EP0489830A1 - Expression of alpha-macroglobulins - Google Patents

Abstract

Alpha-macroglobulins, including human alpha2-macroglobulins and their variants, fragments or derivatives thereof, are produced using recombinant technology. The products are useful as additives to growth media, as proteinase inhibitors, as carriers in enzyme replacement therapy, and as DNA carriers in gene therapy.

Description

Title: Expression of alpha-macroglobullns

FIELD OF THE INVENTION

The present invention relates to the expression of α-macroglobu- 1ins, derivatives and variants thereof, and especially the expression of the human α₂-macroglobulin (α₂M) in an active form in mammalian cells, and the expression of genetically engineered variants thereof. The use of such recombinant α-macroglobulins, especially recombinant α₂M(rα^* ₂M) and variants is described with examples from the fields of medicine for therapeutic purposes, and the development of novel defined growth media for propagation of mammalian cells in culture.

BACKGROUND OF THE INVENTION.

BIOCHEMISTRY OF tt,-MACROGLOBULIN fa-M). The proteinase binding glycoprotein α₂M, which is synthesized in the liver, constitute together with the complement proteins C3, C4 and C5 a separate class of structurally and functionally related large plasma proteins. For a recent review see (Sottrup-Jensen, L. (1987) in: The Plasma Proteins (Putnam, F.W., ed.) 2nd Ed., 5: 191-291, Academic Press, Orlando, FL).

Apart from C5 these proteins contain an internal β-cysteinyl- γ-glutamyl thiol ester, which enables the proteolytically activated forms of α₂M, C3, and C4 to participate in characteristic covalent binding reactions (Sottrup-Jensen, L., et al., (1980) FEBS Lett. 121: 275-280; Salvesen, G.S. and Barrett, A.J., (1981) Biochem. J. 187: 695-701). The thiol este structure, which in the active proteins can be slowly cleaved by a number o small nitrogen nucleophiles, constitutes a unique type of postsyntheti modification of proteins, and plays a prominent role in the biological properties of α₂M. The presence of the active thiol esters in α₂M is reveale by a characteristic pattern of heat fragmentation (Harpel , P.C., et al . , (1979) J. Biol. Chem. 254: 8869-8878).

Traditionally, α₂M has been studied within the context of plasm proteinase inhibitors, although by several criteria it is unique. Wherea most plasma proteinase inhibitors are monomeric proteins of roughly simila size, containing approximately 430-500 residues, α₂M is a tetramer whose 180 kD subunits contain 1451 residues (Sottrup-Jensen et al . , (1984) J. Biol. Chem. 259: 8318-8327).

Furthermore, in contrast to most other proteinase inhibitors, which form 1:1 complexes with serine proteinases engaging the active sit of the proteinase and the reactive site of the inhibitor, α₂M forms complexes with a broad spectrum of proteinases differing in their substrate specifi¬ city and catalytic mechanism e.g.: trypsin, leucocyte elastase, chymotrypsin, pancreatic elastase, cathepsin G, plasmin, plasma kallikrein and thrombin. 5 The second-order rate constant for association between these proteinases and α₂M varies by several orders of magnitude. Both 1:1 and 2:1 proteinase-α₂M complexes can be formed, and the disulfide-bridged dimer (360 kD) appears to be the functional unit of α₂M (Sottrup-Jensen, L. (1987) in: The Plasma Proteins (Putnam, F.W., ed.) 2nd Ed., .5: 191-291, Academic Press,

10Orlando, FL) . Contrary to "classical" proteinase inhibitor complexes the α₂M bound proteinase is still active, especially toward small synthetic substrates (Sottrup-Jensen, L. (1987) in: "The Plasma Proteins" (Putnam, F.W., ed.) 2nd Ed., 5: 191-291, Academic Press, Orlando, FL).

The mechanism of proteinase binding by α₂M has been described by

15 the "trap" (Barrett, A.J. and Starkey, P.M. (1973) Biochem. J. 133: 709- 724), where proteolytic cleavage of a particularly exposed peptide stretch near the middle of the 180-kD subunit (the "bait" region) results in a conformational change of the αr₂M tetramer, thereby entrapping the proteina¬ se. The nature of the essentially irreversible proteinase complex formation

20with α₂M has long remained elusive. However, recent investigations show that a major fraction (typically > 80-90 % of the trapped proteinase is also cova- 1entlybound throughepsilon-lysyl (proteinase)-γ-glutamyl (α₂M) bonds (Sottrup- Jensen, L. et al., (1981) FEBS Lett. 128: 127-132; Sand, 0. et al . , (1985) J. Biol. Chem. 260: 15723-15735; Pochon, F. et al., (1987) FEBS Lett. 217:

25101-105).

PHYSIOLOGICAL ASPECTS OF PROTEINASE-ttM INTERACTIONS.

Since the α₂M-proteinase complexes are rapidly cleared from the circulation (Ohlsson, K. (1971) Acta Physiol. Scand. £1: 269-272; Imber, 30M.J. and Pizzo, S.V. (1981) J. Biol. Chem. 256: 8134-8139.) a general role as a "clearing vehicle" for plasma proteinases has been envisaged.

The main physiological targets may include proteinases of the coagulation and fibrinolysis systems and plasma kallikrein, and perhaps also proteinases like leucocyte elastase, cathepsin G and collagenases and other

35 proteinases released during cellular turnover (Sottrup-Jensen, L. and

Birkedal-Hansen, H. (1989) J. Biol. Chem. 264: 393-401).

Although α₂M may be largely confined to the vasculature in healthy uninflamed tissues, the inhibitor and its proteinase complexes are found at near plasma levels in inflammatory exudates of rheumatoid joints and gingival crevicular fluids (Tollefsen, T. and Saltved, E. (1980) J. Periodont. Res. 15: 96-106; Borth, W., et al . , (1983) Ann. N. Y. Acad. Sci. 421: 377-381). While plasma α₂M appear to be synthesized in the liver (Schreiber, G. (1987) in: "The Plasma Proteins" (Putnam, F.W., ed) 2nd Ed., 5: 294-363, Academic Press, Orlando, FL.) other sites of synthesis exist. Several cell strains in culture have been shown to produce α₂M including fibroblasts (Mosher, D.F., et al., (1977) J. Clin. Invest. 60: 1036-1045) and monocytes- /macrophages (Hovi, T., et al . , (1977) J. Exp. Med. 145: 1580-1589).

Whereas hepatocytes and Kupffer cells of the liver are most important for clearance of α₂M-proteinase complexes in plasma (Davidsen, O., et al., (1985) Biochim. Biophys. Acta 846: 85-92), fibroblasts (Van Leuven, F., et al., (1979) J. Biol. Chem. 254: 5155-5160; Mosher, D.F. and Vaheri , A. (1980) Biochim. Biophys. Acta 627: 113-122) and macrophages (Debanne, M.T., et al., (1975) Biochim. Biophys. Acta ill: 295-304; Kaplan, J. and Nielsen, M.L. (1979) J. Biol. Chem. 254: 7323-7328) also possess receptors for α₂M-proteinase complexes.

These observations suggest that there may be a considerable extravascular turnover of o.₂M perhaps primarily carrying proteinases functioning in the cellular micro environment (Sottrup-Jensen, L. and Birkedal-Hansen, H. (1989) J. Biol. Chem. 264: 393-401).

SUMMARY OF THE INVENTION

Briefly stated, the present invention discloses a method for the production of recombinant α-macroglobulins, and especially human α₂M, and variants thereof in an active form.

Within a preferred embodiment, the cultured host cell is an eukaryotic cell such as a mammalian cell or cells derived from organisms such as insects, plants, yeast or other fungi, such as Aspergillus.

The invention further relates to DNA sequences comprising a gene encoding for the expression of human a₂M and variants thereof, vectors comprising such DNA sequences, and suitable hosts transformed with such vectors.

Yet another aspect of the invention is the use of recombinant α.₂M and variants thereof as a protein carrier in enzyme replacement therapy (ERT).

Yet another aspect of the invention is the use of recombinant α₂M and variants thereof as a DNA carrier in gene therapy.

Further aspects of the invention relates to the use of recom¬ binant Qr-macroglobulins, especially human a₂M, and variants thereof as constituents of growth media, either as an additive or co-expressed with a desired gene product.

DEFINITIONS

5 Prior to setting forth the invention it may be helpful for an understanding thereof to set forth definitions of certain terms to be used hereafter.

Complementary DNA or cDNA: A DNA molecule or sequence which have been lOenzy atically synthesized from sequences present in a mRNA template.

DNA Construct: A DNA molecule, or a clone of such a molecule, either single- or double-stranded, which may be isolated in partial form from a naturally occurring gene or which has been modified to contain segments of DNA which

15 are combined and juxtaposed in a manner which would not otherwise exist in nature.

Plasmid or Vector: A DNA construct containing genetic information which may provide for its replication when inserted into a host cell. A plasmid 20generally contains at least one gene sequence to be expressed in the host cell, as well as sequences encoding functions which facilitate such gene expression, including promoters and transcription initiation sites. It may be a linear or closed circular molecule.

25 Joined: DNA sequences are said to be joined when the 5' and 3' ends of one sequence are attached by phosphodiester bonds to the 3^Λ and 5' ends, respectively, of an adjacent sequence. Joining may be achieved by such methods as ligation of blunt or cohesive termini, by synthesis of joined sequences through cDNA cloning, or by removal of intervening sequences

30through a process of directed mutagenesis.

Variant: A peptide related to the original peptide, but wherein the amino acid sequence has been altered through mutation of the gene encoding the original peptide. 35 ABBREVIATIONS

AMINO ACIDS

Figure la illustrates the construction of plasmid pll36.

Figure lb illustrates the construction of plasmid pll67. Figure 2 illustrates the structure of plasmid pll67.

Figure 3 illustrates a gel electrophoresis (10 - 20 % SDS-PAGE) of the thermal fragmentation products generated from α₂M and rα₂M.

Figure 4 illustrates a gel electrophoresis of the thermal fragmentation products generated from methylamine treated α₂M and rα₂M. Figure 5 illustrates a gel electrophoresis (SDS-PAGE) of the reaction products generated from trypsin treatment of α₂M and rα₂M.

Figure 6 illustrates a gel electrophoresis of the reaction produ¬ cts generated from trypsin treatment of methylamine-treated a₂M and rα₂M. 5 Figure 7 illustrates a "rate gel" electrophoresis of unreacted native -and trypsin treated α₂M and rα₂M.

Figure 8 illustrates a "rate gel" electrophoresis of unreacted native -and methylamine treated α₂M and rα₂M.

Figure 9 illustrates the chromatograms of α:₂M and rα₂M on a lOSuperose 6 column.

Figure 10 illustrates the gel electrophoresis (10 - 20 % reducing SDS-PAGE) of the reaction products from chy otrypsin treated human o:₂M, human PZP and rα₂M-PZP.

Figure 11 illustrates the gel electrophoresis (10 - 20 % reducing 15 SDS-PAGE) of the reaction products from elastase treated human α₂M, human PZP and rα₂M-PZP.

Figure 12 illustrates the gel electrophoresis (10 - 20 % reducing SDS-PAGE) of the reaction products from trypsin treated human α₂M, human PZP and rα₂M-PZP. 20 Figure 13 illustrates the gel electrophoresis (10 - 20 % reducing SDS-PAGE) of the reaction products from Staphylococcus aureus Glu-specific protease treated human α₂M, human PZP and rcc₂M-PZP.

25DETAILED DESCRIPTION OF THE INVENTION

According to the invention there is provided a process for the production of α-macroglobulins, especially human α₂-macroglobulin, or fragments or derivatives, including variants thereof, wherein a functionally operative expression vector comprising a gene encoding for the expression of

30 a α-macroglobulin, especially human α₂-macroglobulin, or fragments or derivatives thereof, including variants, or alleles of such a gene, is intro¬ duced into a suitable host capable of expressing said gene, said host is cultured in a suitable nutrient medium containing sources of assimilable carbon and nitrogen and other essential nutrients, and the expressed a-

35macroglobulin, especially human α₂-macroglobulin, or fragments or derivatives thereof is recovered.

Many proteins synthesized particularly in mammalian cells undergo post-translational modification (processing) of one kind or the other. Depending on the final destination and on the specific function of a newly synthesized protein, it may go through a number of processing steps leading to covalent modifications such as e.g.: glycosylation, -γ-carboxylation, β- hydroxylation, sulphatation, amidation, thiol ester formation, phosphory- δlation, proteolytic cleavage at precursor processing sites, fatty acylation (Rosner, M.R. (1986). in: "Mammalian Cell Technology", (Thilly, W.G. ed), Butterworth Publishers, Stoneham, MA.: 63-89).

Proteins of various sizes and with a variety of different post- -translational modifications have been successfully expressed in transformed

10 heterologous mammalian host cells using recombinant DNA technology. A few examples: Human coagulation factors Vila and IX have been expressed in trans¬ formed BHK (Syrian Baby Hamster Kidney) cells with correct post-trans!ational modifications such as γ-carboxylation and glycosylation (Thi , L. et al . , (1988) Biochemistry 27: 7785-7793; Busby, S. et al . , (1985) Nature 3_16: 271-

15273). Human Platelet-derived Growth Factor AB heterodimer has been expres¬ sed in transformed CHO (Chinese Hamster Ovary) cells with correct processing of the A and B chain precursors and correct assembly of the AB heterodimer. Human coagulation factor VIII has been expressed in transformed CHO cells with correct processing of the precursor leading to a two chain molecule that

20 can be activated by thrombin and factor Xa (Kaufman, R.J. et al . , (1988) J. Biol. Chem. 263: 6352-6362; Pittman, D.D. and Kaufman, R.J. (1988) Proc. Natl. Acad. Sci . USA 85: 2429-2433).

So far, there have been no reports on the heterologous expression of proteins in which the formation of an active thiol ester is a prominent

25 post-translational modification.

The biosynthesis of the internal thiol ester in the third com¬ ponent (C3) of complement from rabbit has been investigated (Iijima, M. et al., (1984) J. Biochem. 96: 1539-1546). Rabbit liver mRNA was translated in vitro in a rabbit reticulocyte lysate system, and the synthesized C3 specific

30 products did not incorporate radio labelled methylamine. On the other hand radio labelled iodoacetamide reacted with the synthesized C3 specific products; these results indicated the presence in the primary C3 specific translation product of a free thiol group instead of a reactive thiol ester. If a liver homogenate supernatant (S-13) including cytosol and microsomes was

35 included, the C3 specific product could now incorporate methylamine. By increasing the concentration of the S-13 component(s), the incorporation of methylamine in C3 specific products was increased, and at the same time incorporation of iodoacetamide decreased. If the S-13 fraction was treated at 65^eC for 5 in, the activity was completely lost. The results from this investigation strongly suggest an involve¬ ment of a transglutaminase-like or other type, of enzyme in the posttransla- tional formation of an active thiol ester in rabbit C3. There are no similar investigations addressing the formation of the thiol ester in other α-macro- globulins, e.g. α₂M, but from analogy and homology considerations, it is expected that a similar mechanism is responsible for the formation of thiol esters in other α-macroglobulins synthesized in the mammalian liver.

Through this investigation a number of developments were done which also are deemed to be encompassed of the present invention. These include DNA sequences comprising a gene encoding for the expression of α- macroglobulins, especially human α₂-macroglobulin, or fragments or deriva¬ tives and variants thereof as exemplified in SEQ ID NO:1 and SEQ ID N0:3. Another aspect of the invention relates to functionally operative expression vectors comprising a gene encoding for the expression of at least one α-macroglobulin, especially human α₂-macroglobulin or fragments or derivatives and variants thereof, or alleles of such a gene.

Such vectors preferably further comprise regulatory elements necessary for the stable maintenance of said vector in mammalian cells. Also, such vectors may further include sequences providing for the processing and secretion of the expressed product.

In relation to the use of recombinant α-macroglobulins, and especially rα₂M, in growth media it may be co-expressed with another desired gene product, and consequently the vectors of the invention may further comprise one or more other genes encoding for a desired gene product.

The invention further relates to transformed hosts comprising a functionally operative expression vector according to the invention compri¬ sing a gene encoding for the expression of human α₂-macroglobulin or fragments or derivatives and variants thereof, or alleles of such a gene.

The host may be selected from the group comprising a bacterial strain, a fungal strain, a mammalian cell line, or a mammal, especially a fungus, such as belonging to the genus Asperqillus, or a yeast strain, pre¬ ferably belonging to the genus Saccharomvces. Another preferred type of host is a mammalian cell line, preferably a Syrian Baby Hamster Kidney (BHK) cell line, and especially the one which is available from ATCC under No. CRL 1632. The invention further relates to the recombinant human α₂- macroglobulin or a variant thereof in an active form having the amino acid sequence of SEQ ID N0:2, or SEQ ID N0:4.

APPLICATIONS OF α-MACROGLOBULINS. ESPECIALLY rα .

The present invention discloses applications of α-macroglobulins, and especially rα₂M. These should be regarded not as limitations but as a few examples among many for the use of recombinant derived α-macroglobulins.

α-MACROGLOBULINS AS CONSTITUENTS OF DEFINED GROWTH MEDIA.

Degradation of specific heterologous products produced in either transformed or non-transformed mammalian cells is a potential problem in the production of recombinant products. This is due to the fact that many host cells secretes one or more different proteinases. When a production cell line is grown in the presence of e.g. 10

% fetal calf serum, such proteolytic degradation of secreted recombinant or native protein products is a minor problem due to a buffering effect of the added serum proteins.

However, the use of fetal calf serum in the large scale growth (fermentation) of mammalian production cell lines is not a desirable situation for a number of reasons. First of all fetal calf serum is a very costly constituent of complex growth media; second, the demand for fetal calf serum from a growing biophar aceutical industry might not be easily fulfilled in the future, and third, the use of fetal calf serum constitutes a potential quality control problem in the production of pharmaceuticals intended for use in humans.

To circumvent these problems, efforts can be expected in the field of development of defined growth media for use with mammalian cells. Addition of various proteinase inhibitors to such new defined growth media will be required to ensure the integrity of the secreted products. Alternatively, the producer cell line might, through genetic engineering, be endowed with the capacity to produce and secrete proteinase inhibitors along with the desired product(s). α-Macroglobulins, and especially Human α₂M, are proteinase inhibitors of broad specificity, and they are therefore according to the invention used as constituents of defined growth media for mammalian cells, either as a medium additive or as a product co-produced with the desired product. The target sites for a number of different proteinases, e.g. bovine trypsin, Streptomvces qriseus trypsin, papain, porcine elastase, bovine chymosin, bovine chymotrypsin, Staphylococcus aureus strain V8 proteinase, human plasmin, bovine thrombin, thermolysin, subtilisin Novo and Streptomvces qriseus proteinase B have been mapped in the bait region of human α₂M (Mortensen, S.B., et al., (1981) FEBS Lett.135: 295-300) and other α-macroglobulins (Sottrup-Jensen, L., Sand, 0., Kristensen, L. and Fey, G.H. J.Biol.Chem. 264.15781-15789, 1989). It is evident that α₂M and the other α- acroglobulins as proteinase inhibitors have broad specificities. In those situations, where the proteinase inhibitory spectrum of a α-macroglobulin, such as α₂M, is not sufficient for the prevention of product degradation, it is possible through site specific mutation, protein engineering, etc. to change the proteinase inhibitor specificity of the α- acroglobulin, such as α₂M. Incorporation of desirable specific proteinase target sites in the bait region of recombinant α₂M will change the inhibitor specificity of the mutated α₂M. Furthermore it is possible through genetic engineering to construct novel specific or general proteinase target sites in the bait region of a α-macroglobulin in order to enhance its versatility as a proteinase inhibitor of specific or broad inhibitory spectrum. Furthermore it is possible to remove specific target sites in an α- macroglobulin in order to avoid degradation of the variant in question by certain proteases in the circulation that will already be inhibited through the action of naturally present proteinase inhibitors.

The production of recombinant products in fungi, such as species and strains of e.g. Asperqillus and Saccharomvces also meets with potential problems of product degradation. In some cases it is possible to isolate proteinase negative mutants of desirable production strains. This might not always be the case, and co-expression of α-macroglobulins, such as α₂M or α₂M-mutants together with a desirable product may inhibit proteolysis of the product in question.

α-MACROGLOBULIN MUTANTS AS SPECIFIC PROTEINASE INHIBITORS.

The a ino acid sequence of the bait region of α-macroglobulins defines the specificity of the α-macroglobulin towards different proteina- ses. A comparison of cleavage patterns for different proteinases and bait region sequences in five mammalian α-macroglobulins has recently been published (Sottrup-Jensen, L., Sand, 0., Kristensen, L. and Fey, G.H. The α-macroglobulin bait region. Sequence diversity and localization of cleavage sites for proteinases in five mammalian α-macroglobulins. J. Biol . Chem. 264, 15781-15789, 1989). It has previously been clearly demonstrated that the bait region in each species of α-macroglobulin is the major determinant of proteinase inhibitor specificity. The present invention demonstrates the possibility of modulating the inhibitor specificity of human α₂M by 5 alterations of proteinase target sites in the bait region.

In the present invention it is demonstrated that the bait region of human α₂M (residues 690 to 730 in SEQ ID N0:2) can be mutated at will to obtain a new proteinase inhibitor profile of this macroglobulin. The example presented in the present invention describes the construction of a hybrid lOmacroglobulin. In this hybrid the bait region from human pregnancy zone protein (PZP) was introduced into human α₂M, from which the native bait region had been removed. The hybrid molecule, which was constructed by the use o recombinant DNA technology, revealed a proteinase inhibitor profile similar to the inhibitor profile of PZP.

15 The invention thus demonstrates the possibility to design and produce proteinase inhibitors with altered and new inhibitor specificities at will .

This finding is important for the design of new proteinase inhibitors. Due to the low antigenicity the bait region in macroglobulins

20 (Van Leuven, F., Marynen, P., Cassiman, J.-J. and Van den Berghe, H. Mapping of structure-function relationships in proteins with a panel of monoclonal antibodies. A study on human alpha-2-macroglobulin. J. Immunol. Methods 111, 39-49, 1988, and Delain, E., Barray, M., Tapon-Bretaudiere, J., Pochon, F., Marynen, P., Cassiman, J.-J., Van den Berghe, H. and Van Leuven, F. Th

25Molecular Organization of Human alpha2-Macroglobulin. An Immunoelectro microscopic study with monoclonal antibodies. J. Biol . Chem. 263, 2981-2989, 1988) it is now possible, by the use of the technology described in th present invention, to design non-immunogenic new proteinase inhibitors tha can be used e.g. in the treatment of any disease, where aggressive proteina

30 ses constitute a threat to the health of man.

In the present specification the production of α₂M variants i described by the construction of a hybrid macroglobulin. It is clear to th skilled person in the art that changes also could be obtained through othe genetic engineering methods, such as described in International Publicatio

35 No. W0 89/06279 (N0V0 INDUSTRI A/S). Also it is clear that other α acroglobulins could be employed instead of the human α₂M, such as thos mentioned in Sottrup-Jensen, L. et al . (1989), supra. røJt AS A PROTEIN CARRIER IN ENZYME REPLACEMENT THERAPY.

A different application of α^ is .its use as a carrier of macro- molecules such as proteins and nucleic acids. When α₂M reacts with and forms a complex with a proteinase in solution, α₂M may bind other proteins (also non-proteinase proteins) present in that solution (Salvesen, G.S. et al . , (1981) Bioche . J. 195: 453-461). In the case of Fabry's disease, which is an X-chromosome linked disorder of glycosphingolipid metabolism, it has recently been demonstrated that α₂M can function as a carrier in an in vitro model of enzyme replacement therapy (ERT) (Osada, T., et al., (1987) Biochem. Biophys. Res. Commu. 142: 100-106). α₂M was conjugated to coffee bean α- galactosidase through the action of trypsin, and the formed complex was internalized through α₂M-receptor specific (Van Leuven, F., et al . , (1981) J. Biol. Chem. 256: 9016-9022) endocytosis and delivered to the lysosomes, which is the target organelle for α₂M-receptor mediated internalization of α₂M- proteinase complexes (Willingham, M.C. and Pastan, I., (1980) Cell 21: 67- 77).

Such a scheme in ERT provides a method of internalization to the lysosome of the enzyme in question and at the same time it might alleviate potential antigenicity problems arising from the use of heterologous enzymes in therapy. One limitation in this type of ERT (Osada, T., et al., (1987) Biochem. Biophys. Res. Commu. 142: 100-106) would be the types of potential target cells that could be treated by this protocol. Obviously, they would have to express the α₂M-receptor. In a future development of the system, the possibility might exist to redesign the cell specificity of α₂M internaliza- tion by exchanging the receptor binding domain of α₂M with other receptor ligands. Hereby α^M-mutants could be designed to enter any cell type known to express a specific internalizable receptor.

This type of development would of course require a system for the production of recombinant derived α₂M. The use of native human α₂M as a carrier in ERT (as described above) is undesirable due to the now well known risks of the employment of blood derived products in the treatment of human disease.

The production of recombinant α₂M in accordance with the present invention alleviates this problem by providing for large scale production of rα₂M.

rα AS A DNA CARRIER IN GENE THERAPY.

Advances in gene transfer into mammalian cells have opened for the possibility of the treatment of a number of genetic disorders through gene therapy. A major problem in gene therapy will be the specific targeting of genes into the appropriate cells within the body. (Williamson, B., (1982) Nature 298: 416-418; Anderson, W.F., (1984) Science 226: 401-409; Parkman, R., (1986) Science 232: 1373-1378). It was recently described that a constructed foreign gene containing the chloramphenicol acetyltransferase (CAT) on a bacterial plasmid could be targeted to the liver of rats by specific receptor directed internalization (Wu, G.Y. and Wu, C.H. (1988) J. Biol. Chem. 263: 14621- 14624). The DNA carrier consisted of a galactose-terminal (asialo)glyco- protein and asialoorosomucoid covalently linked to poly-L-lysine. The polycation poly-L-lysine can bind DNA in a strong non-covalent and nondamag- ing interaction. It was demonstrated that complex bound DNA was internalized by cell-surface asialoglycoprotein receptors that are unique to hepatocytes. The complex was injected intravenously, and upon analysis only the liver expressed the CAT activity.

In the present invention the use of rα₂M as a carrier of DNA in gene therapy is suggested. Reaction of rα₂M with a proteinase such as trypsin or with methylamine in the presence of covalently closed circular plasmid DNA is likely to result in partial or total entrapment of DNA within the complexing α₂M molecule. After intravenous injection of such complexes with exposed receptor binding domains, the complex will be rapidly cleared from the blood and internalized in specific target cells, such as hepatocytes and Kupffer cells. Through protein engineering on the receptor binding domain of rα₂M it will be possible to design a DNA carrier specific for other cell types. The advantage in this system as compared to the above described system using the asialoglycoprotein receptor is, that it will not be necessary to identify different DNA carrier systems for each new cell type.

EXAMPLES

Materials and methods: Microorganisms and cell lines

E. coli K12 (MC1061) is available from e.g. Stratagene Inc., 11099 North Torrey Pines Rd., La Jolla, California 92037.

HepG2 (Human hepatoblasto a cell line) is freely available fro American Type Culture Collection, under No. HB 8065.

BHK (Syrian Hamster Kidney cell line, thymidine kinase mutan line tk^'lsl3, (Waechter and Baserga (1982) Proc. Nat! . Acad. Sci . USA 79: 1106-1110); is freely available from American Type Culture Collection, under No. CRL 1632.

Plasmids and vectors

5

Plasmids pCDVI-PL and pSP62-K2 are available from Dr. Tasuku Honjo, Faculty of Medicine, Kyoto University, Kyoto 606, Japan. pSP62-K2 was derived from the plasmid pSP62-PL (available from New England Nuclear/Du Pont (U.K.) Ltd., Wedgwood Way, Stevenage, Hertfordshire, SG14QN) as 10described (Noma et al., (1986) Nature, 319: 640-646). pCDVI-PL was derived from pcDVl (Okayama, H. and Berg, P. (1983) Molec. cell. Biol. 3: 280-289) as described (Noma et al., (1986) Nature, 319: 640-646).

M13mpl8 is available from Pharmacia LKB Biotechnology (catalog # 27-1552-01) (Norrander, J., Ke pe, T. and Messing, J. Gene 26: 101-106, 151983).

M13mpl9 is available from e.g. International Biotechnologies, Inc., P.O. Box 9558, 275 Winchester Avenue, New Haven, Connecticut 06535, USA. pDHFR-I is available from Dr. K.L.Berkner, ZymoGenetics Inc.,

204225 Roosevelt Way NE, Seattle, Washington 98105. (The construction of this plasmid is given in detail in: Berkner, K.L. and Sharp, P.A. (1984) Nucleic

Acids Res. 12: 1925-1941). The molecular cloning of the DHFR cDNA present in this plasmid, and its sub-cloning in mammalian expression vectors under the control of adenovirus derived promoters has previously been described

25 in detail (Chang, A.C.Y., et al . , Nature 275: 617-624 and Kaufman, R.J. and

Sharp, P.A. (1982) Mol . Cell. Biol. 2: 1304-1319) . The backbone plasmid in pDHFR-I is pBR322 (Sutcliffe, J.G. (1979) Cold Spring Harbor Symp. Quant.

Biol. 43: 77-90; Sutcliffe, J.G. (1978) Nucleic. Acids Res. 5: 2721-2728). pUC13 is described in: Vieira, J. and Messing, J.: 1982, Gene 19:

30259-268 and available from Pharmacia LKB Biotechnology (catalog # 27-4954-

01). pUC19 i s descri bed in: Yani sch-Perron, C. and Messing, J . , 1985, Gene 33 : 103-119 and avai l abl e from Pharmaci a LKB Bi otechnol ogy (catal og # 27-4951 -01 ) . 35 Growth media

LB-broth:

Mix 227 g Bacto Tryptone, Difco 0123-01

113.5 g Yeast extract, Difco 0127-01, and 227 g NaCl in a sealable plastic container.

Add 12.5 g mix to 500 ml water in a 1000 ml bottle, shake well and sterilize in an autoclave.

Dulbeccos Modified Eagle Medium is available from e.g. Gibco Ltd. P.O. Box 35, Trident House, Renfrew Road, Paisley PA34EF, Renfrewshire, Scotland. Cat.# 042-250 IM (10 * concentrate).

Antibodies

Anti-α₂M A033 and peroxidase conjugated anti-α₂M PE326 were from DAK0PATTS A/S, Copenhagen, Denmark.

EXAMPLE 1.

CLONING AND SEQUENCE DETERMINATION OF HUMAN α,M

Preparation of messenger RNA from the human cell line HepG2.

The human hepatoblastoma cell line HepG2 (American Type Culture Collection No. HB 8065, freely available) was used as a source for mRNA preparation. HepG2 cells were grown to a total cell number of 15 * 10⁷ in Dulbecco's Modified Eagle medium containing 10% fetal calf serum and antibiotics.

Total RNA was isolated by the guanidinium thiocyanate method (Chirgwin et al., (1979) Biochemistry 18: 5293-5299) and purified by CsCl gradient centrifugation. A total of 3000 μg RNA was obtained. mRNA was isolated by use of an oligo(dT)-cellulose column (Aviv & Leder (1972) Proc. Natl. Acad. Sci . USA 69: 1408-1412). 60 μg of mRNA was obtained after on cycle of affinity chromatography. After ethanol precipitation, this preparation of mRNA was resuspended in 10 mM Tris-HCl pH 7.5, 0.1 mM EDTA- Na₂ at a final concentration of 1 μg/μl and stored at -80°C for subsequen use in the construction of a cDNA library.

Construction of a cDNA library from HepG2 mRNA.

A cDNA library was constructed in the pCDVI-PL/pSP62-K2 vector (Noma et al., (1986) Nature, 3_!9: 640-646. Available from Dr. Tasuku Honjo, Faculty of Medicine, Kyoto University, Kyoto 606, Japan) by use of the methods described by Okayama & Berg (Mol . Cell. Biol. 2: 161-170 (1982); Mol. Cell. Biol. 3: 280-289 (1983)).

E. coli K12 (MC1061) (Casadaban & Cohen (1980) J. Mol. Biol.

5138: 179-207) was used for transformation. MC1061 were grown in L-broth at

37°C to 00₆₆₀=0.5. Twenty ml were centrifuged, and the pellet was resuspended in 7 ml of ice-cold sterile 0.1 M CaCl₂, incubated on ice for 30 minutes, centrifuged briefly, and finally kept in the cold room overnight.

Ninety-five μl suspension of transformation-competent E. coli 0MC1061 were added per 10 μl of cDNA preparation. The mixture was incubated on ice for 30 minutes, heat-shocked at 43,5°C for 45 seconds, and finally, after addition of L-broth, incubated at 37°C for 30 minutes.

After resuspension, the cells were plated onto L-broth plates containing ampicillin (50 μg/ml) and grown for 8 hrs at 37°C. A total of 2.9 5*10⁵ individual colonies could be obtained from this library.

Screening of the HepG2 library for cDNA clones encoding human α,M.

5 * 10" individual colonies were screened by standard colony hybridization technique using nitrocellulose filters (Maniatis et al . , (1982) 0Molecular Cloning - A Laboratory Manual, Cold Spring Harbor, New York). A 20-mer oligonucleotide mixture 5' CC(T/C)TTCAT(G/A)TC(T/C)TC(T/C)TG(T/C)TT 3' where the notation (X/Y) means that either of the nucleic acids X or Y may be used, complementary to the human α₂M mRNA in the region encoding amino 5 acid residues Lys-Gln-Glu-Asp-Met-Lys-Gly (residues number 493 - 499 in Sottrup-Jensen et al., J. Biol. Chem. 259: 8318-8327 (1984) was synthesized (on a DNA synthesizer from Applied Biosystems, USA), labelled with ^P (using T₄ polynucleotide kinase and -γ-^P-ATP) to a specific activity of 3 * 10⁸ cpm/pmol oligonucleotide. The labelled oligonucleotides were purified by gel 0 chromatography and subsequently used in the screening of the cDNA library. The hybridization solution contained 6 * SSC, 5 * Denhardt's solution, 0.05% SDS (Maniatis et al . , (1982) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor, New York) and 10⁶ cpm/ml of labelled oligo¬ nucleotide mix. 5 Hybridization was performed for 3 hrs at 45°C. Then the filters were washed in 6 * SSC, 0.05% SDS at 45^βC for 3 * 10 minutes. After-autora- diography the filters were washed under the same conditions, but this time at 52^βC. A colony that still showed hybridization at this temperature was isolated and the cDNA insert of the corresponding plasmid (designated pα₂M) from this isolate was sequenced (Tabor & Richardson (1987) Proc. Natl . Acad. Sci. USA 84: 4767-4771). The sequence of the cDNA and the derived encoded amino acid sequence are shown in the appended sequence listings, SEQ ID N0:1:, and SEQ ID N0:2:.

Characterization of pα-,M. pα₂M had a cDNA insert of approximately 4.6 kb. Its sequence is given in Table I above. The sequence in Table I demonstrates that the entire coding region of α₂M including the signal peptide is found in the insert.

In addition to the coding region, the insert contains sequences derived from the 5'- and 3' untranslated regions of the α₂M mRNA molecule. The amino acid sequence of the human α₂M as deduced from the cDNA in pα₂M is in total agreement with the published sequence (Sottrup-Jensen et al., (1984) J. Biol. Chem. 259: 8318-8327). Codon number 1000 (numbered from the initiating methionine codon in the signal peptide) was found to be ATC encoding an isoleucine and not GTC (encoding a valine) as found in an α₂M cDNA synthesized from human liver mRNA (Kan et al . , (1985) Proc. Natl. Acad. Sci. USA. 82: 2282-2286). In the α₂M cDNA sequence from the HepG2 library we have further identified ten silent changes as compared to the sequence from the liver library, see the following Table I:

TABLE I

The position of the oligonucleotide mixture used as a hybridiza¬ tion probe in the colony screenings was from position 1574 to position 1594, and the position of the reactive thiol ester is from position 2939 to 2953 in SEQ ID N0:1.

EXAMPLE 2.

Construction of a mammalian expression vector for α-J-l. pα₂M was digested (fig. la) with Xbal and EcoRI, and a 1.2 kb fragment containing the 5' part of the α₂M cDNA together with the multiple cloning site of pSP62-K2 was isolated on an agarose gel and cloned in an Xbal/EcoRI digested M13mpl9 vector to generate M13mpl9A. To facilitate further subclonings of the α₂M cDNA, a unique EcoRV site was introduced in the 1.2 kb fragment 10 nucleotides 5' to the initiating ATG (methionine) codon through site directed mutagenesis (Kunkel et al . , (1987) Methods Enzy ol . 154: 367-382). In the same mutagenesis experiment, in which the mutagenic oligonucleotide N0R593:

5'(TTCπCCCCATGGTGGATATCGAAGGAGCT )3' was used, the 5 nucleotides 5' to the methionine codon was changed to CCACCATG; this mutation creates a new Ncol site spanning the ATG codon. A correct mutant M13mpl9B was identified through restriction enzyme digestion and DNA sequencing.

The mutated 5' end of α₂M cDNA was isolated from M13mpl9A repli- cative form through digestion with Hindlll and EcoRI and agarose gel electro- δphoresis. The isolated DNA fragment was then joined to Hindlll/EcoRI digested pα₂M through ligation to generate pll36. In this plasmid the α₂M cDNA is reassembled in its total length, but now with a unique EcoRV site at the 5' end. pi136 was digested with EcoRV/Dral, and the α₂M fragment was isolated on an agarose gel and cloned in a mammalian expression vector under control of 0 the adenovirus 2 major late promoter (Ad 2 MLP).

The adenovirus-promoter based vector was constructed by K.L.Berk- ner (ZymoGenetics Inc., Seattle, WA.), and a detailed description of the functional elements in the mammalian expression vector is given in: Powell, J.S. et al., (1986) Proc. Natl. Acad. Sci. USA 83: 6465-6469 and in: Boel 5 et al., (1987) FEBS Lett. 219: 181-188).

The expression vector used for expression of human α₂M was generated from the mammalian expression vector pPP (Boel, E. et al . , (1987) FEBS Lett. 219: 181-188), in which human pancreatic polypeptide cDNA was cloned under control of Ad 2 MLP. 0 pPP was digested (fig. lb) with BamHI and the resulting stag¬ gered ends were repaired with DNA polymerase (Klenow fragment and the four deoxynucleotide triphosphates). The 4.5 kb EcoRV/Dral α₂M cDNA fragment was joined to this vector through ligation, and correct recombinants were characterized through restriction enzyme analysis on isolated iniprep. 5 plasmids.

The α₂M-mRNA transcribed from the resulting 8.76 kb plasmid (designated pll67 (fig. 2)) has the adenovirus 2 late tripartite leader (Ll- 3) at its 5' end together with an mRNA splice signal (SS). At the 3' end of the construct the transcript is terminated with the SV40 late termination - 0 and polyadenylation signal. 5' to the Ad 2 MLP the construct includes the SV40 enhancer (ENH) and the 0 to 1 (0 - 1) map units from adenovirus 5.

Expression of α_?M in mammalian cells.

For expression of human α₂M in cultured BHK cells (Syrian Hamster 5Kidney, thymidine kinase mutant line tk^''sl3, (Waechter and Baserga (1982) Proc. Natl. Acad. Sci. USA 79: 1106-1110); American Type Culture Collection CRL 1632) the expression vector pll67 was co-transfected with pDHFR-I (Berk- ner, K.L. and Sharp, P.A. (1984) Nucleic Acids Res.12: 1925-1941. Available from K.L.Berkner, ZymoGenetics Inc. Seattle) into subconfluent cells by the calcium phosphate mediated transfection procedure (Graham and Van der Eb (1973) Virology 52: 456-467). In the transfect.ion experiment the molar ratio between pi167 and pDHFR-I was 10:1. Cells were grown in Dulbeccos Modified Eagle Medium supplemented with 10% fetal calf serum (FCS). Forty-eight hours after transfection, cells were trypsinized and diluted into medium containing 400 nM ethotrexate (MTX). After 10 to 12 days, individual colonies were cloned out and expanded separately. The expanded cultures were propagated for 24 hours as described above, and producer clones were identified using an enzyme linked immunosorbent assays (ELISA) (Munck Petersen C, et al., (1985) Scand. J. Clin. Lab. Invest. 45: 735-740) against human α₂M secreted to the growth medium.

Description of the α,M ELISA assay.

The materials used in the ELISA were: Catching antibody A033 anti-α₂M,

Peroxidase-conjugated anti-α₂M antibody PE326,

1,2-Phenylenediamine, dihydrochloride (0PD) all from DAK0PATTS A/S, Copenhagen, Denmark.

Urea peroxide, 125 g, was from Organon Teknika. 96 well ELISA plates were from NUNC, Copenhagen.

Coating buffer:

100 M carbonate buffer pH 9.6 was made up as follows:

Add 3.18 g Na₂C0₃ and 5.96 g NaHC0₃ to 1000 ml water.

Standard and sample buffer:

To 100 ml of 150 mM phosphate buffer pH 7.2 was added:

50 μl Tween 20

2 g Bovine Serum Albumin (Sigma A 7030).

Washing buffer:

10 mM sodium phosphate pH 7.4

145 M sodium chloride

0.1 % Tween 20.

Citric acid-phosphate buffer, pH 4.9:

The following reagents were added to 1000 ml of water

7.3 g citric acid

23.88 g Na₂HP0₄, 12 H₂0 0.5 ml Tween 20

The buffer was used for a maximum of 14 days, stored at 4°C.

Urea peroxide solution: 125 mg urea peroxide was dissolved in 8.93 ml water. The solution was kept in the dark at 4°C.

Coating of the plates for assay:

The 96 well plate was coated with 175 μl of the DAKO A033 antibody diluted 1:1000 in the coating buffer. The plate was incubated over night at 4°C. Before use the plate was washed 4 times in washing buffer.

Application of standards and samples:

100 μl standard or sample was added to each well. As a standar purified human α₂M, 2 mg/ml (prepared as described in: Sottrup-Jensen et al., (1983) Ann. N.Y. Acad. Sci.421: 41-60) was used. The standard curve include the following serial dilutions: 1:4000, 1:8000, 1:16000 etc. down to 1:1024000, corresponding to final concentrations from 500 μg/1 down to 1.9 μg/1. All dilutions were done in the Standard and sample buffer. The plat was incubated over night at 4^βC and then washed 4 times with wash buffe before the next step.

Addition of conjugated antibody:

100 μl of PE326, which had been diluted 1:6000 in the Standar and sample buffer, was added to each well. The plate was incubated for 2 at 20°C, and then washed 4 times with wash buffer.

Enzyme activation:

8 mg of 0PD was dissolved in 12 ml of Citric acid- phosphat buffer. To this solution 500 μl Urea peroxide solution was added and th mixture was used immediately. 100 μl of the final solution was added to eac well, and the plate was incubated in the dark for 6 in. Then 100 μl of 2 H₂S0₄ was added to each well and the A^ was read in an automated ELISA plat reader.

The above described ELISA did not give any background on mediu supplemented with 10% FCS, nor did it give any background in BHK cel conditioned medium. Of 24 isolated MTX resistant clones, 16 produce detectable amounts of recombinant α₂M. Selected cell lines that secreted 12.3 mg/1 (K16-6) and 19.1 mg/1 (K17-6) in the supernatant (grown in a 6 well NUNC-plate) over a 48 hour period were expanded for large scale production of recombinant human α₂M (rα₂M).

Purification of recombinant human α,M.

Cell lines K16-6 and K17-6 were each expanded into one ten- double tray (NUNC, Denmark) with a growth surface of 6000 cm². At 80% confluency the medium on the cells was changed from containing the 10% fetal calf serum (FCS) down to 2%. After 48 hours of growth in medium with only 2% (FCS), the medium was removed, and the cells were washed twice with serum free medium. Cells were then grown serum free for 4 to 5 days with change of serum free medium every two days. Conditioned medium was pooled and analyzed for rα₂M by ELISA. The pooled conditioned medium from K16-6 and from K17-6 contained 7.15 mg/1 and 21.5 mg/1 of rα₂M, respectively.

The rα₂M was purified according to published procedures (Sottrup- Jensen et al., (1983) Ann. N. Y. Acad. Sci. 421: 41-60). Briefly the conditioned medium was loaded onto a 10 ml Zn-Chelate column (Zn²⁺- iminodiacetic acid Sepharose 4B (Porath, J. et al . , (1975) Nature 258: 598- 599) equilibrated with 25 mM Tris-HCl pH 8.0, and washed with 100 ml phosphate buffered saline (PBS) pH 7.2 until A₂₈₀ < 0.036. A second wash with 20 mM sodium phosphate, 500 mM NaCl pH 6.2 was performed until A_2β0 < 0.033. The flow rate was 100 ml/hr and 3 ml fractions were collected. rα₂M was eluted with 100 mM EDTA pH 7.0 at a flow rate of 40 ml/hr. During elution 1 ml fractions were collected.

Recovery of rα₂M was 44%. The rα₂M containing fractions were con¬ centrated to 1 ml on an Amicon devise equipped with a PM 10 membrane and then loaded onto a Superose 12 gelfiltration column (25 M Tris-HCl, 150 M NaCl pH 8.0). The rα₂M containing fractions were pooled and stored at -20°C until analysis.

EXAMPLE 3.

Characterization of recombinant human rα_?M.

A. Chemical reactions at the thiol ester: thermal fragmentation and methylamine induced cleavage. A number of different analyses were performed to evaluate the structural and biological characteristics of the human rα₂M as compared to a preparation of human plasma derived α₂M, designated preparation LSJ39.

An important structural feature of α₂M is the presence of the 5 thiol ester. When heated to 95^βC for 15 min, the thiol ester will induce a peptide bond cleavage in the backbone of α₂M at the position of the thiol esterified Glx-residue. This results in the fragmentation of the 180 kD α₂M monomer into two polypeptides of 120 kD and 60 kD. Fig. 3 shows an analysis of both the purified rα₂M (from two transformed BHK cell lines) and the

10 purified human plasma derived preparation LSJ39 on a 10-20% SDS polyacryl- amide gel. The different preparations, either native human or BHK cell derived recombinant α₂M were all heat treated to induce thermal fragmenta¬ tion before loading onto the gel. Molecular weight markers (from top to bottom: 180, 120, 92, 60, 43, 26, 14 and 6 kD) were applied to lanes 1 and

158. Samples in lanes 2, 3 and 4 were not reduced before electrophoresis, while samples in lanes 5, 6 and 7 were reduced. Preparation LSJ39 was applied to lanes 2 and 5. rα₂M K16-6 was applied to lanes 3 and 6, and rα₂M K17-6 was applied to lanes 4 and 7.

It was clear from the patterns of protein fragments on the gel,

20 that both human α₂M and the two rα₂M preparations showed a considerable degree of thermal fragmentation. As expected, only the reduced samples displayed this fragmentation. In the nonreduced samples, the molecules migrated as the 360 kD dimer.

In the human plasma derived preparation LSJ39 (lane 5) a fragment

25migrating slightly faster than the 60 kD fragment could be observed. Lanes 6 and 7 indicated the presence in the recombinant material of a simila faster migrating fragment. It is possible that this fragment represented slightly underglycosylated variant of the 60 kD fragment.

Methylamine (MA) and other small nitrogen containing nucleo-

30philes will cleave the thiol ester and thereby inactivate the ester (Sottrup- Jensen, L., et al., (1980) FEBS Lett. 121: 275-280; Salvesen, G.S. et al., (1981) Biochem. J.195: 453-461). After MA induced inactivation of the thiol ester, thermal fragmentation of α₂M can no longer be observed.

Fig. 4 shows a SDS-PAGE run similar to that shown in Fig. 3 (wit

35 respect to loaded samples), in which applied α₂M and rα₂M had been pretreate with MA. From this gel it was concluded, that the thiol ester of rα₂M was jus as susceptible to cleavage with MA as the thiol ester of native α₂M. Upo reduction MA-treated α₂M and rα₂M migrated as a single 180 kD monomer species.

SUBSTITUTESHEET Lanes 5 of both Fig. 3 and 4 shoved an additional band of approximately 85 kD. When α₂M is cleaved in the bait region by proteinases present in the blood, it generates two fragments, each with a molecular weight of 85 kD. The human α₂M preparation LSJ39 (purified from serum) contained these cleavage products, while they could not be detected on this gel in the two rα₂M preparations. This indicated that the material secreted from the transformed BHK cell lines was largely native uncomplexed α₂M. Any α₂M molecules, that have reacted with proteinases are inactivated and can not form additional complexes with other proteinases. Since the BHK cell does not produce any proteinases that forms complexes with the rα₂M product, this cell is therefore well suited for production of recombinant human α₂M.

B. Reaction with trypsin.

Reaction with trypsin is a standard way of analyzing the proteinase-complex formation ability of α₂M (Sottrup-Jensen, L. (1987) in: "The Plasma Proteins" (Putnam, F.W., ed.) 2nd Ed., 5_: 191-291, Academic Press, Orlando, FL; Harpel, P.C. (1973) J. Exp. Med.138: 508-521; Harpel, P.C, et al . , (1979) J. Biol. Chem. 254: 8869-8878; Swenson, R.P. and Howard, J.B. (1979) J. Biol. Chem. 254: 4452-4456). In this reaction trypsin will cleave at its target site(s) in the bait region of α₂M, and the resulting reduced cleavage products (85 kD) will migrate as a double band. Under nonreducing conditions the trypsin-α₂M complexes will migrate as high molecular weight products.

Fig. 5 shows the result of such an analysis (performed as described (Sottrup-Jensen, L. (1987) in: "The Plasma Proteins" (Putnam, F.W., ed.) 2nd Ed., 5: 191-291, Academic Press, Orlando, FL; Harpel, P.C. (1973) J. Exp. Med. 138: 508-521; Harpel, P.C, et al . , (1979) J. Biol. Chem. 254: 8869-8878; Swenson, R.P. and Howard, J.B. (1979) J. Biol. Chem. 254: 4452- 4456)) on the native human α₂M preparation LSJ39 (lanes 2 and 5) and on rα₂M from cell lines K16-6 (lanes 3 and 6) and K17-6 (lanes 4 and 7). The samples in lanes 2, 3 and 4 were not reduced before electrophoresis, while the samples in lanes 5, 6 and 7 were. Lane 5 shows that almost all of the human native α₂M was cleaved with trypsin, while the two preparations of rα₂M were cleaved with an efficiency of approximately 80% or more. Without reduction of the complexes no low molecular weight products from the reaction between trypsin and the native α₂M or the BHK cell derived rα₂M were seen on the gel. The 85 kD fragments derived from the recombinant material migrated somewhat faster than the human standard; as mentioned above the recombinant materi¬ al might be slightly underglycosylated. When α₂M is reacted with methylamine, the thiol ester will be inactivated, and α₂M changes conformation from the "slow" form to the "fast" form (Sottrup-Jensen, L. (1987) in: The Plasma Proteins (Putnam, F.W., ed.) 2nd Ed., 5: 191-291, Academic Press, Orlando, FL; Van Leuven, F., Cassiman, J.-J. and Van Den Berghe, H. (1981) J. Biol. Chem. 256: 9016-9022). In this conformation it can no longer react rapidly with or form complexes with proteinases such as e.g. trypsin.

Fig. 6 shows the results of a set of experiments that were run in parallel to the experiments described above and shown in Fig. 5. However, before reaction with trypsin the native human α₂M and the rα₂M used in this experiment had been treated with methylamine (Sottrup-Jensen, L., et al., (1980) FEBS Lett. .121: 275-280). Under these conditions both the native α₂M and the rα₂M show a marked decrease in reactivity towards trypsin (80% or more of the α₂M and rα₂M monomers were migrating as a 180 kD polypeptide) . This indicates that trypsin does not rapidly cleave at the bait region in methylamine treated human α₂M or in BHK cell derived rα₂M.

In these types of experiments BHK cell derived rα_zM has shown characteristics similar to those of native human α₂M.

C Trypsin and methylamine induc^ed conformational change in α_?M.

As mentioned above the α₂M molecule will undergo a conformational change both through complex formation with proteinases and through methyl¬ amine induced cleavage of the thiol ester. The change in structure results in an altered mobility on rate gels (Sottrup-Jensen, L. (1987) in: The Plasma Proteins (Putnam, F.W., ed.) 2nd Ed., 5: 191-291, Academic Press, Orlando, FL; Van Leuven, F., Cassiman, J.-J. and Van Den Berghe, H. (1981) J. Biol. Chem. 256: 9016-9022); unreacted α₂M will migrate as a "slow" form, while reacted α₂M will migrate as a "fast" form.

Fig. 7 and Fig. 8 show these conformational changes, as they appear after reaction with trypsin and methylamine, respectively (analyzed on 5-10% rate gels).

Lanes 1 on both gels contain purified human pregnancy zone protein (PZP) (Sand, 0. et al . , (1985) J. Biol. Chem. 260: 15723-15735), which is known to appear in both a dimeric (D) and a tetrameric (T) configuration.

Lanes 2 on both gels contain unreacted human α₂M preparation LSJ39. Lanes 3 on both gels show the fast migrating form, resulting fro reaction with trypsin and methylamine, respectively. Lanes 4 on both gels show the unreacted rα_zM preparation K16-6, and lanes 5 show the corresponding fast forms. Lanes 6 on both gels show the unreacted rα₂M preparation K17- 6, and lanes 7 show the corresponding fast forms.

It can be concluded that both complex formation between rα₂M and trypsin and reaction of rα₂M with methylamine result in the appearance of fast migrating structures. These structures appear (as analyzed on rate gels) to be very similar to the structures obtained when human α₂M was allowed to react with trypsin and methylamine. It is also evident from these figures that the rα₂M proteins showed a migration, which, when compared to the migration of di eric and tetrameric PZP on the gels, is in agreement with the finding that these molecules are produced and secreted from the BHK cells in the active tetrameric conformation.

D. Chromatography of α,M on a Superose 6 column.

A Superose 6 column can partially resolve α₂M molecules in the dimeric configuration from molecules in the tetrameric configuration

(Sottrup-Jensen, L. unpublished). Human standard α₂M and rα₂M was analyzed on a 24 ml Superose 6 column (buffer: 25 mM Tris-HCl, 125 mM NaCl pH 8.0; flow rate: 1 ml/min; fraction size: 1 ml). Fig. 9 shows the diagrams obtained from the chromatography of purified human standard α₂M and rα₂M from the K17- 6 and the K16-6 BHK cell lines. Tetrameric α₂M (Sottrup-Jensen, unpublished observation) will elute in fraction 12 on this type of column. It is evident from the chromatograms that both of the rα₂M preparations eluted in fraction

12, as did the human standard α₂M. On this type of column, dimeric α₂M molecules will elute in fraction 14 and 15 (Sottrup-Jensen, unpublished observation). This type of analysis supported the results obtained from the rate gels (Figs. 7 and 8), that rα₂M was secreted from BHK cells in a tetrameric configuration.

E. Trypsin protection analysis. When trypsin is trapped inside the α₂M molecule, it retains its catalytic capacity towards low molecular weight substrates such as S-2222 (N-benzoyl-L-Ile-L-Glu-Gly-L-Arg-p-nitroanilide), If trypsin is efficiently complexed with α₂M, it will be protected against high molecular weight inhibitors such as Soybean Trypsin Inhibitor (STI) (Sottrup-Jensen, L. (1987) in: The Plasma Proteins (Putnam, F.W., ed.) 2nd Ed., 5: 191-291, Academic Press, Orlando, FL; Ganrot, P.O. (1966) Clin. Chi . Acta. 14: 493-501; Sottrup-Jensen, L. et al., (1981) FEBS Lett. 1_28: 127-132).

K16-6 and K17-6 derived rα₂M was compared with human plasma α₂M in such a protection assay. 100 μl α₂M (in 25 mM Tris-HCl, 125 mM NaCl , pH 8.0) was mixed with 30 μl trypsin (0.5 mg/ml in 20 mM sodium acetate pH 5.0). After incubating for 2 min. 30 μl 1 mg/ml STI (in PBS) was added. 10 μl ali- quots were removed after 2 and 4 min. and each mixed with 750 μl 0.12 mM S- 2222 (dissolved 0.1 M sodiumphosphate pH 8.0, 5% dimethylsulfoxide) . The change in absorbance at 405 nm was recorded for 2 min. The results of the assay are given in the following Table II:

Human LSJ39 0.140 5.00 0.028

K16-6 0.111 4.62 0.024

K17-6 0.119 4.87 0.024

From these results it can be concluded that rα₂M had essential¬ ly the same protection capacity for trypsin against STI as compared with the protection capacity of human plasma α₂M.

If α₂M is treated with methylamine before the protection assay, the protection capacity drops dramatically. In a similar assay as that described above, methylamine treated human plasma α₂M only retained 17% of its protection capacity, while K16-6 and K17-6 rα₂M retained 16% and 14% respectively. It can be concluded that rα₂M protected trypsin against STI with almost the same efficiency as did human plasma α₂M.

E. Amino terminal amino acid sequencing of rα,M.

Theoretically, the α₂M characterized in the present investiga¬ tion could only be either bovine (contaminant from serum), from hamster (endogenous product from the BHK cell) or derived from expression of the transfected plasmid pll67. The ELISA assay used never recognized any α₂M in BHK cell conditioned medium, whether with or without added fetal calf serum. To make sure that the investigated α₂M was human α₂M, and to characterize the amino terminal processing of the recombinant product, amino terminal amino acid sequence determination was carried on out K16-6 and K17-6 rα₂M as described (Sottrup-Jensen, L. et al., (1984) J. Biol. Chem. 259: 8293-8303). The Edman degradation was repeated for 12 cycles, and the identity of the detected amino acid derivative in each cycle, was in total agreement with the amino terminal sequence of human α₂M: Ser-Val-Ser-Gly-Lys-Pro-Gln-Tyr-Met- Val-Leu-Val-, whereas bovine α₂M has the following amino terminal sequence: Ala-Val-Asp-Gly-Lys-Pro-Gln-Tyr-Met-Val-Leu-Val- (unpublished, Dr. Torsten Kristensen, Department of Molecular Biology, University of Aarhus, Denmark.)

EXAMPLE 4. Construction and expression of a bait region mutant of human α_?M.

In the present example it is demonstrated that the bait region of human α₂M can be substituted by the bait region of human pregnancy zone protein (PZP) (Sottrup Jensen, L., Folkersen, J., Kristensen, T. and Tack, B.F. Partial primary structure of human pregnancy zone protein: extensive sequence homology with human alpha 2-macroglobul n. Proc. Natl. Acad. Sci. U.S.A. 81. 7353-7357, 1984; Sand, 0., Folkersen, J., Westergaard, J.G. and Sottrup Jensen, L. Characterization of human pregnancy zone protein. Comparison with human alpha 2-macroglobulin. J.Biol.Chem. 260, 15723-15735, 1985). The resulting α₂M bait region mutant exhibited a proteinase inhibitor profile similar to that of human pregnancy zone protein.

To facilitate substitution of DNA fragments encoding the bait region of human α₂M cDNA, target sites for the restriction enzymes Pstl and SacII were introduced at the 5' and at the 3' end of the cDNA region encoding the bait region.

The human α₂M expression plasmid pll67 was digested with BamHI and Clal, and a 2660 bp fragment, which carried the central part of the human α₂M cDNA, was subcloned in the BamHI and Clal digested vector pSX191. This vector, which had previously been constructed, is a derivative of pUC19. It was constructed as described: pUC19 was digested with EcoRI and Hindlll, and a synthetic linker with the following sequence

Kpnl Pstl EcoRI Hind3 Clal Sphl BamHI AATTGGTACCCTGCAGGAATTCAAGCTTATCGATGGCATGCGGATCC - N0R781 CCATGGGACGTCCTTAAGTTCGAATAGCTACCGTACGCCTAGGTCGA - N0R782

was cloned in the digested pUC19 vector. The linker, which was an annealing product from the two synthetic oligonucleotides N0R781 and N0R782, has cohesive ends that will ligate to the EcoRI and the Hindlll sites of pUC19 in such a way that these ligation sites are not regenerated in the pSX191 vector. Thus pSX191 carried sites for Kβnl, Pstl, EcoRI, Hindlll. Clal, Sphl and BamHI.

The resulting plasmid pSX191α₂M was digested with BamHI and Hindlll, and a purified 2.6 kb BamHI/Hindlll α₂M fragment was cloned in BSTITUTE SHEET M13mpl8 to generate M13mpl8α₂M for mutagenesis by described methods. A synthetic oligonucleotide NOR973, with the following sequence:

5' (TTCATACTGCTGCAGCTGTGGACAC)3 ' was used to introduce a Pstl site at position 2102 (SEQ ID N0:1) in the cDNA sequence, and a oligonucleotide (N0R974) with the following sequence:

5'(AGCCACCCCCGCGGAGTTTACCAC)3^/ was used to introduce a SacII site at position 2271 (SEQ ID NO:1) in the cDNA sequence. These sites were chosen because they did not introduce alterations in the encoded amino acid sequence, and they were within a convenient distance of the bait region in human α₂M cDNA. Both primers were used in the same mutagenesis experiment (Kunkel , T.A., Roberts, J.D. and Zakour, R.A. Rapid and Efficient Site-Specific Mutagenesis without Phenotypic Selection. Methods in Enzvmol . 154. 367-382, 1987); dsDNA was isolated from mutated M13mpl8α₂M plaques, and the DNA was digested with the restriction enzymes Pstl and SacII. Correctly mutated recombinants, which had an insert of 160 bp, were further analyzed by DNA sequencing (Tabor, S. and Richardson, C.C DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 84, 4767-4771, 1987). A 2.6 kb BamHI/Hindlll fragment from a correct α₂M cDNA mutant (M13mpl8α₂M#212.1) was subcloned in a BamHI/Hindlll digested pUC13 vector, and a correct subclone pl308 was isolated and characterized with BamHI/Hindlll and Pstl/SacII double digestions and DNA electrophoresis.

The Pstl/SacII fragment in pl308 can be excised and replaced with a different DNA fragment, which encodes bait region variants. The resulting new variants (bait region mutants or analogs) of α₂M cDNA can be isolated as BamHI/Clal fragments and subcloned back into BamHI/Clal digested expression vector pll67.

In the present example DNA encoding the amino acids of the bait region for human PZP (Sottrup-Jensen et al . 1989, supra) was obtained fro ligation, annealing and cloning of 8 synthetic oligonucleotide...

The DNA sequence of the synthetic fragment and the encoded amin acids as inserted into the α₂M clone are given in SEQ ID N0:3, and comprises positions 2107 to 2305 and the corresponding amino acids. A P_stl site wa introduced at the 5' end in the synthetic fragment, and SacII and BamHI site were introduced at the 3' end.

This synthetic 0.2 kb DNA fragment was cloned in a Pstl/Ba H digested M13mpl8 vector for DNA sequencing. DNA from a clone containing th correct sequence was digested with Pstl and SacII, and the purified 0.2 k fragment was cloned in a Pstl/SacII digested and gel purified pl308 vector. A correct recombinant, p267PZP, was characterized with restriction enzyme digestions, and from this plasmid, bait region mutated (α₂M → PZP) cDNA was isolated as a 2.7 kb BamHI/Clal fragment and subcloned in a BamHI/Clal digested α₂M expression vector pll67. The resulting plasmid, designated pl365, was grown as a large scale plasmid preparation, purified by CsCl centrifuga- tion, and cotransfected with pDHFR-I into BHK cells.

Through this procedure the nucleotides 2102 to 2275 in SEQ ID N0:1 was removed and replaced with nucleotides 2102 to 2305 in SEQ ID N0:3.

The procedures for transfection, selection of bait region mutated α₂M (designated rα^-PZP) recombinants (with an α₂M specific ELISA), large scale production and purification of mutated α₂M were as described elsewhere (EXAMPLE 2) in this application.

Characterization of the proteinase inhibitor specificity of a bait region mutant of human α_?M.

The purified recombinant α₂M mutant, rα₂M-PZP, was characterized with respect to its inhibitor specificity profile against various proteina¬ ses by the use of previously described methods (Sand et al .1985) . For comparison human plasma derived α₂M and PZP were treated with the same set of proteinases in parallel reactions. The proteinases used were chymotryp- sin, elastase, trypsin and Staphylococcus aureus Glu-specific proteinase. It has been reported (Sand et al.1985) that chymotrypsin and elastase show a rapid reaction with both PZP and α₂M, while the reaction between the two proteinase inhibitors and trypsin and Staphylococcus aureus Glu-specific proteinase is quite dissimilar for PZP and α₂M: both proteinases react rapidly with α₂M, while the reaction with PZP is slow (Sand et al.1985). The reason for this difference in reaction rate with the different proteinases is believed to be due to the fact that the bait region in PZP contains strong specificity determinant for chymotrypsin and elastase, but none for trypsin and Staphylococcus aureus Glu-specific proteinase.

The results of the analysis is presented in figures 10 to 13. Figure 10 illustrates the gel electrophoresis (10 - 20 % reducing SDS-PAGE) of the reaction products from chymotrypsin treated human α₂M, human PZP and rα₂M-PZP. Molecular weight markers (from top to bottom: 180, 120, 92, 60, 43, 26, 14 and 6 kD) were applied to lanes 1 and 8. All samples were reduced. Lanes 2, 3 and 4 show the cleavage products obtained from reaction of chymotrypsin with human plasma derived PZP, rα₂M-PZP and human plasma derived α₂M, respectively. The ratio of proteinase to inhibitor was 1:1. Lanes 5, 6 and 7 show cleavage products from similar reactions at a ratio of 2:1 UTE SHEET between proteinase and the three tested inhibitors. In all 6 lanes cleavage products (85 kD) could be identified. This indicated that rα₂M-PZP reacted with chymotrypsin with similar characteristics as did human plasma derived α₂M and PZP.

5 Figure 11 illustrates the gel electrophoresis (10 - 20 % reducing SDS-PAGE) of the reaction products from elastase treated human α₂M, human PZP and rα₂M-PZP. Molecular weight markers were the same as applied on the gel in Fig. 2. All samples were reduced. Lanes 2, 3 and 4 show the cleavage products obtained from reaction of elastase with human plasma derived PZP,

10rα₂M-PZP and human plasma derived α₂M, respectively. The ratio of proteinase to inhibitor was 1:1. Lanes 5, 6 and 7 show cleavage products from similar reactions at a ratio of 2:1 between proteinase and the three tested inhibitors. In all 6 lanes cleavage products (85 kD) could be identified. This indicated that rα₂M-PZP reacted with elastase with similar character¬ istics as did human plasma derived α₂M and PZP.

Figure 12 illustrates the gel electrophoresis (10 - 20 % reducing SDS-PAGE) of the reaction products from trypsin treated human α₂M, human PZP and rα₂M-PZP. Molecular weight markers were the same as applied on the gel in Fig. 2. All samples were reduced. Lanes 2, 3 and 4 show the cleavage

20 products obtained from reaction of trypsin with human plasma derived PZP, human plasma derived α₂M and rα₂M-PZP, respectively. The ratio of proteinase to inhibitor was 1:1. Lanes 5, 6 and 7 show cleavage products from similar reactions at a ratio of 2:1 between proteinase and the three tested inhibitors. In lanes 3 and 6 cleavage products (85 kD) could be identified

25 from the reaction between trypsin and α₂M. In lanes 2, 4, 5 and 7 no cleavage products were observed from the reaction of trypsin with PZP and rα₂M-PZP.

This result demonstrated that rα₂M-PZP reacted poorly with trypsin as did human plasma derived PZP, while α₂M was cleaved in the reaction with trypsin.

Figure 13 illustrates the gel electrophoresis (10 - 20 % reducing

30SDS-PAGE) of the reaction products from Staphylococcus aureus Glu-specifi protease treated human α₂M, human PZP and rα₂M-PZP. Molecular weight markers were the same as applied on the gel in Fig. 2. All samples were reduced. Lanes 2, 3 and 4 show the cleavage products obtained from reaction o Staphylococcus aureus Glu-specific protease with human plasma derived PZP,

35rα₂M-PZP and human plasma derived α₂M, respectively. The ratio of proteinas to inhibitor was 1:1. Lanes 5, 6 and 7 show cleavage products from simila reactions at a ratio of 2:1 between proteinase and the three teste inhibitors. In lanes 4 and 7 cleavage products (85 kD) could be identifie from the reaction between Staphylococcus aureus Glu-specific protease an α₂M. In lanes 2, 3, 5 and 6 much less cleavage product could be identified from the reaction of this proteinase with .PZP and rα₂M-PZP. This result demonstrated that rα₂M-PZP reacted poorly with the Staphylococcus aureus proteinase as did human plasma derived PZP, while α₂M was cleaved in the reaction with this proteinase.

It can be concluded that rα₂M-PZP showed the same pattern of reaction with four proteinases as did human plasma derived PZP. This pattern of reaction was different from the corresponding pattern obtained from reaction with α₂M. Thus rα₂M-PZP has been demonstrated to have a proteinase inhibitor profile similar to native PZP and dissimilar to α₂M. Thus it has been demonstrated that the proteinase inhibitor profile of α₂M can be modulated by substitution of DNA fragments encoding the bait region.

The substitution as described in this invention did not destroy the activity of the proteinase inhibitor, and it is therefore demonstrated that functional macroglobulin hybrids can be constructed by substitutions (mutations) in the bait region. The finding will lead to the design of α₂M- derivatives with new desired proteinase specificities. No doubt, these results could be extended to other macroglobulin based hybrids, in which the bait region can be modified at will to obtain new inhibitor specificities. Aggressive activity of proteinases is often a problem in relation to various diseases (e.g. the activity of elastase and cathepsin G in severe inflammation leads to tissue and organ destruction and failure). Inhibitors of such proteinases will be useful in drug design. In situations where the target site for the proteinase is known, but no inhibitor can be identified, α₂M can be engineered (mutated in the bait region) to obtain the desired specificity. In a situation where the target specificity of the proteinase in question is unknown, saturation mutagenesis or random synthesis of the bait region will lead to an indefinite number of target sequences that can be introduced and expressed in hybrid macroglobulins. These hybrids can be screened for proteinase inhibition, and the target sequence(s) can be identified. The resulting α₂M analog can be produced and purified as described elsewhere in this invention. Upon injection into the circulation such α₂M analogs will inhibit and clear from the blood any proteinase of the given specificity. Introduction of protein analogs or mutants in the human body always raises the possibility for antigenicity. The generation of-a panel of 45 mouse monoclonal antibodies against human α₂M has been described (Van Leuven et al.1988; Delain et al.1988). None of these antibodies were directed against the bait region. This indicates that the bait region is not highly antigenic and that mutants in this region of the molecule can be generated and used for therapeutical uses without risk for antibody development.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Novo Nordisk A/S

(ii) TITLE OF INVENTION: Expression of Plasma Glycoproteins (iii) NUMBER OF SEQUENCES: 4

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Novo Nordisk A/S, Patent Department

(B) STREET: Novo Alle

(C) CITY: Bagsvaerd

(E) COUNTRY: DENMARK

(F) ZIP: DK-2880

(vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: DK 4235/89, DK 4236/89, DK 4237/89

(B) FILING DATE: 29-AUG-1989

(2) INFORMATION FOR SEQ ID N0:1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4569 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA

(iii) HYPOTHETICAL: N

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(F) TISSUE TYPE: Hepatic

(G) CELL TYPE: Hepatoblastoma (H) CELL LINE: HepG2

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 29..4450 (D) OTHER INFORMATION:

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:1:

GTCTCCTCCA GCTCCTTCTT TCTGCAAC ATG GGG AAG AAC AAA CTC CTT CAT 52

Met Gly Lys Asn Lys Leu Leu His 1 5

CCA AGT CTG GH CTT CTC CTC TTG GTC CTC CTG CCC ACA GAC GCC TCA 100 Pro Ser Leu Val Leu Leu Leu Leu Val Leu Leu Pro Thr Asp Ala Ser 10 15 20 GTC TCT GGA AAA CCG CAG TAT ATG GTT CTG GTC CCC TCC CTG CTC CAC 148 Val Ser Gly Lys Pro Gin Tyr Met Val Leu Val Pro Ser Leu Leu His 25 30 35 40

ACT GAG ACC ACT GAG AAG GGC TGT GTC CTT CTG AGC TAC CTG AAT GAG 196 Thr Glu Thr Thr Glu Lys Gly Cys Val Leu Leu Ser Tyr Leu Asn Glu 45 50 55

ACA GTG ACT GTA AGT GCT TCC TTG GAG TCT GTC AGG GGA AAC AGG AGC 244 Thr Val Thr Val Ser Ala Ser Leu Glu Ser Val Arg Gly Asn Arg Ser 60 65 70

CTC TTC ACT GAC CTG GAG GCG GAG AAT GAC GTA CTC CAC TGT GTC GCC 292 Leu Phe Thr Asp Leu Glu Ala Glu Asn Asp Val Leu His Cys Val Ala 75 80 85

TTC GCT GTC CCA AAG TCT TCA TCC AAT GAG GAG GTA ATG TTC CTC ACT 340 Phe Ala Val Pro Lys Ser Ser Ser Asn Glu Glu Val Met Phe Leu Thr 90 95 100

GTC CAA GTG AAA GGA CCA ACC CAA GAA TTT AAG AAG CGG ACC ACA GTG 388 Val Gin Val Lys Gly Pro Thr Gin Glu Phe Lys Lys Arg Thr Thr Val 105 110 115 120

ATG GTT AAG AAC GAG GAC AGT CTG GTC TTT GTC CAG ACA GAC AAA TCA 436 Met Val Lys Asn Glu Asp Ser Leu Val Phe Val Gin Thr Asp Lys Ser 125 130 135

ATC TAC AAA CCA GGG CAG ACA GTG AAA TTT CGT GTT GTC TCC ATG GAT 484 He Tyr Lys Pro Gly Gin Thr Val Lys Phe Arg Val Val Ser Met Asp 140 145 150

GAA AAC TTT CAC CCC CTG AAT GAG TTG ATT CCA CTA GTA TAC ATT CAG 532 Glu Asn Phe His Pro Leu Asn Glu Leu He Pro Leu Val Tyr He Gin 155 160 165

GAT CCC AAA GGA AAT CGC ATC GCA CAA TGG CAG AGT TTC CAG TTA GAG 580 Asp Pro Lys Gly Asn Arg lie Ala Gin Trp Gin Ser Phe Gin Leu Glu 170 175 180

GGT GGC CTC AAG CAA TTT TCT TTT CCC CTC TCA TCA GAG CCC TTC CAG 628 Gly Gly Leu Lys Gin Phe Ser Phe Pro Leu Ser Ser Glu Pro Phe Gin 185 190 195 200

GGC TCC TAC AAG GTG GTG GTA CAG AAG AAA TCA GGT GGA AGG ACA GAG 676 Gly Ser Tyr Lys Val Val Val Gin Lys Lys Ser Gly Gly Arg Thr Glu 205 210 215

CAC CCT TTC ACC GTG GAG GAA TTT GTT CTT CCC AAG TTT GAA GTA CAA 724 His Pro Phe Thr Val Glu Glu Phe Val Leu Pro Lys Phe Glu Val Gin 220 225 230

GTA ACA GTG CCA AAG ATA ATC ACC ATC TTG GAA GAA GAG ATG AAT GTA 772 Val Thr Val Pro Lys He He Thr He Leu Glu Glu Glu Met Asn Val 235 240 245 TCA GTG TGT GGC CTA TAC ACA TAT GGG AAG CCT GTC CCT GGA CAT GTG 820 Ser Val Cys Gly Leu Tyr Thr Tyr Gly Lys Pro Val Pro Gly His Val 250 255 260

ACT GTG AGC ATT TGC AGA AAG TAT AGT GAC GCT TCC GAC TGC CAC GGT 868

Thr Val Ser He Cys Arg Lys Tyr Ser Asp Ala Ser Asp Cys His Gly

265 270 275 280

GAA GAT TCA CAG GCT TTC TGT GAG AAA TTC AGT GGA CAG CTA AAC AGC 916 Glu Asp Ser Gin Ala Phe Cys Glu Lys Phe Ser Gly Gin Leu Asn Ser

285 290 295

CAT GGC TGC TTC TAT CAG CAA GTA AAA ACC AAG GTC TTC CAG CTG AAG 964 His Gly Cys Phe Tyr Gin Gin Val Lys Thr Lys Val Phe Gin Leu Lys 300 305 310

AGG AAG GAG TAT GAA ATG AAA CTT CAC ACT GAG GCC CAG ATC CAA GAA 1012 Arg Lys Glu Tyr Glu Met Lys Leu His Thr Glu Ala Gin He Gin Glu 315 320 325

GAA GGA ACA GTG GTG GAA TTG ACT GGA AGG CAG TCC AGT GAA ATC ACA 1060 Glu Gly Thr Val Val Glu Leu Thr Gly Arg Gin Ser Ser Glu He Thr 330 335 340

AGA ACC ATA ACC AAA CTC TCA TTT GTG AAA GTG GAC TCA CAC TTT CGA 1108 Arg Thr He Thr Lys Leu Ser Phe Val Lys Val Asp Ser His Phe Arg 345 350 355 360

CAG GGA ATT CCC TTC TTT GGG CAG GTG CGC CTA GTA GAT GGG AAA GGC 1156 Gin Gly He Pro Phe Phe Gly Gin Val Arg Leu Val Asp Gly Lys Gly 365 370 375

GTC CCT ATA CCA AAT AAA GTC ATA TTC ATC AGA GGA AAT GAA GCA AAC 1204 Val Pro He Pro Asn Lys Val He Phe He Arg Gly Asn Glu Ala Asn 380 385 390

TAT TAC TCC AAT GCT ACC ACG GAT GAG CAT GGC CTT GTA CAG TTC TCT 1252 Tyr Tyr Ser Asn Ala Thr Thr Asp Glu His Gly Leu Val Gin Phe Ser 395 400 405

ATC AAC ACC ACC AAT GTT ATG GGT ACC TCT CTT ACT GTT AGG GTC AAT 1300 He Asn Thr Thr Asn Val Met Gly Thr Ser Leu Thr Val Arg Val Asn 410 415 420

TAC AAG GAT CGT AGT CCC TGT TAC GGC TAC CAG TGG GTG TCA GAA GAA 1348

Tyr Lys Asp Arg Ser Pro Cys Tyr Gly Tyr Gin Trp Val Ser Glu Glu

425 430 435 440

CAC GAA GAG GCA CAT CAC ACT GCT TAT CTT GTG TTC TCC CCA AGC AAG 1396 His Glu Glu Ala His His Thr Ala Tyr Leu Val Phe Ser Pro Ser Lys

445 450 455

AGC TTT GTC CAC CTT GAG CCC ATG TCT CAT GAA CTA CCC TGT GGC CAT 1444 Ser Phe Val His Leu Glu Pro Met Ser His Glu Leu Pro Cys Gly His 460 465 470 ACT CAG ACA GTC CAG GCA CAT TAT ATT CTG AAT GGA GGC ACC CTG CTG 1492 Thr Gin Thr Val Gin Ala His Tyr He Leu Asn Gly Gly Thr Leu Leu 475 480 485

GGG CTG AAG AAG CTC TCC TTC TAT TAT CTG ATA ATG GCA AAG GGA GGC 1540 Gly Leu Lys Lys Leu Ser Phe Tyr Tyr Leu He Met Ala Lys Gly Gly 490 495 500

ATT GTC CGA ACT GGG ACT CAT GGA CTG CTT GTG AAG CAG GAA GAt ATG 1588 He Val Arg Thr Gly Thr His Gly Leu Leu Val Lys Gin Glu Asp Met 505 510 515 520

AAG GGC CAT TTT TCC ATC TCA ATC CCT GTG AAG TCA GAC ATT GCT CCT 1636 Lys Gly His Phe Ser He Ser He Pro Val Lys Ser Asp He Ala Pro 525 530 535

GTC GCT CGG TTG CTC ATC TAT GCT GTT TTA CCT ACC GGG GAC GTG ATT 1684 Val Ala Arg Leu Leu He Tyr Ala Val Leu Pro Thr Gly Asp Val He 540 545 550

GGG GAT TCT GCA AAA TAT GAT GTT GAA AAT TGT CTG GCC AAC AAG GTG 1732 Gly Asp Ser Ala Lys Tyr Asp Val Glu Asn Cys Leu Ala Asn Lys Val 555 560 565

GAT TTG AGC TTC AGC CCA TCA CAA AGT CTC CCA GCC TCA CAC GCC CAC 1780 Asp Leu Ser Phe Ser Pro Ser Gin Ser Leu Pro Ala Ser His Ala His 570 575 580

CTG CGA GTC ACA GCG GCT CCT CAG TCC GTC TGC GCC CTC CGT GCT GTG 1828 Leu Arg Val Thr Ala Ala Pro Gin Ser Val Cys Ala Leu Arg Ala Val 585 590 595 600

GAC CAA AGC GTG CTG CTC ATG AAG CCT GAT GCT GAG CTC TCG GCG TCC 1876 Asp Gin Ser Val Leu Leu Met Lys Pro Asp Ala Glu Leu Ser Ala Ser 605 610 615

TCG GTT TAC A" CTG CTA CCA GAA AAG GAC CTC ACT GGC TTC CCT GGG 1924 Ser Val Tyr A_.ι Leu Leu Pro Glu Lys Asp Leu Thr Gly Phe Pro Gly 620 625 630

CCT TTG AAT GAC CAG GAC GAT GAA GAC TGC ATC AAT CGT CAT AAT GTC 1972 Pro Leu Asn Asp Gin Asp Asp Glu Asp Cys He Asn Arg His Asn Val 635 640 645

TAT ATT AAT GGA ATC ACA TAT ACT CCA GTA TCA AGT ACA AAT GAA AAG 2020 Tyr He Asn Gly He Thr Tyr Thr Pro Val Ser Ser Thr Asn Glu Lys 650 655 660

GAT ATG TAC AGC TTC CTA GAG GAC ATG GGC TTA AAG GCA TTC ACC AAC 2068 Asp Met Tyr Ser Phe Leu Glu Asp Met Gly Leu Lys Ala Phe Thr Asn 665 670 675 680

TCA AAG ATT CGT AAA CCC AAA ATG TGT CCA CAG CTT CAA CAG TAT GAA 2116 Ser Lys He Arg Lys Pro Lys Met Cys Pro Gin Leu Gin Gin Tyr Glu 685 690 695 ATG CAT GGA CCT GAA GGT CTA CGT GTA GGT πT TAT GAG TCA GAT GTA 2164 Met His Gly Pro Glu Gly Leu Arg Val Gly Phe Tyr Glu Ser Asp Val 700 705 710

ATG GGA AGA GGC CAT GCA CGC CTG GTG CAT GTT GAA GAG CCT CAC ACG 2212 Met Gly Arg Gly His Ala Arg Leu Val His Val Glu Glu Pro His Thr

715 720 725

GAG ACC GTA CGA AAG TAC TTC CCT GAG ACA TGG ATC TGG GAT TTG GTG 2260 Glu Thr Val Arg Lys Tyr Phe Pro Glu Thr Trp He Trp Asp Leu Val

730 735 740

GTG GTA AAC TCA GCA GGT GTG GCT GAG GTA GGA GTA ACA GTC CCT GAC 2308 Val Val Asn Ser Ala Gly Val Ala Glu Val Gly Val Thr Val Pro Asp 745 750 755 760

ACC ATC ACC GAG TGG AAG GCA GGG GCC TTC TGC CTG TCT GAA GAT GCT 2356 Thr He Thr Glu Trp Lys Ala Gly Ala Phe Cys Leu Ser Glu Asp Ala 765 770 775

GGA CTT GGT ATC TCT TCC ACT GCC TCT CTC CGA GCC TTC CAG CCC TTC 2404 Gly Leu Gly He Ser Ser Thr Ala Ser Leu Arg Ala Phe Gin Pro Phe 780 785 790

TTT GTG GAG CTT ACA ATG CCT TAC TCT GTG ATT CGT GGA GAG GCC TTC 2452 Phe Val Glu Leu Thr Met Pro Tyr Ser Val He Arg Gly Glu Ala Phe 795 800 805

ACA CTC AAG GCC ACG GTC CTA AAC TAC CTT CCC AAA TGC ATC CGG GTC 2500 Thr Leu Lys Ala Thr Val Leu Asn Tyr Leu Pro Lys Cys He Arg Val 810 815 820

AGT GTG CAG CTG GAA GCC TCT CCC GCC TTC CTA GCT GTC CCA GTG GAG 2548 Ser Val Gin Leu Glu Ala Ser Pro Ala Phe Leu Ala Val Pro Val Glu 825 830 835 840

AAG GAA CAA GCG CCT CAC TGC ATC TGT GCA AAC GGG CGG CAA ACT GTG 2596 Lys Glu Gin Ala Pro His Cys He Cys Ala Asn Gly Arg Gin Thr Val 845 850 855

TCC TGG GCA GTA ACC CCA AAG TCA TTA GGA AAT GTG AAT TTC ACT GTG 2644 Ser Trp Ala Val Thr Pro Lys Ser Leu Gly Asn Val Asn Phe Thr Val 860 865 870

AGC GCA GAG GCA CTA GAG TCT CAA GAG CTG TGT GGG ACT GAG GTG CCT 2692 Ser Ala Glu Ala Leu Glu Ser Gin Glu Leu Cys Gly Thr Glu Val Pro

875 880 885

TCA GTT CCT GAA CAC GGA AGG AAA GAC ACA GTC ATC AAG CCT CTG TTG 2740 Ser Val Pro Glu His Gly Arg Lys Asp Thr Val He Lys Pro Leu Leu

890 895 900

GTT GAA CCT GAA GGA CTA GAG AAG GAA ACA ACA TTC AAC TCC CTA CTT 2788 Val Glu Pro Glu Gly Leu Glu Lys Glu Thr Thr Phe Asn Ser Leu Leu 905 910 915 920 TGT CCA TCA GGT GGT GAG GTT TCT GAA GAA TTA TCC CTG AAA CTG CCA 2836 Cys Pro Ser Gly Gly Glu Val Ser Glu Glu Leu Ser Leu Lys Leu Pro 925 930 935

CCA AAT GTG GTA GAA GAA TCT GCC CGA GCT TCT GTC TCA GTT TTG GGA 2884 Pro Asn Val Val Glu Glu Ser Ala Arg Ala Ser Val Ser Val Leu Gly 940 945 950

GAC ATA TTA GGC TCT GCC ATG CAA AAC ACA CAA AAT CTT CTC CAG ATG 2932 Asp He Leu Gly Ser Ala Met Gin Asn Thr Gin Asn Leu Leu Gin Met 955 960 965

CCC TAT GGC TGT GGA GAG CAG AAT ATG GTC CTC TTT GCT CCT AAC ATC 2980 Pro Tyr Gly Cys Gly Glu Gin Asn Met Val Leu Phe Ala Pro Asn He 970 975 980

TAT GTA CTG GAT TAT CTA AAT GAA ACA CAG CAG CTT ACT CCA GAG ATC 3028 Tyr Val Leu Asp Tyr Leu Asn Glu Thr Gin Gin Leu Thr Pro Glu He 985 990 995 1000

AAG TCC AAG GCC ATT GGC TAT CTC AAC ACT GGT TAC CAG AGA CAG TTG 3076 Lys Ser Lys Ala He Gly Tyr Leu Asn Thr Gly Tyr Gin Arg Gin Leu 1005 1010 1015

AAC TAC AAA CAC TAT GAT GGC TCC TAC AGC ACC TTT GGG GAG CGA TAT 3124 Asn Tyr Lys His Tyr Asp Gly Ser Tyr Ser Thr Phe Gly Glu Arg Tyr 1020 1025 1030

GGC AGG AAC CAG GGC AAC ACC TGG CTC ACA GCC TTT GTT CTG AAG ACT 3172 Gly Arg Asn Gin Gly Asn Thr Trp Leu Thr Ala Phe Val Leu Lys Thr 1035 1040 1045

TTT GCC CAA GCT CGA GCC TAC ATC TTC ATC GAT GAA GCA CAC ATT ACC 3220 Phe Ala Gin Ala Arg Ala Tyr He Phe He Asp Glu Ala His He Thr 1050 1055 1060

CAA GCC CTC ATA TGG CTC TCC CAG AGG CAG AAG GAC AAT GGC TGT TTC 3268 Gin Ala Leu He Trp Leu Ser Gin Arg Gin Lys Asp Asn Gly Cys Phe 1065 1070 1075 1080

AGG AGC TCT GGG TCA CTG CTC AAC AAT GCC ATA AAG GGA GGA GTA GAA 3316 Arg Ser Ser Gly Ser Leu Leu Asn Asn Ala He Lys Gly Gly Val Glu 1085 1090 1095

GAT GAA GTG ACC CTC TCC GCC TAT ATC ACC ATC GCC CTT CTG GAG ATT 3364 Asp Glu Val Thr Leu Ser Ala Tyr He Thr He Ala Leu Leu Glu He 1100 1105 1110

CCT CTC ACA GTC ACT CAC CCT GTT GTC CGC AAT GCC CTG TTT TGC CTG 3412 Pro Leu Thr Val Thr His Pro Val Val Arg Asn Ala Leu Phe Cys Leu 1115 1120 1125

GAG TCA GCC TGG AAG ACA GCA CAA GAA GGG GAC CAT GGC AGC CAT GTA 3460 Glu Ser Ala Trp Lys Thr Ala Gin Glu Gly Asp His Gly Ser His Val 1130 1135 1140 TAT ACC AAA GCA CTG CTG GCC TAT GCT TTT GCC CTG GCA GGT AAC CAG 3508 Tyr Thr Lys Ala Leu Leu Ala Tyr Ala Phe Ala Leu Ala Gly Asn Gin 1145 1150 1155 ^• 1160

GAC AAG AGG AAG GAA GTA CTC AAG TCA CTT AAT GAG GAA GCT GTG AAG 3556 Asp Lys Arg Lys Glu Val Leu Lys Ser Leu Asn Glu Glu Ala Val Lys 1165 1170 1175

AAA GAC AAC TCT GTC CAT TGG GAG CGC CCT CAG AAA CCC AAG GCA CCA 3604 Lys Asp Asn Ser Val His Trp Glu Arg Pro Gin Lys Pro Lys Ala Pro 1180 1185 1190

GTG GGG CAT TTT TAC GAA CCC CAG GCT CCC TCT GCT GAG GTG GAG ATG 3652 Val Gly His Phe Tyr Glu Pro Gin Ala Pro Ser Ala Glu Val Glu Met 1195 1200 1205

ACA TCC TAT GTG CTC CTC GCT TAT CTC ACG GCC CAG CCA GCC CCA ACC 3700 Thr Ser Tyr Val Leu Leu Ala Tyr Leu Thr Ala Gin Pro Ala Pro Thr 1210 1215 1220

TCG GAG GAC CTG ACC TCT GCA ACC AAC ATC GTG AAG TGG ATC ACG AAG 3748 Ser Glu Asp Leu Thr Ser Ala Thr Asn He Val Lys Trp He Thr Lys 1225 1230 1235 1240

CAG CAG AAT GCC CAG GGC GGT TTC TCC TCC ACC CAG CAC ACA GTG GTG 3796 Gin Gin Asn Ala Gin Gly Gly Phe Ser Ser Thr Gin His Thr Val Val 1245 1250 1255

GCT CTC CAT GCT CTG TCC AAA TAT GGA GCA GCC ACA TTT ACC AGG ACT 3844 Ala Leu His Ala Leu Ser Lys Tyr Gly Ala Ala Thr Phe Thr Arg Thr 1260 1265 1270

GGG AAG GCT GCA CAG GTG ACT ATC CAG TCT TCA GGG ACA TTT TCC AGC 3892 Gly Lys Ala Ala Gin Val Thr He Gin Ser Ser Gly Thr Phe Ser Ser 1275 1280 1285

AAA TTC CAA GTG GAC AAC AAC AAC CGC CTG TTA CTG CAG CAG GTC TCA 3940 Lys Phe Gin Val Asp Asn Asn Asn Arg Leu Leu Leu Gin Gin Val Ser 1290 1295 1300

TTG CCA GAG CTG CCT GGG GAA TAC AGC ATG AAA GTG ACA GGA GAA GGA 3988 Leu Pro Glu Leu Pro Gly Glu Tyr Ser Met Lys Val Thr Gly Glu Gly 1305 1310 1315 1320

TGT GTC TAC CTC CAG ACA TCC TTG AAA TAC AAT ATT CTC CCA GAA AAG 4036 Cys Val Tyr Leu Gin Thr Ser Leu Lys Tyr Asn He Leu Pro Glu Lys 1325 1330 1335

GAA GAG TTC CCC TTT GCT TTA GGA GTG CAG ACT CTG CCT CAA ACT TGT 4084 Glu Glu Phe Pro Phe Ala Leu Gly Val Gin Thr Leu Pro Gin Thr Cys 1340 1345 1350

GAT GAA CCC AAA GCC CAC ACC AGC TTC CAA ATC TCC CTA AGT GTC AGT 4132 Asp Glu Pro Lys Ala His Thr Ser Phe Gin He Ser Leu Ser Val Ser 1355 1360 1365 TAC ACA GGG AGC CGC TCT GCC TCC AAC ATG GCG ATC GTT GAT GTG AAG 4180 Tyr Thr Gly Ser Arg Ser Ala Ser Asn Met Ala He Val Asp Val Lys 1370 1375 1380

ATG GTC TCT GGC TTC ATT CCC CTG AAG CCA ACA GTG AAA ATG CTT GAA 4228 Met /al Ser Gly Phe He Pro Leu Lys Pro Thr Val Lys Met Leu Glu 1385 1390 1395 1400

AGA TCT AAC CAT GTG AGC CGG ACA GAA GTC AGC AGC AAC CAT GTC TTG 4276 Arg Ser Asn His Val Ser Arg Thr Glu Val Ser Ser Asn His Val Leu 1405 1410 1415

ATT TAC CTT GAT AAG GTG TCA AAT CAG ACA CTG AGC TTG TTC TTC ACG 4324 He Tyr Leu Asp Lys Val Ser Asn Gin Thr Leu Ser Leu Phe Phe Thr 1420 1425 1430

GTT CTG CAA GAT GTC CCA GTA AGA GAT CTC AAA CCA GCC ATA GTG AAA 4372 Val Leu Gin Asp Val Pro Val Arg Asp Leu Lys Pro Ala He Val Lys 1435 1440 1445

GTC TAT GAT TAC TAC GAG ACG GAT GAG TTT GCA ATT GCT GAG TAC AAT 4420 Val Tyr Asp Tyr Tyr Glu Thr Asp Glu Phe Ala He Ala Glu Tyr Asn 1450 1455 1460

GCT CCT TGC AGC AAA GAT CTT GGA AAT GCT TGAAGACCAC AAGGCTGAAA 4470 Ala Pro Cys Ser Lys Asp Leu Gly Asn Ala 1465 1470

AGTGCTTTGC TGGAGTCCTG TTCTCTGAGC TCCACAGAAG ACACGTGTTT TTGTATCTTT 4530

AAAGACTTGA TGAATAAACA CTTTTTCTGG TCAAAAAAA 4569

(2) INFORMATION FOR SEQ ID N0:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1474 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(E) FEATURES: bait region: 690-730 (ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:

Met Gly Lys Asn Lys Leu Leu His Pro Ser Leu Val Leu Leu Leu Leu 1 5 10 15

Val Leu Leu Pro Thr Asp Ala Ser Val Ser Gly Lys Pro Gin Tyr Met 20 25 30

Val Leu Val Pro Ser Leu Leu His Thr Glu Thr Thr Glu Lys Gly Cys 35 40 45

Val Leu Leu Ser Tyr Leu Asn Glu Thr Val Thr Val Ser Ala Ser Leu 50 55 60

Glu Ser Val Arg Gly Asn Arg Ser Leu Phe Thr Asp Leu Glu Ala Glu 65 70 75 80 42

Asn Asp Val Leu His Cys Val Ala Phe Ala Val Pro Lys Ser Ser Ser 85 90 95

Asn Glu Glu Val Met Phe Leu Thr Val Gin Val Lys Gly Pro Thr Gin 100 105 110

Glu Phe Lys Lys Arg Thr Thr Val Met Val Lys Asn Glu Asp Ser Leu 115 120 125

Val Phe Val Gin Thr Asp Lys Ser He Tyr Lys Pro Gly Gin Thr Val 130 135 140

Lys Phe Arg Val Val Ser Met Asp Glu Asn Phe His Pro Leu Asn Glu 145 150 155 160

Leu He Pro Leu Val Tyr He Gin Asp Pro Lys Gly Asn Arg He Ala 165 170 175

Gin Trp Gin Ser Phe Gin Leu Glu Gly Gly Leu Lys Gin Phe Ser Phe 180 185 190

Pro Leu Ser Ser Glu Pro Phe Gin Gly Ser Tyr Lys Val Val Val Gin 195 200 205

Lys Lys Ser Gly Gly Arg Thr Glu His Pro Phe Thr Val Glu Glu Phe 210 215 220

Val Leu Pro Lys Phe Glu Val Gin Val Thr Val Pro Lys He He Thr 225 230 235 240

He Leu Glu Glu Glu Met Asn Val Ser Val Cys Gly Leu Tyr Thr Tyr 245 250 255

Gly Lys Pro Val Pro Gly His Val Thr Val Ser He Cys Arg Lys Tyr 260 265 270

Ser Asp Ala Ser Asp Cys His Gly Glu Asp Ser Gin Ala Phe Cys Glu 275 280 285

Lys Phe Ser Gly Gin Leu Asn Ser His Gly Cys Phe Tyr Gin Gin Val 290 295 300

Lys Thr Lys Val Phe Gin Leu Lys Arg Lys Glu Tyr Glu Met Lys Leu 305 310 315 320

His Thr Glu Ala Gin He Gin Glu Glu Gly Thr Val Val Glu Leu Thr 325 330 335

Gly Arg Gin Ser Ser Glu He Thr Arg Thr He Thr Lys Leu Ser Phe 340 345 350

Val Lys Val Asp Ser His Phe Arg Gin Gly He Pro Phe Phe Gly Gin 355 360 365

Val Arg Leu Val Asp Gly Lys Gly Val Pro He Pro Asn Lys Val He 370 375 380 Phe He Arg Gly Asn Glu Ala Asn Tyr Tyr Ser Asn Ala Thr Thr Asp 385 390 395 400

Glu His Gly Leu Val Gin Phe Ser He Asn Thr Thr Asn Val Met Gly 405 410 415

Thr Ser Leu Thr Val Arg Val Asn Tyr Lys Asp Arg Ser Pro Cys Tyr 420 425 430

Gly Tyr Gin Trp Val Ser Glu Glu His Glu Glu Ala His His Thr Ala 435 440 445

Tyr Leu Val Phe Ser Pro Ser Lys Ser Phe Val His Leu Glu Pro Met 450 455 460

Ser His Glu Leu Pro Cys Gly His Thr Gin Thr Val Gin Ala His Tyr 465 470 475 480

He Leu Asn Gly Gly Thr Leu Leu Gly Leu Lys Lys Leu Ser Phe Tyr 485 490 495

Tyr Leu He Met Ala Lys Gly Gly He Val Arg Thr Gly Thr His Gly 500 505 510

Leu Leu Val Lys Gin Glu Asp Met Lys Gly His Phe Ser He Ser He 515 520 525

Pro Val Lys Ser Asp He Ala Pro Val Ala Arg Leu Leu He Tyr Ala 530 535 540

Val Leu Pro Thr Gly Asp Val He Gly Asp Ser Ala Lys Tyr Asp Val 545 550 555 560

Glu Asn Cys Leu Ala Asn Lys Val Asp Leu Ser Phe Ser Pro Ser Gin 565 570 575

Ser Leu Pro Ala Ser His Ala His Leu Arg Val Thr Ala Ala Pro Gin 580 585 590

Ser Val Cys Ala Leu Arg Ala Val Asp Gin Ser Val Leu Leu Met Lys 595 600 605

Pro Asp Ala Glu Leu Ser Ala Ser Ser Val Tyr Asn Leu Leu Pro Glu 610 615 620

Lys Asp Leu Thr Gly Phe Pro Gly Pro Leu Asn Asp Gin Asp Asp Glu 625 630 635 640

Asp Cys He Asn Arg His Asn Val Tyr He Asn Gly He Thr Tyr Thr 645 650 655

Pro Val Ser Ser Thr Asn Glu Lys Asp Met Tyr Ser Phe Leu Glu Asp 660 665 670

Met Gly Leu Lys Ala Phe Thr Asn Ser Lys He Arg Lys Pro Lys Met 675 680 685 Cys Pro Gin Leu Gin Gin Tyr Glu Met His Gly Pro Glu Gly Leu Arg 690 695 700

Val Gly Phe Tyr Glu Ser Asp Val Met Gly Arg Gly His Ala Arg Leu 705 710 715 720

Val His Val Glu Glu Pro His Thr Glu Thr Val Arg Lys Tyr Phe Pro 725 730 735

Glu Thr Trp He Trp Asp Leu Val Val Val Asn Ser Ala Gly Val Ala 740 745 750

Glu Val Gly Val Thr Val Pro Asp Thr He Thr Glu Trp Lys Ala Gly 755 760 765

Ala Phe Cys Leu Ser Glu Asp Ala Gly Leu Gly He Ser Ser Thr Ala 770 775 780

Ser Leu Arg Ala Phe Gin Pro Phe Phe Val Glu Leu Thr Met Pro Tyr 785 790 795 800

Ser Val He Arg Gly Glu Ala Phe Thr Leu Lys Ala Thr Val Leu Asn 805 810 815

Tyr Leu Pro Lys Cys He Arg Val Ser Val Gin Leu Glu Ala Ser Pro 820 825 830

Ala Phe Leu Ala Val Pro Val Glu Lys Glu Gin Ala Pro His Cys He 835 840 845

Cys Ala Asn Gly Arg Gin Thr Val Ser Trp Ala Val Thr Pro Lys Ser 850 855 860

Leu Gly Asn Val Asn Phe Thr Val Ser Ala Glu Ala Leu Glu Ser Gin 865 870 875 880

Glu Leu Cys Gly Thr Glu Val Pro Ser Val Pro Glu His Gly Arg Lys 885 890 895

Asp Thr Val He Lys Pro Leu Leu Val Glu Pro Glu Gly Leu Glu Lys 900 905 910

Glu Thr Thr Phe Asn Ser Leu Leu Cys Pro Ser Gly Gly Glu Val Ser 915 920 925

Glu Glu Leu Ser Leu Lys Leu Pro Pro Asn Val Val Glu Glu Ser Ala 930 935 940

Arg Ala Ser Val Ser Val Leu Gly Asp He Leu Gly Ser Ala Met Gin 945 950 955 960

Asn Thr Gin Asn Leu Leu Gin Met Pro Tyr Gly Cys Gly Glu Gin Asn 965 970 975

Met Val Leu Phe Ala Pro Asn He Tyr Val Leu Asp Tyr Leu Asn Glu 980 985 990 Thr Gin Gin Leu Thr Pro Glu He Lys Ser Lys Ala He Gly Tyr Leu 995 1000 1005

Asn Thr Gly Tyr Gin Arg Gin Leu Asn Tyr Lys His Tyr Asp Gly Ser 1010 1015 1020

Tyr Ser Thr Phe Gly Glu Arg Tyr Gly Arg Asn Gin Gly Asn Thr Trp 1025 1030 1035 1040

Leu Thr Ala Phe Val Leu Lys Thr Phe Ala Gin Ala Arg Ala Tyr He 1045 1050 1055

Phe He Asp Glu Ala His He Thr Gin Ala Leu He Trp Leu Ser Gin 1060 1065 1070

Arg Gin Lys Asp Asn Gly Cys Phe Arg Ser Ser Gly Ser Leu Leu Asn 1075 1080 1085

Asn Ala He Lys Gly Gly Val Glu Asp Glu Val Thr Leu Ser Ala Tyr 1090 1095 1100

He Thr He Ala Leu Leu Glu He Pro Leu Thr Val Thr His Pro Val 1105 1110 1115 1120

Val Arg Asn Ala Leu Phe Cys Leu Glu Ser Ala Trp Lys Thr Ala Gin 1125 1130 1135

Glu Gly Asp His Gly Ser His Val Tyr Thr Lys Ala Leu Leu Ala Tyr 1140 1145 1150

Ala Phe Ala Leu Ala Gly Asn Gin Asp Lys Arg Lys Glu Val Leu Lys 1155 1160 1165

Ser Leu Asn Glu Glu Ala Val Lys Lys Asp Asn Ser Val His Trp Glu 1170 1175 1180

Arg Pro Gin Lys Pro Lys Ala Pro Val Gly His Phe Tyr Glu Pro Gin 1185 1190 1195 1200

Ala Pro Ser Ala Glu Val Glu Met Thr Ser Tyr Val Leu Leu Ala Tyr 1205 1210 1215

Leu Thr Ala Gin Pro Ala Pro Thr Ser Glu Asp Leu Thr Ser Ala Thr 1220 1225 1230

Asn He Val Lys Trp He Thr Lys Gin Gin Asn Ala Gin Gly Gly Phe 1235 1240 1245

Ser Ser Thr Gin His Thr Val Val Ala Leu His Ala Leu Ser Lys Tyr 1250 1255 1260

Gly Ala Ala Thr Phe Thr Arg Thr Gly Lys Ala Ala Gin Val Thr He 1265 1270 1275 1280

Gin Ser Ser Gly Thr Phe Ser Ser Lys Phe Gin Val Asp Asn Asn Asn 1285 1290 1295 Arg Leu Leu Leu Gin Gin Val Ser Leu Pro Glu Leu Pro Gly Glu Tyr 1300 1305 1310

Ser Met Lys Val Thr Gly Glu Gly Cys Val Tyr Leu Gin Thr Ser Leu 1315 1320 1325

Lys Tyr Asn He Leu Pro Glu Lys Glu Glu Phe Pro Phe Ala Leu Gly 1330 1335 1340

Val Gin Thr Leu Pro Gin Thr Cys Asp Glu Pro Lys Ala His Thr Ser 1345 1350 1355 1360

Phe Gin He Ser Leu Ser Val Ser Tyr Thr Gly Ser Arg Ser Ala Ser 1365 1370 1375

Asn Met Ala He Val Asp Val Lys Met Val Ser Gly Phe He Pro Leu 1380 1385 1390

Lys Pro Thr Val Lys Met Leu Glu Arg Ser Asn His Val Ser Arg Thr 1395 1400 1405

Glu Val Ser Ser Asn His Val Leu He Tyr Leu Asp Lys Val Ser Asn 1410 1415 1420

Gin Thr Leu Ser Leu Phe Phe Thr Val Leu Gin Asp Val Pro Val Arg 1425 1430 1435 1440

Asp Leu Lys Pro Ala He Val Lys Val Tyr Asp Tyr Tyr Glu Thr Asp 1445 1450 1455

Glu Phe Ala He Ala Glu Tyr Asn Ala Pro Cys Ser Lys Asp Leu Gly 1460 1465 1470

Asn Ala

(2) INFORMATION FOR SEQ ID N0:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4599 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA to mRNA

(iii) HYPOTHETICAL: Y

(iv) ANTI-SENSE: N

(vi) ORIGINAL SOURCE:

(A) ORGANISM: Homo sapiens

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 29..4480 (D) OTHER INFORMATION: ( ix) FEATURE:

(A) NAME/KEY: insertion_seq

(B) LOCATION: 2102..2305 (D) OTHER INFORMATION:

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

GTCTCCTCCA GCTCCTTCTT TCTGCAAC ATG GGG AAG AAC AAA CTC CTT CAT 52

Met Gly Lys Asn Lys Leu Leu His 1 5

CCA AGT CTG GTT CTT CTC CTC TTG GTC CTC CTG CCC ACA GAC GCC TCA 100 Pro Ser Leu Val Leu Leu Leu Leu Val Leu Leu Pro Thr Asp Ala Ser 10 15 20

GTC TCT GGA AAA CCG CAG TAT ATG GTT CTG GTC CCC TCC CTG CTC CAC 148 Val Ser Gly Lys Pro Gin Tyr Met Val Leu Val Pro Ser Leu Leu His 25 30 35 40

ACT GAG ACC ACT GAG AAG GGC TGT GTC CTT CTG AGC TAC CTG AAT GAG 196 Thr Glu Thr Thr Glu Lys Gly Cys Val Leu Leu Ser Tyr Leu Asn Glu 45 50 55

ACA GTG ACT GTA AGT GCT TCC TTG GAG TCT GTC AGG GGA AAC AGG AGC 244 Thr Val Thr Val Ser Ala Ser Leu Glu Ser Val Arg Gly Asn Arg Ser 60 65 70

CTC TTC ACT GAC CTG GAG GCG GAG AAT GAC GTA CTC CAC TGT GTC GCC 292 Leu Phe Thr Asp Leu Glu Ala Glu Asn Asp Val Leu His Cys Val Ala 75 80 85

TTC GCT GTC CCA AAG TCT TCA TCC AAT GAG GAG GTA ATG TTC CTC ACT 340 Phe Ala Val Pro Lys Ser Ser Ser Asn Glu Glu Val Met Phe Leu Thr 90 95 100

GTC CAA GTG AAA GGA CCA ACC CAA GAA TTT AAG AAG CGG ACC ACA GTG 388 Val Gin Val Lys Gly Pro Thr Gin Glu Phe Lys Lys Arg Thr Thr Val 105 110 115 120

ATG GTT AAG AAC GAG GAC AGT CTG GTC TTT GTC CAG ACA GAC AAA TCA 436 Met Val Lys Asn Glu Asp Ser Leu Val Phe Val Gin Thr Asp Lys Ser 125 130 135

ATC TAC AAA CCA GGG CAG ACA GTG AAA TTT CGT GTT GTC TCC ATG GAT 484 He Tyr Lys Pro Gly Gin Thr Val Lys Phe Arg Val Val Ser Met Asp 140 145 150

GAA AAC TTT CAC CCC CTG AAT GAG TTG ATT CCA CTA GTA TAC ATT CAG 532 Glu Asn Phe His Pro Leu Asn Glu Leu He Pro Leu Val Tyr He Gin 155 160 165

GAT CCC AAA GGA AAT CGC ATC GCA CAA TGG CAG AGT TTC CAG TTA GAG 580 Asp Pro Lys Gly Asn Arg He Ala Gin Trp Gin Ser Phe Gin Leu Glu 170 175 180 GGT GGC CTC AAG CAA TTT TCT TTT CCC CTC TCA TCA GAG CCC TTC CAG 628 Gly Gly Leu Lys Gin Phe Ser Phe Pro Leu Ser Ser Glu Pro Phe Gin 185 190 195 ^■ 200

GGC TCC TAC AAG GTG GTG GTA CAG AAG AAA TCA GGT GGA AGG ACA GAG 676 Gly Ser Tyr Lys Val Val Val Gin Lys Lys Ser Gly Gly Arg Thr Glu 205 210 215

CAC CCT TTC ACC GTG GAG GAA TTT GTT CTT CCC AAG TTT GAA GTA CAA 724 His Pro Phe Thr Val Glu Glu Phe Val Leu Pro Lys Phe Glu Val Gin 220 225 230

GTA ACA GTG CCA AAG ATA ATC ACC ATC TTG GAA GAA GAG ATG AAT GTA 772 Val Thr Val Pro Lys He He Thr He Leu Glu Glu Glu Met Asn Val 235 240 245

TCA GTG TGT GGC CTA TAC ACA TAT GGG AAG CCT GTC CCT GGA CAT GTG 820 Ser Val Cys Gly Leu Tyr Thr Tyr Gly Lys Pro Val Pro Gly His Val 250 255 260

ACT GTG AGC ATT TGC AGA AAG TAT AGT GAC GCT TCC GAC TGC CAC GGT 868 Thr Val Ser He Cys Arg Lys Tyr Ser Asp Ala Ser Asp Cys His Gly 265 270 275 280

GAA GAT TCA CAG GCT TTC TGT GAG AAA TTC AGT GGA CAG CTA AAC AGC 916 Glu Asp Ser Gin Ala Phe Cys Glu Lys Phe Ser Gly Gin Leu Asn Ser 285 290 295

CAT GGC TGC TTC TAT CAG CAA GTA AAA ACC AAG GTC TTC CAG CTG AAG 964 His Gly Cys Phe Tyr Gin Gin Val Lys Thr Lys Val Phe Gin Leu Lys 300 305 310

AGG AAG GAG TAT GAA ATG AAA CTT CAC ACT GAG GCC CAG ATC CAA GAA 1012 Arg Lys Glu Tyr Glu Met Lys Leu His Thr Glu Ala Gin He Gin Glu 315 320 325

GAA GGA ACA GTG GTG GAA TTG ACT GGA AGG CAG TCC AGT GAA ATC ACA 1060 Glu Gly Thr Val Val Glu Leu Thr Gly Arg Gin Ser Ser Glu He Thr 330 335 340

AGA ACC ATA ACC AAA CTC TCA TTT GTG AAA GTG GAC TCA CAC TTT CGA 1108 Arg Thr He Thr Lys Leu Ser Phe Val Lys Val Asp Ser His Phe Arg 345 350 355 360

CAG GGA ATT CCC TTC TTT GGG CAG GTG CGC CTA GTA GAT GGG AAA GGC 1156 Gin Gly He Pro Phe Phe Gly Gin Val Arg Leu Val Asp Gly Lys Gly 365 370 375

GTC CCT ATA CCA AAT AAA GTC ATA TTC ATC AGA GGA AAT GAA GCA AAC 1204 Val Pro He Pro Asn Lys Val He Phe He Arg Gly Asn Glu Ala Asn 380 385 390

TAT TAC TCC AAT GCT ACC ACG GAT GAG CAT GGC CTT GTA CAG TTC TCT 1252 Tyr Tyr Ser Asn Ala Thr Thr Asp Glu His Gly Leu Val Gin Phe Ser 395 400 405 ATC AAC ACC ACC AAT GTT ATG GGT ACC TCT CTT ACT GTT AGG GTC AAT 1300 He Asn Thr Thr Asn Val Met Gly Thr Ser Leu Thr Val Arg Val Asn 410 415 420

TAC AAG GAT CGT AGT CCC TGT TAC GGC TAC CAG TGG GTG TCA GAA GAA 1348 Tyr Lys Asp Arg Ser Pro Cys Tyr Gly Tyr Gin Trp Val Ser Glu Glu 425 430 435 440

CAC GAA GAG GCA CAT CAC ACT GCT TAT CTT GTG TTC TCC CCA AGC AAG 1396 His Glu Glu Ala His His Thr Ala Tyr Leu Val Phe Ser Pro Ser Lys 445 450 455

AGC TTT GTC CAC CTT GAG CCC ATG TCT CAT GAA CTA CCC TGT GGC CAT 1444 Ser Phe Val His Leu Glu Pro Met Ser His Glu Leu Pro Cys Gly His 460 465 470

ACT CAG ACA GTC CAG GCA CAT TAT ATT CTG AAT GGA GGC ACC CTG CTG 1492 Thr Gin Thr Val Gin Ala His Tyr He Leu Asn Gly Gly Thr Leu Leu 475 480 485

GGG CTG AAG AAG CTC TCC TTC TAT TAT CTG ATA ATG GCA AAG GGA GGC 1540 Gly Leu Lys Lys Leu Ser Phe Tyr Tyr Leu He Met Ala Lys Gly Gly 490 495 500

ATT GTC CGA ACT GGG ACT CAT GGA CTG CTT GTG AAG CAG GAA GAC ATG 1588 He Val Arg Thr Gly Thr His Gly Leu Leu Val Lys Gin Glu Asp Met 505 510 515 520

AAG GGC CAT TTT TCC ATC TCA ATC CCT GTG AAG TCA GAC ATT GCT CCT 1636 Lys Gly His Phe Ser He Ser He Pro Val Lys Ser Asp He Ala Pro 525 530 535

GTC GCT CGG TTG CTC ATC TAT GCT GTT TTA CCT ACC GGG GAC GTG ATT 1684 Val Ala Arg Leu Leu He Tyr Ala Val Leu Pro Thr Gly Asp Val He 540 545 550

GGG GAT TCT GCA AAA TAT GAT GTT GAA AAT TGT CTG GCC AAC AAG GTG 1732 Gly Asp Ser Ala Lys Tyr Asp Val Glu Asn Cys Leu Ala Asn Lys Val 555 560 565

GAT TTG AGC TTC AGC CCA TCA CAA AGT CTC CCA GCC TCA CAC GCC CAC 1780 Asp Leu Ser Phe Ser Pro Ser Gin Ser Leu Pro Ala Ser His Ala His 570 575 580

CTG CGA GTC ACA GCG GCT CCT CAG TCC GTC TGC GCC CTC CGT GCT GTG 1828 Leu Arg Val Thr Ala Ala Pro Gin Ser Val Cys Ala Leu Arg Ala Val 585 590 595 600

GAC CAA AGC GTG CTG CTC ATG AAG CCT GAT GCT GAG CTC TCG GCG TCC 1876 Asp Gin Ser Val Leu Leu Met Lys Pro Asp Ala Glu Leu Ser Ala Ser 605 610 615

TCG GTT TAC AAC CTG CTA CCA GAA AAG GAC CTC ACT GGC TTC CCT GGG 1924 Ser Val Tyr Asn Leu Leu Pro Glu Lys Asp Leu Thr Gly Phe Pro Gly 620 625 630 CCT TTG AAT GAC CAG GAC GAT GAA GAC TGC ATC AAT CGT CAT AAT GTC 1972 Pro Leu Asn Asp Gin Asp Asp Glu Asp Cys He Asn Arg His Asn Val 635 640 645

TAT ATT AAT GGA ATC ACA TAT ACT CCA GTA TCA AGT ACA AAT GAA AAG 2020 Tyr He Asn Gly He Thr Tyr Thr Pro Val Ser Ser Thr Asn Glu Lys 650 655 660

GAT ATG TAC AGC πc CTA GAG GAC ATG GGC TTA AAG GCA TTC ACC AAC 2068 Asp Met Tyr Ser Phe Leu Glu Asp Met Gly Leu Lys Ala Phe Thr Asn 665 670 675 680

TCA AAG Aπ CGT AAA CCC AAA ATG TGT CCA CAG CTG CAG TCA GTG TCA 2116 Ser Lys He Arg Lys Pro Lys Met Cys Pro Gin Leu Gin Ser Val Ser 685 690 695

GCC GGC GCC GTG GGA CAG GGA TAT TAT GGA GCC GGA CTG GGA GTG GTG 2164 Ala Gly Ala Val Gly Gin Gly Tyr Tyr Gly Ala Gly Leu Gly Val Val 700 705 710

GAG AGG CCT TAT GTG CCT CAG CTG GGT ACC TAT AAT GTG ATC CCT CTG 2212 Glu Arg Pro Tyr Val Pro Gin Leu Gly Thr Tyr Asn Val He Pro Leu 715 720 725

AAT AAT GAG CAG AGC TCA GGA CCT GTG CCT GAG ACA GTG AGG AAG TAT 2260 Asn Asn Glu Gin Ser Ser Gly Pro Val Pro Glu Thr Val Arg Lys Tyr 730 735 740

TTC CCT GAG ACA TGG ATC TGG GAT CTG GTG GTG GTG AAT TCC GCG GGT 2308 Phe Pro Glu Thr Trp He Trp Asp Leu Val Val Val Asn Ser Ala Gly 745 750 755 760

GTG GCT GAG GTA GGA GTA ACA GTC CCT GAC ACC ATC ACC GAG TGG AAG 2356 Val Ala Glu Val Gly Val Thr Val Pro Asp Thr He Thr Glu Trp Lys 765 770 775

GCA GGG GCC TTC TGC CTG TCT GAA GAT GCT GGA CTT GGT ATC TCT TCC 2404 Ala Gly Ala Phe Cys Leu Ser Glu Asp Ala Gly Leu Gly He Ser Ser 780 785 790

ACT GCC TCT CTC CGA GCC TTC CAG CCC πc TTT GTG GAG CTC ACA ATG 2452 Thr Ala Ser Leu Arg Ala Phe Gin Pro Phe Phe Val Glu Leu Thr Met 795 800 805

CCT TAC TCT GTG ATT CGT GGA GAG GCC TTC ACA CTC AAG GCC ACG GTC 2500 Pro Tyr Ser Val He Arg Gly Glu Ala Phe Thr Leu Lys Ala Thr Val 810 815 820

CTA AAC TAC CTT CCC AAA TGC ATC CGG GTC AGT GTG CAG CTG GAA GCC 2548 Leu Asn Tyr Leu Pro Lys Cys He Arg Val Ser Val Gin Leu Glu Ala 825 830 835 840

TCT CCC GCC πc CTA GCT GTC CCA GTG GAG AAG GAA CAA GCG CCT CAC 2596 Ser Pro Ala Phe Leu Ala Val Pro Val Glu Lys Glu Gin Ala Pro His 845 850 855 TGC ATC TGT GCA AAC GGG CGG CAA ACT GTG TCC TGG GCA GTA ACC CCA 2644 Cys He Cys Ala Asn Gly Arg Gin Thr Val Ser Trp Ala Val Thr Pro 860 865 870

AAG TCA TTA GGA AAT GTG AAT TTC ACT GTG AGC GCA GAG GCA CTA GAG 2692 Lys Ser Leu Gly Asn Val Asn Phe Thr Val Ser Ala Glu Ala Leu Glu 875 880 885

TCT CAA GAG CTG TGT GGG ACT GAG GTG CCT TCA GTT CCT GAA CAC GGA 2740 Ser Gin Glu Leu Cys Gly Thr Glu Val Pro Ser Val Pro Glu His Gly 890 895 900

AGG AAA GAC ACA GTC ATC AAG CCT CTG TTG GTT GAA CCT GAA GGA CTA 2788 Arg Lys Asp Thr Val He Lys Pro Leu Leu Val Glu Pro Glu Gly Leu 905 910 915 920

GAG AAG GAA ACA ACA TTC AAC TCC CTA CTT TGT CCA TCA GGT GGT GAG 2836 Glu Lys Glu Thr Thr Phe Asn Ser Leu Leu Cys Pro Ser Gly Gly Glu 925 930 935

GTT TCT GAA GAA TTA TCC CTG AAA CTG CCA CCA AAT GTG GTA GAA GAA 2884 Val Ser Glu Glu Leu Ser Leu Lys Leu Pro Pro Asn Val Val Glu Glu 940 945 950

TCT GCC CGA GCT TCT GTC TCA GTT TTG GGA GAC ATA TTA GGC TCT GCC 2932 Ser Ala Arg Ala Ser Val Ser Val Leu Gly Asp He Leu Gly Ser Ala 955 960 965

ATG CAA AAC ACA CAA AAT CTT CTC CAG ATG CCC TAT GGC TGT GGA GAG 2980 Met Gin Asn Thr Gin Asn Leu Leu Gin Met Pro Tyr Gly Cys Gly Glu 970 975 980

CAG AAT ATG GTC CTC TTT GCT CCT AAC ATC TAT GTA CTG GAT TAT CTA 3028 Gin Asn Met Val Leu Phe Ala Pro Asn He Tyr Val Leu Asp Tyr Leu 985 990 995 1000

AAT GAA ACA CAG CAG CTT ACT CCA GAG ATC AAG TCC AAG GCC ATT GGC 3076 Asn Glu Thr Gin Gin Leu Thr Pro Glu He Lys Ser Lys Ala He Gly 1005 1010 1015

TAT CTC AAC ACT GGT TAC CAG AGA CAG TTG AAC TAC AAA CAC TAT GAT 3124 Tyr Leu Asn Thr Gly Tyr Gin Arg Gin Leu Asn Tyr Lys His Tyr Asp 1020 1025 1030

GGC TCC TAC AGC ACC TTT GGG GAG CGA TAT GGC AGG AAC CAG GGC AAC 3172 Gly Ser Tyr Ser Thr Phe Gly Glu Arg Tyr Gly Arg Asn Gin Gly Asn 1035 1040 1045

ACC TGG CTC ACA GCC TTT GTT CTG AAG ACT TTT GCC CAA GCT CGA GCC 3220 Thr Trp Leu Thr Ala Phe Val Leu Lys Thr Phe Ala Gin Ala Arg Ala 1050 1055 1060

TAC ATC TTC ATC GAT GAA GCA CAC ATT ACC CAA GCC CTC ATA TGG CTC 3268 Tyr He Phe He Asp Glu Ala His He Thr Gin Ala Leu He Trp Leu 1065 1070 1075 1080 TCC CAG AGG CAG AAG GAC AAT GGC TGT TTC AGG AGC TCT GGG TCA CTG 3316 Ser Gin Arg Gin Lys Asp Asn Gly Cys Phe Arg Ser Ser Gly Ser Leu 1085 1090 1095

CTC AAC AAT GCC ATA AAG GGA GGA GTA GAA GAT GAA GTG ACC CTC TCC 3364 Leu Asn Asn Ala He Lys Gly Gly Val Glu Asp Glu Val Thr Leu Ser 1100 1105 1110

GCC TAT ATC ACC ATC GCC CTT CTG GAG ATT CCT CTC ACA GTC ACT CAC 3412 Ala Tyr He Thr He Ala Leu Leu Glu He Pro Leu Thr Val Thr His 1115 1120 1125

CCT GTT GTC CGC AAT GCC CTG TTT TGC CTG GAG TCA GCC TGG AAG ACA 3460 Pro Val Val Arg Asn Ala Leu Phe Cys Leu Glu Ser Ala Trp Lys Thr 1130 1135 1140

GCA CAA GAA GGG GAC CAT GGC AGC CAT GTA TAT ACC AAA GCA CTG CTG 3508 Ala Gin Glu Gly Asp His Gly Ser His Val Tyr Thr Lys Ala Leu Leu 1145 1150 1155 1160

GCC TAT GCT TTT GCC CTG GCA GGT AAC CAG GAC AAG AGG AAG GAA GTA 3556 Ala Tyr Ala Phe Ala Leu Ala Gly Asn Gin Asp Lys Arg Lys Glu Val 1165 1170 1175

CTC AAG TCA CTT AAT GAG GAA GCT GTG AAG AAA GAC AAC TCT GTC CAT 3604 Leu Lys Ser Leu Asn Glu Glu Ala Val Lys Lys Asp Asn Ser Val His 1180 1185 1190

TGG GAG CGC CCT CAG AAA CCC AAG GCA CCA GTG GGG CAT TTT TAC GAA 3652 Trp Glu Arg Pro Gin Lys Pro Lys Ala Pro Val Gly His Phe Tyr Glu 1195 1200 1205

CCC CAG GCT CCC TCT GCT GAG GTG GAG ATG ACA TCC TAT GTG CTC CTC 3700 Pro Gin Ala Pro Ser Ala Glu Val Glu Met Thr Ser Tyr Val Leu Leu 1210 1215 1220

GCT TAT CTC ACG GCC CAG CCA GCC CCA ACC TCG GAG GAC CTG ACC TCT 3748 Ala Tyr Leu Thr Ala Gin Pro Ala Pro Thr Ser Glu Asp Leu Thr Ser 1225 1230 1235 1240

GCA ACC AAC ATC GTG AAG TGG ATC ACG AAG CAG CAG AAT GCC CAG GGC 3796 Ala Thr Asn He Val Lys Trp He Thr Lys Gin Gin Asn Ala Gin Gly 1245 1250 1255

GGT TTC TCC TCC ACC CAG CAC ACA GTG GTG GCT CTC CAT GCT CTG TCC 3844 Gly Phe Ser Ser Thr Gin His Thr Val Val Ala Leu His Ala Leu Ser 1260 1265 1270

AAA TAT GGA GCA GCC ACA TTT ACC AGG ACT GGG AAG GCT GCA CAG GTG 3892 Lys Tyr Gly Ala Ala Thr Phe Thr Arg Thr Gly Lys Ala Ala Gin Val 1275 1280 1285

ACT ATC CAG TCT TCA GGG ACA TTT TCC AGC AAA TTC CAA GTG GAC AAC 3940 Thr He Gin Ser Ser Gly Thr Phe Ser Ser Lys Phe Gin Val Asp Asn 1290 1295 1300 AAC AAC CGC CTG TTA CTG CAG CAG GTC TCA TTG CCA GAG CTG CCT GGG 3988 Asn Asn Arg Leu Leu Leu Gin Gin Val Ser Leu Pro Glu Leu Pro Gly 1305 1310 1315 1320

GAA TAC AGC ATG AAA GTG ACA GGA GAA GGA TGT GTC TAC CTC CAG ACA 4036 Glu Tyr Ser Met Lys Val Thr Gly Glu Gly Cys Val Tyr Leu Gin Thr 1325 1330 1335

TCC TTG AAA TAC AAT ATT CTC CCA GAA AAG GAA GAG TTC CCC TTT GCT 4084 Ser Leu Lys Tyr Asn He Leu Pro Glu Lys Glu Glu Phe Pro Phe Ala 1340 1345 1350

TTA GGA GTG CAG ACT CTG CCT CAA ACT TGT GAT GAA CCC AAA GCC CAC 4132 Leu Gly Val Gin Thr Leu Pro Gin Thr Cys Asp Glu Pro Lys Ala His 1355 1360 1365

ACC AGC TTC CAA ATC TCC CTA AGT GTC AGT TAC ACA GGG AGC CGC TCT 4180 Thr Ser Phe Gin He Ser Leu Ser Val Ser Tyr Thr Gly Ser Arg Ser 1370 1375 1380

GCC TCC AAC ATG GCG ATC GTT GAT GTG AAG ATG GTC TCT GGC TTC ATT 4228 Ala Ser Asn Met Ala He Val Asp Val Lys Met Val Ser Gly Phe He 1385 1390 1395 1400

CCC CTG AAG CCA ACA GTG AAA ATG CTT GAA AGA TCT AAC CAT GTG AGC 4276 Pro Leu Lys Pro Thr Val Lys Met Leu Glu Arg Ser Asn His Val Ser 1405 1410 1415

CGG ACA GAA GTC AGC AGC AAC CAT GTC TTG ATT TAC CTT GAT AAG GTG 4324 Arg Thr Glu Val Ser Ser Asn His Val Leu He Tyr Leu Asp Lys Val 1420 1425 1430

TCA AAT CAG ACA CTG AGC TTG TTC TTC ACG GTT CTG CAA GAT GTC CCA 4372 Ser Asn Gin Thr Leu Ser Leu Phe Phe Thr Val Leu Gin Asp Val Pro 1435 1440 1445

GTA AGA GAT CTG AAA CCA GCC ATA GTG AAA GTC TAT GAT TAC TAC GAG 4420 Val Arg Asp Leu Lys Pro Ala He Val Lys Val Tyr Asp Tyr Tyr Glu 1450 1455 1460

ACG GAT GAG TTT GCA ATT GCT GAG TAC AAT GCT CCT TGC AGC AAA GAT 4468 Thr Asp Glu Phe Ala He Ala Glu Tyr Asn Ala Pro Cys Ser Lys Asp 1465 1470 1475 1480

CTT GGA AAT GCT TGAAGACCAC AAGGCTGAAA AGTGCTTTGC TGGAGTCCTG 4520 Leu Gly Asn Ala

TTCTCTGAGC TCCACAGAAG ACACGTGTTT TTGTATCTTT AAAGACTTGA TGAATAAACA 4580 CTTTTTCTGG TCAAAAAAA 4599

(2) INFORMATION FOR SEQ ID N0:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1484 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear (E) FEATURES: bait region: 690-740 (ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID N0:4:

Met Gly Lys Asn Lys Leu Leu His Pro Ser Leu Val Leu Leu Leu Leu 1 5 10 15

Val Leu Leu Pro Thr Asp Ala Ser Val Ser Gly Lys Pro Gin Tyr Met 20 25 30

Val Leu Val Pro Ser Leu Leu His Thr Glu Thr Thr Glu Lys Gly Cys 35 40 45

Val Leu Leu Ser Tyr Leu Asn Glu Thr Val Thr Val Ser Ala Ser Leu 50 55 60

Glu Ser Val Arg Gly Asn Arg Ser Leu Phe Thr Asp Leu Glu Ala Glu 65 70 75 80

Asn Asp Val Leu His Cys Val Ala Phe Ala Val Pro Lys Ser Ser Ser 85 90 95

Asn Glu Glu Val Met Phe Leu Thr Val Gin Val Lys Gly Pro Thr Gin 100 105 110

Glu Phe Lys Lys Arg Thr Thr Val Met Val Lys Asn Glu Asp Ser Leu 115 120 125

Val Phe Val Gin Thr Asp Lys Ser He Tyr Lys Pro Gly Gin Thr Val 130 135 140

Lys Phe Arg Val Val Ser Met Asp Glu Asn Phe His Pro Leu Asn Glu 145 150 155 160

Leu He Pro Leu Val Tyr He Gin Asp Pro Lys Gly Asn Arg He Ala 165 170 175

Gin Trp Gin Ser Phe Gin Leu Glu Gly Gly Leu Lys Gin Phe Ser Phe 180 185 190

Pro Leu Ser Ser Glu Pro Phe Gin Gly Ser Tyr Lys Val Val Val Gin 195 200 205

Lys Lys Ser Gly Gly Arg Thr Glu His Pro Phe Thr Val Glu Glu Phe 210 215 220

Val Leu Pro Lys Phe Glu Val Gin Val Thr Val Pro Lys He He Thr 225 230 235 240

He Leu Glu Glu Glu Met Asn Val Ser Val Cys Gly Leu Tyr Thr Tyr 245 250 255

Gly Lys Pro Val Pro Gly His Val Thr Val Ser He Cys Arg Lys Tyr 260 265 270 Ser Asp Ala Ser Asp Cys His Gly Glu Asp Ser Gin Ala Phe Cys Glu 275 280 285

Lys Phe Ser Gly Gin Leu Asn Ser His Gly Cys Phe Tyr Gin Gin Val 290 295 300

Lys Thr Lys Val Phe Gin Leu Lys Arg Lys Glu Tyr Glu Met Lys Leu 305 310 315 320

His Thr Glu Ala Gin He Gin Glu Glu Gly Thr Val Val Glu Leu Thr 325 330 335

Gly Arg Gin Ser Ser Glu He Thr Arg Thr He Thr Lys Leu Ser Phe 340 345 350

Val Lys Val Asp Ser His Phe Arg Gin Gly He Pro Phe Phe Gly Gin 355 360 365

Val Arg Leu Val Asp Gly Lys Gly Val Pro He Pro Asn Lys Val He 370 375 380

Phe He Arg Gly Asn Glu Ala Asn Tyr Tyr Ser Asn Ala Thr Thr Asp 385 390 395 400

Glu His Gly Leu Val Gin Phe Ser He Asn Thr Thr Asn Val Met Gly 405 410 415

Thr Ser Leu Thr Val Arg Val Asn Tyr Lys Asp Arg Ser Pro Cys Tyr 420 425 430

Gly Tyr Gin Trp Val Ser Glu Glu His Glu Glu Ala His His Thr Ala 435 440 445

Tyr Leu Val Phe Ser Pro Ser Lys Ser Phe Val His Leu Glu Pro Met 450 455 460

Ser His Glu Leu Pro Cys Gly His Thr Gin Thr Val Gin Ala His Tyr 465 470 475 480

He Leu Asn Gly Gly Thr Leu Leu Gly Leu Lys Lys Leu Ser Phe Tyr 485 490 495

Tyr Leu He Met Ala Lys Gly Gly He Val Arg Thr Gly Thr His Gly 500 505 510

Leu Leu Val Lys Gin Glu Asp Met Lys Gly His Phe Ser He Ser He 515 520 525

Pro Val Lys Ser Asp He Ala Pro Val Ala Arg Leu Leu He Tyr Ala 530 535 540

Val Leu Pro Thr Gly Asp Val He Gly Asp Ser Ala Lys Tyr Asp Val 545 550 555 560

Glu Asn Cys Leu Ala Asn Lys Val Asp Leu Ser Phe Ser Pro Ser Gin 565 570 575 Ser Leu Pro Ala Ser His Ala His Leu Arg Val Thr Ala Ala Pro Gin 580 585 590

Ser Val Cys Ala Leu Arg Ala Val Asp Gin Ser Val Leu Leu Met Lys 595 600 605

Pro Asp Ala Glu Leu Ser Ala Ser Ser Val Tyr Asn Leu Leu Pro Glu 610 615 620

Lys Asp Leu Thr Gly Phe Pro Gly Pro Leu Asn Asp Gin Asp Asp Glu 625 630 635 640

Asp Cys He Asn Arg His Asn Val Tyr He Asn Gly He Thr Tyr Thr 645 650 655

Pro Val Ser Ser Thr Asn Glu Lys Asp Met Tyr Ser Phe Leu Glu Asp 660 665 670

Met Gly Leu Lys Ala Phe Thr Asn Ser Lys He Arg Lys Pro Lys Met 675 680 685

Cys Pro Gin Leu Gin Ser Val Ser Ala Gly Ala Val Gly Gin Gly Tyr 690 695 700

Tyr Gly Ala Gly Leu Gly Val Val Glu Arg Pro Tyr Val Pro Gin Leu 705 710 715 720

Gly Thr Tyr Asn Val He Pro Leu Asn Asn Glu Gin Ser Ser Gly Pro 725 730 735

Val Pro Glu Thr Val Arg Lys Tyr Phe Pro Glu Thr Trp He Trp Asp 740 745 750

Leu Val Val Val Asn Ser Ala Gly Val Ala Glu Val Gly Val Thr Val 755 760 765

Pro Asp Thr He Thr Glu Trp Lys Ala Gly Ala Phe Cys Leu Ser Glu 770 775 780

Asp Ala Gly Leu Gly He Ser Ser Thr Ala Ser Leu Arg Ala Phe Gin 785 790 795 800

Pro Phe Phe Val Glu Leu Thr Met Pro Tyr Ser Val He Arg Gly Glu 805 810 815

Ala Phe Thr Leu Lys Ala Thr Val Leu Asn Tyr Leu Pro Lys Cys He 820 825 830

Arg Val Ser Val Gin Leu Glu Ala Ser Pro Ala Phe Leu Ala Val Pro 835 840 845

Val Glu Lys Glu Gin Ala Pro His Cys He Cys Ala Asn Gly Arg Gin 850 855 860

Thr Val Ser Trp Ala Val Thr Pro Lys Ser Leu Gly Asn Val Asn Phe 865 870 875 880 Thr Val Ser Ala Glu Ala Leu Glu Ser Gin Glu Leu Cys Gly Thr Glu 885 890 895

Val Pro Ser Val Pro Glu His Gly Arg Lys Asp Thr Val He Lys Pro 900 905 910

Leu Leu Val Glu Pro Glu Gly Leu Glu Lys Glu Thr Thr Phe Asn Ser 915 920 925

Leu Leu Cys Pro Ser Gly Gly Glu Val Ser Glu Glu Leu Ser Leu Lys 930 935 940

Leu Pro Pro Asn Val Val Glu Glu Ser Ala Arg Ala Ser Val Ser Val 945 950 955 960

Leu Gly Asp He Leu Gly Ser Ala Met Gin Asn Thr Gin Asn Leu Leu 965 970 975

Gin Met Pro Tyr Gly Cys Gly Glu Gin Asn Met Val Leu Phe Ala Pro 980 985 990

Asn He Tyr Val Leu Asp Tyr Leu Asn Glu Thr Gin Gin Leu Thr Pro 995 1000 1005

Glu He Lys Ser Lys Ala He Gly Tyr Leu Asn Thr Gly Tyr Gin Arg 1010 1015 1020

Gin Leu Asn Tyr Lys His Tyr Asp Gly Ser Tyr Ser Thr Phe Gly Glu 1025 1030 1035 1040

Arg Tyr Gly Arg Asn Gin Gly Asn Thr Trp Leu Thr Ala Phe Val Leu 1045 1050 1055

Lys Thr Phe Ala Gin Ala Arg Ala Tyr He Phe He Asp Glu Ala His 1060 1065 1070

He Thr Gin Ala Leu He Trp Leu Ser Gin Arg Gin Lys Asp Asn Gly 1075 1080 1085

Cys Phe Arg Ser Ser Gly Ser Leu Leu Asn Asn Ala He Lys Gly Gly 1090 1095 1100

Val Glu Asp Glu Val Thr Leu Ser Ala Tyr He Thr He Ala Leu Leu 1105 1110 1115 1120

Glu He Pro Leu Thr Val Thr His Pro Val Val Arg Asn Ala Leu Phe 1125 1130 1135

Cys Leu Glu Ser Ala Trp Lys Thr Ala Gin Glu Gly Asp His Gly Ser 1140 1145 1150

His Val Tyr Thr Lys Ala Leu Leu Ala Tyr Ala Phe Ala Leu Ala Gly 1155 1160 1165

Asn Gin Asp Lys Arg Lys Glu Val Leu Lys Ser Leu Asn Glu Glu Ala 1170 1175 1180 Val Lys Lys Asp Asn Ser Val His Trp Glu Arg Pro Gin Lys Pro Lys 1185 1190 1195 1200

Ala Pro Val Gly His Phe Tyr Glu Pro Gin Ala Pro Ser Ala Glu Val 1205 1210 1215

Glu Met Thr Ser Tyr Val Leu Leu Ala Tyr Leu Thr Ala Gin Pro Ala

1220 1225 1230

Pro Thr Ser Glu Asp Leu Thr Ser Ala Thr Asn He Val Lys Trp He

1235 1240 1245

Thr Lys Gin Gin Asn Ala Gin Gly Gly Phe Ser Ser Thr Gin His Thr 1250 1255 1260

Val Val Ala Leu His Ala Leu Ser Lys Tyr Gly Ala Ala Thr Phe Thr 1265 1270 1275 1280

Arg Thr Gly Lys Ala Ala Gin Val Thr He Gin Ser Ser Gly Thr Phe 1285 1290 1295

Ser Ser Lys Phe Gin Val Asp Asn Asn Asn Arg Leu Leu Leu Gin Gin 1300 1305 1310

Val Ser Leu Pro Glu Leu Pro Gly Glu Tyr Ser Met Lys Val Thr Gly 1315 1320 1325

Glu Gly Cys Val Tyr Leu Gin Thr Ser Leu Lys Tyr Asn He Leu Pro 1330 1335 1340

Glu Lys Glu Glu Phe Pro Phe Ala Leu Gly Val Gin Thr Leu Pro Gin 1345 1350 1355 1360

Thr Cys Asp Glu Pro Lys Ala His Thr Ser Phe Gin He Ser Leu Ser 1365 1370 1375

Val Ser Tyr Thr Gly Ser Arg Ser Ala Ser Asn Met Ala He Val Asp 1380 1385 1390

Val Lys Met Val Ser Gly Phe He Pro Leu Lys Pro Thr Val Lys Met 1395 1400 1405

Leu Glu Arg Ser Asn His Val Ser Arg Thr Glu Val Ser Ser Asn His 1410 1415 1420

Val Leu He Tyr Leu Asp Lys Val Ser Asn Gin Thr Leu Ser Leu Phe

1425 1430 1435 1440

Phe Thr Val Leu Gin Asp Val Pro Val Arg Asp Leu Lys Pro Ala He

1445 1450 1455

Val Lys Val Tyr Asp Tyr Tyr Glu Thr Asp Glu Phe Ala He Ala Glu 1460 1465 1470

Tyr Asn Ala Pro Cys Ser Lys Asp Leu Gly Asn Ala 1475 1480

Claims

PATENT CLAIMS

1. A process for the production of recombinant α-macroglobulin, variants, fragments or derivatives thereof, wherein a functionally operative expression vector comprising a gene encoding for the expression of α- macroglobulin, variants, fragments or derivatives thereof, or alleles of such a gene, is introduced into a suitable host capable of expressing said gene, said host is cultured in a suitable nutrient medium containing sources of assimilable carbon and nitrogen and other essential nutrients, and the expressed α-macroglobulin or fragments or derivatives thereof is recovered.

2. The process of claim 1, wherein said gene encodes for the expression of human α₂-macroglobulin, variants, fragments or derivatives thereof.

3. The process of claim 2, wherein said gene encodes for the expression of human α₂-macroglobulin having the amino acid sequence of SEQ ID N0:2, or a fragment or derivative thereof.

4. The process of claim 2 or 3, wherein said gene comprises the DNA sequence of SEQ ID N0:1, or a fragment thereof.

5. The process of claim 1 or 2, wherein said gene encodes for a variant α-macroglobulin, in which the amino acid sequence of the bait region has been altered.

6. The process of claim 5, wherein the bait region has been altered by incorporation of further proteinase target sites.

7. The process of claim 5, wherein the bait region has been altered by removal of proteinase target sites.

8. The process of claim 5, wherein the bait region has been altered by replacing one or more specific proteinase target sites with one or more other specific proteinase target sites.

9. The process of claim 8, wherein said proteinase target sites ar specific for bovine trypsin, Streptomvces griseus trypsin, papain, porcine elastase, bovine chymosin, bovine chymotrypsin, Staphylococcus aureus strain V8 proteinase, human plasmin, bovine thrombin, thermolysin, subtilisin Novo and/or Streptomvces qriseus proteinase B.

10. The process of claim 5, wherein wherein the bait region has been altered by replacing said bait region or part thereof with a bait region or a part thereof from another α-macroglobulin.

11. The process of claim 10, wherein said bait regions originate from human α₂M, Pregnancy Zone Protein (PZP), rat α,M, rat α₂M, rat α,I₃ variant 1, or rat α,I₃ variant 2 (α ₃ = α,-inhibitor 3), especially PZP.

12. The process of any of claims 5 to 11, wherein said gene encodes for the expression of human a α₂-macroglobulin variant having the amino acid sequence of SEQ ID N0:4, or a fragment or derivative thereof.

13. The process of any of claims 5 to 12, wherein said gene comprises the DNA sequence of SEQ ID N0:3, or a fragment thereof.

14. The process of any of the claims 1 to 13, wherein said gene is a synthetic gene.

15. The process of any of the claims 1 to 14, wherein said α- macroglobulin, variant, fragment or derivative thereof is co-expressed with a desired gene product.

16. The process of any of the claims 1 to 15, wherein said gene is, or is derived from, a human gene.

17. The process of any of the claims 1 to 16, wherein said host is a bacterial strain, a fungal strain, a mammalian cell line, or a mammal.

18. The process of claim 17, wherein said host is a fungus.

19. The process of claim 18, wherein said fungus belongs to the genus Asperqillus.

20 The process of claim 18, wherein said host is a yeast.

21. The process of claim 20, wherein said yeast belongs to the genus Saccharomvces.

22. The process of claim 17, wherein said host is a mammalian cell line.

23. The process of claim 22, wherein said mammalian cell line is a Syrian Baby Hamster Kidney (BKH) cell line.

24. The process of claim 23, wherein said cell line is available from ATCC under No. CRL 1632.

25. A DNA sequence comprising a gene encoding for the expression of an α-macroglobulin, variants, fragments or derivatives thereof.

26 The DNA sequence of claim 25, wherein said gene encodes for human α2-macroglobulin.

27. The DNA sequence of claim 25, wherein said gene encodes for the amino acid sequence of SEQ ID N0:2 or a fragment or derivative thereof.

28. The DNA sequence of claim 26 or 27, wherein said gene has the nucleotide sequence of SEQ ID N0:1 or a fragment thereof.

29. The DNA sequence of claim 25 or 26, wherein said gene encodes for a variant α-macroglobulin, in which the amino acid sequence of the bait region has been altered.

30. The DNA sequence of claim 29, wherein said bait region has been altered by incorporation of further proteinase target sites.

31. The DNA sequence of claim 29, wherein said bait region has been altered by removal of proteinase target sites.

32. The DNA sequence of claim 29, wherein said bait region has been altered by replacing one or more specific proteinase target sites with on or more other specific proteinase target sites.

33. The DNA sequence of claim 29, wherein, wherein said proteinase target sites are specific for bovine trypsin, Streptomvces qriseus trypsin, papain, porcine elastase, bovine chy osin, bovine chymotrypsin, Staphylococ¬ cus aureus strain V8 proteinase, human plasmin, bovine thrombin, thermoly- sin, subtilisin Novo and/or Streptomyces qriseus proteinase B.

34. The DNA sequence of claim 29, wherein the bait region has been altered by replacing said bait region or part thereof with a bait region or a part thereof from another α-macroglobulin.

35. The DNA sequence of claim 34, wherein said bait region originates from human α₂M, Pregnancy Zone Protein (PZP), rat α,M, rat α₂M, rat α,I₃ variant 1, or rat α,I₃ variant 2, especially PZP.

36. A functionally operative expression vector comprising a gene in accordance with any of the claims 25 to 35 for the expression of human α₂- macroglobulin, variants, fragments or derivatives thereof, or alleles of such a gene.

37. The vector of claim 36, further comprising regulatory elements necessary for the stable maintenance of said vector in mammalian cells.

38. The vector of claim 36 or 37, further comprising sequences providing for the processing and secretion of the expressed product.

39. The vector of any of the claims 36 to 38, further comprising one or more other genes encoding for a desired gene product.

40. A functionally operative expression vector comprising a gene encoding for the expression of an α-macroglobulin, variants, fragments or derivatives thereof, or alleles of such a gene, essentially as described.

41. A transformed host comprising a functionally operative expression vector comprising a gene encoding for the expression of human α₂-macro- globulin or fragments or derivatives thereof, or alleles of such a gene.

42. The host of claim 41, wherein said vector is the vector of any of the claims 36 to 40.

43. The host of claim 41 or 42, wherein said host is a bacterial strain, a fungal strain, a mammalian cell line, or a mammal.

44. The host of claim 43, wherein said host is a fungus.

45. The host of claim 44, wherein said fungus belongs to the genus Asperqillus.

46. The host of claim 44, wherein said host is a yeast.

47. The host of claim 46, wherein said host belongs to the genus Sac¬ charomvces.

48. The host of claim 43, wherein said host is a mammalian cell line.

49. The host of claim 48, wherein said host is a Syrian Baby Hamster Kidney (BHK) cell line.

50. The host of claim 49, wherein said cell line is available from ATCC under No. CRL 1632.

51. Recombinant human α₂-macroglobulin of SEQ ID N0:2 or SEQ ID N0:4 in an active form.

52. Recombinant α-macroglobulin, variants, fragments or derivatives thereof produced by a process of any of the claims 1 to 24.

53. Recombinant α-macroglobulin, variants, fragments or derivatives thereof of claim 52 produced by the use of a vector of any of the claims 36 to 40.

54. Recombinant α-macroglobulin, variants, fragments or derivatives thereof essentially as described.

55. Recombinant human α2-macroglobulin, variants, fragments o derivatives thereof essentially as described.

56. A growth medium comprising one or more α-macroglobulins.

57. A growth medium comprising recombinant α-macroglobulin, variants, fragments or derivatives thereof according to any of the claims 51 to 55.

58. Use of recombinant α-macroglobulin, variants, fragments or derivatives thereof according to any of the claims 51 to 55 as a protein carrier in enzyme replacement therapy.

59. Use of recombinant α-macroglobulin, variants, fragments or derivatives thereof according to any of the claims 51 to 55 as a DNA carrier in gene therapy.