EP0494215A1 - Promoteur de plantes a activation par la lumiere - Google Patents

Promoteur de plantes a activation par la lumiere

Info

Publication number
EP0494215A1
EP0494215A1 EP19900914548 EP90914548A EP0494215A1 EP 0494215 A1 EP0494215 A1 EP 0494215A1 EP 19900914548 EP19900914548 EP 19900914548 EP 90914548 A EP90914548 A EP 90914548A EP 0494215 A1 EP0494215 A1 EP 0494215A1
Authority
EP
European Patent Office
Prior art keywords
promoter
protein
gene
sequence
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP19900914548
Other languages
German (de)
English (en)
Inventor
Julie Carol Lloyd
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
TWYFORD SEEDS Ltd
Trouw (UK) Ltd
Ciba Geigy UK Ltd
Rhone Poulenc Rorer Ltd
Advanced Technologies Cambridge Ltd
Biotal Ltd
Imperial Chemical Industries Ltd
MicroBio Group Ltd
Bayer CropScience Ltd Great Britain
Unilever UK Central Resources Ltd
Nickerson International Seeds Ltd
Original Assignee
TWYFORD SEEDS Ltd
Trouw (UK) Ltd
Agricultural Genetics Co Ltd
Ciba Geigy UK Ltd
Advanced Technologies Cambridge Ltd
Biotal Ltd
Imperial Chemical Industries Ltd
Schering Agrochemicals Ltd
Unilever UK Central Resources Ltd
Rhone Poulenc Ltd
Nickerson International Seeds Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by TWYFORD SEEDS Ltd, Trouw (UK) Ltd, Agricultural Genetics Co Ltd, Ciba Geigy UK Ltd, Advanced Technologies Cambridge Ltd, Biotal Ltd, Imperial Chemical Industries Ltd, Schering Agrochemicals Ltd, Unilever UK Central Resources Ltd, Rhone Poulenc Ltd, Nickerson International Seeds Ltd filed Critical TWYFORD SEEDS Ltd
Publication of EP0494215A1 publication Critical patent/EP0494215A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8237—Externally regulated expression systems

Definitions

  • the present invention relates to a light-activatable plant promoter.
  • FBPase Fructose-l,6-bisphosphatase
  • the protein is nuclear encoded.
  • the wheat genome contains three copies, one derived from each of the progenitors of hexaploid T ⁇ aestivum.
  • FBPase is synthesised as a precursor protein with a transit sequence of about 50 amino acids which is cleaved from the mature protein during transport into the chloroplast.
  • FBPase The enzyme activity of FBPase is light-regulated via the ferredoxin/thioredoxin system.
  • a full length cDNA for wheat FBPase has been isolated (Raines e_t ⁇ , Nucl. Acids Res. Ij6, 7931-7942, 1988). This provided the first complete amino acid sequence for FBPase.
  • the cDNA clone was also used as a probe to determine steady state levels of FBPase mRNA in wheat leaves during development and also under different light regimes (Raines e_t a , 1988). These results suggested that FBPase gene activity is responsive to light although other developmental factors appeared also to influence final mRNA levels.
  • the present invention provides a light-activatable promoter having the sequence: ATCGATAGGTTCGACAGAAGCTGCCACGTACCTATGAAACTCAATTGATTATTATATCCA TATTATTGAAGTTTATTTTTGTAGAATGTTATTCAATTCCAGAAGTTGTAAGTTCCGTAA GACCTGTAATATTGGCCCAATCGAAGACCAACGTTTCTTGAGCTAAATTTAGCTTTTTTT TTAGAAAGTAATTTAGCTTGCACCCTGGTAAGTGCCACAGAGTGGCACCAATACATGGAA CTCAAACATTTTTTGTCCCAGGTTTAGTGACGCGATGATGACAGCTTTAGTTGTCAAGCA TGACAACCTTTTTTTTAGAATGGTAAGTTTTACTCTTTTTTAGATGACAACTTAGTTTTTAA AAAGTCAGGCCAAAGTGCTTCGTGACACACGTGTGACACTTATCATTCAGTTTGTCTAAT TCACATCTAGATATTTTTTAAGGATGTCGTGGCTGGAAAAAGTGCTTCGTGACACACGTGTGACACT
  • the invention also provides a DNA fragment comprising such a promoter operably linked to a heterologous gene encoding a protein.
  • a vector which comprises a heterologous gene encoding a protein under the control of a promoter as above such that the gene is capable of being expressed in a plant cell transformed with the vector.
  • a suitable vector is one in which the promoter is fused directly to the 5'-end of the gene.
  • the vector may further contain a region which enables the gene and the promoter to be transferred to and stably integrated in a plant cell genome.
  • the vector is generally a plasmid.
  • Plant cells can be transformed with such a vector.
  • the invention therefore further provides plant cells which harbo ⁇ r a promoter as above operably linked to a heterologous gene encoding a protein.
  • Transgenic plants may be regenerated from such plant cells.
  • a transgenic plant can be obtained which harbours in its cells a promoter as above operably linked to a heterologous gene encoding a protein. Seed may be obtained from the transgenic plants.
  • the invention further provides a method of producing a desired protein in a plant cell, which method comprises:
  • the invention additionally provides a method of producing a transgenic plant capable of producing a desired protein, which method comprises:
  • the desired proteins can be isolated from the transformed plant cells obtained by the first method and from the plants obtained by the second method.
  • the present promoter is composed of the sequence upstream of the wheat FBPase gene from base -934 to base -54, base 1 being A of the ATG translational start codon for FBPase.
  • the promoter may be obtained by preparing a genomic library of wheat DNA, screening the library for the FBPase gene and digesting the sequence upstream of the wheat FBPase gene with appropriate restriction enzymes. There is a Clal restriction site at base -934 and a Hhal restriction site at base -54.
  • plasmid vectors which contain an upstream sequence of the wheat FBPase gene comprising the promoter sequence from base -934 to base -54.
  • These vectors include pl.8ES.
  • E. coli MC 1022 harbouring pl. ⁇ ES was deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 25 August 1989 under accession number NCIMB 40184.
  • the promoter may be released by Clal/Hhal digestion of pl. ⁇ ES.
  • the promoter sequence may be modified by one or more base substitutions, insertions and/or deletions and/or by an extension at either or both ends. However, the modified promoter sequence must still be capable of acting as a light-activatable promoter.
  • a shortened promoter sequence from base-497 to base -54 of the upstream sequence of the wheat FBPase gene has been found not be sufficient to direct expression of a protein at satisfactory levels.
  • a longer promoter sequence may be provided which extends upstream of base -934, for example to another restriction site.
  • An extension upstream of base -934 typically comprises the natural FBPase sequence upstream of base -934.
  • a suitable extended promoter therefore has the sequence:
  • This longer sequence may be obtained from a genomic library of wheat DNA as above or by digesting pl. ⁇ ES with EcoRI and Hhal.
  • the longer sequence may also be modified by one or more base sub:. Itutions, insertions and/or deletions and/or by an extension at either or both ends. Again, such a modified sequence must be capable of acting as a light-activatable promoter. There may be a degree of homology of at least 60%, for example at least 75%, at least 85% or at least 95%, between the modified sequence and the unmodified natural sequence from base -1726 to base -54 upstream of the wheat FBPase gene.
  • a modified promoter sequence may be obtained by introducing changes into the natural promoter sequence. This may be achieved by any appropriate technique, including restriction of the natural sequence with an endonuclease, insertion of linkers, use of an exonuclease and/or a polymerase and site-directed mutagenesi ⁇ .
  • a shorter DNA sequence therefore may be obtained by removing nucleotides from the 5'-terminus or the 3'-terminus of the natural promoter sequence, for example using an exonuclease such as BA 31.
  • a modified sequence is capable of acting as a light-activatable promoter may be readily ascertained.
  • the modified sequence is placed upstream of a protein coding sequence, such as the bacterial reporter gene ⁇ -glucurc idase as in the Example.
  • a protein coding sequence such as the bacterial reporter gene ⁇ -glucurc idase as in the Example.
  • Tobacco leaf discs can then be transformed.
  • the protein expressed when the transformed cells are exposed to light is then assayed, in the case of ⁇ -glucuronidase as described in the Example.
  • the promoter may be operably linked to a heterologous gene encoding a protein.
  • the heterologous gene may encode any protein it is desired to express.
  • heterologous is that the gene is not naturally operably linked to the promoter.
  • the gene does not therefore encode wheat FBPase.
  • the protein may comprise a transit peptide sequence at its N-terminus.
  • the promoter is typically used to control the expression of genes in photosynthetic tissues.
  • the protein whose expression is controlled by the promoter may be a protein encoded by a herbicide-resistance gene or a protein conferring biological control of pests or pathogens.
  • the protein may therefore be an insecticidal protein, such as B. thuringiensis toxin, to give resistance to leaf-eating insects.
  • Other uses to which the promoter may be put are the production of viral coat proteins to protect against viral infection, the production of high value proteins such as pharmaceuticals and the production of proteins to alter taste or nutritive value of forage grasses, etc.
  • the promoter sequence may be fused directly to a heterologous gene or via a linker.
  • the linker sequence may comprise an intron. Excluding the length of any intron sequence, the linker may be composed of up to 45 bases, for example up to 30 or up to 15 bases. We have found that no protein was expressed, however, when a gene encoding (3-glucuronidase was fused to the promo - via the sequence from base -53 to base 129 of the wheat .Pase gene.
  • DNA fragments and vectors can be prepared in which the promoter is operably linked to a heterologous gene.
  • the fragments and vectors may be single or double stranded.
  • Plant cells can be transformed by way of such fragment directly or by way of such a vector.
  • the vector incorporates the heterologous gene under the control of the promoter.
  • the vector contains regulatory elements capable of enabling the gene to be expressed in a plant cell transformed with the vector. Such regulatory elements include, besides the promoter, translational initiation and/or termination sequences.
  • the vector typically contains too a region which enables the chimaeric gene and associated regulatory control elements to be transferred to and stably integrated in the plant cell genome.
  • the vector is therefore typically provided with transcriptional regulatory sequences and/or, if not present at the 3'-end of the coding sequence of the gene, a stop codon.
  • a DNA fragment may therefore also incorporate a terminator sequence and other sequences which are capable of enabling the gene to be expressed in plant cells.
  • An enhancer or other element able to increase or decrease levels of expression obtained in particular parts of a plant or under certain conditions may be provided in the DNA fragment and/or vector.
  • Transformed cells are selected by growth in an appropriate medium.
  • Plant tissue can therefore be obtained comprising a plant cell which harbours the heterologous gene under the control of the promoter , for example in the plant cell genome.
  • the gene is therefore expressible in the plant cell.
  • Plants can then be regenerated which include the heterologous gene and the promoter in their cells, for example integrated in the plant cell genome, such that the gene can be expressed.
  • the regenerated plants can be reproduced and, for example, seed obtained.
  • a preferred way of transforming a plant cell is to use Agrobacterium tumefaciens containing a vector comprising the promoter operably linked to the heterologous gene.
  • a hybrid plasmid vector may therefore be employed which comprises:
  • the DNA to be integrated into the plant cell genome is delineated by the T-DNA border sequences of a Ti-plasmid. If only one border sequence is present, it is preferably the right border sequence.
  • the DNA sequence which enables the DNA to be transferred to the plant cell genome is generally the virulence (vir) region of a Ti-plasmid.
  • the heterologous gene and its transcriptional and translational control elements, including the promoter can therefore be provided between the T-DNA borders of a Ti-plasmid.
  • the plasmid may be a disarmed Ti-plasmid from which the genes for tumorigenicity have been deleted.
  • the gene and its transcriptional and control elements, including the promoter can, however, be provided between T-DNA borders in a binary vector jLri trans with a Ti-pla ⁇ mid with a vir region.
  • a binary vector therefore comprises:
  • Agrobacterium tumefaciens therefore, containing a hybrid plasmid vector or a binary vector _ir ⁇ trans with a Ti-plasmid possessing a vir region can be used to transform plant cells.
  • Tissue explants such as stems or leaf discs may be inoculated with the bacterium.
  • the bacterium may be co-cultured with regenerating plant protoplasts.
  • P-_.ant protoplasts may also be transformed by direct introduction of DNA fragments which encode the eterologous gene and in which the promoter and appropriate wther transcriptional and translational control elements are present or of a vector incorporating such a fragment. Direct introduction may be achieved using electroporation or polyethylene glycol.
  • Plant cells from monocotyledonous or dicotyledonous plants can be transformed according to the present invention.
  • Monocotyledonous species include barley, wheat, maize and rice.
  • Dicotyledonous species include tobacco, tomato, sunflower, petunia, cotton, sugarbeet, potato, lettuce, melon, soybean, canola (rapeseed) and poplars.
  • Tissue cultures of transformed plant cells are propagated to regenerate differentiated transformed whole plants.
  • the transformed plant cells may be cultured on a suitable medium, preferably a selectable growth medium. Plants may be regenerated from the resulting callus. Transgenic plants are thereby obtained whose cells harbour the promoter operably linked to the heterologous gene, for example integrated in their genome. The gene is consequently expressible in the cells. Seed from the regenerated plants can be collected for future use.
  • Expression of the protein encoded by the gene linked to the promoter is determined by the presence or absence of light. Expression occurs when light is present. If desired, therefore, expression of protein can be controlled by artificially increasing or decreasing the length of time for which plants or plant tissue cells are exposed to light, for example in a greenhouse or laboratory.
  • Figure 1 is a restriction map of FBPase genomic recombinant lambda 6aFl showing the fragments subcloned for promoter construct preparation and the extent of nucleotide sequencing;
  • FIG. 1 shows the FBPase gene structure
  • FIG. 3 shows the FBPase upstream sequences with restriction enzyme sites underlined
  • Figure 4 shows the construction of plasmid pBIXS, with t i denoting FBPase upstream sequences, denoting FBPase coding sequence, I. I denoting ⁇ -glucuronidase coding sequence and i . i denoting nopaline synthase terminator sequence;
  • Figure 5 shows the construction of plasmid pBlES
  • Figure 6 shows the construction of plasmid pBIEB
  • Figure 7 shows the construction of plasmid pBIHH
  • Figure 8 shows the contruction of plasmid ⁇ pBICH and pBIXH
  • Figure 9 shows the FBPase promoter constructs pBIES:ES, pBIXS:XS, pBIHH:HH, pBICH:CH and pBIXH:XH;
  • Figure 10 shows the sequences at the BamHl and S al sites of pBl201.1 and pBI201.2 and the sequences of construct junctions
  • Figure 11 shows the levels of ⁇ -glucuronidase activity in transformed plants, the level for untransformed plants being 0.014.
  • the strategy employed to isolate the wheat FBPase promoter involved first constructing a genomic library of wheat DNA and then screening of the library using a cDNA probe for FBPase.
  • Vector DNA 1.5 ⁇ g
  • wheat DNA 3.5 ⁇ g
  • T4 DNA ligase T4 DNA ligase
  • i_n vitro commercially available extracts
  • a restriction map was made of the 14Kb insert DNA of the positive phage 6aFl (Fig. 1) and the position and orientation of the FBPase gene determined by hybridization studies. DNA fragments covering this region were subcloned into the plasmid vector pUBSl, which is a pUC19 derivative containing the polylinker region of the Bluescript plasmid of Stratagene (Raines e_t aJL, 1988). Overlapping sequence was obtained from these clones by exonuclease III digestion and double-stranded dideoxy nucleotide sequence analysis. Data was assembled and analysed using the Staden packages. The extent of the sequence determined is indicated on Fig. 1.
  • Fig. 3 The regulatory sequences upstream of the FBPase gene, including all of those used in the constructs described below, are given in Fig. 3. This comprises 1726 bp 5' to the translation initiation codon ATG and 194 bp of protein coding sequence. Restriction enzyme sites used during subsequent cloning procedures are indicated and underlined. It was proposed that these sequence would contain all of the promoter and other regulatory elements necessary to direct correct expression of protein coding sequences placed downstream under their control.
  • Plasmid pBl201.1 is a promoterless ⁇ -glucuronidase cassette vector. Ligation resulted in the formation of pBIXS. The junction of FBPase sequences was checked by nucleotide sequencing (Fig. 10).
  • the plasmid pl.8ES was digested with BamHI and Sail and the FBPase fragment released purified by agarose gel electrophoresis. This fragment was then digested with Hhal and the overhang removed by digestion with T4 DNA polymerase. Following EcoRI digestion the fragment was ligated into Smal-EcoRI cut pUBSl.
  • the resulting plasmid pl. ⁇ EH was digested with Kpnl and the site blunted using T4 DNA polymerase, followed by digestion with BamHI.
  • the vector pBl201.1 was digested with Sail and the site filled in using the Klenow enzyme before cutting with BamHI. Vector and FBPase promoter fragment were then ligated together to create the plasmid pBIEB.
  • the sequence of the fusion junction is shown in Fig. 10.
  • constructs are based on pBIHH (described above) but contain less promoter sequence and have additional polylinker sites 5' to the FBPase sequence.
  • pBIHH and pBIEB were both digested with Clal and EcoRI and the vector portion of pBIEB ligated to the FBPase- ⁇ -glucuronidase fragment derived from pBIHH. This produced the construct pBICH. Digestion of pBICH with Xbal and Clal followed by filling in with the Klenow enzyme and religation created the plasmid pBIXH.
  • E. coli MC 1022 harbouring pl. ⁇ ES was deposited at the National Collection of Industrial and Marine Bacteria, Aberdeen, GB on 25 August 1989 under accession number NCIMB 40183.
  • the FBPase promoter constructs that were obtained are shown schematically in Figure 9.
  • the FBPase promoter ⁇ -glucuronidase expression cassettes were subcloned from their pUC19 derived vectors as EcoRI-Hindlll (pBIXS, pBICH, pBIXH) or EcoRI (pBIES, pBIEB, pBIHH) fragments into the binary vector pBIN 19 (Bevan, Nucl. Acids Res. 12, 8711-8721, 1984). These constructs were then mobilised from Escherichia coli MC1022 into Agrobacterium tumefaciens LBA4404 as described (Bevan, 1984). Leaf discs of Nicotiana tabacum var. Samsun were transformed as described (Horsch e_t al, Science 223, 496-498, 1984) and selected on shooting medium containing 100 g/ml kanamycin.
  • the activity of the FBPase promoter in individual light-grown transformants was determined by measuring ⁇ -glucuronidase activity in leaf extracts. Tissue extracts were prepared and analysed for fluorescence of the reaction product 4-methyl umbelliferone as described (Jefferson, 1987). Reactions were usually incubated at 37°C for 4 hours with aliquots sampled at 60 min intervals. The protein concentration in each extract was measured to allow direct comparisons to be made between them (using a Bio-Rad kit). The two translational fusions (pBIXS and pBIES) and one transcriptional fusion (pBIEB) yielded no plants with measurable ⁇ -glucoronidase activity above that of untransformed controls. Between 5 and 10 plants containing each construct were regenerated and assayed.
  • HH18 was one of the four pBIHH tobacco transformants from Example 1 and, in particular, was plant 1 from Figure 11. These Fl seeds were a heterogeneous population representing all possible genetic combinations, as more than one copy of the construct may have inserted into the genome. Due to the mixed nature of tht. Fl generation plants 6-8 seedlings given each treatment were assayed for ⁇ -glucuronidase activity.
  • the average ⁇ -glucuronidase activity of light-grown 8 day seedlings was 2.075 pmol 4-methyl umbelliferone formed/min/5yl extract and for etiolated (dark-grown) plants was 0.126.
  • the value for untransformed tobacco was 0.025.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

On prévoit un promoteur de plantes à activation par la lumière. Ce promoteur a été identifié comme séquence de promotion du gène de fructose-1,6-bisphosphatase. Le promoteur peut être utilisé pour régler l'expression des gènes dans les tissus photosynthétiques.
EP19900914548 1989-09-29 1990-09-28 Promoteur de plantes a activation par la lumiere Withdrawn EP0494215A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB898922007A GB8922007D0 (en) 1989-09-29 1989-09-29 Light-activatable plant promoter
GB8922007 1989-09-29

Publications (1)

Publication Number Publication Date
EP0494215A1 true EP0494215A1 (fr) 1992-07-15

Family

ID=10663813

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19900914548 Withdrawn EP0494215A1 (fr) 1989-09-29 1990-09-28 Promoteur de plantes a activation par la lumiere

Country Status (5)

Country Link
EP (1) EP0494215A1 (fr)
JP (1) JPH07501921A (fr)
CA (1) CA2066652A1 (fr)
GB (1) GB8922007D0 (fr)
WO (1) WO1991005054A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5460952A (en) * 1992-11-04 1995-10-24 National Science Counsil Of R.O.C. Gene expression system comprising the promoter region of the α-amylase genes
US5712112A (en) 1992-11-04 1998-01-27 National Science Council Of R.O.C. Gene expression system comprising the promoter region of the alpha-amylase genes
US6288302B1 (en) 1992-11-04 2001-09-11 National Science Council Of R.O.C. Application of α-amylase gene promoter and signal sequence in the production of recombinant proteins in transgenic plants and transgenic plant seeds
FR2712604B1 (fr) * 1993-11-15 1996-02-02 Commissariat Energie Atomique Cassette de clonage et d'expression, vecteurs d'expression et bactéries transformées comprenant le promoteur Frup de R. Capsulatus; leurs applications.
DE19644478A1 (de) 1996-10-25 1998-04-30 Basf Ag Blattspezifische Expression von Genen in transgenen Pflanzen
ATE506441T1 (de) * 1998-08-19 2011-05-15 Monsanto Technology Llc Pflanzliche expressionsvektoren
US7122721B1 (en) 1999-10-05 2006-10-17 Basf Aktiengesellschaft Plant gene expression under the control of constitutive plant V-ATPase promoters

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9105054A1 *

Also Published As

Publication number Publication date
WO1991005054A1 (fr) 1991-04-18
CA2066652A1 (fr) 1991-03-30
GB8922007D0 (en) 1989-11-15
JPH07501921A (ja) 1995-03-02

Similar Documents

Publication Publication Date Title
KR0168038B1 (ko) 증진된 식물내 발현을 위한 합성 B.t. 유전자의 제조방법 및 그 유전자
AU648951B2 (en) Agrobacterium mediated transformation of germinating plant seeds
CA2078229A1 (fr) Promoteur de vegetaux
US5436393A (en) Potato tuber specific transcriptional regulation
US6239329B1 (en) Shoot meristem specific promoter sequences
Fobert et al. Detection of gene regulatory signals in plants revealed by T-DNA-mediated fusions
WO1993001283A1 (fr) Plantes transgeniques sans genes de selection
US5073675A (en) Method of introducing spectinomycin resistance into plants
CA2112800A1 (fr) Cassette d'expression et plasmides pour l'expression specifique d'une cellule stomatique et leur utilisation pour introduire des cellules de plantes et des plantes transgeniques
EP0353908A2 (fr) Constructions d'ADN et plantes les incorporant
EP0494724A2 (fr) Plasmides pour contrôler l'expression dans des plantes
WO1993006711A1 (fr) Gene d'invertase d'acide de tomate
US5442052A (en) Expression of genes in transgenic plants
EP0126546A2 (fr) Expression de gènes structurels de plantes
Gidoni et al. Coordinated expression between two photosynthetic petunia genes in transgenic plants
EP0494215A1 (fr) Promoteur de plantes a activation par la lumiere
US5217902A (en) Method of introducing spectinomycin resistance into plants
KR100387948B1 (ko) 식물 공변세포 특이적 유전자 발현 프로모터
Hensgens et al. Translation controls the expression level of a chimaeric reporter gene
KR20020012224A (ko) 암술 조직에 대한 특이적 활성을 지닌 프로모터 및 그의이용
US5723757A (en) Plant promoters specific for sink organ expression of genes
US20020108141A1 (en) Promoter system of plant translationally controlled tumor protein gene
US7557264B2 (en) Gossypium hirsutum tissue-specific promoters and their use
JP2574130B2 (ja) 植物細胞の遺伝的修飾方法
US6664384B1 (en) Duplicated cassava vein mosaic virus enhancers and uses thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19920427

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FR GB IT LI LU NL SE

17Q First examination report despatched

Effective date: 19940310

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 19940921