation of [ ⁇ -32P]GTP remaining bound to rap, an increase in the dissociation of [ ⁇ -32p]GTP could be interpreted as an increase in GTP hydrolysis.
• the purified rap GAP preparations were also tested using [ ⁇ -32P]GTP bound to rap. No loss of bound radioactivity was noted in response to rap GAP.
• neither rap GAPm nor rap GAPb stimulates the dissociation of [ ⁇ - assay described previously. This indicates that rap GAPm is distinct from the GTPase activating proteins specific for ras p21 and rho B. The activities of rap GAPm and rap GAPb were killed by heat boiling.
• Antibodies to rap GAP are produced using standard procedures known in the art. For example, antibodies are produced by injecting a host animal such as rabbit rat goat mouse, etc., with the rap GAP or fragments thereof, alone or conjugated to an appropriate carrier if required to elicit an antibody response.
• the rap GAP can be excised from the reduced SDS-PAGE, combined with an adjuvant, for example, complete Freund's adjuvant and used to immunize the host animals.
• an adjuvant for example, complete Freund's adjuvant
• Example 7 Synthesis of Peptide Sequences
• the peptides containing the partial sequences of rap GAP may be synthesized by methods well known in the art
• the preferred method of peptide synthesis is the solid-phase method, described in more detail in Merrifield, R.B., 1985, Science. 222:341-347, on a Biosearch 9500 automated peptide machine, cleaved with hydrogen fluoride and purified by preparative HPLC using a Waters Delta Prep 3000 instrument, on a 15-20 ⁇ m Vydac CH Prep PAK column.
• An alternative method is by means of ABI Automatic Synthesis.
• F(G)VSTKI ⁇ FT(W)DXA(O Q ; IASNFL(P)AYIVVQAENPGTEPP(A)YK; and IASNFLS AYVWQAEGGGPDGXLYKV are respectively synthesized.
• These synthetic peptides can be used to raise the polyclonal and monoclonal antibodies to rap GAP.
• these peptides may be conjugated with keyhole limpet hemocyanin (KLH) or bovine serum albumin (BSA). The conjugation is achieved via the sulfhydryl group in the cysteine residue.
• KLH keyhole limpet hemocyanin
• BSA bovine serum albumin
• the DNA sequence for BR67 is as follows: 5 , -GGGGGCTCTGTGCCAGGGTTCTCAGCCTGCACCACAATGTAGGC-3 ,
• the cDNA library used was Clonetech cDNA library described supra under 'TV. Identification and Isolation of rap GAP Sequences.”
• HP3-12 the DNA sequence of HP3-12 is indicated in Figure 10.
• Knowledge of its DNA sequence led, in turn, to additional probes that were used to screen the Stratagene cDNA library (described supra under "IV. Identification and Isolation of Rap GAP Sequences !
• kinasing of single strands prior to annealing or for labeling is achieved using an excess, e.g., approximately 10 units of polynucleotide kinase to 0.1 nmole substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl 2 ,
• the oUgonucleotide probe designated BR67 was used to screen the Clontech cDNA library. While various procedures are known, a description of the preferred procedure follows.
• the library was plated at about 50,000 plaques perplate using 5 plates. Thus, about 250,000 plaques were initially screened using the plaque hybridization procedure.
• Each 150 mM plate was replicated onto duplicate nitrocellulose filter papers (S & S type B A-85). DNA was fixed to the filter by sequential treatment for 5 minutes with 0.5 N NaOH plus 1.0 M NaCl; 1.5 M NaCl plus 0.5 M Tris-HCl pH 8; and 20 mM Tris plus 2 mM EDTA pH 8. Filters were air dried and baked at 80 ⁇ C for 2 hours.
• Duplicate nitrocellulose filters were prehybridized at 42 ⁇ C for 2-4 hours with 10 mis per filter of DNA hybridization buffer (5 x SSC, 5 x Denhardt's solution, 50 ⁇ g/ml salmon sperm DNA, 50 mM sodium Phosphate, 0.1% SDS) with 30% formamide. (5 x Denhardt's solution contains polyvinylpyrrolidone, and 1 x 0.02% each of Ficoll and bovine serum albumin). The buffer was removed and the samples were hybridized with the kinased probe under conditions which depend on the stringency desired. About 1 to 2 x 10 6 cpm/ml total was used.
• Typical moderately stringent conditions employ a temperature of 42 ⁇ C plus 50% formamide for 24-36 hours with 1-5 ml filter of DNA hybridization buffer containing probe. For higher stringencies high temperatures and shorter times were employed.
• the preferred hybridization conditions consisted of a first lift under high stringency conditions (16 hours at 42°C with 50% formamide in hybridization buffer) and a second lift under low stringency condition (16 hours at 42 * C with 30% formamide in hybridization buffer ) overnight. About 1 x 106 cprrj/ml was used. The filters were washed twice, 30 minutes each wash, with 2 x SSC/0.1% SDS and 0.2 x SSC/0.1% SDS at 65 ⁇ C and then air dried. Finally, the filters were autoradiographed at -70 ⁇ C for 72 hours with intensifying screens.
• HP3-12 The positive recombinant bacteriophages were purified, one ofwhich was termed HP3-12.
• the phage DNA was isolated as follows. HP3-12 was plated at high density on a lawn of E. coli strain Y 1090 (r-) (commerically available from Clontech). Following lysis of the E. coli. phage particles were eluted into S M buffer (0.1 M NaCl 8.1 mM MgS0 4 50 mM Tris - HCl pH 7.5 0.01% Gelatin) by covering the E. soli with buffer and incubating the plate in the cold for 6 or more hours.
• S M buffer 0.1 M NaCl 8.1 mM MgS0 4 50 mM Tris - HCl pH 7.5 0.01% Gelatin
• phage DNA was isolated by the procedure of Maniatis si al, supra.
• HP3-12 was subcloned into a suitable vector in order to obtain DNA sequence.
• DNA can be cloned into a variety of vectors, in the instant invention it was subcloned into the pGEM vector (Promega, Madison, WI).
• HP3-12 The cDNA insert for HP3-12 was subcloned into pGEM as follows: HP3-12 ⁇
• DNA was digested with EcoRl which produced two fragments, the cut ⁇ DNA and an insert of about 3.0 kb.
• the insert was isolated using low melt agarose (SeaPlaque®, FMC Corp., Rockland, ME) and ligated into pGEM using techniques described in Struhl K., 1985. BioTechniques.2(6):453.
• the pGEM vector is designed such that when it was transformed into an E. coli lacking a portion of the lac region (i.e. DH5 ⁇ ) and plated onto an indicator plate (i.e. MacConkey's Agar, commerically available from Difco Co., Detroit, MI, Cat. # D-781138).
• HP3-12 was sequenced and several oUgonucleotides based on the sequence were synthesized. The sequences of these oUgonucleotides are shown below:
• BR149 5'-AAC ⁇ TGCCATCTGGACAACAT ⁇ AGGGAACTCGGTGAGGCAGGAGATGG-3'
• a radioactively labelled 233-bp PCR product was generated as follows: 1-10 ng HP3-12 cDNA EcoRl fragment was used as template along with 2 ⁇ M of dATP and of dTTP, respectively; 1 ⁇ M of dCTP and dGTP, respectively; 1 ⁇ M (100 ⁇ Ci) of
• [ ⁇ -32P]dCTP and [ ⁇ -32P]dGTP were 10 pmoles of upstream (i.e. BRl 19) and downstream (i.e. BR120) primers, respectively; 1 x PCR buffer (50 mM KCl, 20 mM Tris-HCl 8.0, 2.5 mM MgCl 2 , 0.1 mg/ml BSA) and 1 unit Taq polymerase (Perkins-Elmer - Cetus Corp., EmeryviUe, CA). Reaction cycle was 95 ⁇ C-30s, 60°C-30s, 72 ⁇ C-30s; 20-25 cycles (using Thermal Cycler, Perkins-Elmer - Cetus Corp.). The resulting product was purified through a spin column.
• Either an oUgonucleotide probe or the labeled PCR product was used to rescreen the Clontech cDNA Ubrary or to screen the Stratagene cDNA library.
• Filters were hybridized as foUows: those probed with BRl 16 were hybridized at 42°C in hybridization buffer with 35% formamide, those probed with the PCR product described above or the oligonucleotide BR149 were hybridized at 42°C in hybridization buffer with 50% formamide. All filters were washed twice, 30 minutes each wash, with 2 x SSC/0.1% SDS and 0.2 x SSC/0.1% SDS at 65°C and then air dried. FinaUy, the filters were autoradiographed at -70 ⁇ C for 72 hours with intensifying screens.
• Example 9 Expression of Rap-GAP
• the 3.4 kb HuB 10A EcoRl cDNA insert was subcloned into the Baculovirus transfer vector, pAcC13 to generate pAcRG9.
• the EcoRl fragment from HP3-12 was cloned into the baculovirus transfer vector pAcC13, and was designated pAcRGl.
• the pAcC13 vector was derived from pAcC12 vector which in rum was derived from the pVL941 vector.
• the construction of pVL941 was disclosed in Luckow, V. A. et al., 1989, Virology. 170:31.
• pAcC12 a polylinked derivative of pVL941
• pVL941 The construction of pAcC12, a polylinked derivative of pVL941, was disclosed in Quilliam, L.A., ei l, 1990, Mol. Cell. Biol.. JL0(6):2901.
• pAcC12 was derived from pVL941 by deleting the unique EcoRl site at 7.15 kUobases and introducing a polylinker sequence
• pAcC13 was derived from pAcC12 by replacing the Kpnl fragment between 4 and 4.5 map units with a synthetic oligonucleotide containing the polylinker sequence 5'- GTACCAGATCTGCAGAATTCTAGAGGATCCTGATCAGCTAGAGAGCTC GCGGCCGCCCGGGCCGTAC-3'. The construction of pAcC13 is shown by Munemitsu, S., £ial, 1990. Mol. Cell. Bio.. 10(111:5977.
• the preferred solubiUzation solution consists of 20 mM Tris, pH 8.0, containing 0.5% NP-40, 0.5% deoxycholate (Sigma Chemical Co., St. Louis, MO), 1 mM dithiothreitol, 1 mM EDTA, 0.2 mM phenylmehtylsulphonyl fluoride (PMSF), and 1 ⁇ g/ml each of pepstatin and leupeptin.
• the extract was centrifuged for 15 minutes at 15,000 x g and aUquots diluted into GAP assay buffer, and assayed for GAP activity as described above.
• baculovirus can be recovered from Sf9 cells transfected with the above described transfer vectors using the techniques described by Summers and Smith, above. Such virus can be employed to transform cells directly with the appropriate rap GAP clone.
• Expression levels from the pAcRGl construct was low and therefore another construct was engineered to introduce an initiating methionine and the epitope for the Glu-Glu antibody [EEEEYMPME], subsequent to the EcoRl site.
• the resulting 5' amino acid sequence would read MEEEEYMPMEGIRA [PTTK . . .].
• This construct was designated pAcRG4 and was used for subsequent purifications.
• rap-GAP The EcoRl fragment from HuBlOA was cloned into pAcC13 as described above and designated pAcRG9. Expression of rap-GAP from both these constructs (i.e. pAcRG4 and pAcRG9) were very high in that the rap GAP protein represented more than 50% of the total protein recovered from the ceU lysate.
• the rap GAP activity as assayed using the preferred method described above in section ⁇ , subpart C, "Procedure for Rap GAP Assay", was over 10,000-fold higher in lysates prepared from AcRG4 infected ceUs compared to lysates from Sf9 cells infected with virus containing deleted polyhedrin promoter only.
• Figure 12 shows that antibodies, raised against a synthetic peptide based on a partial sequence of rap GAP: GQTSEEELFSTNEES (designated S in Figure 10), recognized and bound to rap GAP protein.
• the preparation of the synthetic peptide, rabbit antibodies, and the Western blot was as described in "II. Rap GAP Assay", above.
• the methods for isolating cytosoUc and membrane recombinant rap GAP are as foUows.
• the peUet was solubiUzed in 20 mM Tris, 1 mM DTT, 1 mM EDTA, 0.2 mM PMSF, pepstatin and leupeptin.
• the resulting mixture was ultracentrifuged at 100,000 x g for 60 minutes.
• the resulting supernatant was the cytosoUc fraction.
• To isolate the membrane fraction the resulting peUet was washed once with the above buffer and recentrifuged. The peUet was then solubilized in the above buffer containing 0.5% NP40 and 0.5% deoxycholate and recentrifuged.
• Example 10 Methods of Purifying Rap GAP Using Monoclonal Antibodies to Rap GAP
• the above MABs to rap GAP can be used to isolate and purify rap GAP.
• an efficient immunoaffinity method for isolating membrane associated rap GAP involves the use of biotinylated MABs (b-MABs) and streptavidin-agarose. The general method is outlined in Updyke, T.V., ⁇ l al-, 1986, Methods in Enzymologv.
• Streptavidin-agarose can therefore be used to efficiently bind immune complexes found between b-MABs and detergent- solubilized membrane rap GAP. Id.
• Updyke presents methods for preparing the streptavidin-agarose matrix and determining the amount of streptavidin linked to the agarose matrix using [ 14 ] biotin binding assay.
• the methods for purifying and biotinylating the MABs to rap GAP are essentiaUy as presented in Updyke.
• the preferred MABs are those produced by hybridomas, described in the previous section, grown in serum free medium.
• Membrane detergent extracts are incubated with the biotinylated MABs and the mixture is then passed over streptavidin-agarose.
• the nonadsorbed proteins are washed off the resin and adsorbed proteins are eluted by denaturation.
• the eluted proteins are analyzed by SDS-PAGE and staining with Coo Blue or sUver.
• rap GAP described herein can be used to identify anti-cancer therapeutics, particularly those that are effective against ras related tumors. It is known that rap reverts ras transformed cells. Kitayama, H., sill-, 1989, Cell, supra. It has been shown that rap GAP does not stimulate ras p21 GTPase activity, nor does ras p21 GAP stimulate the GTPase activity of rap. Kikuchi, A., st al., 1989, J. Biol. Chem.. 264:9133-9136.
• Mutant rap Val 12 contains an amino acid sequence corresponding to mutant ras Val 12 which is insensitive to ras GAP, i.e., the mutant ras Val 12 is not stimulated by ras GAP.
• Ras Val 12 is a mutant of wild-type ras Gly 12. Rap Val 12 has been transfected into the human tumor ceU line HT 1080 which contained activated oncogenic ras gene.
• rap Val 12 was about ten times better than the wild-type rap Gly 12 at reverting the ras oncogenic phenotype. (Speech by M. Noda, at U.S. Japan Study Group, Hawaii, January 23, 1990). Without wishing to be bound by any theory or appUcants' proposed models, appkcants propose Models A and B regarding the role rap GAP plays in the reversion of ras transformed cells.
• Model A proposes that it is the rap-GTP, when bound to ras GAP, which causes the reversion of the ras transformed cells.
• the rap GAP serves only to stimulate the hydrolysis of GTP, i.e. it serves only to stimulate the conversion of rap-GTP to rap-GDP.
• the rap In order to revert a ras-transformed cell, the rap must be maintained in the rap-GTP form, this can be achieved by preventing rap GAP from binding to rap-GTP.
• a chemical which prevents rap GAP from binding to rap-GTP can serve as an anti-cancer therapeutic.
• this chemical can be identified in the following assay.
• "X” denotes the chemical to be screened.
• "X" is added to rap GAP under experimental conditions essentiaUy similar to the rap GAP assays described previously, in which the production of rap-GDP is assayed. After an appropriate incubation period, rap-GTP is added to the mixture. If "X" prevents or inhibits the production of rap-GDP, then X can serve as an anti-cancer therapeutic.
• Model B unlike Model A, proposes that it is the rap GAP in the rap GAP- rap-GTP complex which is responsible for the reversion of ras-transformed ceUs. That is, rap-GTP reverts the transformed phenotype by interacting with rap GAP as an effector target
• an anti-cancer therapeutic chemical is one which fulfil the requirement of rap-GTP in the rap GAP-rap-GTP interaction. It is proposed that the downstream product(s) of rap GAP-rap-GTP interaction serves to regulate and revert ras oncogenic behavior.
• a successful anti-cancer therapeutic would be one which can substitute for rap-GTP in interacting with rap GAP to revert ras-transformed ceUs.
• the assay will involve introducing the potential anti-cancer therapeutic "X" into ras transformed cells, and assaying for increased production of the downstream product or decrease in the upstream target (precursor of the downstream product).
• the following assay may be used if the downstream substrate of rap GAP-rap-GTP interaction is known.
• the in vitro assay would involved first labelling the substrate using methods known in the art, e.g., radiolabelUng. The labeUed substrate is then mixed with rap GAP, and chemical "X" that is to be screened.
• labeUed product is then assayed.
• "X" can serve as an anti-cancer therapeutic if labeUed products are obtained.
• Deposit of Biological Materials The foUowing plasmid has been deposited with the American Type Culture Collection (ATCC), 12001 Parklawn Drive, Rockville, Maryland 20852 (USA) pursuant to the provisions of the Budapest Treaty.
• the present invention is not to be considered Umited in scope by the deposited recombinant transfer vector or plasmid, since the deposited vector or plasmid is intended only to be iUustrative of particular aspects of the invention.

Landscapes

• Chemical & Material Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Life Sciences & Earth Sciences (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Medicinal Chemistry (AREA)
• Molecular Biology (AREA)
• Gastroenterology & Hepatology (AREA)
• Zoology (AREA)
• Toxicology (AREA)
• Immunology (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (4)

Publications (1)

Family

ID=27054118

Family Applications (1)

Country Status (3)

Families Citing this family (6)

Family Cites Families (1)

• 1991
  • 1991-03-15 WO PCT/US1991/001763 patent/WO1991015582A2/en not_active Application Discontinuation
  • 1991-03-15 EP EP19910907352 patent/EP0537155A1/de not_active Withdrawn
  • 1991-03-15 AU AU75546/91A patent/AU7554691A/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events