HU210541A9 - Tissue plasminogen activator having zymogenic or fibrin specific properties and substituted at amino acid positions 296-299, dna molecules encoding them, vectors, and host cells - Google Patents

Description

The present invention relates to certain tissue plasminogen activator (t-PA) zimogens, to processes for the preparation of such zimogens, and to methods and compositions for use in the medical field. In addition, the invention relates to modified variants having amino acid substitutions within the protease domain of t-PA, which modifies the variant as a zymogen, i.e., relatively inactive in its single-chain form but active when converted in the presence of fibrin in the presence of fibrin, and / or even more fibrin (or plasma clot) more specific than wild-type (vt) t-PA.

2. Description of the state of the art

Plasminogen activators are enzymes that activate the zymogen plasminogen to produce the serine protease plasmin (cleaved between Arg561-Val562), which degrades various proteins, including fibrin. Plasminogen activators studied include streptokinase, a bacterial protein, urokinase, an enzyme synthesized in the kidney and other sites, originally isolated from urine, and human tissue plasminogen activator (t-PA), which is produced by cells enzyme produced.

The mechanism of action of each plasminogen activator is different: streptokinase complexes with plasminogen or plasmin to produce plasminogen activating activity; urokinase directly cleaves plasminogen; while t-PA, fibrin and plasminogen interact to produce maximal activity.

T-PA has been identified and described as a particularly important and potent novel biological therapeutic agent that has shown remarkable results in the treatment of vascular diseases, e.g. in the treatment of myocardial infarction, partly due to its high fibrin specificity and partly due to its significant in vivo ability to clot.

Although the presence of t-PA has been suggested by numerous studies in various scientific working groups, essentially pure isolates were first identified from a natural source by Collen et al., And the accompanying plasminogen activator effect was measured in vivo / 4,752,603. U.S. Pat. see also Rijken et al., J. Bioi. Chem. 256, 7035 (1981)].

Subsequently, t-PA was fully identified and characterized by DNA sequencing and deduced amino acid sequencing based on successful work using recombinant DNA technology to produce large amounts of t-PA in isolated environments. This work is described in Pennica et al., Natura 301, 214 (1983) and U.S. Patent 4,766,075. U.S. Pat.

23).

From these descriptions, it is already apparent that the t-PA molecule contains five domains (domains) that have already been defined in homologous or otherwise similar constructs that have been identified in various other proteins, e.g. trypsin, chymotrypsin, plasminogen, prothrombin, fibronectin and epidermal growth factor (EGF). These domains, named from the N-terminus of the amino acid sequence of t-PA, are named as follows: 1) the finger region (F), which is defined in many ways, from 1 to approx. The 44th amino acid region; 2) the growth region (G), defined in different ways, such as the approx. Amino acid 45 to amino acid 91 (based on EGF homology); 3) the "first hook" (OFF), which is set at approx. 92 amino acids to ca. 173. defined as an amino acid region; 4) the "second hook" (K2), which is approx. from amino acid 180, approx. defined as the region up to 261 amino acids; and 5) the so-called serine protease domain (P), which is generally defined to be about 1 to about 5 ppm. covers the region from 264 amino acids to the C-terminus of the molecule. These domains, usually adjacent to each other or separated by short "linker" regions, represent the complete amino acid sequence of 1-527 amino acids of the putative mature form of t-PA.

Different domains have been described differently in how they share certain specific biologically relevant properties. The finger domain is characterized by having at least one very important sequence which has a high binding affinity for fibrin. (This activity is believed to play an important role in the high specificity that t-PA exhibits in the clotting of fibrin-rich thrombi.) The growth factor-like region is similarly related to cell surface binding activity. The second hook region is also strongly associated with fibrin binding and the ability of fibrin to stimulate t-PA activity. The serine protease domain is responsible for the enzymatic cleavage of plasminogen, resulting in plasmin.

Despite the significant benefits associated with natural t-PA as a blood clotting agent, it is not believed that natural protein necessarily represents optimal t-PA under all conditions. Therefore, many variants of steel have been proposed and designed to enhance the specific properties of t-PA. Some of these variants overcome the disadvantages of using natural t-PA in cases where an agent with a longer half-life or slower clearance rate would be more advantageous, e.g. in the treatment of deep vein thrombosis or sequential reperfusion of infarct patients or where a single-stranded agent would be preferred.

For example, the entire finger domain or a significant one

HU 210 54! Removal of part of A9 results in a molecule that has significantly reduced fibrin-binding properties, although there is nevertheless a decrease in the total rate at which the remainder is cleared (PCT Publication No. WO 89/00197, issued January 12, 1989). published).

No. 199,574. Variants containing amino acid substitutions at the proteolytic cleavage sites have been described in

Positions 275, 276 and 277. These variants, which are preferably characterized as t-PA variants containing amino acid residues other than arginine at position 275, are referred to as protease resistant single chain t-PA variants which, unlike natural t-PA, which is single chain or in a two-chain form - resistant to protease cleavage at position 275 and consequently not metabolically converted in vivo to a two-chain form. This single-chain form is believed to have some biological and commercial benefits when it is more stable while increasing fibrin binding and fibrin stimulation relative to double-chain t-PA. Furthermore, plasminogen activators comprising a domain capable of interacting with fibrin and a protease domain of urokinase have been described; an embodiment thereof is a modified urokinase which is less prone to the formation of double-chain urokinase (see PCT Publication No. WO 88/05081, published July 14, 1988).

Further patents for modifying the cleavage site of the t-PA protease, e.g. are as follows: No. 241,209 European Patent Specification; No. 201,153 European Publication Bulletin (published in.

11 on 12); No. 233,013 European Patent Publication (published August 19, 1987); 292,009, 293,936; 293,934; European Publication Documents (published on 23.11.1988 and 1988).

July 12 and 7 December 12, 1988) and WO 88/10119. PCT Publication Document.

A 117-119., 184-186. and 448-450. glycosylated mutants exhibit greater specific activity as the molar percentage of carbohydrate is reduced (European Patent Publication No. 227,462, published July 1, 1987). This patent application further describes the use of a fibrin / fibrin degradation product assay and teaches that the t-PA molecule may be modified as described in U.S. Pat. sites, or remove up to 25 amino acids from the C-terminus. In addition, t-PA mutants with Asn119, Alal86 and Asn450 amino acids from which the N-glycosylation sites have been selectively removed by DNA modification but contain O-linked carbohydrates have been shown to be ca. is twice as effective as melanoma t-PA in an in vitro lysis assay (European Patent Publication No. 225,286, published June 10, 1987).

Substitution of amino acid 449 for t-PA with any amino acid other than arginine to modify the glycosylation site and modification of Arg 275 or the -3-amino acid residue. and the elimination of sites between sites 91 and 91 (PCT Publication No. WO 87/04722, published August 13, 1987). An amino acid substitution at position 448 of t-PA from steel to eliminate the possibility of glycosylation has been described (European Patent Publication No. 297,066, published December 28, 1988). A 448-450. and N-terminal 1-82. A combination of amino acid deletions is disclosed in WO 89/00191. PCT Application Publication (published January 12, 1989). In addition, urokinase in the Asp302Ser303-Thr3-4 region has been modified to prevent glycosylation (European Patent Publication No. 299,706, published January 18, 1989).

However, changes in glycosylation sites, particularly amino acid 117, appear to always result in a molecule with altered solubility characteristics, which may result in changes in circulatory half-life and / or fibrin-binding properties (23.09.1987). European Patent Publication No. 238,304, published on.

When the growth factor domain of t-PA was deleted, the resulting variant was still active and bound to fibrin, as reported by A.J. van Zonneveld et al. / Thrombos. Haemostas. 54 (1), 4 (1985). Various deletions within the growth factor domain have also been reported in the patent literature / see No. 241,209. European Patent Publication (des-51-87); No. 241,208 European Patent Publication (des-51-87 and des-51-173); WO 87/04722; PCT Application Publication (deletion of all or part of the N-terminal 1-91); No. 231,624 European Patent Publication (deletion of total growth factor domain); No. 242,836 European Patent Publication No. 62-269688; Japanese Publication Document (Kokai) (Deletion of all or part of the growth factor domain).

It has also been shown that t-PA can be modified both in the first hook region and in the growth factor region, resulting in an increased circulatory half-life (European Patent Publication No. 241,208, published October 10, 1987). The region between amino acids 51 and 87 (including the boundaries) can be deleted from t-PA, resulting in a variant that has a slower plasma clearance / 1 Bioi. Chem. 263: 1599-1602 (1988). Thus, t-PA can be modified in the region between the mature native t-PA 67-69 without deleterious biological properties by deleting certain amino acids or replacing one or more amino acids with different amino acids (published October 10, 1987). European Patent Publication No. 240,334).

A t-PA / urokinase hybrid which utilizes the 273-527 amino acid region of t-PA has also been described (European Patent Publication No. 290,118, published November 9, 1988).

Serpine-resistant mutants of human t-PA having alterations in the protease domain including d296-302 t-PA, R304S t-PA and R304E t-PA have been described by Madison et al. Natur 339, 721-724

EN 210 541 A9 (1989), and Ringe Dagmar (accompanying publication in the same issue).

A general review of plasminogen activators and their second-generation derivatives can be found in Harris, 1987, Protein Engineering 1,449-458. For a further review of t-PA variants, see Pannekoek et al., Fibrinolysis 2: 123-132 (1988) and Ross et al., Annaual Reports in Medicinal Chemistry, Vol. 23, Chapter 12 (1988).

Although the above descriptions provide evidence that newer and, in various respects, better t-PA agents are available, no t-PA molecules that are activated until they reach the site of the clot to be solved have not yet been described. Currently, t-PA molecules are active in the presence of fibrin and / or plasma proteins or in whole blood, either in single-chain or double-chain form. It would be desirable to have a zymogen t-PA which, in the presence of fibrin, would require its single-chain form to be linked to its two-chain form to become fully active. Such variant molecules are likely to show fewer side effects, such as. with reduced bleeding and fibrinogen-saving properties, thus providing important new alternatives for medicine in the treatment of cardiovascular disease and many other medical conditions that result from thromboembolytic blockage of blood vessels and the prevention of adhesions.

It would also be desirable to provide a t-PA molecule that has a higher level of fibrin-stimulated (or plasma-clot-stimulated) activity than wild-type t-PA than fibrinogen-stimulated (or plasma-stimulated) activity, i.e., fibrin (or plasma clot) -specific, so it will act only at the site of the clot and not systemically.

Accordingly, it is an object of the present invention to provide zymogen and / or fibrin-specific t-PA molecules which have improved therapeutic and pharmaceutical properties.

It is a further object of the present invention to provide treatment conditions that allow the use of anticoagulant agents which are active only at the site of the thrombus and can be used at a higher level than other such agents.

These and other objects of the invention will be apparent to those skilled in the art.

BRIEF SUMMARY OF THE INVENTION

The above aspects of the invention may be accomplished by providing a tissue plasminogen activator (t-PA) capable of converting into an enzymatically active form of t-PA upon plasmin cleavage. In another aspect, the invention provides a t-PA variant that contains amino acid changes at one or more sites within the t-PA protease domain relative to wild-type t-PA, which renders the molecule zymogenic with the corresponding wild-type t-PA. Relative to PA.

In one particularly preferred embodiment, t-PA is a human t-PA and the change is in the region around 305 including site 305, such as the site 305. exchange of histidine for phenylalanine at position 305 of the corresponding wild-type t-PA.

In still other embodiments, the invention relates to a DNA sequence encoding the zymogen and variant described above, replicable expression vectors capable of expressing the transformed host cell, and microorganisms and cell cultures transformed with said vectors.

In yet another embodiment, the invention provides a process comprising:

(a) introducing an amino acid variation into the protease domain of t-PA; and (b) screening the resulting t-PA variants for zymogenicity.

Another aspect of the present invention is a human tissue plasminogen activator (t-PA) variant having one or more of the following biological activities: zymogen activity, fibrin specificity or plasma clot specificity; which variant is characterized in that it contains an amino acid change in the protease domain relative to the corresponding wild-type t-PA, which is responsible for said biological activity, provided that such changes are restricted to the 270-280, 448-450 and They are outside regions 502-527. The variant in which change is a substitution is preferred.

Another aspect of the present invention is a process comprising the steps of:

(a) introducing an amino acid variation into the protease domain of the tissue plasminogen activator (t-PA), and (b) examining the resulting t-PA variants for their ability to exhibit one or more of the following biological activities: zymogenic activity , fibrin specificity or plasma clot specificity.

In further embodiments, the invention provides DNA sequences and replicable vectors encoding the above variants, and host cells transformed with them.

In yet another embodiment, the present invention is directed to a composition for treating a vascular condition or disease comprising a therapeutically effective amount of a zymogen or variant of the invention together with a pharmaceutically acceptable carrier. Also included is a composition for preventing the formation or remodeling of fibrin deposition or adhesion, which comprises a therapeutically effective amount of a zymogen or variant of the invention together with a pharmaceutically acceptable carrier.

In yet another embodiment, the invention provides a method of treating a vascular condition or disease in a mammal, comprising administering to the mammal an effective amount of a suitable composition as described above.

The invention further provides a method for treating mammalian fibrin deposition or adhesion

A method of preventing the formation of a fibrin deposition or adhesion site by administering an effective amount of a suitable composition as described above.

The present invention is based, inter alia, on particularly successful research which has shown that certain t-PA molecules are zymogens in the presence of a stimulator of t-PA activity, such as plasmin-degrading fibrinogen fragments, and thus their fibrinolytic activity is reduced when they are normally found in plasma and are activated when they are close to plasmin at the site of the blood clot. Thus, the zymogen is activated as required by specifically localized clot therapy. The zymogens of the present invention are expected to be "fibrinogen-sparing" and, thus, usually used in higher doses than their non-zymogen counterparts, resulting in faster clot dissolution and more clot dissolution.

It is a further object of the present invention to provide a t-PA molecule that is more specific to fibrin (or plasma clot) so that it acts more favorably at the site of the clot than unmodified t-PA.

DESCRIPTION OF THE FIGURES

Figure 1 depicts the structure of the t-PA primer showing the position of the five domains, the disulfide bridge formation and the activation site where the molecule is linked to a double chain molecule.

Figures 2 and 3 are schematic representations of a suitable method for the production of pCISt-PA, together with a description of certain significant restriction sites.

Figure 4 is a schematic representation of a suitable method for the production of p7-1H, together with a description of certain significant restriction sites.

FIG. shows the fibrin binding of a mixture of t-PA (open triangles) at 10 ng / ml t-PA.

6-9. Figures 3A and 4B show plots of plasminogen-plasmin conversion kinetics in the presence of plasmin-degraded fibrinogen in the predominantly single-chain wild-type t-PA (Fig. 6), in the two-chain wild-type t-PA (Fig. 8), and ) and the two-chain F305H t-PA (Figure 9). The squares, lines, and circles represent the various concentrations of plasminogen and t-PA in the assay buffer detailed at the end of Example I. In these figures, ordinate is the absorbance at 405 nm and the square of the number of minutes of absorbance at which the absorbance is measured.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS A. Definitions

As used herein, the terms "human tissue plasminogen activator", "human t-PA" and "t-PA" denote a human intrinsic (tissue-type) plasminogen activator having two functional domains consisting of a protease domain , which is capable of converting plasminogen to plasmin, and from an N-terminal region believed to be responsible for fibrin binding. These three terms therefore include polypeptides that include these functional domains as part of the entire sequence. T-PA can be properly produced, e.g. in recombinant cell culture systems, in biologically active forms containing the protease region and regions of t-PA that are otherwise native to the source of t-PA. It will be appreciated that natural allele variants also exist and occur from person to person, which are expressed in the amino acid difference (s) throughout the sequence.

As used herein, "wild-type t-PA" refers to tPA disclosed in U.S. Patent No. 4,766,075. cDNA, the disclosure of which is incorporated herein by reference. The t-PA encoded in this manner is suitably a t-PA molecule, whether native or recombinant, including 293 or 294 cells, Chinese hamster ovary cells, and the like.

As used herein, the "protease domain" refers to the region of the mature form of wild-type t-PA from amino acid 264 to amino acid 527 (including borders).

As used herein, the terms "zymogen", "zymogen", and "zymogen activity" are used to describe the t-PA of the present invention that must meet one or both of the following definitions. In the first definition, these terms mean that, in the presence of plasmin-degraded fibrinogen, t-PA requires its single-chain form to be fused to a two-chain ("enzymatically active") form in the presence of plasmin to increase its enzymatic activity. under the test conditions described below.

In the presence of fibrinogen fragments, the single chain form (zymogen) of t-PA, as defined herein, is less active, as assayed below, than wild-type two-chain t-PA, and is enzymatically converted to more active form when exposed to plasmin levels. causes a complete transformation of a single chain form to a two chain form. In general, the activity of the single-chain form is reduced to 50% or less of the activity of the double-chain, preferably to 20% or less, more preferably less than 10% of the activity; then, when coupled to the two-chain form, the activity is reduced to about 10%. It increases from 20% to more than 100%, preferably to at least 50% of the activity of the wild-type bivalent form.

The variant is assayed for enzymatic activity by determining the kinetics of the conversion of plasminogen to plasmin in the presence of fibrinogen fragments, the S-2251 chromogen.

EN 210 541 using the A9 substrate and using the assay described in Example I.

For the purposes of the present invention, zymogen, by its first definition, is a substance which exhibits a distinct lag phase in plasmin production, and thus growth in A405, and, when plotted against time squared, exhibits linear kinetics with increasing with time. Time kinetics is described in W. Nieuwenhuizen, M. Voskuilen, D. Traas, B. Hoegee-de Nobel and Verheijen J. H. Fibrinogen-Structural Variations and Interaction / editors: A. Henschen, B. Hessel, Mc Donagh J. and Saldeen T. (1985) 331-342. pages, the full teachings of which are incorporated herein by reference. Without being limited to any theory, this effect is likely due to the plasmin-catalyzed transformation of the single-chain form to the double-chain form, leading to the zymogen activation of t-PA. This is in contrast to the linear kinetics observed for wild-type single-chain tPA, wild-type two-chain t-PA, and the zymogen t-PA form from the start of the study.

In a second alternative definition, the term "zymogen" refers to a t-PA molecule that exhibits a greater difference in activity between single-chain and double-chain forms in its enzymatic activity assay than wild-type recombinant t-PA (rtPA). Preferably, the difference in zymogenic activity is at least 1.5 times that observed for wild-type rt-PA. This difference in activity can be obtained by decreasing the activity of the single-chain form to a greater extent than the double-chain form when compared to wild-type t-PA; at the same time, with growth, the activity of the double-chain form is increased to a greater extent than that of the single-chain form compared to wild-type t-PA; or any combination of the events described above produces this described effect. The zymogenicity of wild-type t-PA has been described by Losealzo / J. Clin. Invest. 82, 1391-1397 (1988) and Ranby et al., Thrombosis Research. 27, 175-183 (1982).

The term "fibrin specificity" refers to the activity of a mutant showing a higher ratio of fibrin-dependent specific activity to fibrinogen-dependent specific activity in assay S-2251 (both single-chain and double-chain) than wild-type rt-PA, and preferably this ratio is at least 1.5.

"Plasma clot specificity refers to the activity of a mutant that exhibits a higher ratio of plasma clot-specific activity to plasma-dependent specific activity in assay S-2251 (both single-stranded and double-stranded) than wild-type rt-PA, and preferably the ratio is at least 1.5.

As used herein, a "transient expression system" refers to a cell culture comprising cells transfected with a vector encoding a t-PA variant, which vector expresses the DNA sequence encoding the variant transiently, i.e., may not be stable. Such cells are considered to be "transient expression".

B. General Procedures

1. Variants of an amino acid sequence

Referring to Figure 1, which illustrates the primary structure of t-PA, for discussion of the variants of the invention.

In Figure 1, the letters in the circles represent the one letter codes of the amino acids, the linking lines between the chains represent the disulfide bridges, the open circles represent the glycosylation sites, and the F, GF KI, K2 and SP marks the finger, growth factor, 1. hook, hook 2 and the serine protease domains.

In the "shorthand" designation of the t-PA variants disclosed herein, it is noted that the numbers refer to the position of the amino acid residues along the putative mature tPA amino acid sequence (European Patent Publication No. 93,619). To identify amino acids, we use the one letter alphabet of the amino acids, i.e.

asp D aspartic aspartic Ile I Izoleu- tin Thr T threonine Leu L leucine Ser S serine Tyr Y tyrosine Glu E glutamine -carbamic Phe F Fenilala- nin Pro P proline His H Hiszti- dyne Gly G glycine Lys K lysine below THE alanine Arg R arginine Cys C cysteine Trp W Tripto- wood With V Valin Gin Q glutamine min Met M Metio- nin Asn N aspartic gin

For the substitution variants herein, the designation consists of a letter, a subsequent number, and a letter again. The first (left) letter represents the amino acid in wild-type mature t-PA. The number refers to the position of the amino acid where the substitution occurs, and the second letter (right) indicates the amino acid used to replace the wild-type amino acid. In an insertion variant, the notation consists of a letter i followed by a number; this indicates the location of the root before insertion in wild-type mature t-PA; followed by one or more uppercase letters indicating the type of installation. In a deletion (deletion) variant, the notation consists of a letter d followed by the number of the start of the deletion, followed by the number of the end of the deletion; site numbering is based on wild-type mature t-PA numbering. Multiple mutations are separated by commas in the notation for ease of reading.

The name is exemplified by the following examples: a substitution variant in which wild-type t-PA at position 305 is substituted with phenylalanine histidine.

EN 210 541 A9 replaced with F305H. A substitution variant having multiple substitutions is described in paragraphs 296-299. in successive locations from KHRR to AAAA, designated K296A, H297A, R298A, R299A. An insertion variant where cysteine and valine are inserted after the 305th position of wild-type t-PA is designated as ³305 CV. A deletion variant wherein 300-305. sites are deleted from wild-type mature t-PA, designated d300-305. The designation "t-PA" follows each mutant.

A preferred class of zimogens are those in which substitutions, insertions, and deletions occur at or around position 305. These variants include those containing the 305th position of the corresponding wild-type t-PA other than phenylalanine. More preferred are variants that contain at position 305 a side-chain amino acid capable of acting or acting as a hydrogen-binding donor, such as, e.g. containing a hydroxyl group or a nitrogen atom. More preferred such amino acids are arginine, lysine, tyrosine, asparagine, glutamine and histidine, most preferably histidine. Preferred insertional zymogen variants of this type include those containing one or more amino acid insertions after amino acids 304 or 305, such as those described above, that is, or are capable of acting as a hydrogen bonding donor, e.g. side chain amino acids having hydroxyl or nitrogen, such as arginine, lysine, tyrosine, asparagine, glutamine and histidine, most preferably histidine. Preferred deletion zymogen mutants include those that contain deletions in the wild-type t-PA 297-305 region (including borders), including d297 t-PA, d298 t-PA, and the like. and combinations thereof, e.g. d297-299 t-PA or d297, d305 t-PA.

Preferred embodiments of the above zymogenic variants include: F305H t-PA; F305T t-PA; F305N t-PA; F305K t-PA; F305R t-PA; F305Q t-PA; i304 H t-PA; i304 T t-PA; i304 N t-PA; 304 K t-PA; R 304 R t-PA; 30 304 Q t-PA; 304 HH t-PA; 305 H t-PA; i305 T t-PA; 305 N t-PA; 305 K t-PA; i305 R t-PA; i305 Q t-PA; 30 304 Η, i305 H t-PA; i305 HH t-PA; d297 t-PA; d298 t-PA; d299 t-PA; d300 t-PA; d301 t-PA; d302 t-PA; d3O3 t-PA; d304 t-PA; d305 t-PA; d297-298 t-PA; d297-299 t-PA; d297-300 t-PA; d297-301 t-PA; d297-302 t-PA; d297-303 t-PA; d297304 t-PA; d297-305 t-PA; d3OO-301 t-PA; d300-302 t-PA; d300-303 t-PA; d300-304 t-PA; d3OO-305 t-PA; d304-305 t-PA; d297, d300 t-PA; d297, d305 t-PA; dl-44, N184D, F305H t-PA; dl-44, F305H t-PA; d144.1210R, G211A, K212R, V213R, F305H t-PA; d144.1210R, G211A, K212R, V213R, F305H t-PA; dl44, T252R.F305H t-PA; dl-44, V213K, T252R, F305H tPA; dl-44.121 OK, F305H t-PA; dl-44, I210R, G211H, K212Q, V213K, F305H t-PA; I210R, G211H.K212-Q, V213K, F305H t-PA; I210R, G211A, K212R.V213R, F305H t-PA; dl-44, N184D, I210R, G211A, K212R, V213R, T252R, F305H t-PA;

N184D, I210R, G211A, K212R, V213R, T252R, F305H t-PA; d92-179, F305H t-PA; d92-179, I210R, G211A, K212R, V213R, F305H t-PA; d92-179, N184D, I210R, G211A, K212R, V213R, T252R, F305H t-PA; d92-179, I210R, G211- A, K212R, V213R, T252R, F305H t-PA; Y67N, F305H t-PA; dl-44, Y67N, F3O5H t-PA; and their T252R or NI845 analogs and combinations thereof. (Changes in domains other than the aprotease domain will be described later.)

Preferred zymogenic variants are F305H t-PA; F305T t-PA; F3O5N t-PA; F305K t-PA; F3O5R t-PA; F305Q t-PA; I304 H t-PA, dl-44, F305H t-PA; d92-179, F305H t-PA; dl-44, Nl-84D, F305H tPA; dl-44, I210R, G211A, K212R, V213R, F305H t-PA; dl-44.1210R, G211A, K212R, V213K, F305H t-PA; I210R, G211A, K212R, V213R, F305H t-PA; d92179, I210R, G211A, K212R, V213R, F305H t-PA; d92179, N184D.I210R, G211 A, K212R, V213R, F305H tPA; d92-179, N184D, I210R, G211A, K212R, V213R, T252R, F3O5H t-PA; dl-44, N184D, I210R, G211A, K212R, V213R, T252R, F305H t-PA; and N184D, 1210R, G211A, K212R, V213R, T252R, F305H t-PA.

Particularly preferred variants of the first class of zimogens are F305H t-PA; F305T t-PA; F305N t-PA; F305Q t-PA; i304 H t-PA; dl-44, F305H t-PA; d92179, F305H t-PA and most preferably F3O5H t-PA.

Another preferred class of zymogens of the present invention and another class of variants which are alternatively or in excess of fibrin (or plasma clot) are variants having one or more changes in the charged amino acid residues in small regions of the protease domain, wherein said regions or adjacent regions may be responsible for the interaction of t-PA with other substances that may affect various activities of t-PA.

The regions identified by the activity assay by this method correspond to the following wild-type t-PA residues: 267, 283-287, 296-299, 303-304, 322, 326-327, 331-332, 339- 342, 347-351, 353-356, 360-362, 364-366, 369-371, 378383, 387-392, 400-405, 408, 410, 416-418, 426-430, 432-434, 440, 445-449, 449-453, 460-462, 471-472, 477, 487-489, 505-506,513, 519-523 and 523-526.

One or more of these regions, or subunits thereof, are altered to determine whether the desired biological property or properties are obtained. Charged amino acid residues (Arg, Asp, His, Lys and Glu) can be appropriately identified by alanine scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989), the entire disclosure of which is incorporated herein by reference. and may be replaced by a neutral or negatively charged amino acid to influence the interaction of the amino acids with the surrounding aqueous environment within and outside the cell.

Mutants of this second preferred class of zimogens and fibrin-specific molecules are those

In which the amino acids were substituted at the following wild-type t-PA sites: 267, 283 + 287, 296-299, 303-304, 331-332, 339 + 342, 347-349 + 351, 364-366, 408 , 410, 416-418, 426-427 + 429-430, 432434, 440, 445 + 449, 449 + 453, 460 + 462, and / or 477, where the + sign means that only in the specified locations, means that all will be replaced at the specified locations.

For alanine scanner mutagenesis, it is more preferred to substitute an amino acid that will neutralize the charge of the wild type t-PA as opposed to one that gives the molecule an opposite charge. Any hydrophobic, substantially uncharged or oppositely charged amino acid may be used, including the following preferred amino acids: alanine, glycine, serine, threonine, asparagine, glutamine, valine, leucine, isoleucine, phenylalanine, and tyrosine. Of these, smaller amino acids such as alanine, serine and threonine are preferred over larger amino acids such as valine, leucine and isoleucine. Charged amino acids such as aspartic acid or glutamic acid are less preferred.

More preferably, the amino acids used for substitution are either alanine, serine, threonine, asparagine, glutamine, phenylalanine or tyrosine, with alanine, serine and threonine being most preferred. The most preferred amino acid for this purpose is alanine, since it eliminates the side chain behind the beta carbon atom and is thus less likely to alter the backbone conformation of the wild-type t-PA molecule. Further, alanine is frequently found at both protected and exposed sites / Creighton T.E .: The Proteins (published by Freeman W.H. & Co., N.Y.); Chothia C. J. Mol. Biol. 150: 1 (1976).

Preferred variants of the latter class of zimogens or fibrin (or plasma clot) specific variants are those in which the modifications are within the protease domain of t-PA, with the exception of the following variants: D365At-PA; R462L t-PA; A4735 t-PA; Ü296-304 t-PA; d296-302 t-PA; R298E t-PA; R299E t-PA; R304E t-PA; R304S t-PA; O296-299 t-PA and K296E, R298E, R299E t-PA.

More specifically, preferred variants are those containing one or more substitutions at the following positions of wild-type t-PA: 267, 283, 287, 296, 297, 298, 299, 303, 304, 311, 332, 339, 342, 347, 348 , 349, 351, 364, 365, 366, 408, 410, 416, 417, 418, 426, 427, 429, 430, 432, 434, 440, 445, 449, 453, 460, 462 or 477, or combinations thereof .

Even more preferred are the protease domain variants in which the wild-type t-PA is substituted at the following sites: 267, 283 + 287, 296299, 303-304, 331-332, 339 + 342, 347-349 + 351, 364366, 408 , 410, 416-418, 426-427 + 429-430, 432 + 434, 440, 445 + 449, 449 + 453, 460 + 462 and 477, where the + sign means that the substitutions only occur at the positions indicated, but not between them, and the sign means that all candidate positions, including those between them, are being changed.

Even more preferred variants of this latter class of zymogen or fibrin (or plasma clot) specific variants are R267A t-PA; D283A, H287A t-PA; K296A, H297A, R298A, R299A t-PA; E3O3A, R304A t-PA; H331A, H332A t-PA; R339A, R342A t-PA; E347A, E348A, E349A, K351A t-PA; D364A, D365A.D366A t-PA; E408A t-PA, E410A t-PA; K416A, H417A, E418A t-PA; E426A, R427A, K429A, E430A t-PA; H432A, R434A t-PA, R440A t-PA; H445A, R449A t-PA; R449A, D453A t-PA; D460A, R462A t-PA and D447A t-PA.

Of these, the most preferred substitution is when wild-type t-PA 296-299. each of its residues is replaced by an alanine residue, i.e., K296A, H297A, R298A, R299A t-PA.

Preferred insertion variants with zymogenic or fibrin-specific activity are those in which one or more amino acids are inserted at sites 296, 297, 298 and / or 299. Also preferred are protease domain variants incorporating tyrosine, asparagine, lysine, arginine or glutamine.

Other variants can be identified by one or more amino acid changes (deletion, substitution, or insertion, but preferably substitution) within the protease domain (264-527 amino acids) of the native t-PA molecule by demonstrating zymogenic properties compared to wild-type t-PA, using one or more of the following screening methods.

In addition to differing from the native sequence at one or more protease domain sites by having specific properties for zymogen and / or fibrin (or plasma clot), the t-PA variants of the invention may optionally include radical substitutions in other regions of the native sequence, deletions or insertions to improve certain properties of the molecule, provided that the changes do not prevent the single chain form of t-PA from being cleaved into the double chain or otherwise alter the desired biological properties created by modifications or modifications of the protease domain according to the invention. . Preferred changes in these other domains are given in the above list of the most preferred zymogenic variants of the first type.

Such variants are, for example, those which are preferably free of at least a portion of the finger domain, the growth factor domain and / or the first hook domain, and / or are free of glycosylation at the glycosylation site around amino acid 194 and preferably contain amino acid modifications at and 2. hook at the putative lysine binding site.

Further, the fibrin binding of t-PA can be modified, most preferably, restored or enhanced by appropriate substitution of positively or negatively charged amino acid residues at the contiguous ligand-binding "pocket" edges of the t-PA 2 domain. Variants of the invention are generally prepared by site-directed mutagenesis or excision / ligation techniques, which are described below.

A specific example of such variants is the molecule lacking the amino acid residues 1-44. amino acid (designated dl-44) and the molecule contains aspartic acid at position 184

HU 210 541 A9 (Ref. N184D). The 1-44 amino acid deficient variants are described in detail in WO 89/00197, cited above. PCT Application.

All of the above variants may optionally be modified in various other regions of the molecule, provided that such modifications still meet the criteria for zymogen and / or fibrin (or plasma clot) specific properties herein. Examples of such changes include:

1st / 1st hook modifications, eg. 92-179. site deletion, and / or

2nd / 2nd hook modifications, eg. the app. 174-261. deletion or modification of locations in approx. 205-215 amino acids, in particular 210-213 amino acids, and / or

3. / Amendments to about 244-255. amino acids, particularly at or in place of 252, and / or

4. / Modifications to app. 233-242. amino acids 236-238, and / or

5. / Modifications at known glycosylation sites, e.g. the

184, and / or

6. / modification of glycosylation within the growth factor domain as dependent on 20.05.1988,

U.S. Patent Application Serial No. 07 / 196,909, the entire contents of which is incorporated herein by reference. More specifically, the t-PA molecule is N- or O-glycosylated within the growth factor domain, preferably at positions 67-69. sites where tyrosine at position 67 was replaced with an asparagine residue to alter the half-life of the t-PA molecule.

Most of these modifications can significantly alter clearance rates and fibrin binding relative to native t-PA. Those skilled in the art will be able to determine, by a suitable assay method, the optimal properties of each variant desired in a particular case.

Modifications to replace or insert the appropriate amino acid (s) into the native molecule to generate the above sequence variants can be accomplished by any known method, e.g. by targeted mutagenesis, or by ligating the appropriate sequence into the DNA encoding the protein of interest, as described below.

2. Site-specific mutagenesis

The production of t-PA variants, as described herein, is preferably accomplished by site-directed mutagenesis of a DNA encoding a previously produced variant or unmodified form of the protein. Site-specific mutagenesis allows for the production of t-PA variants using specific oligonucleotide sequences encoding the desired mutant DNA sequence and a sufficient number of adjacent nucleotides to form a primer sequence of suitable size and sequence complexity. formation on both sides of the jumper. Typically an approx. A primer of 20-25 nucleotides in length is the preferred primer. 5-10 residues on each side of the junction of the sequence to be changed. In general, the technique of site-specific mutagenesis is well known in the art and exemplified by Adelman et al., The disclosure of which is incorporated herein by reference in its entirety (DNA 2, 183 (1983)).

The site-specific mutagenesis technique uses a phage vector that exists in both single-stranded and double-stranded forms. Typical vectors for site-directed mutagenesis include e.g. phage M13 / Messing et al., Third Cleveland Symposium on Macromolecules and Recombinant DNA, published by Walton A, Elsevier, Amsterdam (1981), the entire disclosure of which is incorporated herein by reference. These phages are already commercially available and are well known in the art. Alternatively, plasmid vectors containing the origin of the single-stranded replication phage may be used. Veira et al., Meth. Enzymol. 153: 3 (1987) to obtain single-stranded DNA.

In general, site-directed mutagenesis, as described herein, is performed by first obtaining a single-stranded vector comprising the DNA sequence encoding said t-PA within its sequence. An oligonucleotide primer carrying the desired mutated sequence is prepared, usually synthetically, e.g. Crea et al., Proc. Natl. Acad. Sci. USA. 75, 5765 (1978)]. This primer is then annealed with the single-stranded vector containing the t-PA sequence and DNA polymerizing enzymes, such as. Klenowfragmense of E. coli polymerase I, to effect completion of the synthesis of the mutation-carrying fiber. Thus, a heteroduplex is formed in which one strand encodes the original non-mutated heteroduplex vector, which is then encoded by suitable cells, e.g. Clones containing recombinant vectors carrying the mutated sequence arrangement were used to transform JM101 cells and selected by hybridization. Hybridization is performed on radioactive probes consisting of a ³² P-labeled mutagenesis primer.

Once such a clone is selected, the mutated t-PA region can be removed and inserted into a suitable vector for the production of t-PA, typically an expression vector of the type typically used to transform an appropriate eukaryotic host. In the context of the present invention, Chinese hamster ovary (CHO) cells or the 293 cells / human kidney cells described by Graham et al., J. Gene. Virol. 36, 59 (1977)) are preferred for the production of long-term stable t-PA producing cells. However, the invention is not limited to CHO production, as it is known that many other types of cells can be used appropriately, especially where only the enzyme transient production is required for assay purposes. so e.g. a transient system employing 293 cells, which provides a convenient system for the production of t-PA variants for analytical purposes, is described below.

HU 210 541 A9

3. Cleavage / ligation technique

Another method for generating mutations in the DNA sequence encoding t-PA involves cleavage of the t-PA coding DNA at the appropriate site by restriction enzyme digestion, extraction of the suitably cleaved DNA, oligonucleotide encoding the desired amino acid, and flanking regions. e.g. synthesis of blunt-ended polylinkers (or digestion of the synthetic oligonucleotide with the restriction enzymes used to cleave DNA encoding t-PA instead of using polyl linkers to form cohesive ends), and ligation of synthetic DNA to the structural gene encoding t-PA for the rest.

4. Host cell cultures and vectors

Although expression in Chinese hamster ovary (CHO) cells is ultimately beneficial for the production of t-PA, the vectors and methods described herein are suitable for use in a wide variety of eukaryotic organisms as host cells.

In general, of course, prokaryotes are preferred for the initial cloning of DNA sequences and for constructing the vectors of the invention. Especially preferred is e.g. E. coli K12294 strain (ATCC 31,446) and E. coli W3110 strain (ATCC 27,325). Other suitable microbial strains include E. coli strains, such as E. coli. E. coli B and E. coli XI776 (ATCC 31,537). These examples are, of course, only illustrative and not limiting.

Prokaryotes may also be used for expression. The aforementioned strains as well as Bacillus, e.g. Bacillus subtilis and other Enterobacteria, such as. Salmonella typhimurium or Selminia marcesars, and strains of various Pseudomonas species can be used as hosts for expression.

In general, plasmid vectors containing replicon and control sequences from species compatible with the host cell are used in conjunction with these host organisms. The vector typically carries a replication site as well as marker sequences that are capable of promoting phenotypic selection in transformed cells. so e.g. E. coli is typically transformed using p BR322, a plasmid from E. coli species, see e.g. Bolivar et al., Gene 2.95 (1977). PBR322 contains the ampicillin and tetracycline resistance genes and thus transformed cells can be easily identified. Plasmid pBR322, or other microbial plasmids or phages, must also contain, or be modified to include, promoters that can be used to express the microbial organism's own proteins.

The most commonly used promoters in the recombinant DNA technique include the beta-lactamase (penicillinase) and lactose promoter systems (Chang et al., Nat. 375, 615 (1978); Itakura et al., Science 198, 1056 (1977); Goeddel et al., Natur. 281,544 (1979) / and a tryptophan (trp) promoter system / Goeddel et al., Nucl. Acids Sl 8: 4057 (1980); No. 36,776 European Patent Publication / and alkaline phosphatase systems. Although these are the most commonly used promoters, other microbial promoters have been described and used, and details of their nucleotide sequence have already been disclosed, so that one skilled in the art can link these operably to plasmid vectors. Sebenlist et al., Cell 20: 269 (1980).

In addition to prokaryotes, eukaryotic microorganisms, e.g. yeasts are also useful in the invention. Sachcharomyces cerevisiae, or common baker's yeast, is the most commonly used of eukaryotic microorganisms, although numerous other strains are available. so e.g. For expression in Saccharomyces, plasmid YRp7 is commonly used (Stinchcomb et al., 1979, Nat. 282, 39; Kinsman et al., 1979, Gene 7, 141; Tschemger et al., Gene 12: 157 (1980). This plasmid already contains the trpl gene, which serves as a selectable marker for yeast mutant strains that have lost their ability to grow on tryptophan; such as ATCC 44,076 or strain PEP4-1 (Jones: Genetics 85, 12 (1977)). The presence of trpl lesion, as a feature of the host cell genome, then provides an efficient environment for the detection of transformants that can grow in the absence of tryptophan.

Promoter sequences useful in yeast vectors include 3-phosphoglycerate kinase / Hitzeman et al., J. Biol. Chem. 255, 2073 (1980) / or promoters of other glycolytic enzymes / Hess et al., J. Adv. Enzyme Rém. 7, 149 (1986); Holland et al., Biochemistry 17, 4900 (1978)] such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, isomerase and glucokinase promoter. In the construction of appropriate expression plasmids, termination sequences linked to these genes are also ligated to the 3 end of the sequence in the expression vector to allow polyadenylation and termination of the m RNA. Other promoters that have the additional advantages of growth-regulated transcription include the promoter regions of the following enzymes: alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, nitrogen metabolism degrading enzymes, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and and the enzymes responsible for the utilization of galactose. Any plasmid vector containing a yeast-compatible promoter, origin of replication, and termination sequences may be used.

In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any cell culture is functional, whether vertebrate or invertebrate. However, vertebrate cells are of major interest and the proliferation of vertebrate cells in cell culture (tissue culture) has become routine in recent years / Tissue Culture,

HU 210 541 A9 Publishers: Kruse and Patterson, Academic Press (1973). Examples of such usable host cell lines are VERŐ and HeLa cells, CHO cell lines, W138, BHK, COS-7, 293 and MDCK cell lines. For such cells, expression vectors typically carry (if necessary) an origin of replication, a promoter with any necessary ribosome binding site before the gene to be expressed, RNA binding sites, polyadenylation sites, and transcriptional terminator sequences.

When used in mammalian cells, control functions in expression vectors are often provided by viral substances. so e.g. commonly used promoters are derived from polio, adenovirus 2 viruses, and most commonly from Simian Virus 40 (5V40). The early and late promoters of 5V40 are particularly suitable because both can be readily recovered from the virus as a fragment that also contains the 5V40 viral origin of replication (Fiers et al., 1978, Nat. 273, 113). Smaller or larger 5V40 fragments may also be used provided they contain a sequence of approximately 250 bp extending from the Hindin site to the BglI site in the viral origin of replication. Furthermore, it is possible and often desirable to use promoter or control sequences that are normally linked to the desired gene sequence, provided that these control sequences are compatible with the host cell systems.

Typically, an origin of replication may be generated either by constructing a vector containing an exogenous origin, which may be derived from SV40 or other viral sources (e.g., polio, adeno, VSV, BPV) or by the chromosomal replication mechanism of the host cell. Once the vector is integrated into the host cell chromosome, the latter is often sufficient.

A sufficient amount of human t-PA can be produced by cell cultures; however, refining the process using a secondary coding sequence serves to further increase production levels. The secondary coding sequence contains dihydrofolate reductase (DHFR), which through an externally regulated parameter, such as. methotraxate (MTX), thereby enabling expression to be regulated by regulating MTX concentration.

For transfection with vectors containing the DNA sequences encoding both the t-PA variant and the DHFR protein of the present invention, it is convenient to select a preferred host cell having regard to the type of DHFR protein used. When using wild-type DHFR protein, it is preferable to select a host cell deficient in DHFR, thus allowing the use of the DHFR coding sequence as a marker for successful transfection in a selective medium free of hypoxanthine, glycine and thymidine. In this case, a suitable host cell is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub and Chasin, Proc. Natl. Acad. Sci. USA 77,4216 (1980).

On the other hand, when using a DHFR protein with low binding affinity for MTX as a control sequence, it is not necessary to use DHFR-deficient cells. Because the mutant DHFR is resistant to MTX, the MTX-containing medium can be used as a means of selection, provided that the host cells themselves are MTX-sensitive. Most eukaryotic cells that are capable of adsorbing MTX appear to be sensitive to MTX. One such suitable cell line is a CHO line, CHO-K1 (ATCC CCL 61).

5. Typical, applicable, cloning and expression methods

When mammalian cells are used as host cells, transfection is generally carried out by calcium phosphate precipitation as described by Graham and Van Der Eb (Virology 52, 546 (1978)). However, other suitable methods for introducing DNA into cells, such as injection into the nucleus, electroporation or protoplast fusion.

When yeast is used as a host, transfection is generally carried out using polyethylene glycol as described by Hinnen, Proc. Natl. Acad. Sci. 21, 1929-1933 (1978).

When prokaryotic cells or cells containing essential cell wall constructs are used, a preferred method of transfection is calcium treatment using calcium as described by Cohen et al., Proc. Natl. Acad. Sci. (USA) 69, 2110 (1972), or more recently, electroporation.

Standard ligation techniques are used to construct appropriate vectors containing the desired coding and control sequences. Isolated plasmids or DNA fragments are cleaved, engineered and ligated in the desired form to produce the required plasmids.

Cleavage is performed by restriction enzyme treatment (or enzyme treatment) in the appropriate buffer. Generally approx. 1 µg of plasmid or DNA fragment was used at ca. 1 unit enzyme approx. In 20 μΐ buffer solution. (Appropriate buffers and substrate volumes for each restriction enzyme are always provided by the enzyme manufacturer.) 1 hour and incubation temperature 37 ° C. After incubation, the protein is removed by phenol and chloroform extraction and the nucleic acid is recovered from the aqueous fraction by ethanol precipitation.

If blunt ends are required, the preparation can be treated for 15 minutes at 15 ° C with 10 units of Klenow fragment of DNA polymerase I (Klenow) followed by phenol-chloroform extraction and ethanol precipitation.

Size separation of the cleaved fragments was performed on a 6% polyacrylamide gel as described by Goeddel et al. / Nucleic Acids Slit. 8, 4057 (1980).

For ligation, approximately equimolar amounts of the desired components, which have the appropriate ends shaped so as to be correctly attached to one another, are treated for about 10 minutes. 10 units with T4 DNA ligase per 0.5 μg DNA. (When using split vectors11

As a component, it may be useful to prevent bacterial alkaline phosphatase pretreatment to re-ligate the cleaved vector.)

As discussed above, t-PA variants are preferably produced by specific mutations. The variants used in the practice of the present invention are most readily constructed using specific oligonucleotide sequences which encode the DNA sequence of the desired mutation and contain a sufficient number of adjacent nucleotides to form sequences of sufficient size and sequence complexity to form a stable duplex. mutation on both sides.

For analysis of correct sequences in the constructed plasmids, the ligation mixture is typically used to transform E. coli KI2294 (ATCC 31,446) or other suitable E. coli strains and the successful transformants are selected for ampicillin or tetracycline resistance depending on the strain. The plasmids were prepared from the transformants and analyzed by restriction mapping and / or DNA sequence analysis according to Messing et al., Nucleic Acids Slit. 9, 309 (1981) or Maxam et al., Methods of Enzymology 65, 499 (1980).

After introducing the DNA into the mammalian host cell and selecting the stable transformants on appropriate medium, amplification of the DHFR protein coding sequences is performed in the presence of approximately 20,000500,000 pM / l MTX concentration, which is competitive with DHFR activity. inhibitor. The actual range of concentration will, of course, be highly dependent on the nature of the DHFR gene and protein and the characteristics of the host. It is clear that generally defined lower and upper limits cannot be set. Appropriate concentrations of other folic acid analogs or other compounds that inhibit DHFR may also be used. But MTX itself is suitable, readily available.

In order to simplify the examples, some commonly used procedures are referred to as "shorthand" keywords.

The "plasmids" are designated by the lower case letter p followed by the alphanumeric designation. The starting plasmids are either commercially available in unlimited quantities or can be prepared from such accessible plasmids by known methods. In addition, other equivalent plasmids are known in the art and will be apparent to one of ordinary skill in the art.

"Digestion" of DNA refers to the catalytic cleavage of DNA by an enzyme that acts only at certain sites in the DNA. Such enzymes are called restriction enzymes and the sites for which they are specific are called restriction sites. The various restriction enzymes used herein are commercially available, and reaction conditions, cofactors, and other requirements are used according to the manufacturer's instructions. Restriction enzymes are usually denoted by abbreviations which consist of a capital letter followed by additional letters representing the microorganism from which the particular restriction enzyme was originally obtained, followed by a number to denote the particular enzyme. Usually approx. 1 µg of plasmid or DNA fragment was used together with about 2 units of enzyme for approx. In 20 μΐ buffer solution. Suitable buffers and substrate amounts for each restriction enzyme are always provided by the enzyme manufacturers. The incubation time is approx. one hour at the normal temperature of 37 ° C, but this may vary according to the manufacturer's instructions. After incubation, the protein is removed by phenol-chloroform extraction and the digested nucleic acid is recovered from the aqueous fraction by ethanol precipitation. In some cases, restriction enzyme digestion is followed by hydrolysis of the terminal 5-phosphates with bacterial alkaline phosphatase to prevent circularization of the two restriction fragments of the DNA fragment or the formation of a closed loop that would prevent the insertion of another DNA fragment at the restriction site. Plasmid digestion is not followed by 5'-terminal dephosphorylation unless otherwise noted. Methods and reagents for dephosphorylation are conventional / Maniatis T. et al., Molecular Cloning, 133-134. (1982).

"Extraction" or "isolation" of a particular DNA fragment from a restriction digest is the separation of the digested mixture by polyacrylamide or agarose gel electrophoresis, identification of said fragments by comparison of their motility with known molecular weight DNA fragments, removal of the desired fragment fragment. and isolating DNA from the gel. This procedure is generally known; Lawn R. et al., Nucleic Acids Slit. 9, 6103-6114 (1981) and Goeddel, D., et al., Nucleic Acids Sl. 8, 4057 (1980).

"Southern analysis" is a method for verifying the presence of DNA sequences in a digested or DNA-containing mixture by hybridization to a known labeled oligonucleotide or DNA fragment. For the purposes of the present invention, unless otherwise indicated, Southern analysis comprises the steps of separating the digested mixture on 1% agarose, denaturing and transferring it to nitrocellulose by Southern E.J. Mole. Biol. 98, 503-517 (1975)) and hybridized according to Maniatis T. (1977) 687-701.

"Transformation" refers to the introduction of DNA into an organism so that it can be replicated either as an extrachromosomal element or integrated into the chromosome. Unless otherwise indicated, the calcium chloride method of Mandel et al. Mole. Biol. 53, 154 (1970).

"Ligation" refers to a process that leads to the formation of phosphodiester bonds between two double-stranded nucleic acid fragments (Maniatis T, cited above, p. 146). Unless otherwise noted, ligation is performed using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 µg of approximately equimolar amount of DNA fragment.

HU 210 541 A9

"Production" of DNA refers to the isolation of plasmid DNA from transformants from a microbiological culture. Unless otherwise noted, Maniatis et al. Use the alkaline SDS method (previously cited, page 90).

"Oligonucleotides" are short single or double stranded polydeoxynucleotides that are chemically synthesized by known methods and then purified on a polyacrylamide gel.

C. Pharmaceutical Compositions

The compounds of the invention may be formulated according to known methods for the preparation of pharmaceutically acceptable compositions comprising combining the t-PA product in admixture with a pharmaceutically acceptable carrier. Suitable carrier excipients and their formulation, including other human proteins, e.g. human serum albumin, e.g. in Remington s Pharmaceutical Sciences / 16. Mack Publishing Co., eds. Oslo et al. (1980), the full disclosure of which is incorporated herein by reference. Such compositions typically contain an effective amount of a variant of the invention, e.g. in the range of about 0.5 to 5 mg / ml, together with a suitable amount of a suitable carrier, to provide a pharmaceutically acceptable composition for effective treatment of the patient. The particular t-PA variant may be administered parenterally to individuals suffering from or in the presence of cardiovascular disease, or may be introduced by other methods that ensure effective delivery of the drug to the bloodstream.

Compositions which are particularly useful for the clinical administration of t-PA products used in the practice of the present invention include e.g. sterile aqueous solutions or sterile hydrated powders, e.g. lyophilized proteins. In general, it is desirable to provide a suitable amount of a pharmaceutically acceptable salt in the formulation, usually in an amount sufficient to render the formulation isotonic. A pH regulator is also required, e.g. arginine base and phosphoric acid, in sufficient amounts to maintain a sufficient pH, usually between 5.5 and 7.5. In addition, to improve the half-life or stability of aqueous formulations, further agents, e.g. addition of glycerol. In this way, the t-PA variant formulations are suitable for parenteral administration, but particularly intravenous administration.

Dosages and desired drug concentrations of the pharmaceutical compositions of the present invention may vary depending on the particular application. so e.g. for the treatment of deep vein thrombosis or peripheral vascular disease, bolus doses typically of about 0.05-0.2 mg / kg are administered in successive administrations to maintain relatively stable blood levels, preferably around 3 pg / ml.

However, in cases involving urgent medical care, where infusion facilities are usually not available, and in cases where the disease in question (embolism, infarction) is usually of a critical nature, slightly higher initial doses such as an intravenous bolus of about 0.3 mg / kg.

For example, the t-PA variant of the invention may be conveniently administered parenterally to individuals suffering from or predisposed to cardiovascular disease. The amount and rate of administration may be parallel to or higher than that currently used for other cardiovascular thrombolytic agents in clinical treatment, e.g. 1-2 mg / kg body weight in intravenous or intra-arterial doses every 1.5-12 hours in myocardial infarction, pulmonary embolism, etc. patients. Higher doses may also be tolerated since the variants of the present invention have fewer side effects than wild-type tPA, while at the same time producing faster and more complete blood clotting.

An example of a suitable dosage form is an ampoule containing 50 mg of t-PA, arginine, phosphoric acid, and polysorbate 80, supplemented with 50 ml of sterile water for injection and mixed with an appropriate volume of 0.9% sodium chloride injection.

The t-PA variants of the present invention are useful in preventing the formation or re-formation of fibrin deposition or adhesion. A preferred embodiment of this use is described in WO 89/00049. PCT Application Publication (published January 12, 1989), the entire disclosure of which is incorporated herein by reference. Such treatment generally involves the topical administration of a composition to a putative site of fibrin deposition or adhesion, wherein said composition comprises a therapeutically effective amount of the t-PA variant in a gradual dissolution that will gradually release the active ingredient locally for about 3 days to two weeks. . Typically, the t-PA variant is administered at a dose sufficient to prevent fibrin deposition or adhesion formation following surgery, infection, accident, or inflammation. This amount is typically between 0.02 mg / g of gel and 2.5 mg / g of gel, with the most preferred range being between 0.25 mg / g and approx. 1.0 mg / g gel.

The vehicle, in which t-PA is typically formulated to prevent the formation of adhesion, is a semi-solid, mucous, pharmaceutically inert carrier which helps to locate the enzyme at a possible adhesion site. Such carriers include long chain hydrocarbons or edible oils and waxes consisting of mixtures of saturated and unsaturated fatty acid glycerides or mixtures of modified saturated and unsaturated fatty acid glycerides. Examples of these are solid carriers such as petroleum jelly or semi-synthetic glycerides, polyhydroxy solvents such as petroleum jelly. glycerol, long chain hydrocarbons, biodegradable polymers and liposomes.

The following examples illustrate the best practices currently practiced in the practice of the present invention, but are not to be construed as limiting.

HU 210 541 A9

All references and patent applications cited herein are expressly incorporated herein by reference.

/. EXAMPLE

A. Construction and Use of Expression Vectors for the Recombinant Production of T-PA Variants

1. Construction of plasmid p7-1Hp a) p CIST-PA

Plasmid pCIST-PA was constructed as described e.g. United States Patent Application Serial No. 07 / 071,506, issued July 9, 1987. In summary, the pCIHt-PA vector containing the cytomegalovirus enhancer and promoter, the cytomegalovirus splice donor site and intron, the Ig variable region acceptor site, the cDNA encoding t-PA / Pennica et al., Natura 301, 214 (1983) / and the first site for the polyadenylation and transcription termination of hepatitis surface antigen.

constructing the pF8CIS vector containing the cytomegalovirus enhancer (Boshart et al., Cell 41: 520 (1985)) and the promoter (Thomsen et al., Proc. Natl. Acad. Sci. (USA) 81: 659 (1984), a cytomegalovirus donor site and a portion of an intron (Sternberg et al., J. of Virol. 49, 190 (1984)], the Ig variable region intron and linker acceptor site, the factor VIII coding cDNA and the SV40 polyadenylation site. The three parts of the construction are detailed below.

1. The ampicillin resistance marker and origin of replication of the final vector is derived from plasmid pUC13pML, a variant of pML13 (Lusky et al., 1981, Nat. 293, 79). PUC13pML was constructed by transferring the pUC13 polylinker (Veira et al., Gene 12, 259 (1982)) to the EcoRI and HindIII sites of pML. The second starting glaze is pUC8CMV, a source of CMV enhancer, promoter, and linker donor sites. PUC8CMV was constructed by inserting a 1-732 nucleotide sequence of the CMV enhancer, gromoter, and binding donor into the blunt sites of pUCBPst1 and SphII - see Veira, supra. Synthetic BamHI-HindIII linkers (commercially available from New England Biolabs) are ligated to the cohesive BamHI end to form a HindIII site. Following this ligation, a HindIII-HindIII digestion was performed. This digestion is an approx. This results in an 800 bp fragment containing the CMV enhancer, promoter and linker donor site. After gel isolation, this 800 bp fragment was ligated to a 2900 bp fragment of pUC13pML. The fragment required for the construction of pFBCIS is obtained by digestion of the above intermediate plasmid with SalI and HindIII. This 3123 bp fragment contains the ampicillin resistance marker, origin of replication from pUC13pML, and CMV control sequences including enhancer, promoter, and linker donor site.

2. The Ig variable region intron and linker acceptor sequence is constructed using a synthetic oligomer. A 99-mer for the IgG intron and a 30-mer for the linker acceptor site are synthesized by the following sequences (Bthwell et al., Cell 24, 625 (1981)):

5'-AGTAGCAAGCTTGACGTGTGGCAGGCTTGA ... 31 GATCTGGCCATACACTTGAGTGACAATGA ...

CATCCACTTTGCCTTTCTCTCCACAGGT ...

8 GTCCACTCCCAG-3 '

3'-CAGGTGAGGGTGCAGCTTGACGTCGTCGGA-5 'DNA polymerase I (Klenow fragment) is loaded at the ends of the synthetic fragments and a double-stranded fragment is created (Wartell et al., Gene 9, 307 (1980)). This is followed by a double digestion with Pstl and HindIII. This synthetic linker was cloned into pUC13 (Veira et al., Supra) at the PstI and Hind III sites. The clone containing the synthetic oligonucleotide, designated pUCIg.10, was digested with PstI. To this fragment is added a ClaI site using a PstI-Cla I linker. Following Hind III digestion, a 118 bp fragment was isolated on a gel containing a portion of the Ig intron and the Ig variable region acceptor site.

3. In the third part of the construction scheme, the 3 'end of the hepatitis surface antigen is replaced by the polyadenylation site and the transcription termination site of the SV40 early region. A vector, pUC.SV40, containing the SV40 sequences was inserted into the pUCB at the BamHI site as described by Veira et al., Supra. PUC.5V40 is then digested with EcoRI and Hpa I. From this digestion, a 143 bp fragment containing only the SV40 polyadenylation site was isolated on gel. Two additional fragments were isolated from the gel following digestion of pSVE.8clD (European Patent Publication No. 160,457). The 4.8 kb fragment is derived from Eco RI and Cla I digestion and contains the SV40-DHFR transcription unit. , the origin of pML replication and the ampicillin resistance marker. It is formed by digestion with Clal and Hpal

The 7.5 kb fragment contains the factor VIII cDNA. A tripartite ligation results in pSVE, 8c24 D. This intermediate plasmid was digested with Clal and SalI to obtain a 9611 bp fragment containing the factor VIII cDNA with the SV40 polyadenylation site and transcription termination sites followed by the SV40DHFR transcription unit.

For the final three-part ligation resulting in pF8CIS: a) the 3123 bp SalI-HindIII fragment containing the origin of replication, the ampicillin resistance marker and the CMV enhancer, promoter and binding donor; b) the 118 bp HindIII-ClaI fragment comprising the Ig intron and the linker acceptor; and c) a 9611 bp Clal-SalI fragment comprising the factor VIII cDNA, the SV40 polyadenylation site and the SV40-DHFR transcription unit.

Subsequently, the plasmid pCIHt-PA was completely constructed

EN 210 541 A9 from the plasmid pClat-PA and the plasmid pFBCIS above were prepared as follows:

The t-PA cDNA is first cloned into pML to form a Clal site at the 5 terminus of the gene. To do this, a 3238 bp fragment of pSVpa-DHFR (otherwise referred to as pETPFR, see above) was inserted into the site of pMLHindHI (Lusky et al., Supra). The colonies are screened for clones having the 5 'end of the cDNA adjacent to the Clal site. The intermediate plasmid is called pCLAt-PA. The t-PA cDNA, followed by the 3'-polyadenylation region, was isolated as a 2870 bp Clal-KgnI fragment. This fragment was ligated to the 5146 bg fragment of pF8CIS. This Call-KpnI fragment of the pF8CIS vector provides the 5 'control region, the SV40DHFR transcription unit, the ampicillin resistance gene and the origin of the pML (see Figure 2).

Expression levels of t-PA are cleaved by transfection of pCIHt-PA with CHO or 293 cells by methods known per se and described above. From the medium obtained from the transfected 293 cells, for example by measurement, it is shown that pCIHt-PA produces 420 ng / ml tPA.

Finally, the pCISt-PA vector containing the cytomegalovirus enhancer, promoter, cytomegalovirus binding donor site and intron, Ig variable region binding acceptor site, cDNA encoding t-PA, and the SV40 polyadenylation sequence was constructed as follows. :

The starting vectors for this construct are pCIHt-PA and pFBCIS (see above). The latter vector has the same controls as pCIHt-PA, but also includes the factor VIII cDNA and the SV40 polyadenylation site. SecII was used to cleave the t-PA cDNA 3 '. The resulting 3 'overhang is blunt-ended with T4 polymerase. The pCIHt-PA is then cleaved with Clal. This site separates the chimeric intron between the CMV intron sequences and the Ig variable region intron. A 2870 bp fragment was isolated from the gel from Clal treatment. The SV40 polyadenylation site, DHFR, transcriptional regulator, bacterial origin of replication and the ampicillin resistance gene, as well as the CMV enhancer and promoter and binding donor were isolated from pF8CIS. These elements were isolated as a 2525 bp SalI-BamHI fragment and a 3113 bp HapI-SalI fragment. A tripartite ligation between the KpnI (blunt) -Ca Ia fragment, Hpal-SalI and the SalI-BamHI fragment results in pCISt-PA, which is expressed in both CHO and 293 cells as discussed above for plasmid pCIHt-PA. , 55 and 3000 ng / ml t-PA expression levels (see Figure 3).

b) Final construction of p7-1H

Plasmid pCISt-PA was digested with SpeI and then treated with a large fragment of E. coli DNA polymerase I (Klenow) and deoxyribonucleoside triphosphates to form blunt ends. The resulting linear fragment was ligated using the T4 DNA ligase to the 0.45 kb Rsal / AhalII fragment containing the + strand origin from the single-stranded DNA phage as described by Zinder et al. / Microbial. Port. 49, 101 (1985)). The ligation products which contain the florigo in both possible orientations at the SpeI site of the pCISt-PA fragment are isolated. A plasmid containing this origin in the orientation that the antisense strand of the t-PA gene is encapsulated in virons in the presence of helper phage is designated and designated as p7-1H (see Figure 4).

2. Mutagenesis of the expression plasmid

(a) Template production

Plasmid p7-IH was introduced into E. coli strain JM101 (ATCC 33,876) by calcium chloride-mediated transformation. These cells are then infected with M13K07 helper virus, and single-stranded p7-1H DNA is prepared as described by Veira et al. / Meth. Enzymol. 153: 3 (1987). Briefly, 0.3 ml of a saturated culture of transformed cells in 2YT medium is supplemented with 10 ⁹ -10 ° pfu (plaque-forming unit) M133O07 and the mixture is incubated for 15 minutes at 37 ° C. 1.5 ml of fresh 2YT medium containing 50 pg / ml carbenicillin was added and the culture was gently stirred for 16 hours at 37 ° C. After pelleting the cells, the phage and the encapsulated plasmid DNA were recovered and single-stranded DNA was prepared as described by Anderson / Nucl. Acids. Gap. 9, 3015 (1981)].

(b) Site-directed in vitro mutagenesis

Mutagenesis on p7-1H is performed using the 5'-CGGAGAGCGGCACCTGTGCGGGG-3 'oligodeoxyribonucleotide, essentially according to Zoller et al., Meth. Enzymol. 100, 468 (1983)], except for the mutant with the phe305 → his305 mutation, which is identified by telephybridization rather than plaque hybridization. Mutations are confirmed directly on single-stranded plasmid DNA by DNA sequence analysis using the dideoxynucleotide chain termination method (Sanger et al., Proc. Natl. Acad. Sci. (USA) 74, 5463 (1977)).

3. Expression and purification a) Plasmid preparation

The transformed cells are grown to saturation in 500 ml of LB medium containing 50 µg / ml carbenicillin. The cells are pelleted by centrifugation and resuspended in 40 ml of a solution containing 50 mM glucose, 10 mM EDTA and 25 mM Tris-HCl, pH 8.0. To this suspension was added 60 ml of 1% sodium dodecyl sulfate and 0.07 M NaOH, and the mixture was incubated for 2 minutes at 25 ° C and for 10 minutes at 0 ° C. To this was added 52 ml of 4 M acetic acid and 3 M sodium acetate and the mixture was incubated for 30 minutes at 0 ° C.

After centrifugation for 20 minutes at 11,500 rpm, the supernatant was mixed with two volumes of 100% cold ethanol and the resulting precipitate was recovered by centrifugation. The pellet containing plasmid DNA and RNA was dried and redissolved in 100 mM Tris pH 8.0, 10 mM EDTA and 1 μg / ml RNase A. After purification of the resulting solution by centrifugation, 0.5 mg / ml

Until a concentration of A9 is reached, ethidium bromide and an equal weight of CsCl are added. The DNA was then centrifuged in a Beckman VT165 rotor for 16 hours at 55,000 rpm at 18 ° C. The DNA layer is aspirated with a needle, extracted with n-butanol to remove ethidium bromide, then diluted with water and precipitated with ethanol. The DNA was redissolved in a final concentration of 1 mg / ml in 10 mM Tris pH 8.0 and 1 mM EDTA.

b) Transfection and expression

293 cells were grown to confluence. 10 pg of the plasmid DNA mutant t-PA is mixed with 1 pg of DNA encoding the VARNS gene (Thimmappaya et al., Cell 31, 543 (1982)) and dissolved in 500 µl of 1 mM Tris.HCl, 0.1 mM. Contains EDTA and 0.277 M CaCl ₂ . A mixture of 50 mM HEPES (pH 7.35), 280 mM NaCl and 1.5 mM NaPO ₄ 500 µl (dropwise while vortexing) was added and the precipitate allowed to form for 10 minutes at 25 ° C. The suspended pellet was then added to the cells (100 mM per plate) and allowed to settle for 4 hours in the incubator. The medium is then aspirated and 2 ml of 20% glycerol / phosphate-buffered saline (PBS) is added over 30 seconds. The cells are then washed twice with 5 ml of serum-free medium, then fresh medium is added and the cells are incubated for 5 days.

To generate stable CHO cell lines expressing the t-PA variant, the 1.4 kb Bgl II / Apal fragment carrying the majority of the t-PA coding sequences (the BglII site encodes the full-length t-PA coding DNA and 1). codon and the ApaI site spans codons 465-466 of the full-length t-PA coding DNA) can be ligated into the 6.0 kb BglI / Apa I vector from pPADHFR-6 (disclosed in European Patent Application No. 93,619). fragment. The resulting plasmid is then introduced into CHO cells and induced to overexpress t-PA variants by amplifying the coding sequence by selection in methotrexate-containing medium.

c) Cleaning

Purification of the t-PA product was accomplished by passing the conditioned medium through a column of controlled-size glass beads (bed volume, 1 mL) previously bound with anti-t-PA goat polyclonal antibody A6 (prepared by a known method). Before applying the medium, the column was equilibrated with a solution containing 0.1 M Tris.HCl pH 7.5 and 1 M NaCl. AtPA is eluted with a solution of 0.1 M acetic acid, 0.15 M NaCl, 0.02 ar ginine, and 0.01 o Tween 80 (p H 2.0), and the fractions are immediately neutralized with Tris base . Fractions were adjusted to 0.01% Tween 80 prior to collection. On the reducing SDS gel, t-PA is found to be mostly single-chain (80%).

B. Biological studies

I. Quantification of t-PA

Protein concentrations are routinely determined by the ELISA standardized on native sequence t-PA (see European Patent Publication No. 93,619). Protein purity and

homogeneity by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (PAGE-SDS) in the Laemmli buffer system (Naturre 227, 680 (1970)). Typically, 7-17% gradient gels are used and the proteins are visualized by Morrissey silver staining / Anal. Biochem. 117, 307 (1981)]. The t-PA variant produced as described above was found to be pure and homogeneous by this method.

2. Test S-2251

The results of blood clot lysis and S-2251 assays are averages of some independent observations (clot lysis: 2 determinations; S-2251: 3 determinations).

The ability of t-PA to activate plasminogen can be measured by in vitro assay by preincubating t-PA and plasminogen and adding plasmin-specific HD-valyl-H-leucyl-H lysine paranitroanilide (S-2251) substrate. The maximum rate of this reaction is observed in the presence of fibrin (ogen) or fibrin (ogen) fragments which act as stimuli for this reaction.

The plasmin-specific substrate S-2251 was used in a two-step assay to measure the plasminogen activation ability of the sample. Fibrinogen can be used as a stimulant by incubating the sample with 0.02 ml of a 20 mg / ml solution of fibrinogen in a total volume of 0.12 ml of 0.05 M Tris.HCl, 0.12 M NaCl and 0. 01% Tween 80 (pH 7.4).

A commercially available solution of Glu-plasminogen was added, 0.03 ml of a 2.0 mg / ml solution in 0.05 M Tris and 0.12 M NaCl buffer (p H 8.0). ). After 10 hours at 37 ° C, 0.35 mL of 0.86 M was added

S-2251 in 0.037 M Tris, 0.086 M NaCl and 0.007% Tween 80 (pH 7.4). This mixture was incubated for 5 minutes; the reaction was quenched with 0.1 ml of 50% glacial acetic acid. Absorbance was measured at 405 nm. Activity is expressed as the change in absorbance per nanogram per minute in the presence of substrate.

The results show that the F305H variant has 78% of the wild-type specific activity with fibrinogen; this is probably due to the pre-growth lag phase of the A405.

3. Blood clot lysis

Wild-type and F305H t-PA are tested for their ability to lyse fibrin in the presence of saturation concentrations of plasminogen according to Carlsen et al., Anal. Biochem. 168: 428-435 (1988). The in vitro blood clot lysis assay measures the activity of t-PAs by turbidimetry using a microcentrifuge analytical instrument. The mixture of thrombin and t-PA test samples is centrifuged into a mixture of fibrinogen and plasminogen to induce clot formation and subsequent clot dissolution. The resulting absorbance versus time profile is analyzed to determine the end point of the assay. The activities of the t-PA variants are compared with the standard curve of rt-PA (see European Patent Publication No. 93,619).

EN 210 541 A9 release document). The buffer used in the assay was 0.06 M sodium phosphate buffer, pH 7.4, containing 0.01 (v / v) Tween 80 and 0.01% (w / v) sodium azide. Human thrombin is present at a concentration of 33 units / ml. The fibrinogen was cooled in ice water (2.0 mg / ml clotting protein) to precipitate the fibronectin and filter by gravity. Glu-plasminogen is present at a concentration of 1 mg / ml. The analyzer chamber temperature is set to 37 ° C. The dispenser is set to either add 20 μΐ rt-PA (approximately 62.5 ng / ml 1.0 pg / ml) as a sample to the standard curve, or add 20 μΐ rt-PA at a single concentration. thrombin used as a secondary reagent and 200 μΐ of the 50: 1 (v / v) fibrinogen: plasminogen mixture used as the primary reagent. The absorbance / time program was applied after 5 minutes of incubation with a 340 nm filter and 90-reading intervals.

The results indicate that the F305H variant, when used in this assay, has approximately 46% of the blood clotting activity of normal wild-type t-PA.

4. Fibrin binding

The method used for fibrin binding is modified by the method described by Rijken et al. Biol. Chem. 257, 2920 (1982). The sample t-PA to be tested is added to a solution of 0.05 M Tris pH 7.4, 0.12 M NaCl, 0.01% Tween 80, 1 mg / ml human serum albumin and various concentrations of plasminogen-free fibrin (0, 0.05, 0.1, 0.25 and 0.5 mg / ml). The final reaction volume is 1 ml and the concentration of t-PA is 10 ng / ml per sample. Samples were incubated at 37 ° C for 5 minutes and then 1 unit of thrombin was added. The samples were then incubated for one hour at 37 ° C. Blood clots are removed by centrifugation and the amount of unbound t-PA remaining in the supernatant is determined by ELISA.

The results (Figure 5) show that predominantly single-chain F305H t-PA (closed triangles) are almost as well bound to fibrin under the assay conditions as single-chain wild-type t-PA (closed squares) and single-chain t-PA (closed squares). and a mixture of two-stranded wild-type t-PA (open triangles). The two-chain F3O5H t-PA (closed loops) also binds to fibrin at least as well as the two-chain wild-type t-PA (closed diamonds).

5. Zymogen kinetics with S-2251

(a) Production of fibrinogen

Human fibrinogen (Calbiochem) is de-fibrinogenated by loading it on a lysine-Sepharose column and collecting the effluent. The combined fibrinogen thus obtained is decomposed by an overnight plasmin-Sepharose column treatment. The resulting clotting capacity is 7%. The concentration is then adjusted to 1.51 mg / ml.

(b) Procedure

The kinetics of the conversion of plasminogen to wild-type t-PA and F3O5H t-PA in the presence of fibrinogen are determined using the chromogenic plasmin substrate S-2251. The wild-type and F3O5H t-PA molecules were used both in the single-chain form (obtained by the purification described above) and in the double-chain linked form (which was performed mainly with plasmin-Sepharose for 1 hour at 37 ° C). incubation).

In the presence of 1.2 μΜ plasmin-degraded fibrinogen fragments prepared as above, the reaction is performed at 0.08-0.89 μΜ plasminogen concentration and 2.3-9.0 nM t-PA concentration, 12M NaCl, 0.05 M Tris and 0.01% Tween 80 (pH 7.4). Plasminogen, fibrinogen and buffer were preincubated for 3 hours at room temperature. The

S-2251 was added at a final concentration of 0.9 mM and the samples were incubated at 37 ° C for approx. Heat for 5 minutes. At zero time t-PA samples are added and the absorbance of each sample is read at 30 second intervals for 10 minutes at 37 ° C.

The results are shown in Figures 6 and 7 (for wild-type, single-chain and two-chain t-PA) and Figures 8 and 9 (for F305H single-chain and two-chain t-PA). In the figures, the ordinate is the absorbance at 405 nm and the abscissa is the square of the number of minutes during which the absorbance is measured. Closed circles contained 0.9 μΜ plasminogen (and 15.7 nM wild-type t-PA, 10.8 nM F305H t-PA, 16.1 nM wild-type t-PA, and 17, 2 nM F3O5H single chain t-PA); closed triangles with 0.11 μΜ plasminogen (and 11.8 nM wild-type t-PA, 8.1 nM F305H t-PA, 12.1 nM wild-type t-PA, Represent 12.9 nM F305H single chain t-PA); closed squares 0.16 μΜ plasminogen (and 9.8 nM wild-type double-stranded t-PA, 6.7 nM F305H double-stranded t-PA, 10.1 nM wild-type single-stranded t-PA, Represent 10.8 nM F305H single chain t-PA); open circles 0.22 μΜ plasminogen (and 7.9 nM wild-type double-stranded t-PA, 5.4 η M F305H double-stranded t-PA, 8.1 nM wild-type single-stranded t-PA and 8.6 η M F305H single chain t-PA); open triangles 0.44 μΜ plasminogen (and 3.9 nM wild-type double-stranded t-PA,

Represent 2.7 nM F305H double chain t-PA, 4.0 nM wild-type single chain t-PA, 4.3 nM F3O5H single chain t-PA); open squares 0.9 μΜ plasminogen (and

3.9 nM wild-type double-stranded t-PA, 2.7 nM F3O5H double-stranded t-PA, 4.0 nM wild-type single-stranded t-PA, and

Represent 4.3 nM F3O5H single chain t-PA).

The curves show that only the absorbance of the predominantly single chain F395H variant exhibits a pronounced lag phase in the early stages of the reaction, followed by an increase in activity. The two-chain F305H variant does not show this lag phase; this appears to have kinetic properties similar to single or double-chain t-PA. This behavior demonstrates the zymogenic nature of the F305H variant, which was not observed in wild-type t-PA.

//. EXAMPLE

The alanine scanner is known as stra17

The A9 scan (ALA scan) described by Cunningham and Wells (see above) is used to generate the variants evaluated in this example. This method involves identifying small surfaces of the t-PA protease domain that contain charged amino acid residues. Without wishing to be bound by any theory, it is believed that either these regions containing charge groups or adjacent regions, or both, are responsible for the interaction of the t-PA molecule with its substrate and various other substances that modify its activity. In each region, charged amino acids (e.g., Arg, Asp, His, Lys, and Glu) are replaced with alanine (one mutant molecule per region) to determine the importance of that region in the overall activity of the t-PA molecule. The results are described below.

1. Construction of pRK7-t-PA

Plasmid pRK7 was used as a vector to generate t-PA mutants. PRK7 is essentially the same as pRKS (European Patent Publication No. 307,247, published March 15, 1989), except that the sequence of endonuclease restriction sites in the polylinker region is reversed between Clal and Hindin. The t-PA cDNA (Pennica et al., Natura 301, 214 (1983)) was prepared for insertion into the vector by digestion with HindIII restriction endonuclease (which cleaves 49 bp at ATG start codon 5) and Ball restriction endonuclease (which backs 276 bp). cleaves down from the TGA stop codon). This cDNA was ligated to pRK7 previously digested with HindIII and SmaI according to standard ligation methods / Maniatis et al., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory, New York (1982). This construct is called p RK7-t-PA.

2. Site-directed mutagenesis of pRK7-t-PA

Site-directed mutagenesis of t-PA c DNA according to Taylor et al., Nucl. Acids. Gap. 13, 8765 (1985)] using a kit purchased from Amersham Corporation (Cat. No. RPN 1253). To generate the desired mutants, oligonucleotides of the sequences encoding the desired amino5 acid substitutions are synthesized and used as printers. These oligonucleotides are soldered to the single-stranded p RK7-t-PA previously prepared by standard procedures / Viera et al.

Meth.Enz. 143: 3 (1987).

A mixture of three deoxyribonucleotide triphosphates, deoxyribo-adenosine triphosphate (dATP), deoxyribo-boguanosine triphosphate (dGTP) and deoxyribibimimidine triphosphate (dTTP) is combined with a modified dCTP (ds single-stranded pRK7-t-PA to which the oligonucleotide was annealed.

When DNA polymerase is added to this mixture, a single-stranded DNA identical to pRK7-t-PA is formed, except for the mutated bases. In addition, this new strand contains dCTP (ds) instead of dCTP, which serves to protect against restriction endonuclease digestion. After cutting the double-stranded heterodup25 lex template strand with a suitable restriction enzyme, the template strand is digested with ExoIII nuclease after the region containing the mutagenic oligomer. The reaction is then stopped to leave a molecule that is only partially monofilament.

Subsequently, a complete double-stranded DNA homoduplex molecule is formed with DNA polymerase in the presence of all four DNAs, ATP and DNA ligase.

The following oligonucleotides were prepared for use as a pri35 marker in the construction of pRK7-t-PA molecules by the ALA-scan method described above:

5'-GGCTGTACTGGGCCAGGCCGCA-3 '(R267A)

5'-GGCAGCCTGCCAGGGGGCGGAGGCGATGGCGGCGAAGAG-3 (D2 8 3A, H2 8 7A)

5'-CCGCTCTCCGGGCGACGCCGCGGCCGCGGCAAAGAT-3 '(K296A, H297A, R298A, R299A)

5'-GCCCCCGCACAGGAACGCCGCTCCGGGCGA-3 '(E303A, R304A)

5'-CTCCTGGAAGCAGGCGGCGGCAGA-3 '(H322A)

5'-GTGGTGGGGCGGAAACGCCGCCTGGAACGA-3 '(E3 26A, R327A)

5'-CAAGATCACCGTCAGGGCGGCGGGCGGAA-3 '(H331A, H332A)

CTCGCCAGGGACCACCGCGTATGTTGCGCCCAAGAT 5'-3 '(R339A, R342) _{5/3--TTTTTCGACTTCAAATGCCTGCGCCGCCGCGCCAGGGAC} E347A, E348A, E349A, K351) CTTATGGACAATGTATGCTGCGACTGCAAATTTCTG 5'-3' (5 3A E3, E3 5 5A, 6A K3 5) (H360, K361A , E362A) (D364A, D365A, D366A) (D369A, D371A) (K378A, D380A, R383A) (E387A, R392A) (D400A, D405A)

5'-AGTGTCATCATCGAATGCCGCAGCGACAATGTA-3 ¹ 5'-GTCATTGTCGTAAGTGGCAGCAGCGAATTCCTT-3 '

CTGCAGCAGCGCAATGGCATTGGCGTAAGTGTC 5'-3 '

CTCCTGGGCACAGGCGGACGAAGCCGATGCCAGCTGCAG 5'-3 '

AAGGCACACAGTGGCGACCACGCTGCTGCGCTGGGCACA 5'-3 '

ACACTCCGTCCAGGCCGGCAGCTGCAGGGCCGCCGGGGG 5'-3 '

5'-GGAGAGCTGACA.GGCCGTCCAGTC-3 '(E408A)

GTAGCCGGAGAGGGCACACTCCGT 5'-3 '(E410)

5'-AGGAGACAAGGCCGCAGCCGCGCCGTAGCC-3 '(K416A, H417A, E418A)

5'-TCTGACATGAGCCGCCGCCAGCGCCGCCGAATAGAA-3 '(E426A, R427A, K429A, E430A) 5' -GGATGGGTACAGTGCGACAGCAGCCTCCTT-3 '(H432A, R434A)

5'-TTGTGATGTGCAGGCGCTGGGG-3 '(R4 40A)

HU 210 541 A9

5'-GTCGGTGACTGTTGCGTTAAGTAAAGCTTGTGATGT-3 '(R445A, R449A)

5'-ACACAGCATGTTGGCGGTGACTGTTGCGTTAAGTAA-3 (R4 4 9A, D4 5 3A)

5'-GGGCCCGCCGCTCGCAGTGGCTCCAGCACA-3, (D460A, R462A)

5'-GCCCTGGCAGGCGGCGGCCAAGTTTGC-3 '(H471A, D472A)

GGGGCCTCCCGAAGCGCCCTGGCA 5'-3 '(D477A)

5'-CACCAAAGTCATGGCGCCAGCGTTCAGACA-3 '(D487A, R489A)

5'-CACACCCGGGACAGCCGCCTGTCCACA-3 '(K505A, D506A)

5'-GTAGTTGGTAACGGCTGTGTACAC-3 '(K513A)

5'-CGGTCGCATGTTGGCAGCAATCCAGGCTAGGTAGTT-3 '(D519A, R52 2A, D5 2 3A) 5'-TCCTGGTCACGGTGCCATGTTGGCACGAATCCA-3' (D523A, R526A)

3. Bacterial transformation and DNA production

Mutant t-PA constructs generated by the above steps are transformed into E. coli MM294ton A using the standard calcium chloride method (Maniatis et al., Supra) for the preparation and transformation of competent cells. M14294ton A (which is resistant to the T1 phage) is prepared by inserting a Tn10 transposon into the ton A gene and subsequently excising it in an inaccurate manner. This gene is then inserted - transposon insertion mutagenesis / Kleckner et al., J. Mol. Biol. 116, 125-159 (1977)), to E. coli MK294 (ATCC 31,446).

The DNA was extracted from each colony of bacterial transformants using the standard minprep procedure of Maniatis et al., Supra. The plasmids were further purified by passage through a Sepharose CL6B rotary column and analyzed by sequence analysis, restriction endonuclease digestion and agarose gel electrophoresis.

One of these transformants containing the plasmid encoding the mutants K296A, H297A, R298A, R29A was designated pTPA33-2 and deposited with the American Type Culture Collection on July 18, 1989 under ATCC No. 68,059.

4. Transfection of human embryo 293 kidney cells (small scale)

293 cells were grown to confluency in 6-well plates. 25 µg of the plasmid DNA mutant t-PA were dissolved in 150 μΐ containing 1 mM Tris.HCl, 0.1 mM EDTA and 0.227 M calcium chloride. To this was added dropwise (while vortexing) 150 μΐ 50 mM HEPES buffer (pH 7.35), 280 mM NaCl, 1.5 mM NaPO ₄ and the precipitate was allowed to form for 10 minutes at 25 ° C. The suspended pellet was then added to each cell on a 6-well plate and allowed to settle in an incubator for 4 hours. The medium is then aspirated and 1 ml of 20% glycerol (in PBS) is added over 30 seconds. The cells were washed twice, first with 3 ml and then with 1 ml serum-free medium. Thereafter, 3 ml of fresh medium was added and the cells were incubated for 5 days. The medium is then collected and assayed.

When single chain t-PA is the desired product, the procedure is carried out as described above, except that plasminogen depleted serum is used in the cell growth phase.

5. Transfection of human embryonic 293 kidney cells (large-scale)

Used to produce large quantities

For large-scale purification of K296A, H297-A, R298A, R299A, the transfection procedure known from Current Protocols in Molecular Biology is edited by Ausubel et al; published by Wiley Intersciensce (1988) / and modified in part as follows. A suspension of human embryonic kidney cells 293 is grown in a cell culture medium and concentrated by pellet formation. The pellet was resuspended for approx. 10 ⁸ cells / ml and the cells are washed with serum-free medium until necessary. DNA dextran solution was added at a concentration of 250 μg DNA / 500 ml cell and incubated for 90 minutes at 37 ° C with gentle shaking. DMSO was added to a final concentration of 10% and then ca. After 2 minutes, fresh medium was added to allow the cells to grow for approx. Dilute to 10 ⁶ / ml. The cells are then incubated for 7 days and the supernatants collected.

Purification of this mutant is accomplished by passing the supernatant through a column consisting of glass beads coupled with anti-t-PA goat polyclonal antibody A6. This column was pre-conditioned with PBS. After loading the supernatant, the column was equilibrated with Tris-saline buffer (0.1 M Tris-HCl, pH 7.5) and 1 M NaCl. The t-PA variant is then eluted with a solution of 0.1 M acetic acid, 0.15 M NaCl, 0.02 M arginine, and 0.01% Tween 80. Fractions were immediately neutralized with Trisbase and adjusted to 0.01 Tween 80.

6. Biological studies

A. Quantification of t-PA

The amount of t-PA in cell culture supernatants was determined by ELISA using polyclonal antibodies raised against wild-type t-PA.

B. Test S-2288

Assay S-2288 is used to measure the proteolytic activity of the mutants in both single-chain and double-chain forms. This assay is a direct study of the proteolytic activity of t-PA; t-PA cleaves the bond between the small peptide and the paranitroanilide chromophore.

Standard curve samples were prepared by diluting wild-type rt-PA with cell culture medium. Standard curve samples and rt-PA mutant samples are added to the wells of the microtiter plates. If the assay is used to measure the activity of b-chain rt-PA, an incubation step with human plasmin is also included. Human plasmin (Kabi Vitrum) is 0.13 CU (unit casein) / ml

EN 210 541 A9 is added to a final concentration. Samples were incubated for 90 minutes at room temperature. When samples are measured in single-chain form, the plasmin solution is replaced with PBS and the 90-minute incubation is omitted.

Aprotinin / Sigma, approximately 14 TIU (trypsin inhibitor units / mg) is then added to inhibit plasmin activity and the samples are incubated at room temperature for 15 minutes. A 2.16 M solution of S-2288 was diluted

1.45 m M with a solution of 0.1 M Tris, 0.106 mM NaCl, 0.02% sodium azide (pH 8.4) and 100 μΐ of the solution thus obtained. Add to each well of the microtiter plates (final volume in each well is 200 μΐ). The color development is observed at 405 nm. Determine the slope of the absorbance-time curve for each standard and sample. A standard curve is plotted against rt-PA standards, defining the slope of the absorbance time curve as a function of rt-PA activity. The relative activity concentrations of the mutants are then determined from the standard curve. The activity concentration of each mutant is divided by the mutant concentration obtained by the rt-PA ELISA and the resulting specific activity is expressed relative to wild-type t-PA, which is given as 1.0.

The data in Table I are the mean of two assays and the real activity relative to wild-type rt-PA. The results show that the two-chain form is more active (at least 1.5-fold but in some cases nearly 60-fold) than the single-chain form compared to wild-type rt-PA in all mutants shown, indicating that these mutants all of which are considered zymogens in this study.

/. spreadsheet

Zimogens in study S-2288 Relative activity relative to wild type rt-PA (where wild type is 1.0; () indicates experimental error) Mutation a chain doublechain the difference number R267A 0.33 (0.03) 0.85 (0.13) 2.6 D283A.H287A 0.08 (0.11) 0.60 (0.23) 7.5 R339A, R342 0.01 (0.01) 0.52 (0.01) 52 E347A.E348A, E349A.K351A 0.01 (0.01) 0.49 (0.18) 49 K416A.H417A, E418A 0.01 (0.01) 0.59 (0.01) 59 E426A.R427A, K429A.E430A 0.01 (0.01) 0.33 (0.04) 33 H432A, R434A 0.08 (0.01) 0.71 (0.08) 8.9 R440 0.53 (0.03) 0.78 (0.04) 1.5

C. Test S-2251

This assay is an indirect assay for t-PA activity. In this assay, plasminogen is converted to plasmin by t-PA activity and plasmin is converted to plasmin

It cleaves substrate S-2251 to release the paranitro-analyte chromophore. The production of this chromophore is measured as a function of time.

1. Fibrin stimulated S-2251 assay

Standard curve samples were prepared as described for S-2288. Samples tested in double-chain form were incubated with plasmin-Sepharose. Plasmin Sepharose is prepared by coupling approx. 20.8 CU of human plasmin (Kabi Vitrum) in 1 ml of cyanogen bromide activated Sepharose (Pharmacia). Plasmin-Segharose (50 μΐ in 5% slurry) was incubated for 90 minutes at room temperature with 150 μΐ of the sample. Subsequently, the resin was removed by centrifugation and 10 μΐ of the sample was added to the wells of a microtiter plate.

For single-stranded samples, 50 μΐ cell culture medium was added instead of resin and the incubation step was omitted. To each well was added human thrombin (10 μΐ from a 42 unit / ml solution). In each well, the reaction is initiated by adding the following cocktail (130 μΐ): 28 μΐ human Glu-plasminogen (5.3 μΜ), 10 μΐ plasminogen-free human fibrinogen (10 μΜ), 30 μΐ S-2251 ( 3 mM, KabiVitrum) and 62 μΐ PBS. Color development is monitored at 405 nm and the absorbance at 492 nm is subtracted at each point. The slope of the absorbance (time) curve is determined for each standard and for each mutant sample. A standard curve is constructed by plotting the slope of the absorbance (time) curve as a function of rt-PA concentration for rt-PA standards. The determination of the relative specific activity of the mutants has already been described in assay S-2288.

2. Fibrinogen stimulated S-2251 assay

The assay is performed as described for the fibrin-stimulated S-2251 assay, except that thrombin is replaced by PBS.

3. Plasma Clot S-2251 Test

Preparation of the standard curve sample and conversion of single-stranded rt-PA to double-stranded rt-PA using plasmin-Sepharose was performed as described previously for the fibrin-stimulated S-2251 assay. Human thrombin (10 μΐ from a 31 μg / ml solution) was added to each well of the microtiter plate. Standard and mutant samples are added to the plate and the reaction is initiated by the addition of 90 µl of a mixture of 90 µl citric acid glucose in human plasma and 10 µl of 9.1 mM S-2251 (Kabi Vitrum). Color development is measured at 405 nm and the absorbance at 492 nm is subtracted at each time point. Data analysis has already been described for the fibrin-stimulated S-2251 assay,

4. Plasma S-2251 examination

This assay was performed as described for the plasma clot S-2251 except that thrombin was substituted for PBS.

HU 210 541 A9

Mutants for zymogenicity were assayed in fibrin-dependent and plasma clot-dependent assays, and the results obtained were compared to wild-type Π. and III. is shown in Table. For single-chain mutants, values are the average of two determinations. The values given for the two-chain mutants are the average of four determinations.

II. spreadsheet

Zimogens in the fibrin-dependent S-2251 assay Relative activity relative to wild-type rt-PA (where wild-type 1.0; () indicates experimental error) Mutation a chain doublechain the difference number K296A, H297A, R 298A.R299A 1.26 (0.02) 2.82 (0.32) 2.2 E303A.R304A 1.38 (0.04) 2.13 (0.29) 1.5 H331A.H332A 1.29 (0.04) 2.19 (0.68) 1.7 R339A.R342A 0.38 (0.07) 1.04 (0.11) 2.7 K416A.H417A, E418A 0.21 (0.04) 0.96 (0.09) 4.6 E426, R427A, K429A.E430A 0.14 (0) 0.76 (0.07) 5.4 H432A.R434A 0.16 (0.08) 0.99 (0.13) 6.2 D460A, R462A 0.68 (0.04) 1.04 (0.08) 1.5

III. spreadsheet

Zimogens in the plasma clot-dependent S-2251 assay Relative activity relative to wild-type rt-PA (where wild-type 1.0; () indicates experimental error) Mutation a chain doublechain the difference number D283A.H287A 0.53 (0.01) 0.82 (0.04) 1.6 K296A.H297A, R298A.R299A 0.42 (0) 1.29 (0.20) 3.1 E3O3A, R3O4A 0.90 (0.03) 1.34 (0.10) 1.5 H331A.H332A 1.09 (0.09) 1.61 (0.68) 1.5 R339A.R342A 0.19 (0.03) 0.79 (0.10) 4.2 E347A.E348A, E349A.K351A 0.38 (0.05) 0.97 (0.10) 2.6 D364A, D365A, D366A 0.88 (0.03) 1.46 (0.15) 1.7 K416A.H417A, E418A 0.19 (0.05) 0.77 (0.05) 4.1 E426A.R427A, K429A.E430A 0.11 (0.01) 0.66 (0.12) 6 H432A.R434A 0.05 (0.01) 0.38 (0.05) 7.6 H445A.R449A 0.80 (ND) 1.19 (0.11) 1.5

Zimogens in the plasma clot-dependent S-2251 assay Relative activity relative to wild-type rt-PA (where wild-type 1.0; () indicates experimental error) Mutation a chain doublechain the difference number R449A, D453 0.79 (0.01) 1.22 (0.13) 1.5 D460A, R462A 0.21 (0.01) 0.32 (0.02) 1.5 D477A 0.11 (0.02) 0.25 (0.08) 2.3

ND = not determined

It's I-HI. See Table IV below. Table I below indicates which assays each mutant exhibits zymogenicity.

ARC. spreadsheet

Mutation Zymogen a S-2288 fibrin 2251 plasma- thrombi 2251 R267A X D283A, H287A X X K296A.H297A, R298A.R299A X X E303, R304A X X H331A.H332A X X R339A.R342A X X X E347A, E348A, E349A, K351 X X D364A, D365A, D366A X K416A, H417A, E418A X X X E426, R427A, K429A, E430 X X X H432A.R434A X X X R440 X H445A.R449A X R449A.D453A X D460A.R462A X X D477A X

The IV. The zymogenic t-PAs listed in Table II are analyzed in the S2251 fibrin-specific assay in both single-chain and double-chain forms. The results for the single-chain and two-chain t-PA variants are shown in Figs. Table.

Articles V and VI Table VII summarizes the data in Table VII. table. It can be seen that the IV. Each of the zymogenic rt-PAs in Table 1A is specific for fibrin and / or plasma clot relative to wild-type t-PA. X means that the fibrin-fibrinogen or plasma clot-to-plasma ratio is greater than 1.5 in the S-2251 assay and is determined in accordance with Sections V and VI. in Table.

HU 210 541 A9

Table V.

Specificity of rt-PA Variants (Single-Chain) FIBRIN AND PLASMA BLOOD Activities are relative to wild-type rt-PA (where wild-type is 1.0) Mutant fg Fb Fb / Fg E.g PC PC / P1 R276A Avg SD 0.53 (0.00) 0.92 (0.01) 1.74 0.24 (0.01) 0.7 (0.09) 3.00 D283A H287A Avg sd 0.59 (0.02) 0.78 (0.05) 1.32 0.19 (0.07) 0.53 (0.01) 2.76 K296A, H297A, R298A, R299A Avg SD 0.29 (0.05) 1.26 (0.02) 4.40 0.14 (0.03) 0.42 (0.00) 3.00 E303, R304A Avg SD 0.68 (0.09) 1.38 (0.04) 2.04 0.35 (0.01) 0.90 (0.03) 2.61 H331, H332 Avg SD 1.19 (0.06) 1.29 (0.04) 1.08 1.12 (0.13) 1.09 (0.09) 0.97 R339A, R342 Avg SD 0.34 (0.00) 0.38 (0.07) 1.12 0.02 (0.03) 0.19 (0.03) 9.50 E347A, E348A, E349A, K351 Avg SD 0.50 (0.09) 0.87 (0.15) 1.75 0.13 (0.04) 0.38 (0.05) 2.88 D364A, D365A, D366A Avg SD 0.66 (0.03) 1.50 (0.04) 2.27 0.28 (0.04) 0.88 (0.03) 3.14 K416A, H417A, E418A Avg SD 0.34 (0.01) 0.21 (0.04) 0.60 0.10 (0.04) 0.19 (0.05) 1.95 E426A, R427A, K429A, E430A Avg SD 0.21 (0.01) 0.14 (0.00) 0.68 0.07 (0.01) 0:11 (0.01) 1.50 H432A, R434A Avg SD 0.16 (0.01) 0.16 (0.08) 1.00 0.08 (0.010) 0.05 (0.01) 0.60 R440

HU 210 541 A9

Specificity of rt-PA Variants (Single-Chain) FIBRIN AND PLASMA BLOOD Activities are relative to wild-type rt-PA (where wild-type is 1.0) Mutant fg Fb Fb / Fg E.g PC PC / P1 Avg SD 0.62 (0.08) 1.02 (0.18 1.64 0.48 (0.04) 0.86 (0.10) 1.81 H445A, R449A Avg SD 0.52 1.12 2.15 0.24 0.80 3.33 R449A, D453 Avg SD 0.58 (0.01) 1.16 (0.11) 2.00 0.28 (0.01) 0.79 (0.01) 2.87 D460A, R462A Avg SD 0.13 (0.03) 0.68 (0.04) 5.19 0.10 (0.05) 0.21 (0.01) 2.16 D477A Avg SD 0.08 (0.00) 0.09 (0.01) 1.06 0.03 (0.04) 0.11 (0.02) 4.20

Fg = Fibrinogen

Fb = Fibrin

Pl = Plasma

PC = Plasma Clot

Avg = Avg

SD = Standard deviation

VI. spreadsheet

Specificity of rt-PA Variants (DUPLEX) FIBRIN AND PLASMA BLOOD The activities are relative to wild type rt-PA (where wild type is 1.0)

Mutant fg Fb Fb / Fg E.g PC PC / P1 R267A ÁtlSD 0.85 (0.21 0.97 (0.15) 1.14 0.70 (0.08) 0.86 (0.11) 1.23 D283A, H287A ÁtlSD 0.77 (0.12) 1.00 (0.08) 1.31 0.68 (0.14) 0.82 (0.04) 1.19 K296A, H297A, R298A, R299A ÁtlSD 0.31 (0.14) 2.82 (0.32) 9.24 0.24 (0.15) 1.29 (0.20) 5.50 E3O3A, R304A ÁtlSD 0.56 (0.23) 2.13 (0.29) 3.79 0.26 (0.08) 1.34 (0.10) 5.10 H331, H332 ÁtlSD 1.03 (0.86) 2.19 (0.68) 2.12 1.03 (0.67 1.61 (0.68) 1.56 R339A, R342 ÁtlSD 0.55 (0.18) 1.04 (0.11) 1.89 0.23 (0.05) 0.79 (0.10) 3.38 E347A, E348A, E349A, K351

HU 210 541 A9

Specificity of rt-PA Variants (DUPLEX) FIBRIN AND PLASMA BLOOD The activities are relative to wild type rt-PA (where wild type is 1.0)

Mutant fg Fb Fb / Fg E.g PC PC / P1 Avg SD 0.76 (0.24) 1.33 (0.12) 1.76 0.44 (0.11) 0.97 (0.10) 2.20 D364A, D365A, D366A Avg SD 0.73 (0.17) 1.77 (0.23) 2.44 0.26 (0.12) 1.46 (0.15) 5.68 K416A, H417A.E418 Avg SD 0.77 (0.13) 0.96 (0.09) 1.24 0.42 (0.08) 0.77 (0.05) 1.82 e426, R427A, K429A, E430 Avg SD 0.38 (0.27) 0.76 (0.07) 2.01 0.24 (0.07) 0.66 (0.12) 2.80 H432A, R434A Avg SD 0.16 (0.05) 0.99 (0.13) 6.40 0.16 (0.05) 2.31 R440 ÁtlSD 0.51 (0.11) 0.92 (0.10) 1.81 0.51 (0.08) 0.90 (0.09) 1.78 H445A, R449A ÁtlSD 0.62 (0.16) 1.46 (0.10) 2.36 0.29 (0.09) 1.19 (0.11) 4.06 R449A, D453 Avg SD 0.74 (0.14) 1.50 (0.23) 2.04 0.36 (0.12) 1.22 (0.13) 3.36 D460A, R462A Avg SD 0.18 (0.12) 1.04 (0.08) 5.91 0.12 (0.02) 0.32 (0.02) 2.59 D447A Avg SD 0.12 (0.07) 0.10 (0.02) 0.89 0.11 (0.03) 0.25 (0.08) 2.24

Fg = Fibrinogen

Fb - Fibrin

Pl = Plasma

PC = Plasma Clot

Avg = Avg

SD = Standard deviation

VII. spreadsheet

Specificity of fibrin Plasma blood clot specificity Mutant 1-chain 2-chain 1-chain 2-chain R267A X X D283A.H287A X K296A, H297A, R298A, R299A X X X X E303, R304A X X X X H331A.H332A X X R339A.R342A X X X E347A, E348A, E349A, K351 X X X X D364A, D365A, D366A X X X X

HU 210 541 A9

Specificity of fibrin Plasma blood clot specificity Mutant 1-chain 2-chain 1-chain 2-chain K416A, H417A, E418A X X E426, R427A, K429A, E430 X X X H432A.R434A X X R440 X X X X H445A.R449A X X X X R449A.D453A X X X X D460A, R462A X X X X D477A X X

There is a strong correlation between the rt-PA variants that exhibit fibrin and / or plasma clot specificity and those that exemplify the concept of zymogenicity as defined above. In addition, two rtPA variants were found to be fibrin-specific but not zymogenic compared to wild-type rt-PA. VIII. Table 5 presents data for the S-2251 assay for fibrin-specific and plasma-clot specific variants.

Vili. spreadsheet

FIBRIN AND PLASMA BLOOD-SPECIFIC, NON-ZIMOGENE Rt-PA VARIATIONS

Mutant Fg / lch Fb / lch Fb / Fglch Eg / lch PC / lch PC / Pllch E408A ÁtlSD 0.35 (0.01) 0.79 (0.06) 2.28 0.19 (0.04) 0.47 (0.01) 2.51 E410 ÁtlSD 0.61 (0.08) 0.90 (0.04) 1.47 0.51 (0.11) 0.74 (0.05) 1.44 Mutant Fg / 2ch Fb / 2ch Fb / Fg2ch Eg / 2ch PC / 2ch PC / P12ch E408A ÁtlSD 0.34 (0.18) 0.89 (0.11) 2.61 0.24 (0.08) 0.64 (0.04) 2.72 E410 ÁtlSD 0.55 (0.13) 0.92 (0.09) 1.67 0.48 (0.10) 0.88 (0.08) 1.84

Fg = Fibrinogen Fb = Fibrin P1 = Plasma PC = Plasma Clot lch = single chain 2ch = double chain Avg = Mean SD = Standard deviation

Deposit of materials

The following culture was deposited with American Type

Culture Collection (ATCC; 12301 Parklawn Drive, 50 Rockville, Maryland, USA):

Tribe ATCCdeponálási song Date of deposit pTPA33-2 in E. coli MM294tonA 68 059 07/07/1989

This deposit was made in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and its Implementing Rules (the Budapest Treaty). This ensures the maintenance of a live breeding stock for 30 years from the date of deposit. The organism is provided by the ATCC in accordance with the rules of the Budapest Treaty and is the subject of a contract between Genentech and the ATCC providing permanent and unrestricted access to the inoculated culture derivative from the grant of the relevant US patent or any US or foreign patent application. from the date of publication, the earliest date to be taken into account, and to provide for inoculated derivatives of the culture25

EN 210,541 A9 to a person designated and authorized by the President of the United States Patent and Trademark Office pursuant to 35 USC 122 & and the corresponding presidential decree (including CFR Section 1.14 & having regard to Decree 886 OG 638).

Applicant of the present invention undertakes to immediately replace the deposited culture with a viable representative of the same culture, after notification, if the culture is destroyed, lost or destroyed despite being cultivated under appropriate conditions. The availability of the deposited strain shall not be construed as a license for the practice of the invention in respect of rights granted under its jurisdiction in accordance with any government patent law.

The foregoing is considered sufficient to enable the practitioner to carry out the invention. The present invention is not limited to the scope defined by the deposited structure, since the preferred embodiment of the deposited is only one illustration of an object of the invention, and any construct which is functionally equivalent thereto is within the scope of the invention. The deposit of the material does not justify that the description herein is not sufficient to accomplish any object of the invention, including the best solution, nor should it be construed as limiting the scope of the specific example it represents. In addition to the examples described and illustrated herein, many modifications of the invention may be apparent to those skilled in the art and are within the scope of the invention.

PATENT CLAIMS

Claims (14)

PATENT CLAIMS A human tissue plasminogen activator (t-PA) variant having an amino acid substitution at position 296, 297, 298 or 299 of the wild-type human t-PA, or a combination thereof, K296A, H297A, R298A, R299A tPA variant, wherein said variant has one or more of the following biological properties: zymogen character, fibrin specificity or plasma clot specificity relative to wild-type human t-PA. The variant of claim 1, wherein the amino acid used for substitution is alanine, glycine, serine, threonine, asparagine, glutamine, valine, leucine, isoleucine, phenylalanine or tyrosine. The variant of claim 2, wherein the amino acid used for substitution is alanine, serine, threonine, asparagine, glutamine, phenylalanine or tyrosine. The variant of claim 3, wherein the amino acid used for substitution is alanine, serine or threonine. 5. A human tissue plasminogen activator (t-PA) variant comprising a single amino acid sequence 296 of the wild-type t-PA, 297, 298, or 299. 6. A method of identifying human tissue plasminogen activator (tPA) variants having one or more of the following biological properties relative to wild-type human t-PA: zymogen character, fibrin specificity, or plasma clot specificity, including (a) an amino acid residue at position 296, 297, 298 or 299 of the wild-type human t-PA or any combination thereof except for the t-PA variant K296A, H297A, R298A, R299A, and (b) screening the resulting human t-PA variant for one or more of the following biological properties: zymogen character, fibrin specificity and plasma clot specificity. A DNA molecule encoding the t-PA variant of claim 1. 8. A DNA molecule encoding the t-PA variant of claim 5. A replicable expression vector comprising and capable of expressing in a transformed host cell the DNA molecule of claim 7. A replicable expression vector comprising and capable of expressing in a transformed host cell the DNA molecule of claim 8. 11. A host cell transformed with an expression vector according to claim 9. The host cell of claim 11, which is a prokaryotic cell. The host cell of claim 11, which is a eukaryotic cell. A method of treating a vascular condition or disease in a mammal, comprising administering to the mammal an effective amount of a composition comprising an amino acid sequence 296, 297, 298 or 299 of the wild-type human t-PA. or any combination of these sites, a therapeutically effective amount of a tissue plasminogen activator variant having an amino acid substitution, with the exception of variant K296A, H297A, R298A, R299A, wherein said variant has one or more of the following biological features: specificity or plasma clot specificity relative to wild-type human t-PA in admixture with a pharmaceutically acceptable carrier.