EA046901B1 - COMPOSITIONS WITH PCSK9 mRNA AND METHODS OF THEIR APPLICATION - Google Patents

Description

The present invention includes a sequence listing that has been filed electronically in ASCII format and is thus incorporated herein by reference in its entirety. The listed ASCII copy of the file, created on October 29, 2013, is named 121301-00420_SL.txt and is 433512 bytes in size.

State of the art

Proprotein convertase subtilisin/kexin 9 (PCSK9) is a member of the subtilisin serine protease family. The other eight mammalian subtilisin proteases, PCSK1-PCSK8 (also called PC1/3, PC2, furin, PC4, PC5/6, PACE4, PC7 and S1P/SKI-1), are proprotein convertases that process a wide range of secretory pathway proteins and play role in various biological processes (Bergeron, F. (2000) J. Mol. Endocrinol. 24, 1-22, Gensberg, K., (1998) Semin. Cell Dev. Biol. 9, 11-17, Seidah, N. G. ( 1999) Brain Res. 848, 45-62, Taylor, N. A., (2003) FASEB J. 17, 1215-1227 and Zhou, A., (1999) J. Chem. 274, 20745-20748).

It has been suggested that PCSK9 plays a role in cholesterol metabolism. PCSK9 mRNA expression was suppressed in mice by dietary cholesterol (Maxwell, K. N., (2003) J. Lipid Res. 44, 2109-2119), activated by statins in HepG2 cells (Dubuc, G., (2004) Arterioscler. Thromb . Vasc. Biol. 24, 1454-1459) and was activated in sterol regulatory element binding protein (SREBP) transgenic mice (Horton, J. D., (2003) Proc. Natl. Acad. Sci. USA 100, 12027- 12032), as is the case with enzymes involved in cholesterol biosynthesis and low-density lipoprotein receptor (LDLR). Additionally, missense mutations in PCSK9 have been found to be associated with a form of autosomal dominant hypercholesterolemia (Hchola3) (Abifadel, M., et al. (2003) Nat. Genet. 34, 154-156, Timms, K. M., ( 2004) Hum. Genet. 114, 349-353, Leren, T. P. (2004) Clin. 65, 419-422). PCSK9 may also play a role in determining LDL cholesterol levels in the general population, as single nucleotide polymorphism (SNP) species have been associated with cholesterol levels in the Japanese population (Shioji, K., (2004) J. Hum. Genet. 49, 109-114) .

Autosomal dominant hypercholesterolemia (ADH) types are monogenic diseases in which patients present with elevated total and LDL cholesterol levels, tendon xanthomas, and premature atherosclerosis (Rader, D. J., (2003) J. Clin. Invest. 111, 17951803). The pathogenesis of the ADH types and the recessive form, autosomal recessive hypercholesterolemia (ARH) (Cohen, J.C., (2003) Curr. Opin. Lipidol. 14, 121-127), is attributed to impaired liver uptake of LDL. ADH can be caused by mutations in the LDLR that interfere with the uptake of LDL, or by mutations in the protein on LDL, apolipoprotein B, which binds to the LDLR. ARH is caused by mutations in the ARH protein, which is required for endocytosis of the LDLR-LDL complex through its interaction with clathrin. Thus, if PCSK9 mutations are causative in Hchola3 families, then PCSK9 appears to play a role in receptor-mediated LDL uptake.

Overexpression studies indicate a role for PCSK9 in regulating LDLR levels and thus LDL uptake by the liver (Maxwell, K. N. (2004) Proc. Natl. Acad. Sci. uSa 101, 7100-7105, Benjannet, S., et al. (2004) ) J. Biol. Chem. 279, 48865-48875, Park, S. W., (2004) J. Biol. 279, 50630-50638). Adenovirus-mediated overexpression of mouse or human PCSK9 for 3 or 4 days in mice resulted in elevated total and LDL cholesterol levels; this effect is not observed in LDLR knockout animals (Maxwell, K. N. (2004) Proc. Natl. Acad. Sci. USA 101, 7100-7105, Benjannet, S., et al. (2004) J. Biol. Chem. 279, 48865-48875, Park, S. W., (2004) J. Biol. 279, 50630-50638). In addition, overexpression of PCSK9 resulted in a dramatic reduction in hepatic LDLR protein without affecting LDLR mRNA levels, SREBP protein levels, or the ratio of nuclear to cytoplasmic SREBP protein.

Although hypercholesterolemia itself is asymptomatic, prolonged elevation of serum cholesterol can lead to atherosclerosis. Chronically elevated serum cholesterol over decades promotes the formation of atherosclerotic plaques in the arteries, which can lead to progressive stenosis or even complete occlusion of the affected arteries. In addition, smaller plaques can break off and cause a blood clot to form and block blood flow, leading to, for example, myocardial infarction and/or stroke. If the formation of stenosis or blockage is gradual, then the blood supply to tissues and organs is slowly reduced until the functions of the organ are impaired.

Accordingly, there is a need in the art for effective treatments for ASD.

- 1 046901 PCSK9-related diseases such as hyperlipidemia, eg hypercholesterolemia.

Brief description of the invention

As described in more detail below, compositions containing RNAi agents, such as double-stranded mRNA agents, targeting PCSK9 are disclosed herein. Also disclosed are methods of using the compositions of the present invention to inhibit PCSK9 expression and to treat pathologies associated with PCSK9 expression, such as hypercholesterolemia.

Accordingly, in one aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, wherein the antisense strand contains a region complementary to a portion of the mRNA encoding PCSK9, where each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

Isense: 5' n _p -N _a -(XXX) iN _b -YYY -N _b -(Ζ Ζ Z)j -N _a - n _q 3' antisense: 3' n _p '-N _a '-(X'X'X') _k -N _b '-Y'Y'Y'-N _b '-(Z'Z'Z')iN _a '- n _q '5' (III), where each of i, j, k and l are independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each Nb and Nb' independently represents an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides;

Nb modifications are different from Y modifications, and Nb' modifications are different from Y' modifications; and wherein the sense strand is conjugated to at least one ligand.

In one embodiment, i is 0; j equals 0; i equals 1; j equals 1; both i and j are 0, or both i and j are 1. In another embodiment, k is 0; l equals 0; k equals 1; l equals 1; both k and l are 0; or both k and l equal 1.

In one embodiment, XXX is complementary to X'X'X', YYY is complementary to Y'Y'Y', and ZZZ is complementary to Z'Z'Z'.

In one embodiment, the YYY motif is located at or adjacent to a sense strand cleavage site.

In one embodiment, the Y'Y'Y' motif is located at positions 11, 12, and 13 of the antisense strand from the 5' end.

In one embodiment, Y' is 2'-O-methyl.

In one embodiment, formula (III) is represented by formula (IIIa):

Isense: 5' n _P -N _a -YYY -N _a - n _q 3' antisense: 3'n _P '-N _a '-ΥΎΎ'-N _a '-n _q '5' (Illa).

In another embodiment, formula (III) is represented by formula (IIIb):

Isense: 5' n _p -N _a -YYY -N _b -ZZZ -N _a - n _q 3' antisense: 3'n _P '-N _a '-Y'Y'Y'-Ny-Z'Z'Z '-N _a '-n _q -5' (IIIb), where each Nb and Nb' independently represents an oligonucleotide sequence containing 1-5 modified nucleotides.

In yet another embodiment, formula (III) is represented by formula (IIIc):

Isense: 5' n _p -N _a -XXX -N _b -Y Υ Υ -N _a - n _q 3' antisense: 3' n _P '-N _a '- X'X'X'-N _b '- Υ 'ΥΎ'- N _a '- n _q 5' (IIIc), where each N _b and N _b ' independently represents an oligonucleotide sequence containing 1-5 modified nucleotides.

In one embodiment, formula (III) is represented by formula (IIId):

Isense: 5' n _p -N _a -XX X- N _b -Υ Υ Υ -N _b -ZZZ -N _a - n _q 3' antisense: 3' n _P '-N _a - X'X'X'- N _b '-Y'Y'Y'-N _b '-Z'Z'Z'- N _a - n _q - 5' (IIId), where each Nb and Nb' independently represents an oligonucleotide sequence containing 1 -5 modified nucleotides, and each Na and Na' independently represents an oligonucleotide sequence containing 2-10 modified nucleotides.

In one embodiment, the double-stranded region is 15-30 base pairs in length

- 2 046901 ex. In another embodiment, the double-stranded region is 17-23 base pairs in length. In yet another embodiment, the double-stranded region is 17-25 base pairs in length. In one embodiment, the double-stranded region is 23-27 base pairs in length. In another embodiment, the double-stranded region is 19-21 base pairs in length. In another embodiment, the double-stranded region is 21-23 base pairs in length. In one embodiment, each strand contains 15-30 nucleotides.

In one embodiment, the nucleotide modifications are selected from the group consisting of LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C-allyl, 2'-fluoro, 2 '-deoxy, 2'hydroxyl and their combinations. In another embodiment, the nucleotide modifications are 2'-O-methyl or 2'-fluoro modifications.

In one embodiment, the ligand is one or more GalNAc derivatives linked via a divalent or trivalent branched linker. In another embodiment, the ligand is

In one embodiment, the ligand is attached to the 3' end of the sense strand.

In one embodiment, the RNAi agent is conjugated to a ligand, as shown in the following diagram:

where X is O or S. In a particular embodiment, X is O.

In one embodiment, the agent further comprises at least one phosphorothioate or methylphosphonate internucleotide linkage.

In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 3' end of one strand. In one embodiment, the strand is an antisense strand. In another embodiment, the thread is a semantic thread.

In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at the 5' end of one strand. In one embodiment, the strand is an antisense strand. In another embodiment, the thread is a semantic thread.

In one embodiment, the phosphorothioate or methylphosphonate internucleotide linkage is at both the 5' and 3' ends of one strand. In one embodiment, the strand is an antisense strand.

In one embodiment, the base pair at position 1 of the 5' end of the antisense strand of the duplex is an AU base pair.

In one embodiment, the Y nucleotides have a 2'-fluoro modification.

In one embodiment, the Y' nucleotides have a 2'-O-methyl modification.

In one embodiment, p'>0. In another embodiment, p'=2.

In one embodiment, q'=0, p=0, q=0, and the overhanging nucleotides p' are complementary to the target mRNA. In another embodiment, q'=0, p=0, q=0, and the overhanging nucleotides p' are not complementary to the target mRNA.

In one embodiment, the sense strand contains a total of 21 nucleotides and the antisense strand contains a total of 23 nucleotides.

In one embodiment, at least one n _p ' is linked to an adjacent nucleotide by

- 3 046901 by the phosphorothioate bond.

In one embodiment, all np' are linked to adjacent nucleotides via phosphorothioate bonds.

In one embodiment, the RNAi agent is selected from the group of RNAi agents listed in Table. 1, 2, 9, 10, 12 and in Fig. 12.

In one embodiment, the RNAi agent is selected from the group consisting of AD-53815, AD-56663, AD-56658, AD-56676, AD-56666, AD-57928, and AD-60212.

In another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, wherein the antisense strand comprises a region , complementary to a portion of the mRNA encoding PCSK9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

sense: 5' n _p -N _a -(XXX) iN _b -YYY -N _b -(Ζ Ζ Z)j -N _a - n _q 3' antisense: 3' n _p '-N _a '-(X'X'X') _k -N _b '-Y'Y'Y'-N _b '-(Z'Z'Z')iN _a '- n _q '5' (III), where each of i, j, k and l are independently equal to 0 or 1; each of p, p', q and q' is independently equal to 06; each Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each Nb and Nb' independently represents an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each np, np', nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification Y'; and wherein the sense strand is conjugated to at least one ligand.

In yet another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding PCSK9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

sense: 5' n _P -N _a -(XXX) iN _b -YYY -N _b -(Ζ ZZ)j -N _a - n _q 3' antisense: 3' n _P '-N _a '-(X'X 'X')kN _b '-Y'Y'Y'-N _b '-(Z'Z'Z')i-Na'- n _q '5' (III), where each of i, j, k and l is independently equal to 0 or 1;

each n _p , n _q and n _q ', each of which may or may not be present, is independently a protruding nucleotide; each of p, q and q' is independently equal to 0-6;

np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each N _b and N _b ' independently represents an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification Y'; and wherein the sense strand is conjugated to at least one ligand. In a further aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, wherein the antisense strand comprises a region , complementary to a portion of the mRNA encoding PCSK9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

- 4 046901

Isense: 5' n _p -N _a -(XXX) iN _b -YYY -N _b -(ZZZ)j -N _a - n _q 3' antisense: 3' n _p '-N _a '-(X'X'X')kN _b '-Y'Y'Y'-N _b '-(Z'Z'Z')i-Na'- n _q '5' (III), where each of i, j, k and l independently equals 0 or 1;

each np, nq and nq', each of which may or may not be present, is independently an overhanging nucleotide;

each of p, q and q' is independently equal to 0-6;

np'>0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each Nb and Nb' independently represents an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

Nb modifications are different from Y modifications, and Nb' modifications are different from Y' modifications; and wherein the sense strand is conjugated to at least one ligand, where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, wherein the antisense strand comprises a region , complementary to a portion of the mRNA encoding PCSK9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

Isense: 5' n _P -N _a -(XXX) iN _b -YYY -N _b -(ZZZ)j -N _a - n _q 3' antisense: 3' n _P '-N _a '-(X'X'X') _k -N _b '-Y'Y'Y'-N _b '-(Z'Z'Z')iN _a '- n _q '5' (III), where each of i, j, k and l is independently equal to 0 or 1; each n _p , n _q and n _q ', each of which may or may not be present, is independently a protruding nucleotide; each of p, q and q' is independently equal to 0-6;

n _p '>0, and at least one n _p ' is linked to an adjacent nucleotide via a phosphorothioate bond;

each Na and Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each Nb and Nb' independently represents an oligonucleotide sequence containing 0-10 nucleotides that are either modified or unmodified, or combinations thereof;

each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-Omethyl- or 2'-fluoro modifications;

modifications N _b differ from modification Y, and modifications N _b ' differ from modification Y';

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In yet another aspect, the present invention provides RNAi agents, for example, double-stranded RNAi agents, capable of inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell, wherein the double-stranded RNAi agent comprises a sense strand complementary to the antisense strand, wherein the antisense strand comprises a region complementary to a portion of the mRNA encoding PCSK9, wherein each strand is from about 14 to about 30 nucleotides in length, wherein the double-stranded RNAi agent is represented by formula (III):

Isense: 5' n _p -N _a -YYY - N _a - n _q 3' antisense: 3' n _p '-N _a - Y'Y'Y'- N _a '- n _q '5' (Sha), wherein n _p , n _q and n _q ', each of which may or may not be present, are each independently a protruding nucleotide;

each of p, q and q' is independently equal to 0-6;

- 5 046901 np' >0, and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond;

each N _a and N _a ' independently represents an oligonucleotide sequence containing 0-25 nucleotides that are either modified or unmodified, or combinations thereof, each sequence containing at least two nucleotides modified in various ways;

each of YYY and YYY' independently represents one motif of three identical modifications of three consecutive nucleotides, and where the modifications are 2'-O-methyl or 2'-fluoro modifications;

wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, where the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

The present invention also provides cells, vectors, host cells and pharmaceutical compositions containing the double-stranded RNAi agents of the present invention.

In one embodiment, the present invention provides an RNAi agent selected from the group consisting of RNAi agents listed in Table. 1, 2, 9, 10, 12 and in Fig. 12.

In some embodiments, the RNAi agent is administered using a pharmaceutical composition.

In preferred embodiments, the RNAi agent is administered in solution. In some such embodiments, the siRNA is administered in an unbuffered solution. In one embodiment, the siRNA is administered in water. In other embodiments, the siRNA is administered using a buffer solution, such as acetate buffer, citrate buffer, prolamine buffer, carbonate buffer, or phosphate buffer, or any combination thereof. In some embodiments, the buffer solution is phosphate buffered saline (PBS).

In one embodiment, the pharmaceutical compositions further comprise a lipid composition. In one embodiment, the lipid composition includes LNP or XTC. In another embodiment, the lipid composition includes MC3.

In one aspect, the present invention provides methods for inhibiting the expression of PCSK9 in a cell. The methods include contacting a cell with an RNAi agent, such as a double-stranded RNAi agent, or a vector according to the present invention and maintaining the cell obtained in step (a) for a time sufficient to cause cleavage of the PCSK9 gene mRNA transcript, thereby inhibiting expression of the PCSK9 gene in the cell.

In one embodiment, the cell is located in a subject.

In one embodiment, the subject is a human.

In one embodiment, PCSK9 expression is inhibited by at least about 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95%.

In another aspect, the present invention provides methods for treating a subject with a disorder mediated by the expression of PCSK9. The methods include administering to a subject a therapeutically effective amount of an RNAi agent, such as a double-stranded RNAi agent, or a vector of the present invention, thereby treating the subject.

In one embodiment, the subject is a human.

In one embodiment, the person has hypercholesterolemia.

In one embodiment, an RNAi agent, such as a double-stranded RNAi agent, is administered at a dose of about 0.01 to about 10 mg/kg, about 0.5 to about 50 mg/kg, about 10 to about 30 mg/kg , from about 10 to about 20 mg/kg, from about 15 to about 20 mg/kg, from about 15 to about 25 mg/kg, from about 15 to about 30 mg/kg, or from about 20 to about 30 mg/kg .

In one embodiment, the RNAi agent, such as a double-stranded RNAi agent, is administered subcutaneously or intravenously.

In one embodiment, the RNAi agent is administered in a dosing regimen that includes a saturation phase followed by a maintenance phase, where the saturation phase includes the administration of a dose of 2, 1, or 0.5 mg/kg five times per week, and where the maintenance phase includes the administration of a dose of 2 , 1 or 0.5 mg/kg once, twice or three times a week, once every two weeks, once every three weeks, once a month, once every two months, once every three months, one once every four months, once every five months or once every six months.

In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group consisting of once about every 12 hours, once about every 24 hours, once about every 48 hours, once about every 72 hours, and once about every 96 hours. h.

In yet another aspect, the present invention provides methods for treating hypercholesterolemia in a subject. The methods include administering to a subject a therapeutically effective amount

- 6 046901 an RNAi agent, for example a double-stranded RNAi agent, or a vector according to the present invention, thereby treating a subject.

In one embodiment, the subject is a primate or rodent. In another embodiment, the subject is a human.

In one embodiment, an RNAi agent, such as a double-stranded RNAi agent, is administered at a dose of about 0.01 to about 10 mg/kg, or about 0.5 to about 50 mg/kg. In another embodiment, the double-stranded RNAi agent is administered at a dose of from about 10 to about 30 mg/kg.

In one embodiment, the RNAi agent, such as a double-stranded RNAi agent, is administered subcutaneously or intravenously.

In one embodiment, the RNAi agent is administered in a dosing regimen that includes a saturation phase followed by a maintenance phase, where the saturation phase includes administration of a dose of 2 mg/kg, 1 mg/kg, or 0.5 mg/kg five times per week, and where the maintenance phase includes administration of a dose of 2 mg/kg, 1 mg/kg or 0.5 mg/kg once, twice or three times a week, once every two weeks, once every three weeks, once a month, once once every two months, once every three months, once every four months, once every five months or once every six months.

In one embodiment, the RNAi agent is administered in two or more doses. In a specific embodiment, the RNAi agent is administered at intervals selected from the group consisting of once about every 12 hours, once about every 24 hours, once about every 48 hours, once about every 72 hours, and once about every 96 hours. h.

In one embodiment, the methods further include determining the LDLR genotype or α-phenotype of the subject.

In one embodiment, administration results in a decrease in the subject's serum cholesterol level.

In one embodiment, the methods further comprise determining the subject's serum cholesterol level.

The present invention is further illustrated by the following detailed description and drawings.

Brief description of graphic materials

Fig. 1 is a graph showing that, at all three doses tested, there was a dose-dependent effect with AD-48400 conjugated to GalNAc. AD-48399 conjugated to GalNAc serves as a control.

Fig. 2A and 2B are graphs showing the in vivo efficacy and duration of response for the indicated siRNAs.

In fig. 3 is a table showing the sequences of the sense (SEQ ID NO: 16331642, respectively, in order of occurrence) and antisense (SEQ ID NO: 1643-1652, respectively, in order of occurrence) strands of duplexes analyzed for in vivo effectiveness and for prototype optimization .

Fig. 4 is a graph showing the results of in vivo performance assays for prototype optimization.

Fig. 5 is a graph showing the results of in vivo dose response assays performed on PCSK9 transgenic mice. PCSK9 protein levels were determined by ELISA seventy-two hours after single doses of 10 mg/kg, 3 mg/kg, 1 mg/kg, and 0.3 mg/kg AD-57928.

Fig. 6 is a graph showing PCSK9 protein levels in the serum of PCSK9 transgenic mice following administration of AD-57928 at doses of 5x2 mg/kg during the saturation phase and at doses of 1x2 mg/kg or 2x2 mg/kg during the maintenance phase.

Fig. 7 is a graph showing PCSK9 protein levels in the serum of PCSK9 transgenic mice following administration of AD-57928 at doses of 5x1 mg/kg during the saturation phase and at doses of 1x1 mg/kg or 2x1 mg/kg during the maintenance phase.

Fig. 8 is a graph showing PCSK9 protein levels in the serum of PCSK9 transgenic mice following administration of AD-57928 at doses of 5x0.5 mg/kg during the saturation phase and at doses of 1x0.5 mg/kg or 2x0.5 mg/kg during maintenance phases.

Fig. 9 is a graph showing the results of in vivo dose response assays performed on PCSK9 transgenic mice. PCSK9 protein levels were determined by ELISA seventy-two hours after administration of a single dose of 0.3 mg/kg siRNA.

Fig. 10 is a graph showing the amount of AD-57928 and AD-58895 per nanogram of liver from wild-type C57B6 mice following administration of a single 1 mg/kg dose of AD-57928 or AD-58895.

Fig. 11 is a graph showing the amount of AD-57928 and AD-58895 expressed as % theoretical amount in the liver of wild-type C57B6 mice following administration of a single 1 mg/kg dose of AD-57928 or AD-58895.

In fig. 12A is a table showing mRNA agents according to

- 7 046901 but the present invention, containing optimized sequences compared to the sequences of AD-57928. In fig. 12A discloses sense sequences as SEQ ID NOs: 1653-1658, respectively, in order of occurrence, and antisense sequences as SEQ ID NOs: 1659-1664, respectively, in order of occurrence.

Fig. 12B is a graph showing the IC ₅₀ values of the indicated mRNA agents.

Fig. 13 is a graph showing the level of the indicated mRNA agents in the liver of wild-type mice following administration of a single dose of 1 mg/kg of the indicated mRNA agent.

Fig. 14A is a graph showing the amount of PCSK9 protein in nonhuman primate serum, expressed as the percentage of PCSK9 remaining relative to PCSK9 levels in pre-selected blood, following administration of the indicated mRNA agents at qdx5 + qwx3.

Fig. 14B is a graph showing the absolute amount of PCSK9 protein in the serum of nonhuman primates following administration of the indicated mRNA agents at qdx5 + qwx3.

Fig. 15 is a graph showing the amount of low-density lipoprotein cholesterol (LDL or LDLc) in the serum of nonhuman primates, expressed as the percentage of LDL remaining relative to LDL levels in pre-selected blood, after administration of the indicated mRNA agents at qdx5 + qwx3.

Fig. 16A is a graph showing the amount of low-density lipoprotein cholesterol (LDL or LDLc) in the serum of nonhuman primates, expressed as a percentage of the average number of LDL levels in pre-sampled blood, after administration of AD-57928 at a dose of 2 mg/kg at q1w and at dose 1 mg/kg at 2xw.

Fig. 16B is a graph showing the amount of PCSK9 protein in serum compared to that in preselected blood of nonhuman primates following administration of AD57928 at 2 mg/kg at qlw and at 1 mg/kg at 2xw.

Fig. 17A is a graph showing the amount of low-density lipoprotein cholesterol (LDL or LDLc) in the serum of nonhuman primates, expressed as a percentage of the average number of LDL levels in pre-sampled blood, after administration of AD-57928 at a dose of 2 mg/kg at 2xw and a single dose of 25 mg/kg. The last dose for the group, 2 mg/kg at 2xw, was administered on day 36.

Fig. 17B is a graph showing the amount of PCSK9 protein in serum compared to that in preselected blood of nonhuman primates following administration of AD57928 at 2 mg/kg at 2xw and a single dose of 25 mg/kg.

Fig. 18 is a graph showing the amount of low-density lipoprotein cholesterol (LDL or LDLc) in the serum of nonhuman primates, expressed as the percentage of LDL remaining relative to LDL levels in preselected blood, after administration of the indicated mRNA agents at qdx5 + qwx3.

Fig. 19 is a graph showing the amount of low-density lipoprotein cholesterol (LDL or LDLc) in the serum of nonhuman primates, expressed as the percentage of LDL remaining relative to LDL levels in preselected blood, after administration of the indicated mRNA agents at qdx5 + qwx3.

Detailed Description of the Invention

The present invention provides compositions containing RNAi agents, for example, double-stranded mRNA agents targeting PCSK9. Also disclosed are methods of using the compositions of the present invention to inhibit PCSK9 expression and to treat pathologies associated with PCSK9 expression, such as hypercholesterolemia.

I. Definitions.

In order that the present invention may be more easily understood, relevant terms are first defined. In addition, it should be noted that where this document lists a value or range of values of a variable, values and ranges intermediate to the listed values are also intended to be part of the present invention.

The singular form is used throughout this document to denote one or more (i.e., at least one) grammatical entities of an article. By way of example, an element means one element or multiple elements, such as a plurality of elements.

The expression including is used herein to denote the phrase including without limitation and is used interchangeably with it.

The expression or is used herein to refer to the expression and/or and is used interchangeably with it unless the context clearly indicates otherwise.

As used herein, PCSK9 refers to the proprotein convertase subtilisin/kexin 9 gene or proprotein convertase subtilisin/kexin 9 protein. PCSK9 is also known as FH3,

- 8 046901

HCHOLA3, NARC-1 or NARCl. The expression PCSK9 includes human PCSK9, the amino acid or nucleotide sequence of which can be found, for example, in GenBank under accession number GI:299523249; mouse PCSK9, the amino acid or nucleotide sequence of which can be found, for example, in GenBank under accession number GI: 163644257; Rat PCSK9, the amino acid or nucleotide sequence of which can be found, for example, in GenBank under accession number GI:77020249. Additional examples of PCSK9 mRNA sequences are readily available through, for example, GenBank.

As used herein, a target sequence refers to the contiguous portion of the nucleotide sequence of an mRNA molecule formed during transcription of the PCSK9 gene, including the mRNA that is the RNA processing product of the primary transcription product.

As used herein, the expression strand containing sequence refers to an oligonucleotide containing a chain of nucleotides that is characterized by a sequence designated using standard nucleotide nomenclature.

Each of G, C, A and U generally means a nucleotide that contains guanine, cytosine, adenine and uracil as a base, respectively. T and dT are used interchangeably herein and refer to a deoxyribonucleotide where the nucleic base is thymine, such as deoxyribothymine, 2'-deoxythymidine or thymidine. However, it will be understood that the expression ribonucleotide or nucleotide or deoxyribonucleotide can also mean a modified nucleotide, which is described in more detail below, or a nucleotide-mimicking replacement fragment. It is well known to one skilled in the art that guanine, cytosine, adenine and uracil can be replaced by other moieties without significantly changing the base-pairing properties of the oligonucleotide containing the nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide containing inosine as a base may form a base pair with nucleotides containing adenine, cytosine or uracil. Therefore, nucleotides containing uracil, guanine or adenine can be replaced in the nucleotide sequences according to the present invention by nucleotides containing, for example, inosine. Sequences containing such replacement fragments are embodiments of the present invention.

The expressions mRNA, RNAi agent, mRNA agent, RNA interference agent, used interchangeably herein, mean an agent that contains RNA as defined herein and that mediates targeted cleavage of RNA -transcript through the RNA-induced silencing complex (RISC) pathway. mRNA directs sequence-specific destruction of mRNA through a process known as RNA interference (RNAi). The mRNA modulates, eg inhibits, the expression of PCSK9 in a cell, eg a cell of a subject, such as a mammalian subject.

In one embodiment, the RNAi agent of the present invention includes a single-stranded RNA that interacts with a target RNA sequence, for example a PCSK9 mRNA target sequence, to direct cleavage of the target RNA. Without wishing to be bound by theory, it is believed that long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a type III ribonuclease-like enzyme, is involved in the processing of dsRNA into short interfering RNAs of 19-23 base pairs in length with characteristic two-base overhangs at the 3' end (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). Thus, in one aspect, the present invention relates to a single-stranded RNA (siRNA) generated within a cell that promotes the formation of a RISC complex to effect silencing of a target gene, i.e. PCSK9 gene. Accordingly, the expression siRNA is also used herein to explain RNAi, which is described above.

In another embodiment, the RNAi agent may be a single-stranded siRNA that is introduced into a cell or organism to inhibit the target mRNA. Single-stranded RNAi agents bind to Argonaute 2, which has edonuclease activity, from RISC, which then cleaves the target mRNA. Single-stranded siRNAs are typically 15–30 nucleotides long and are chemically modified. The design and testing of single-stranded siRNAs are described in US Pat. No. 8,101,348 and in Lima et al., (2012) Cell 150: 883-894, the entire contents of each of which are therefore incorporated herein by reference. Any antisense nucleotide sequences described herein can be used as single-stranded siRNA that are described herein or that are chemically modified by the methods described in Lima et al., (2012) Cell 150:883-894.

In another embodiment, the mRNA for use in the compositions, applications and methods

- 9 046901 bang according to the present invention is a double-stranded RNA, and is referred to herein as a double-stranded RNAi agent, a double-stranded RNA molecule (dsRNA), a dsRNA agent, or a dsRNA. The expression dsRNA means a complex of ribonucleic acid molecules with a duplex structure, containing two back-to-back and essentially complementary strands of nucleic acids, considered as having a sense and antisense orientation with respect to the target RNA, i.e. PCSK9 gene. In some embodiments of the present invention, double-stranded RNA (dsRNA) triggers the cleavage of target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

In general, the majority of the nucleotides on each strand of a dsRNA molecule are ribonucleotides, but, as described in detail herein, each or both strands may also include one or more nucleotides that are not ribonucleotides, such as a deoxyribonucleotide and/or a modified nucleotide. Additionally, as used herein, the RNAi agent may include chemically modified ribonucleotides; the RNAi agent may involve significant modifications to multiple nucleotides. Such modifications may include all types of modifications disclosed herein or known in the art. Any such modifications that are used in the siRNA molecule are covered by the expression RNAi agent within the context of the specification and claims.

The two strands forming a duplex structure may be different parts of one larger RNA molecule, or they may be separate RNA molecules. In cases where two strands are part of one larger molecule and are therefore connected by an uninterrupted chain of nucleotides from the 3' end of one strand to the 5' end of the corresponding other strand, forming a duplex structure, the connecting strand of RNA is called a hairpin loop. When two strands are joined covalently in a manner other than an uninterrupted chain of nucleotides from the 3' end of one strand to the 5' end of the corresponding other strand forming a duplex structure, the connecting structure is called a linker. RNA strands can have the same or different numbers of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest dsRNA strand minus any overhangs that are present in the duplex. In addition to the duplex structure, the RNAi agent may contain one or more nucleotide overhangs.

In one embodiment, the RNAi agent of the present invention is a 24-30 nucleotide dsRNA that interacts with a target RNA sequence, such as a PCSK9 mRNA target sequence, to direct cleavage of the target RNA. Without wishing to be bound by theory, long double-stranded RNA introduced into cells is cut into siRNA by a type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a type III ribonuclease-like enzyme, is involved in the processing of dsRNA into short interfering RNAs of 19-23 base pairs in length with characteristic two-base overhangs at the 3' end (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC), in which one or more helicases unwind the siRNA duplex, allowing the complementary antisense strand to direct target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases in RISC cleave the target to induce silencing (Elbashir, et al., (2001) Genes Dev. 15:188). As used herein, a nucleotide overhang refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of the RNAi agent when the 3' end of one strand of the RNAi agent extends beyond the 5' end of the other strand or vice versa. A blunt end or blunt end means that there are no unpaired nucleotides at the end of the double-stranded RNAi agent, i.e. no nucleotide overhang. The blunt-ended RNAi agent is a dsRNA that is double-stranded throughout its entire length, i.e. does not have a nucleotide overhang at either end of the molecule. The RNAi agents of the present invention include RNAi agents with nucleotide overhangs at one end (ie, agents with one overhang and one blunt end) or with nucleotide overhangs at both ends.

The expression antisense strand means a strand of a double-stranded RNAi agent that includes a region that is substantially complementary to the target sequence (eg, human PCSK9 mRNA). As used herein, the expression region complementary to a portion of the mRNA encoding transthyretin means a region of the antisense strand that is substantially complementary to a portion of the PCSK9 mRNA sequence. In cases where the complementarity region is not completely complementary to the target sequence, then mismatches are most tolerant in the terminal regions and, if present, typically occur in the terminal region or regions, for example, within 6, 5, 4, 3 or 2 nucleotides from 5'-end and/or 3'-end.

The expression sense strand as used herein means a dsRNA strand that includes a region that is substantially complementary to a region of the antisense strand.

As used herein, the expression cleavage site refers to a region that is adjacent to the cleavage site. The cleavage site is the target site for which

- 10 046901 rum is splitting. In some embodiments, the cleavage site comprises three bases at either end of the cleavage site and adjacent to it. In some embodiments, the cleavage site comprises two bases at either end of the cleavage site and adjacent to it. In some embodiments, the cleavage site is primarily located at a site adjacent to nucleotides 10 and 11 of the antisense strand, and the cleavage site comprises nucleotides 11, 12, and 13.

As used herein and unless otherwise indicated, the expression complementary when used to describe a first nucleotide sequence with respect to a second nucleotide sequence means the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with the oligonucleotide or polynucleotide , containing a second nucleotide sequence, as will be understood by one skilled in the art. Such conditions may, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA, 50°C or 70°C for 12-16 hours followed by wash. Other conditions may apply, such as physiologically relevant conditions that may occur in the body. For example, the complementary sequence is sufficient to provide the corresponding nucleic acid function, such as RNAi. One skilled in the art will be able to determine the set of conditions most suitable for analyzing the complementarity of two sequences in accordance with the end use of the hybridized nucleotides.

The sequences may be completely complementary to any one where there is base pairing of the nucleotides of the first nucleotide sequence with the nucleotides of the second nucleotide sequence along the entire length of the first and second nucleotide sequences. However, when a first sequence is characterized herein as being substantially complementary to a second sequence, then the two sequences may be completely complementary or they may form one or more, but typically no more than 4, 3, or 2, mismatched base pairs during hybridization, while maintaining the ability to hybridize under conditions most suited to their end use. However, when two oligonucleotides are intended to form one or more single-stranded overhangs upon hybridization, such overhangs will not be considered mismatches for purposes of determining complementarity. For example, a dsRNA containing one oligonucleotide of 21 nucleotides in length and another oligonucleotide of 23 nucleotides in length, where the longer oligonucleotide contains a 21 nucleotide sequence that is fully complementary to the shorter oligonucleotide, may still be referred to as fully complementary for purposes described herein.

Complementary sequences used herein may also include or may be formed entirely from non-Watson-Crick base pairs and/or base pairs derived from unnatural and modified nucleotides to the extent that the above requirements are met in relation to their ability to hybridize. Such non-Watson-Crick base pairs include, but are not limited to, ambiguous or Hoogsteen G:U base pairing.

The expressions complementary, fully complementary, and substantially complementary as used herein may be used to refer to a base match between a sense strand and an antisense dsRNA strand, or between an antisense dsRNA strand and a target sequence, as will be understood from the context of their use.

As used herein, a polynucleotide that is substantially complementary to at least a portion of messenger RNA (mRNA) means a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., mRNA encoding PCSK9), including the 5' UTR, open reading frame (ORF) or 3'-UTR. For example, a polynucleotide is complementary to at least a portion of PCSK9 mRNA if the sequence is substantially complementary to a continuous portion of the PCSK9-encoding mRNA.

The expression inhibition as used herein is used interchangeably with contraction, silencing, down-regulation, suppression and other similar expressions, and includes any level of inhibition.

The phrase inhibition of PCSK9 expression as used herein includes inhibition of the expression of any PCSK9 gene (such as, for example, a mouse PCSK9 gene, a rat PCSK9 gene, a monkey PCSK9 gene, or a human PCSK9 gene), as well as variants (for example, naturally occurring variants) or PCSK9 gene mutants. Thus, the PCSK9 gene may be a wild-type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the context of cells, a group of cells, or an organism that has been genetically manipulated.

Inhibition of PCSK9 gene expression includes any level of inhibition of the PCSK9 gene, such as at least partial inhibition of PCSK9 gene expression, such as at least about 5% inhibition, at least about 10% inhibition, at least about 15% inhibition , at least about 20%, at least about 25%, at least an example

- 11 046901 but by 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about by 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96 %, at least about 97%, at least about 98%, or at least about 99%.

PCSK9 gene expression can be assessed based on the level of any variable associated with PCSK9 gene expression, for example, PCSK9 mRNA level, PCSK9 protein level, or serum lipid levels. Inhibition can be assessed by a decrease in the absolute or relative level of one or more of these variables compared to the control level. The control level can be any type of control level that is used in the art, such as a baseline level before drug administration or a level determined in a similar subject, cell, or sample that is untreated or treated with a control (such as, for example, a buffer-only control or control with inactive agent).

The phrase contacting a cell with a double-stranded RNAi agent as used herein includes contacting the cell in any possible manner. Contacting a cell with a double-stranded RNAi agent includes contacting a cell with an RNAi agent in vitro or contacting a cell with an RNAi agent in vivo. Bringing into contact can be carried out directly or indirectly. Thus, for example, the RNAi agent can be brought into physical contact with the cell by a separate implementation of the method or, alternatively, the RNAi agent can be placed in an environment that allows or causes the agent to come into contact with the cell.

Cell contacting in vitro can be accomplished, for example, by incubating the cell with an RNAi agent. Contacting a cell in vivo can be accomplished, for example, by injecting an RNAi agent into or near the tissue in which the cell is located, or by injecting an RNAi agent into another area, bloodstream, or subcutaneous space such that the agent will subsequently reach the tissue containing the cell that needs to be brought into contact with the product. For example, the RNAi agent may contain and/or be linked to a ligand, for example a GalNAc3 ligand, which directs the RNAi agent to a site of interest, such as the liver. Combinations of in vitro and in vivo contact methods are also possible. With respect to the methods of the present invention, the cell can also be contacted with an RNAi agent in vitro and subsequently transplanted into a subject.

The expressions patient or subject as used herein are intended to include either a human or a non-human animal, preferably a mammal, such as a monkey. Most preferably, the subject or patient is a human.

PCSK9-associated disease as used herein is meant to include any disease associated with the PCSK9 gene or protein. Such diseases may be caused, for example, by overproduction of the PCSK9 protein, mutations in the PCSK9 gene, abnormal cleavage of the PCSK9 protein, abnormal interactions between PCSK9 and other proteins, or other endogenous or exogenous substances. Typical PCSK9-associated diseases include types of lipidemia, for example, types of hyperlipidemia and other forms of lipid imbalance, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart disease and circulatory diseases.

A therapeutically effective amount as used herein is meant to include an amount of an RNAi agent that, when administered to a patient to treat a PCSK9-associated disease, is sufficient to effectively treat the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease) . The therapeutically effective amount may vary depending on the RNAi agent, the route of administration of the agent, the disease and its severity and medical history, age, weight, family history, genetic makeup, stage of pathological processes mediated by PCSK9 expression, types of previous or concomitant treatments, if any such, and other individual characteristics of the patient being treated.

A prophylactically effective amount as used herein is intended to include an amount of an RNAi agent that, when administered to a subject who has not yet experienced or exhibited symptoms of a PCSK9-associated disease, but who may be predisposed to the disease, is sufficient to cause to prevent or relieve a disease or one or more symptoms of a disease. Disease mitigation involves slowing the progression of a disease or reducing the severity of a disease that develops later. Prevention

- 12 046901 The clinically effective amount may vary depending on the RNAi agent, route of administration, disease risk and medical history, age, weight, family history, genetic makeup, types of prior or concomitant treatment, if any, and other individual characteristics of the patient being treated.

A therapeutically effective amount or a prophylactically effective amount also includes an amount of an RNAi agent that produces some desired local or systemic effect at an acceptable benefit/risk ratio relative to any treatment. The RNAi agents used in the methods of the present invention can be administered in an amount sufficient to obtain an acceptable benefit/risk ratio for such treatment.

The expression sample as used herein includes the selection of similar fluids, cells or tissues isolated from the body of the subject, as well as fluids, cells or tissues present in the body of the subject. Examples of biological fluids include blood, serum and serous fluids, plasma, cerebrospinal fluid, intraocular fluids, lymph, urine, saliva, and the like. Tissue samples may include samples from tissues, organs, or local sites. For example, samples may be obtained from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of liver cells, such as, for example, hepatocytes). In preferred embodiments, the sample obtained from the subject means blood or plasma obtained from the subject. In further embodiments, the sample obtained from the subject means liver tissue (or its components) obtained from the subject.

II. mRNA according to the present invention.

Described herein are improved double-stranded RNAi agents that inhibit expression of the PCSK9 gene in a cell, such as a cell from a subject, such as a mammal, such as a human, with a lipid disorder, such as hypercholesterolemia, and uses of such double-stranded RNAi agents.

The double-stranded RNAi agents of the present invention include those with chemical modifications that are disclosed, for example, in US Provisional Application No. 61/561,710, filed November 18, 2011, the entire contents of which are incorporated herein by reference.

As shown herein and in Provisional Application No. 61/561710, excellent results can be obtained by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense strand and/or antisense strand of the RNAi agent, particularly at the cleavage site or next to it. In some embodiments, the sense strand and antisense strand of the RNAi agent may be otherwise completely modified. The introduction of such motifs disrupts the pattern of modifications, if any, of the semantic and/or antisense strand. The RNAi agent, for example the sense strand, may optionally be conjugated to a GalNAc derivative ligand. The resulting RNAi agents have excellent gene silencing activity.

More specifically, it has been unexpectedly discovered that in cases where the sense strand and the antisense strand of a double-stranded RNAi agent are completely modified to have one or more motifs of three identical modifications of three consecutive nucleotides at the cleavage site of at least one strand of the RNAi agent or close to it, then the gene silencing activity of the RNAi agent was best enhanced.

Accordingly, the present invention provides double-stranded RNAi agents capable of inhibiting the expression of a target gene (ie, the proprotein convertase subtilisin/kexin 9 (PCSK9) gene) in vivo. The RNAi agent contains a sense strand and an antisense strand. Each RNAi strand can vary in length from 12 to 30 nucleotides. For example, each strand may be 14 to 30 nucleotides in length, 17 to 30 nucleotides in length, 25 to 30 nucleotides in length, 27 to 30 nucleotides in length, 17 to 23 nucleotides in length, 17 to 21 nucleotide in length, 17 to 19 nucleotides in length, 19 to 25 nucleotides in length, 19 to 23 nucleotides in length, 19 to 21 nucleotides in length, 21 to 25 nucleotides in length, or 21 to 23 nucleotides in length.

The sense strand and the antisense strand typically form a double-stranded RNA duplex (dsRNA), also referred to herein as an RNAi vehicle. The duplex region of the RNAi agent can be 12-30 base pairs in length. For example, a duplex region may be 14-30 bp in length, 17-30 bp in length, 27-30 bp in length, 17-23 bp in length, 17-21 bp in length, 17-19 bp nucleotides in length, 1925 nucleotide pairs in length, 19-23 nucleotide pairs in length, 19-21 nucleotide pairs in length, 21-25 nucleotide pairs in length, or 21-23 nucleotide pairs in length. In another example, the duplex region is selected from 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 and 27 nucleotides in length.

In one embodiment, the RNAi agent may contain one or more overhangs and/or blocking groups at the 3' end, 5' end, or both ends of one or both

- 13 046901 chains. The overhang may be 1-6 nucleotides in length, for example, 2-6 nucleotides in length, 1-5 nucleotides in length, 2-5 nucleotides in length, 1-4 nucleotides in length, 2-4 nucleotides in length, 1-3 nucleotides in length, 2-3 nucleotides in length, or 1-2 nucleotides in length. The protrusions may be the result of one thread being longer than the other, or two threads of the same length being staggered. The overhang may form a mismatch with the target mRNA, or it may be complementary to the gene sequences with which the target interaction occurs, or it may have a different sequence. The first and second strands may also be connected, for example, by additional bases to form a hairpin or by other non-base linkers.

In one embodiment, each of the nucleotides in the overhang of the RNAi agent may independently be a modified or unmodified nucleotide, including, without limitation, a 2'-modified sugar such as 2-F, 2'-O-methyl, thymidine (T), 2'-O-methoxyethyl5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo) and any combinations thereof. For example, a TT can be a salient sequence for any end on any strand. The overhang may form a mismatch with the target mRNA, or it may be complementary to the gene sequences with which the target interaction occurs, or it may have a different sequence.

The 5' or 3' overhangs of the sense strand, antisense strand, or both strands of the RNAi agent may be phosphorylated. In some embodiments, the overhang(s) comprise(s) two nucleotides with a phosphorothioate between the two nucleotides, wherein the two nucleotides may be the same or different. In one embodiment, a protrusion is present at the 3' end of the sense strand, the antisense strand, or both strands. In one embodiment, this 3' overhang is present on the antisense strand. In one embodiment, this 3' overhang is present on the sense strand.

The RNAi agent may comprise only one protrusion, which can enhance the interfering activity of RNAi without affecting its overall stability. For example, the single-stranded overhang may be located at the 3' end of the sense strand or, alternatively, at the 3' end of the antisense strand. RNAi may also have a blunt end located at the 5' end of the antisense strand (or 3' end of the sense strand) or vice versa. Typically, the antisense strand of RNAi has a nucleotide overhang at the 3' end and a blunt end at the 5' end. Without wishing to be bound by theory, the asymmetric blunt end at the 5' end of the antisense strand and the knob at the 3' end of the antisense strand promote the inclusion of the guide strand in the RISC process.

In one embodiment, the RNAi agent is a blunt-ended oligomer, 19 nucleotides in length, where the sense strand contains at least one motif of three 2'E modifications of three consecutive nucleotides at positions 7, 8, 9 from 5 'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In another embodiment, the RNAi agent is a blunt-ended oligomer, 20 nucleotides in length, wherein the sense strand contains at least one motif of three 2'E modifications of three consecutive nucleotides at positions 8, 9, 10 from 5 'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In yet another embodiment, the RNAi agent is a blunt-ended oligomer 21 nucleotides in length, wherein the sense strand contains at least one motif of three 2'E modifications of three consecutive nucleotides at positions 9, 10, 11 from 5'end. The antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end.

In one embodiment, the RNAi agent comprises a 21 nucleotide sense strand and a 23 nucleotide antisense strand, wherein the sense strand contains at least one motif of three 2' E modifications of three consecutive nucleotides at positions 9, 10, 11 from 5' -end; the antisense strand contains at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end, where one end of the RNAi agent is blunt while the other end contains a knob of 2 nucleotides. Preferably, the 2-nucleotide overhang is at the 3' end of the antisense strand. In cases where a 2-nucleotide overhang is at the 3' end of the antisense strand, there may be two phosphorothioate internucleotide bonds between the terminal three nucleotides, with two of the three nucleotides being overhanging nucleotides and the third nucleotide being a paired nucleotide adjacent to the overhanging nucleotide. In one embodiment, the RNAi agent further comprises two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand. In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of the motifs, are modified nucleotides. In one embodiment, each residue is independently modi

- 14 046901 is modified with 2-O-methyl or 3'-fluorine, for example, with an alternating motif. Optionally, the RNAi agent further contains a ligand (preferably GalNAc3).

In one embodiment, the RNAi agent comprises sense and antisense strands, wherein the RNAi agent comprises a first strand with a length that is at least 25 and at most 29 nucleotides, and a second strand with a length that is at most 30 nucleotides, at least at least one motif of three 2'-O-methyl modifications of three consecutive nucleotides at positions 11, 12, 13 from the 5' end; wherein the 3' end of the first strand and the 5' end of the second strand form a blunt end, and the second strand is 1-4 nucleotides longer at the 3' end than the first strand, wherein the duplex region is at least 25 nucleotides in length, and the second strand is sufficiently complementary to the target mRNA for at least 19 nucleotides of the length of the second strand to reduce expression of the target gene, wherein the RNAi agent is introduced into the mammalian cells, and wherein cleavage of the RNAi agent by a dicer preferably results in an siRNA containing 3' end of the second strand, thereby reducing expression of the target gene in the mammal. Optionally, the RNAi agent further comprises a ligand.

In one embodiment, the sense strand of the RNAi agent comprises at least one motif of three identical modifications of three consecutive nucleotides, where one of the motifs is at a cleavage site in the sense strand.

In one embodiment, the antisense strand of an RNAi agent may also contain at least one motif of three identical modifications of three consecutive nucleotides, where one of the motifs is at or adjacent to a cleavage site in the sense strand.

For an RNAi agent with a duplex region that is 17-23 nucleotides in length, the antisense strand cleavage site is typically around positions 10, 11, and 12 from the 5' end. Thus, motifs from three identical modifications can be located in positions 9, 10, 11; 10, 11, 12 positions; 11, 12, 13 positions; 12, 13, 14 positions or 13, 14, 15 positions of the antisense strand, with the counting starting from the ^1st nucleotide from the 5' end of the antisense strand or the counting starting from the ^1st paired nucleotide in the duplex region from the 5' end of the antisense strand. The cleavage site in the antisense strand may also vary according to the length of the RNAi duplex region from the 5' end.

The sense strand of an RNAi agent may contain at least one motif of three identical modifications of three consecutive nucleotides at the strand cleavage site; and the antisense strand may be characterized by at least one motif of three identical modifications to three consecutive nucleotides at or near the cleavage site of the strand. In cases where the sense strand and the antisense strand form a dsRNA duplex, the sense strand and the antisense strand may be aligned such that one three-nucleotide motif in the sense strand and one three-nucleotide motif in the antisense strand have at least one nucleotide overlap , i.e. at least one of the three motif nucleotides in the sense strand forms a base pair with at least one of the three motif nucleotides in the antisense strand. Alternatively, at least two nucleotides may overlap, or all three nucleotides may overlap.

In one embodiment, the sense strand of the RNAi agent may contain multiple motifs of three identical modifications of three consecutive nucleotides. The first motif may be at or near the strand cleavage site, and the other motifs may be a flanking modification. The expression flanking modification as used herein means a motif occurring in another part of a strand that is separate from a motif at or adjacent to a cleavage site on the same strand. The flanking modification is either adjacent to the first motif or separated by at least one or more nucleotides. In cases where the motifs are directly adjacent to each other, then the chemical structures of the motifs are different from each other, and when the motifs are separated by one or more nucleotides, then the chemical structures may be the same or different. Two or more flanking modifications may be present. For example, when two flanking modifications are present, each flanking modification may be at one end of the first motif that is at or adjacent to the cleavage site or on both sides of the leading motif.

Like the sense strand, the antisense strand of an RNAi agent may contain multiple motifs of three identical modifications of three consecutive nucleotides, with at least one of the motifs located at or near a strand cleavage site. A given antisense strand may also contain one or more flanking modifications, in alignment similar to flanking modifications that may be present on the sense strand.

In one embodiment, the flanking modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two terminal nucleotides at the 3' end, 5' end, or both ends of the strand.

In another embodiment, the flanking modification in the sense strand or antisense strand of the RNAi agent typically does not include the first one or first two paired nucleotides in the duplex region at the 3' end, 5' end, or both ends of the strand.

- 15 046901

In cases where each of the sense strand and antisense strand of the RNAi agent contains at least one flanking modification, the flanking modifications may fall on the same end of the duplex region and have an overlap of one, two, or three nucleotides.

In cases where each of the sense strand and antisense strand of the RNAi agent contains at least two flanking modifications, the sense strand and antisense strand can be aligned such that two modifications, each from the same strand, fall on one end of the duplex region with overlap one, two or three nucleotides; two modifications, each from one strand, fall on the other end of the duplex region with an overlap of one, two or three nucleotides; two modifications of the same strand fall on either side of the leading motif with an overlap of one, two, or three nucleotides in the duplex region.

In one embodiment, each nucleotide in the sense strand and antisense strand of the RNAi agent, including nucleotides that are part of the motifs, can be modified. Each nucleotide may be modified by the same or a different modification, which may include one or more changes to one or both of the unlinked phosphate oxygen atoms and/or one or more linked phosphate oxygen atoms; changing the ribose sugar component, for example, the 2'-hydroxyl in the ribose sugar; complete replacement of the phosphate fragment with dephosphorized linkers; modification or replacement of a naturally occurring base; and replacement or modification of a ribose phosphate backbone.

Since nucleic acids are polymers of subunits, many of the modifications occur at a position that is repeated in the nucleic acid, such as modification of a base, or a phosphate moiety, or an unlinked O-phosphate moiety. In some cases the modification will occur at all positions in the nucleic acid under consideration, but in many cases it will not. As an example, the modification may occur only at the 3'- or 5'-terminal position, may occur only at the terminal region, for example, at the terminal nucleotide position or in the last 2, 3, 4, 5 or 10 nucleotides of the strand. The modification may occur in a double-stranded region, a single-stranded region, or both. The modification may occur only in a double-stranded region of RNA or may occur only in a single-stranded region of RNA. For example, a phosphorothioate modification at the unbound O position may occur at only one or both ends, may occur only at a terminal region, such as the terminal nucleotide position or the last 2, 3, 4, 5, or 10 nucleotides of a strand, or may occur in the double-stranded and single-stranded regions, in particular at the end. The 5' end or ends may be phosphorylated.

This may be possible, for example, to improve stability, to incorporate specific bases into overhangs, or to incorporate modified nucleotides or nucleotide substituents into single-stranded overhangs, for example, a 5' or 3' overhang or both. For example, it may be desirable to include purine nucleotides in the protrusions. In some embodiments, all or some of the bases in the 3' or 5' overhang may be modified, for example, using the modifications described herein. Modifications may include, for example, the use of modifications at the 2' position of the ribose sugar using modifications that are known in the art, for example, the use of deoxyribonucleotides, 2'-deoxy-2'-fluoro- (2'-F) or 2'- O-methyl modified instead of the ribose sugar of the nucleobase, and modification of the phosphate group, such as phosphorothioate modification. The overhangs may not be homologous to the target sequence.

In one embodiment, each sense strand and antisense strand residue is independently modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl or 2'-fluorine. Threads may contain several modifications. In one embodiment, each residue of the sense strand and the antisense strand is independently modified with 2'-O-methyl or 2'-fluoro.

At least two different modifications are typically present in the sense strand and the antisense strand. These two modifications may be 2'-O-methyl or 2'-fluoro modifications or others.

In one embodiment, N _a and/or N _b has alternating pattern modifications. The expression alternating motif as used herein means a motif with one or more modifications, each modification occurring at alternating nucleotides on the same strand. The expression alternating nucleotide can mean one for every two nucleotides, or one for every three nucleotides, or a similar pattern. For example, if A, B, and C each represent one type of nucleotide modification, then the alternating motif could be AVAVAVAVAVAV..., AAVVAAVVAAVV..., AAVAAVAAVVAAV..., AAAAAAAAAAAV..., AAVAVVVAAVVVV... or ABCAWSAWSAVS. .. etc.

The type of modifications contained in the alternating motif may be the same or different. For example, if each of A, B, C, D represents one type of nucleotide modification, then the alternating pattern, i.e. modification of every second nucleotide may be the same, but each of the sense strand or antisense strand can be selected from several possible modifications

- 16 046901 fications in an alternating motif, such as ABAVAV..., ASASAS..., BDBDBD... or CDCDCD... etc.

In one embodiment, the RNAi agent of the present invention comprises a modification pattern for a sense strand alternating motif that is shifted relative to the modification pattern for an antisense strand alternating motif. The shift may be such that a modified group of nucleotides of the sense strand corresponds to a group of nucleotides of the antisense strand modified in a different way and vice versa. For example, when pairing a sense strand with an antisense strand into a dsRNA duplex, the alternating motif in the sense strand may begin with ABABAB from the 5' to 3' end of the strand, and the alternating motif in the antisense strand may begin with BABABA from the 5' to 3' end. end of the thread in the duplex section. As another example, the alternating motif in the sense strand may begin with AABBAABB from the 5' to 3' end of the strand, and the alternating motif in the antisense strand may begin with BBAABBAA from the 5' to 3' end of the strand in the duplex region, so that between the semantic thread and the antisense thread there is a complete or partial shift in modification patterns.

In one embodiment, the RNAi agent initially contains a pattern of alternating 2'-O-methyl modification and 2'-E modification motif on the sense strand and initially has a shift in the pattern of alternating 2'-O-methyl modification and 2' motif -E-modifications in the antisense strand, i.e. A 2'-O-methyl-modified nucleotide in the base pairs of the sense strand with a 2'-E-modified nucleotide in the antisense strand and vice versa. 1 position in the sense strand may begin with a 2'-E modification, and 1 position in the antisense strand may begin with a 2'-Omethyl modification.

The introduction of one or more motifs of three identical modifications of three consecutive nucleotides into the sense strand and/or antisense strand disrupts the original pattern of modifications present in the sense strand and/or antisense strand. Such disruption of the sense and/or antisense strand modification pattern by introducing one or more motifs of three identical modifications of three consecutive nucleotides into the sense and/or antisense strand unexpectedly increases gene silencing activity against the target gene.

In one embodiment, when a motif of three identical modifications of three consecutive nucleotides is introduced into any of the strands, the modification of the nucleotide following the motif is a modification other than the modification of the motif. For example, part of the sequence containing the motif is ...NaYYYNb..., where Y represents a modification of the motif of three identical modifications of three consecutive nucleotides, and N _a and N _b represent a modification of the nucleotide following the YYY motif, which is different from modification Y, and where N _a and N _b may be the same or different modifications. Alternatively, N _a and/or Nb may or may not be present when the flanking modification is present.

The RNAi agent may further comprise at least one phosphorothioate or methylphosphonate internucleotide linkage. Modification of a phosphorothioate or methylphosphonate internucleotide bond can occur at any nucleotide of the sense strand, or the antisense strand, or both strands at any position in the strand. For example, a modification of an internucleotide bond may occur at each nucleotide of the sense strand and/or antisense strand; each internucleotide linkage modification may occur in an alternating pattern in the sense strand and/or antisense strand; either the sense strand or the antisense strand may contain both internucleotide linkage modifications in an alternating pattern. The alternating internucleotide linkage modification pattern of the sense strand may be the same or different from the antisense strand, and the alternating internucleotide linkage modification pattern of the sense strand may be characterized by a shift relative to the alternating internucleotide linkage modification pattern of the antisense strand.

In one embodiment, RNAi has a modification of a phosphorothioate or methylphosphonate internucleotide linkage at the overhang. For example, the overhang may contain two nucleotides with a phosphorothioate or methylphosphonate internucleotide linkage between the two nucleotides.

Internucleotide linkage modifications can also be made to connect overhanging nucleotides to terminal paired nucleotides in a duplex region. For example, at least 2, 3, 4, or all of the overhanging nucleotides may be linked through a phosphorothioate or methylphosphonate internucleotide linkage, and optionally, additional phosphorothioate or methylphosphonate internucleotide linkages may be present connecting the overhanging nucleotide to a paired nucleotide that follows the overhanging nucleotide. For example, there may be at least two phosphorothioate internucleotide bonds between the terminal three nucleotides, where two of the three nucleotides are overhang nucleotides and the third is a paired nucleotide adjacent to the overhang nucleotide. These terminal three nucleotides may be at the 3' end of the antisense strand, the 3' end of the sense strand, the 5' end of the antisense strand, and/or the 5' end of the antisense strand.

In one embodiment, a 2-nucleotide overhang is located at the 3' end of the antisense

- 17 046901 strands, and two phosphorothioate internucleotide bonds are present between the terminal three nucleotides, with two of the three nucleotides being overhanging nucleotides and the third nucleotide being a paired nucleotide adjacent to the overhanging nucleotide. Optionally, the RNAi agent may additionally have two phosphorothioate internucleotide linkages between the terminal three nucleotides at both the 5' end of the sense strand and the 5' end of the antisense strand.

In one embodiment, the RNAi agent comprises the target mismatch(es) in the duplex or combinations thereof. The mismatch may occur in a protruding region or a duplex region. Base pairs can be ordered based on their propensity to promote dissociation or melting (e.g., by the free energy of association or dissociation of a particular pairing; the simplest approach is to study the pairs on an individual base pair basis, although next-adjacent analysis or similar can also be performed). In terms of promoting dissociation: A:U is more preferable than G:C; G:U is preferred over G:C; and I:C is preferred over G:C (1=inosine). Mismatches, such as non-canonical or non-canonical mating types (which are described elsewhere in this document), are preferred over canonical mating types (A:T, A:U, G:C); and pairing types that include universal bases are preferred over canonical pairing types.

In one embodiment, the RNAi agent comprises at least one of the first 1, 2, 3, 4 or 5 base pairs in duplex regions from the 5' end of the antisense strand independently selected from the group consisting of A:U, G:U , I:C and mismatched pairs, such as non-canonical or non-canonical mating types or mating types that include universal bases, to promote dissociation of the antisense strand at the 5' end of the duplex.

In one embodiment, the nucleotide at position 1 in the duplex region from the 5' end in the antisense strand is selected from the group consisting of A, dA, dU, U and dT. Alternatively, at least one of the first 1, 2, or 3 base pairs in the duplex region from the 5' end of the antisense strand is an AU base pair. For example, the first base pair in the duplex region from the 5' end of the antisense strand is the AU base pair.

In one embodiment, the sequence of the semantic thread can be represented by formula (I):

5' n _p -Na-(XXX )i-Nb-Y YY -N _b -(Z Ζ Ζ )jN _a -n _q 3' (I), where each of i and j is independently equal to 0 or 1;

each of p and q is independently equal to 0-6;

each Na independently represents an oligonucleotide sequence containing 025 modified nucleotides, with each sequence containing at least two nucleotides modified in different ways;

each N _b independently represents an oligonucleotide sequence containing 010 modified nucleotides;

each n _p and n _q independently represents a protruding nucleotide;

where Nb and Y have different modifications; and each of XXX, YYY and ZZZ independently represents one motif of three identical modifications of three consecutive nucleotides. Preferably, in YYY all nucleotides are 2'-F modified.

In one embodiment, Na and/or Nb has alternating pattern modifications.

In one embodiment, the YYY motif is located at or adjacent to a sense strand cleavage site. For example, if the RNAi agent contains a duplex region that is 17-23 nucleotides in length, the YYY motif may be at or near the cleavage site (e.g., may be at positions 6, 7, 8, 7, 8, 9, 8, 9, 10, 9, 10, 11, 10, 11, 12 or 11, 12, 13) in the sense strand, with the counting starting from the ^1st nucleotide from the 5' end or, optionally, the counting starting from the ^1st paired nucleotide in the duplex region from the 5' end.

In one embodiment, i is 1, a j is 0, or i is 0, a j is 1, or both i and j are 1. The thread of meaning can thus be represented by the following formulas:

5' np-Na-YYY-Nb-ZZZ-Na-n _q 3'(lb);

5' np-Na-XXX-N _b -YYY-Na-n _q 3'(Ic); or

5' np-Na-XXX-Nb-YYY-Nb-ZZZ-Na-n _q 3' (Id).

In cases where the sense strand is represented by formula (Ib), Nb is an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the sense strand is represented by formula (Ic), Nb is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified

- 18 046901 nucleotides. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the sense strand is represented by formula (Id), each Nb independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Preferably, Nb is 0, 1, 2, 3, 4, 5 or 6. Each Na can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Each of X, Y and Z can be the same or different from the others.

In other embodiments, i is 0 and j is 0, and the thread of meaning can be represented by the formula

In cases where the sense strand is represented by formula (Ia), each N _a can independently be an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In one embodiment, the sequence of the antisense RNAi strand may be represented by formula (II):

where each of k and l is independently equal to 0 or 1;

each of p' and q' is independently equal to 0-6;

each N _a ' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two nucleotides modified in various ways;

each N _b ' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

np' and _nq ' are each independently an overhanging nucleotide;

where N _b ' and Y' have different modifications;

and each of X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides.

In one embodiment, N _a ' and/or Nb' has alternating pattern modifications.

The Y'Y'Y' motif is located at or near the antisense strand cleavage site. For example, if the RNAi agent contains a duplex region that is 17-23 nucleotides in length, the Y'Y'Y' motif may be at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14 or 13, 14, 15 antisense strand, wherein the counting starts from the ^1st nucleotide from the 5' end or, optionally, the counting starts from the ^1st paired nucleotide in the duplex region from the 5' end. Preferably, the Y'Y'Y' motif is at positions 11, 12, 13.

In one embodiment, in the Y'Y'Y' motif, all nucleotides are 2'-OMe-modified.

In one embodiment, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

The antisense strand can thus be represented by the following formulas:

5' nq'-Na'-Z'Z'Z'-Nb'-Y'Y'Y'-Na'-np’ 3' (Пь);

5' nq’-Na'-Y'Y'Y'-Nb'-X'X'X'-np’ 3’ (Ps); or

5'nq'-Na'-Z'Z'Z'-Nb'-Y'Y'Y'-Nb'-X'X'X'-N _a '-n _P '3' (lid).

In cases where the antisense strand is represented by formula (IIb), Nb' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a ' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Where the antisense strand is represented by formula (IIc), Nb' is an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 0-2 or 0 modified nucleotides. Each N _a ' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the antisense strand is represented by formula (IId), each N _b ' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4, 02 or 0 modified nucleotides. Each N _a ' is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Preferably, N _b is 0, 1, 2, 3, 4, 5 or 6.

In other embodiments, k is 0 and l is 0, and the antisense strand can be represented by the formula

In cases where the antisense strand is represented by formula (IIa), each N _a ' independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

Each of X', Y' and Z' may be the same or different from the others.

Each nucleotide of the sense strand and antisense strand can independently be modified with LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl, or 2' fluorine For example, each nucleotide of the sense strand and antisense strand is independently modified with 2'-O-methyl or 2'-fluoro. X, Y, Z, X', Y' and Z' may each, in particular, be a 2'-Omethyl modification or a 2'-fluoro modification.

In one embodiment, the sense strand of the RNAi agent may contain a YYY motif located at positions 9, 10, and 11 of the strand in cases where the duplex region is 21 nucleotides, counting from the ^1st nucleotide from the 5' end or, optional, counting starts from the ^1st paired nucleotide in the duplex region from the 5'end; and Y is a 2'-E modification. The sense strand may further contain an XXX motif or ZZZ motifs as flanking modifications at the opposite end of the duplex region; and each of XXX and ZZZ is independently a 2'-OMe modification or a 2'-P modification.

In one embodiment, the antisense strand may contain a YYY' motif located at positions 11, 12, 13 of the strand, starting from the ^1st nucleotide from the 5' end or, optionally, starting from the ^1st base pair in the duplex region from 5'end; and Y' represents a 2'-O-methyl modification. The antisense strand may further contain an X'X'X' motif or Z'Z'Z' motifs as flanking modifications at the opposite end of the duplex region; and each of X'X'X' and Z'Z'Z' is independently a 2'-OMe modification or a 2'-F modification.

The sense strand represented by any of the above formulas (Ia), (Ib), (Ic) and (Id) forms a duplex with the antisense strand represented by any of the formulas (IIa), (IIb), (IIc) and (IId), respectively.

Accordingly, RNAi agents for use in the methods of the present invention may comprise a sense strand and an antisense strand, each strand containing from 14 to 30 nucleotides, the RNAi duplex represented by formula (III):

semantic: 5' n _p -N _a -(XXX)i -N _b - Υ YY -N _b -(Ζ Ζ Z)jN _a -n _q 3' antisense: 3' η _ρ -N _a -(X'X 'X')k-Nb -YYY'-N _b -(Z'Z'Z')i-Na -n _q 5' (III) where i, j, k and l are each independently equal to 0 or 1;

each of p, p', q and q' is independently equal to 0-6;

each N _a and Na' independently represent an oligonucleotide sequence containing 0-25 modified nucleotides, with each sequence containing at least two nucleotides modified in various ways;

each N _b and N _b ' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides;

wherein each np', np, _nq ' and _nq , each of which may or may not be present, is independently an overhanging nucleotide; and each of XXX, YYY, ZZZ, X'X'X', Y'Y'Y' and Z'Z'Z' independently represents one motif of three identical modifications of three consecutive nucleotides.

In one embodiment, i is 0 and j is 0; or i equals 1 and j equals 0; or i equals 0 and j equals 1; or both i and j are 0; or both i and j are 1. In another embodiment, k is 0 and l is 0; or k equals 1 and l equals 0; k is 0 and l is 1; or both k and l are 0; or both k and l equal 1.

Exemplary combinations of sense strand and antisense strand forming a duplex for RNAi include the formulas below:

5'np-Na-YYY-Na-n _q 3'

3' Pr-Na -γ Ύ Ύ' -Na n _q 5' (Sha),

5' n _p -Na -YYY -N _b -Ζ Ζ Z -N _a -n _q 3'

3' η _ρ -N _a -ΥΎΎ'-Nb-Z'Z'Z'-Nan _q 5' (Illb),

5' ηρ-Na- XXX -N _b -Υ YY - N _a -n _q 3'

3' n _p -Na'-X'X'X'-Nb'-Y'Y'Y'-Na-n _q 5' (IIIc),

5' n _p -N _a -XXX -N _b -YYY -N _b - Ζ Ζ Z -N _a -n _q 3'

3' np'-Na'-X'X'X'-Nb'-Y'Y'Y'-Nb'-Z'Z'Z'-Na-nq' 5’ (Illd).

In cases where the RNAi agent is represented by formula (IIIa), each N _{a is} independently

- 20 046901 is an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the RNAi agent is represented by formula (IIIb), each N _b independently represents an oligonucleotide sequence containing 1-10, 1-7, 1-5 or 1-4 modified nucleotides. Each N _a is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the RNAi agent is represented by formula (IIIc), each Nb, Nb' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0-4 , 02 or 0 modified nucleotides. Each N _a is independently an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides.

In cases where the RNAi agent is represented by formula (IIId), each Nb, Nb' independently represents an oligonucleotide sequence containing 0-10, 0-7, 0-10, 0-7, 0-5, 0- 4, 0-2 or 0 modified nucleotides. Each N _a , N _a ' independently represents an oligonucleotide sequence containing 2-20, 2-15 or 2-10 modified nucleotides. Each of N _a , N _a ', Nb and Nb' independently contains modifications of the alternating pattern.

Each of X, Y and Z in formulas (III), (IIIa), (IIIb), (IIIc) and (IIId) may be the same or different from the others.

In cases where the RNAi agent is represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), at least one of the Y nucleotides may form a base pair with one of the Y' nucleotides. Alternatively, at least two of the Y nucleotides base pair with the corresponding Y' nucleotides; or all three of the Y nucleotides form base pairs with the corresponding Y' nucleotides.

In cases where the RNAi agent is represented by formula (IIIb) or (IIId), at least one of the Z nucleotides may form a base pair with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides base pair with the corresponding Z' nucleotides; or all three of the Z nucleotides form base pairs with the corresponding Z' nucleotides.

In cases where the RNAi agent is represented by formula (IIIc) or (IIId), at least one of the X nucleotides may base pair with one of the X' nucleotides. Alternatively, at least two of the X nucleotides base pair with the corresponding X' nucleotides; or all three of the X nucleotides form base pairs with the corresponding X' nucleotides.

In one embodiment, the modification of nucleotide Y is different from the modification of nucleotide Y', the modification of nucleotide Z is different from the modification of nucleotide Z', and/or the modification of nucleotide X is different from the modification of nucleotide X'.

In one embodiment, when the RNAi agent is represented by formula (IIId), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications. In another embodiment, when the RNAi agent is represented by formula (IIId), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications, and np'>0, and at least one np' connected to an adjacent nucleotide via a phosphorothioate bond. In yet another embodiment, where the RNAi agent is represented by formula (IIId), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications, n _p '>0, and at least one n _p ' linked to an adjacent nucleotide via a phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker. In another embodiment, where the RNAi agent is represented by formula (IIId), the Na modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one np' is connected to adjacent nucleotide via a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached via a divalent or trivalent branched linker.

In one embodiment, where the RNAi agent is represented by formula (IIIa), the N _a modifications are 2'-O-methyl or 2'-fluoro modifications, np'>0, and at least one _np ' linked to an adjacent nucleotide by a phosphorothioate bond, the sense strand contains at least one phosphorothioate bond, and the sense strand is conjugated to one or more GalNAc derivatives attached by a divalent or trivalent branched linker.

In one embodiment, the RNAi agent is a multimer containing at least two duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further contains a ligand. Each of the duplexes may target the same gene or two different genes, or each of the duplexes may target the same gene at two different target sites.

In one embodiment, the RNAi agent is a multimer containing three

- 21 046901 one, five, six or more duplexes represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId), where the duplexes are connected by a linker. The linker may be cleavable or non-cleavable. Optionally, the multimer further contains a ligand. Each of the duplexes may target the same gene or two different genes, or each of the duplexes may target the same gene at two different target sites.

In one embodiment, two RNAi agents represented by formula (III), (IIIa), (IIIb), (IIIc) and (IIId) are joined to each other at the 5' end, and one or both of the 3' ends is optional conjugated to a ligand. Each of the agents may target the same gene or two different genes, or each of the agents may target the same gene at two different target sites.

Various publications describe multimeric RNAi agents that can be used in the methods of the present invention. Such publications include WO 2007/091269, US Patent No. 7858769, WO 2010/141511, WO 2007/117686, WO 2009/014887 and WO 2011/031520, the entire contents of which are therefore incorporated herein by reference.

An RNAi agent comprising one or more carbohydrate moieties conjugated to the RNAi agent may improve one or more properties of the RNAi agent. In many cases, a carbohydrate moiety will be attached to a modified subunit of the RNAi agent. For example, the ribose sugar of one or more ribonucleotide subunits of the dsRNA agent can be replaced by other moieties, for example, a non-carbohydrate (preferably cyclic) carrier to which the carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit has been substituted in this manner is referred to herein as a ribose modified-substitution subunit (RRMS). The cyclic support may be a carbocyclic ring system, i.e. all atoms in the ring are carbon atoms, or a heterocyclic ring system, i.e. one or more atoms in the ring may be heteroatoms, for example nitrogen, oxygen, sulfur. The cyclic support may be a monocyclic ring system or may contain two or more rings, for example, fused rings. The cyclic support may be a fully saturated ring system or it may contain one or more double bonds.

The ligand can be attached to the polynucleotide via a carrier. The supports include (i) at least one attachment point to the frame, preferably two attachment points to the frame, and (ii) at least one linking attachment point. The expression point of attachment to the backbone, as used herein, means a functional group, for example a hydroxyl group, or, generally, a bond accessible and suitable for introducing a support into the backbone, for example, a phosphate or a modified phosphate, for example a sulfur-containing backbone ribonucleic acid. The term binding attachment point (TAP) in some embodiments means a ring atom of a cyclic support, such as a carbon atom or a heteroatom (other than the atom that provides the point of attachment to the backbone) to which the selected moiety binds. The moiety may be, for example, a carbohydrate, such as a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide and polysaccharide. Optionally, the selected fragment is interconnected to a cyclic carrier. Thus, the cyclic support will often include a functional group, such as an amino group, or typically provide a linkage that is suitable for introducing or linking another chemical building block, such as a ligand, to the constituent ring.

RNAi agents can be conjugated to a ligand via a carrier, where the carrier can be a cyclic group or an acyclic group; preferably, the cyclic group is selected from pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, [1,3]-dioxolane, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and decalin; preferably, the acyclic group is selected from the serinol backbone or the diethanolamine backbone.

In certain specific embodiments, the RNAi agent for use in the methods of the present invention is an agent selected from the group consisting of the agents listed in Table. 1 and 2.

Such agents may further contain a ligand.

A. Ligands.

The double-stranded RNA (dsRNA) agents of the present invention may optionally be conjugated to one or more ligands. The ligand may be attached to the sense strand, the antisense strand, or both strands at the 3' end, 5' end, or both ends. For example, a ligand may be conjugated to a sense strand. In preferred embodiments, the ligand is conjugated to the 3' end of the sense strand. In one preferred embodiment, the ligand is a GalNAc ligand. In particularly preferred embodiments, the ligand is GalNAc3:

- 22 046901

In some embodiments, a ligand, such as a GalNAc ligand, is attached to the 3' end of the RNAi agent. In one embodiment, the RNAi agent is conjugated to a ligand, for example a GalNAc ligand, as shown in the following diagram:

where X is O or S. In one embodiment, X is O.

A wide range of structural elements can be combined with the RNAi agents of the present invention. Preferred moieties are ligands that are linked, preferably covalently, either directly or indirectly through an intermediate linking moiety.

In preferred embodiments, the ligand modifies the distribution, targeting, or lifetime of the molecule into which it is introduced. In preferred embodiments, the ligand provides increased affinity for a selected target, e.g., a molecule, cell or cell type, compartment, receptor, e.g., a cellular compartment, or part of an organ, tissue, organ, or body site, e.g., compared to species in which there is no such ligand. Ligands that provide increased affinity for a selected target are also called targeting ligands.

Some ligands may have endosomolytic properties. Endosomolytic ligands promote lysis of the endosome and/or transport of the composition according to the present invention or its components from the endosome into the cytoplasm of the cell. The endosomolytic ligand may be a polyanionic peptide or a peptidomimetic that exhibits pH-dependent membrane activity and fusogenicity. In one embodiment, the endosomolytic ligand adopts an active conformation at endosomal pH. An active conformation is one in which the endosomolytic ligand promotes endosome lysis and/or transport of the composition of the present invention or its components from the endosome into the cytoplasm of the cell. Exemplary endosomolytic ligands include GALA peptide (Subbarao et al., Biochemistry, 1987, 26:29642972), EALA peptide (Vogel et al., J. Am. Chem. Soc., 1996, 118: 1581-1586) and derivatives thereof ( Turk et al., Biochem. Biophys. Acta, 2002, 1559: 56-68). In one embodiment, the endosomolytic moiety may contain a chemical group (eg, an amino acid) that will undergo changes in charge or protonation in response to changes in pH. The endosomolytic component can be linear or branched.

Ligands can improve the transport, hybridization and specificity properties and can also improve the nuclease resistance of the resulting natural or modified oligonucleotide or polymer molecule containing any combination of monomers described herein and/or natural or modified ribonucleotides.

Ligands typically may include therapeutic modifiers, for example, to enhance absorption; diagnostic compounds or reporter groups, for example for distribution tracking; cross-linking agents and nuclease-resistant fragments. About

- 23 046901 Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines and peptide mimetics.

Ligands may include a naturally occurring substance such as a protein (eg, human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin); carbohydrate (eg dextran, pullulan, chitin, chitosan, inulin, cyclodextrin or hyaluronic acid) or lipid. The ligand may also be a recombinant or synthetic molecule, such as a synthetic polymer, eg, a synthetic polyamino acid, oligonucleotide (eg, an aptamer). Examples of polyamino acids include polyamino acid polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, L-lactide-glycolide copolymer, divinyl ether-maleic anhydride copolymer, No(2 α-hydroxypropyl) meacrylamide copolymer (HMPA), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyurethane, poly(2-ethyl acrylic acid), Nisopropylacrylamide polymers or polyphosphazine. Examples of polyamines include: polyethylenimine, polylysine (PLL), spermine, spermidine, polyamine, pseudopeptide polyamine, polyamine peptidomimetic, polyamine dendrimer, arginine, amidine, protamine, cationic lipid, cationic porphyrin, polyamine quaternary salt, or alpha helical peptide.

Ligands also include targeting groups, for example, a cell or tissue targeting agent, such as a lectin, glycoprotein, lipid or protein, such as an antibody, that binds to a specific cell type, such as a kidney cell. The targeting group may be thyrotropin, melanotropin, lectin, glycoprotein, surface protein A, mucin carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acids, polyvalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, lipid, cholesterol, steroid, bile acid, folate, vitamin B12, biotin, RGD peptide, RGD peptide mimetic or aptamer.

Other examples of ligands include dyes, intercalating agents (eg, acridines), cross-linkers (eg, psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatic hydrocarbons (eg, phenazine, dihydrophenazine), artificial endonucleases or chelator ( e.g. EDTA), lipophilic molecules, e.g. cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bisO(hexadecyl)glycerol, geranyloxyhexyl group, hexadecyl-glycerol, borneol, menthol, 1,3propanediol, heptadecyl group, palmitic acid, myristic acid, O3(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine and peptide conjugates (e.g. antennapedia peptide, Tat-peptide), alkylating agents, phosphate, amino, mercapto, PEG (eg PEG-40K), MPEG, [MPEG] ₂ , polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (eg biotin), transport/absorption aides (eg aspirin, vitamin E, folic acid ), synthetic ribonucleotides (e.g. imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ tetraazamacrocycle complex), dinitrophenyl, HRP or AP.

Ligands may be proteins, such as glycoproteins, or peptides, such as molecules with a specific affinity for a co-ligand, or antibodies, such as an antibody that binds to a specific cell type, such as a cancer cell, endothelial cell or bone cell. Ligands may also include hormones and hormone receptors. They may also include species other than peptides, such as lipids, lectins, carbohydrates, vitamins, cofactors, polyvalent glucose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, or aptamers. The ligand, for example, may be a lipopolysaccharide, a p38 MAP kinase activator, or an NF-kB activator.

The ligand may be a substance, for example a drug, that can increase the uptake of the mRNA agent into a cell, for example by disrupting the cytoskeleton of the cell, for example by disrupting microtubules, microfilaments and/or intermediate filaments of the cell. The drug, for example, may be taxon, vincristine, vinblastine, cytochalasin, nocodazole, yaplakinolide, latrunculin A, phalloidin, swingolide A, indanocin or myoservin.

The ligand may increase the uptake of the oligonucleotide into the cell, for example by activating an inflammatory response. Exemplary ligands that will have such an effect include tumor necrosis factor alpha (TNF-alpha), interleukin-1-beta, or interferon gamma.

In one aspect, the ligand is a lipid or lipid molecule. Such lipids or lipid molecules preferentially bind to a serum protein, such as human serum albumin (HSA). The HSA-binding ligand allows the conjugate to be distributed into a target tissue, such as a target tissue other than the kidney tissue of the body. For example, the target tissue may be the liver, including liver parenchymal cells. Other molecules that can bind to HSA can also be used as ligands. For example, you can use naproxen or aspirin. The lipid or lipid ligand may (a) increase resistance to degradation of the conjugate, (b) increase targeting or transport to the target cell or cell membrane, and/or (c) may

- 24 046901 can be used to adjust the binding to whey protein, eg HSA.

The lipid ligand can be used to modulate, for example, regulate the binding of the conjugate to the target tissue. For example, a lipid or lipid ligand that binds more strongly to HSA is less likely to be targeted to the kidneys and thus less likely to be excreted from the body. A lipid or lipid ligand that binds less strongly to HSA can be used to target the conjugate to the kidneys.

In a preferred embodiment, the lipid ligand binds to HSA. Preferably, it binds to HSA with sufficient affinity such that the conjugate will preferentially distribute to tissue other than kidney tissue.

However, it is preferable that the affinity is not so strong that binding of the HSA ligand is irreversible.

In another preferred embodiment, the lipid ligand binds weakly or not at all to HSA, such that the conjugate will preferentially distribute to the kidney. Other moieties that target kidney cells can also be used instead of or in addition to lipid ligands.

In another aspect, the ligand is a moiety, such as a vitamin, that is taken up by a target cell, such as a proliferating cell. These are particularly suitable for the treatment of disorders characterized by unwanted proliferation of cells, for example of a malignant or benign type, for example cancer cells. Exemplary vitamins include vitamin A, E, and K. Other exemplary vitamins include B vitamins, such as folic acid, B12, riboflavin, biotin, pyridoxal, or other vitamins or nutrients taken up by cancer cells. Also included are HAS, low-density lipoprotein (LDL), and high-density lipoprotein (HDL).

In another aspect, the ligand is a cell penetrating agent, preferably a helical cell penetrating agent. Preferably, the agent is amphipathic. An exemplary agent is a peptide such as tat or antennopedia. If the agent is a peptide, it may be modified, including peptidyl mimetic, invertomers other than peptide or pseudopeptide linkages and the use of D-amino acids. The helical agent is preferably an alpha helical agent, which is preferably characterized by a lipophilic and lipophobic phase.

The ligand may be a peptide or a peptidomimetic. A peptidomimetic (also referred to herein as an oligopeptidomimetic) is a molecule capable of folding into a specific three-dimensional structure similar to a naturally occurring peptide. The peptide or peptidomimetic fragment may be about 5-50 amino acids in length, such as about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids in length. The peptide or peptidomimetic, for example, can be a cell penetrating peptide, a cationic peptide, an amphipathic peptide, or a hydrophobic peptide (eg, consisting primarily of Tyr, Trp, or Phe). The peptide moiety may be a dendrimer peptide, a hindered peptide, or a cross-linked peptide. In another alternative, the peptide fragment may include a hydrophobic membrane trafficking sequence (MTS).

An exemplary hydrophobic MTS-containing peptide is RFGF with the amino acid sequence AAVALLPAVLLALLAP (SEQ ID NO: 1). An RFGF analog (eg, the amino acid sequence AALLPVLLAAP (SEQ ID NO: 2)) containing a hydrophobic MTS can also be a targeting moiety. The peptide moiety may be a delivery peptide that can transport large polar molecules, including peptides, oligonucleotides and proteins, across cell membranes. For example, sequences from the HIV Tat protein (GRKKRRQRRRPPQ (SEQ ID NO: 3)) and the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK (SEQ ID NO: 4)) have been found to function as delivery peptides. The peptide or peptidomimetic may be encoded by random DNA sequences, such as a peptide identified from a phage display library or a single bead-single compound (SBC) combinatorial library (Lam et al., Nature, 354:82-84, 1991). Preferably, the peptide or peptidomimetic linked to the mRNA agent via the introduced monomer unit is a cell targeting peptide such as an arginine glycine aspartic acid (RGD) peptide or RGD mimetic. The peptide fragment may have a length ranging from about 5 amino acids to about 40 amino acids. Peptide fragments may be characterized by structural modification, such as to increase stability or control conformational properties. Any of the structural modifications described below can be used. The RGD peptide fragment can be used to target a tumor cell, such as an endothelial tumor cell or a breast cancer tumor cell (Zitzmann et al., Cancer Res., 62:5139-43, 2002). The RGD peptide can help target mRNA agents to tumors in a variety of other tissues, including lung, kidney, spleen, or liver (Aoki et al.,

- 25 046901

Cancer Gene Therapy 8:783-787, 2001). Preferably, the RGD peptide will help target the mRNA agent to the kidney. The RGD peptide may be linear or cyclic and may be modified, such as glycosylated or methylated, to facilitate targeting to specific tissues. For example, a glycosylated RGD peptide can deliver an mRNA agent to a tumor cell expressing α, β ₃ (Haubner et al., Jour. Nucl. Med., 42:326-336, 2001). Peptides can be used that target markers that are enriched in proliferating cells. For example, RGD-containing peptides and peptidomimetics can target cancer cells, particularly cells that have integrin on their surface. Thus, RGD peptides, cyclic peptides containing RGD, RGD peptides that include D-amino acids, as well as synthetic RGD mimetics can be used. In addition to RGD, other fragments that target the integrin ligand can be used. Typically, such ligands can be used to control cell proliferation and angiogenesis. Preferred conjugates with this type of ligand target PECAM-1, VEGF or another cancer gene, such as the cancer gene described herein.

The cell-penetrating peptide is capable of penetrating a cell, for example, a microbial cell, such as a bacterial or fungal cell, or a mammalian cell, such as a human cell. The microbial cell penetrating peptide, for example, may be an α-helical linear peptide (e.g., LL-37 or Ceropin P1), a disulfide bond-containing peptide (e.g., α-defensin, β-defensin, or bactenecin), or a peptide containing only one or two predominant amino acids (for example, PR-39 or indolicidin). The cell entry peptide may also include a cellular nuclear localization signal (NLS). For example, the cell entry peptide may be a two-component amphipathic peptide such as MPG, which is derived from the fusion domain of HIV-1 gp41 and the NLS of SV40 large T antigen (Simeoni et al., Nucl. Acids Res. 31: 2717-2724, 2003).

In one embodiment, the targeting peptide may be an amphipathic α-helical peptide. Exemplary amphipathic α-helical peptides include, but are not limited to, cecropins, lycotoxins, paradaxins, buforin, CPF, bombinin-like peptide (BLP), cathelicidins, ceratotoxins, S. clava peptides, hagfish intestinal antimicrobial peptides (HFIAP), magainins, brevinin- 2, dermaseptins, mellitins, pleurocidins, H2A peptides, Xenopus peptides, esculentins-1 and caerins. A number of factors will preferably be considered to maintain the integrity of the helix stability. For example, a maximum number of helix-stabilizing residues (eg, leu, ala or lys) will be used, and a minimum number of helix-destabilizing residues (eg, proline or cyclic monomer units) will be used. A capping residue (eg, Gly, which is an exemplary N-capping residue) will be considered and/or C-terminal amidation will be used to provide an additional H-bond to stabilize the helix. The formation of salt bridges between residues with opposite charges separated by i ± 3 or i ± 4 positions can provide stability. For example, cationic residues such as lysine, arginine, homoarginine, ornithine or histidine can form salt bridges with anionic residues, glutamate or aspartate.

Peptide and peptidomimetic ligands include those peptides that are naturally occurring or modified, such as D- or L-peptides; α-, β- or γpeptides; peptides with N-methyl; azapeptides; peptides with one or more amides, i.e. peptides with linkages substituted by one or more of urea, thiourea, carbamate or sulfonylurea linkages; or cyclic peptides.

The targeting ligand can be any ligand that is capable of targeting a specific receptor. Examples are: folate, GalNAc, galactose, mannose, mannose^, sugar clusters such as GalNAc cluster, mannose cluster, galactose cluster or aptamer. A cluster is a combination of two or more sugar units. Targeting ligands also include integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL and HDL ligands. Ligands can also be based on a nucleic acid, such as an aptamer. The aptamer may be unmodified or may have any combination of modifications disclosed herein.

Endosomal releasing agents include imidazoles, poly- or oligoimidazoles, PEI, peptides, fusogenic peptides, polycarboxylates, polycations, latent oligo- or polycations or anions, acetals, polyacetals, ketals/polyketals, orthoesters, polymers with latent or not latent cationic or anionic charges , dendrimers with hidden or non-hidden cationic or anionic charges.

PK modulator means pharmacokinetic modulator. PK modulators include lipophils, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEGs, vitamins, etc. Exemplary PK modulators include, but are not limited to, cholesterol, fatty acids, cholic acid, lithocholic acid, dialkyl glycerides, diacyl glyceride, phospholipids, sphin

- 26 046901 golipids, naproxen, ibuprofen, vitamin E, biotin, etc. Oligonucleotides that contain some phosphorothioate linkages are also known to bind to whey protein, thus short oligonucleotides, e.g., oligonucleotides of about 5 bases, 10 bases, 15 bases, or 20 bases, containing many phosphorothioate linkages in the backbone are also useful in the present invention as ligands (eg as PK-modulating ligands).

In addition, aptamers that bind to serum components (eg, whey proteins) are also useful in the present invention as PK-modulating ligands.

Other ligand conjugates useful in the present invention are described in US patent applications USSN: 10/916185, filed August 10, 2004; USSN: 10/946873, filed September 21, 2004; USSN: 10/833934, filed August 3, 2007; USSN: 11/115989, filed April 27, 2005, and USSN: 11/944227, filed November 21, 2007, which are incorporated by reference in their entirety for all purposes.

In cases where two or more ligands are present, all ligands may have the same properties, may have different properties, or some ligands have the same properties while others have different properties. For example, the ligand may have targeting properties, have endosomolytic activity, or have PK-modulating properties. In a preferred embodiment, all ligands have different properties.

Ligands can be coupled to the oligonucleotides at different locations, for example, at the 3' end, 5' end and/or in an internal position. In preferred embodiments, the ligand is attached to the oligonucleotides via an intermediate linking moiety, such as a carrier described herein. The ligand or bound ligand may be present on the monomer in cases where the monomer is introduced into the growing filament. In some embodiments, a ligand may be introduced by binding to a precursor monomer after the precursor monomer has been introduced into the growing strand. For example, a monomer, eg with an amino-terminal binding moiety (ie no associated ligand), eg TAP-(CH ₂ )nNH ₂ can be introduced into the growing oligonucleotide strand. At the subsequent stage, i.e. after introducing the precursor monomer into the strand, a ligand with an electrophilic group, such as a pentafluorophenyl ester group or an aldehyde group, can subsequently be attached to the precursor monomer by linking the electrophilic group of the ligand to the terminal nucleophilic group of the linking moiety of the precursor monomer.

In another example, a monomer with a chemical group suitable for participation in click chemistry reactions, such as a linker moiety/linker with an azide or alkyne terminus, may be introduced. At the subsequent stage, i.e. after introducing the precursor monomer into the strand, a ligand with a complementary chemical group, such as an alkyne or azide, can be attached to the precursor monomer by linking the alkyne and azide together.

For double-stranded oligonucleotides, ligands may be attached to one or both strands. In some embodiments, the double-stranded mRNA agent comprises a ligand conjugated to the sense strand. In other embodiments, the double-stranded mRNA agent comprises a ligand conjugated to an antisense strand.

In some embodiments, the ligand may be conjugated to nucleobases, sugar moieties, or internucleoside linkages of nucleic acid molecules. Conjugation with purine nucleobases or their derivatives can occur at any position, including intra-ring and extra-ring atoms. In some embodiments, the 2-, 6-, 7-, or 8-position of the purine nucleobase is attached to the conjugate moiety. Conjugation with pyrimidine nucleobases or their derivatives can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of the pyrimidine base may be replaced by a conjugate moiety. Conjugation with sugar moieties of nucleosides can occur at any carbon atom. Examples of sugar moiety carbon atoms that can be attached to the conjugate moiety include 2', 3' and 5' carbon atoms. The 1' position can also be attached to a conjugate moiety, such as in an abasic residue. Internucleoside bonds can also carry conjugate fragments. As for phosphorus-containing bonds (for example, phosphodiester, phosphothioate, phosphodithioate, phosphoramidate, etc.), the conjugate fragment can be attached directly to the phosphorus atom or to the O, N or S atom bonded to the phosphorus atom. For amine- or amide-containing internucleotide linkages (eg, PNA), the conjugate moiety may be attached to the amine or amide nitrogen atom or to an adjacent carbon atom.

Any ligand suitable in the field of RNA interference can be used, although the ligand is typically a carbohydrate, eg, a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, polysaccharide.

- 27 046901

Linkers by which the ligand is conjugated to the nucleic acid include those described above. For example, the ligand may be one or more GalNAc (Nacetylglucosamine) derivatives attached via a divalent or trivalent branched linker.

In one embodiment, the dsRNA of the present invention is conjugated to divalent and trivalent branched linkers comprising structures shown by any of formulas (IV)-(VII):

where q ^2A , q ^2B , q ^3A , q ^3B , q ^4A , q ^4B , q ^5A , q ^5B and q ^5C independently represent for each case 0-20, and where the repeat units may be the same or different;

each of P ^2A , P ^2B , P ^{3A ,} P ^3B , P ^4A , P 4B, P ^5A , P ^5B , P ^5C , T ^{2A ,} T 2B, T 3A, T ^3B , T ^{4A , T 4B ,} T ^4A , T ^5B , T ^5C are absent independently for each case, rearranged as CO, NH, O, S, OC(O), NHC(O), CH ₂ , CH2NH or CH2O;

Q2A, q ^2b , q ³ a, q ^3b , q ⁴ a, q ^4b , q5a, qSB, qSC independently absent for each case, is an alkylene, a substituted alkylene, where one or more methylenes may be interrupted or terminated by one or more of O, S, S(O), SO ₂ , N(R ⁿ ), C(R')=C(R), C=C or C(O);

each of R ^2A , R ^2B , R ^3A , R ^3B , R ^4A , R ^4B , R ^5A , R ^5B , R ^5C is absent independently for each case, represents NH, O, S, CH2, C(O)O, C(O)NH, NHCH(Ra)C(O), -C(O)-CH(R ^a )-NH-CO, CH=NO,

ABOUT

or heterocyclyl;

L ^2A , L ^2B , L ^3A , L ^3B , L ^4A , L ^4B , L ^5A , L ^5B and L ^5C are ligand; those. each independently in each case is a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide or polysaccharide; And

Ra represents an H or side chain of an amino acid.

Trivalent GalNAc conjugating derivatives are particularly suitable for use with an RNAi agent to inhibit target gene expression, such as those of formula (VII):

R

R

Formula (VII) wherein L ^5A , L ^5B and L ^5C are a monosaccharide such as a GalNAc derivative.

Examples of suitable divalent and trivalent branched linker groups by which GalNAc derivatives are conjugated include, but are not limited to, the following compounds:

- 28 046901

- 29 046901

In other embodiments, the RNAi agent for use in the methods of the present invention is an agent selected from the group consisting of AD-53815, AD56663, AD-56658, AD-56676, AD-56666, AD-57928, and AD-60212.

III. Delivery of mRNA according to the present invention.

Delivery of an mRNA agent according to the present invention to a cell, for example, a cell of a subject, such as a human subject (for example, a subject in need thereof, such as a subject with a lipid disorder such as hyperlipidemia), can be accomplished in various ways. For example, delivery can be accomplished by contacting a cell with the mRNA of the present invention either in vitro or in vivo. In vivo delivery can also be accomplished directly by administering a composition containing mRNA, eg dsRNA, to a subject. Alternatively, in vivo delivery can be accomplished indirectly by introducing one or more vectors that encode and direct the expression of the mRNA. Such alternative cases are described further below.

In general, any method of delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with the mRNA of the present invention (see, for example, Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2 (5 ): 139-144 and WO 94/02595, which are incorporated herein by reference in their entirety). With regard to in vivo delivery, factors that are considered in the context of delivery of an mRNA molecule include, for example, the biological stability of the delivered molecule, prevention of nonspecific action, and accumulation of the delivered molecule in the target tissue. The nonspecific effects of mRNA can be minimized by local administration, such as direct injection or tissue implantation, or topical administration of the drug. Local administration at the treatment site maximizes the local concentration of the agent, limits exposure of the agent to systemic tissues that may otherwise be damaged by the agent or that may degrade the agent, and allows for the administration of a lower total dose of the mRNA molecule. Several studies have shown effective knockdown of gene products when mRNA is administered locally. For example, intraocular delivery of dsRNA to VEGF has been shown by both intravitreal injections in cynomolgus monkeys (Tolentino, MJ., et al (2004) Retina 24:132-138) and subretinal injections in mice (Reich, SJ., et al (2003) Mol. Vis. 9:210-216) prevents the formation of new vessels in an experimental model of age-related macular degeneration. In addition, direct intratumoral injection of dsRNA into mice reduces tumor size (Pille, J., et al (2005) Mol. Ther. 11:267-274) and can increase the lifespan of tumor-bearing mice (Kim, WJ., et al (2006) ) Mol. Ther. 14:343-350; Li, S., et al (2007) Ther. RNA interference has also been successful in local delivery to the CNS by direct delivery (Dorn, G., et al. (2004) Nucleic Acids 32:e49; Tan, PH., et al (2005) Gene Ther. 12:59-66 ; Makimura, H., et al (2002) Shishkina, GT., et al (2004) Thakker, ER., et al (2004) Proc. . Sci. U.S.A. 101:17270-17275; Akaneya, Y., et al (2005) J. Neurophysiol. 93:594-602) and to the lungs by intranasal administration. 14:476-484; Zhang, X., et al (2004) J. Biol. Chem. 279:10677-10684; Where the administration of mRNA systemically to treat a disease, the RNA can be modified or, alternatively, delivered using a drug delivery system; both methods act to prevent rapid degradation of dsRNA by endo- and exonucleases in vivo. RNA modification or pharmaceutical carrier may also make it possible

- 30 046901 effective targeting of the mRNA composition to the target tissue, and with their help, unwanted off-target effects can be avoided. mRNA molecules can be modified by chemical conjugation with lipophilic groups such as cholesterol to enhance cellular uptake and prevent degradation. For example, mRNA directed against ApoB and conjugated to a lipophilic cholesterol moiety was administered systemically to mice and resulted in knockdown of apoB mRNA in both the liver and small intestine (Soutschek, J., et al (2004) Nature 432: 173-178). Conjugation of mRNA to an aptamer has been shown to inhibit tumor growth and mediate tumor regression in mouse models of prostate cancer (McNamara, JO., et al (2006) Nat. Biotechnol. 24:1005-1015). In an alternative embodiment, the mRNA can be delivered using drug delivery systems such as a nanoparticle, dendrimer, polymer, liposome or cationic delivery system. Positively charged cationic delivery systems promote binding of the (negatively charged) mRNA molecule and also increase interactions at the negatively charged cell membrane to ensure efficient uptake of mRNA into the cell. Cationic lipids, dendrimers or polymers can either be associated with mRNA or acted upon to form a vesicle or micelle (see, e.g., Kim SH., et al (2008) Journal of Controlled Release 129(2): 107-116) , which contain mRNA. The formation of vesicles or micelles also prevents destruction of the mRNA when administered systemically. Methods for preparing and introducing cationic complexes with mRNA are within the skill of those skilled in the art (see, for example, Sorensen, DR., et al (2003) J. Mol. Biol 327:761-766; Verma, UN., et al. al (2003) Clin. Cancer Res. 9:1291-1300; Arnold, AS et al (2007) J. Hypertens. 25:197-205, which are incorporated herein by reference in their entirety. Some non-limiting examples of drug delivery systems suitable for systemic delivery of mRNA include DOTAP (Sorensen, DR., et al (2003), supra; Verma, UN., et al (2003), supra), oligofectamine, nucleic acid particulates acid-lipidome (Zimmermann, TS., et al (2006) Nature 441:111-114), cardiolipin (Chien, PY., et al (2005) Cancer Gene Ther. 12:321328; Pal, A., et al ( 2005) Int J. Oncol. 26:1087-1091), polyethylenimine (Bonnet ME., et al (2008) Pharm. Res., electronic publication ahead of print August 16; Aigner, A. (2006) J. Biomed. Biotechnol. 71659), Arg-Gly-Asp (RGD) containing peptides (Liu, S. (2006) Mol. Pharm. 3:472-487) and polyamidoamines (Tomalia, DA., et al (2007) Biochem. Soc. Trans. 35:61-67; Yoo, H., et al (1999) Pharm. 16:1799-1804). In some embodiments, the mRNA is complexed with cyclodextrin for systemic administration. Methods of administration and pharmaceutical compositions of mRNA and cyclodextrins can be found in US Pat. No. 7,427,605, which is incorporated herein by reference in its entirety.

A. The mRNA vector-encoded mRNAs of the present invention targeting the PCSK9 gene can be expressed by transcription units inserted into DNA or RNA vectors (see, for example, Couture, A, et al., TIG. (1996), 12:5- 10; Skillern, A., et al., PCT Publication No. WO 00/22113, Conrad, PCT International Publication No. WO 00/22114 and Conrad US Patent No. 6,054,299). Expression may be transient (on the order of hours to weeks) or long-lasting (weeks to months or longer) depending on the specific construct used and the target tissue or cell type. Such transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be an integrating or non-integrating vector. Transgenes can also be engineered to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

Individual strand or strands of mRNA can be transcribed from the promoter of the expression vector. In cases where it is necessary to express two separate strands to produce, for example, dsRNA, then two separate expression vectors can be introduced together into the target cell (for example, by transfection or infection). Alternatively, each individual dsRNA strand may be transcribed from promoters both of which are located on the same expression plasmid. In one embodiment, the dsRNA is expressed as inverted repeat polynucleotides connected by a linker polynucleotide sequence such that the dsRNA has a stem-loop structure.

mRNA expression vectors are typically DNA plasmids or viral vectors. Expression vectors compatible with eukaryotic cells, preferably compatible with vertebrate cells, can be used to generate recombinant mRNA expression constructs as described herein. Expression vectors for eukaryotic cells are well known in the art and are available from a number of commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired nucleic acid segment. Delivery of the mRNA expression vectors may be systemic, such as by intravenous or intramuscular administration, by administration to target cells explanted from a patient and then reintroduced to the patient, or by any other method that allows administration to the desired target cell.

Target cells can be transfected with mRNA expression plasmids complexed with cationic lipid carriers (eg, Oligofectamine) or non-cationic lipid carriers (eg, Transit-TKO™). The present invention also contemplates multiple

- 31 046901 lipid-assisted transfections for types of mRNA-mediated knockdown targeting different regions of the target RNA over a period of a week or more. The successful introduction of vectors into host cells can be controlled using a variety of known methods. For example, transient transfection may be signaled by a reporter, such as a fluorescent marker such as green fluorescent protein (GFP).

Stable transfection of cells ex vivo can be confirmed by using markers that confer resistance to certain environmental factors (eg, antibiotics and drugs) to the transfected cell, such as resistance to hygromycin B.

Viral vector systems that can be used with the methods and compositions described herein include, without limitation, (a) adenoviral vectors; (b) retroviral vectors, including, without limitation, lentiviral vectors, Moloney murine leukemia virus, etc.; (c) adeno-associated virus vectors; (d) herpes simplex virus vectors; (f) SV40-based vectors; (f) polyoma virus vectors; (g) papillomavirus-based vectors; (h) picornavirus-based vectors; (i) vectors based on a poxvirus, such as orthopox, for example, vectors based on vaccinia virus, or avipox, for example, canaripox or fowlpox; and (j) helper-dependent or weak adenovirus. Viruses with impaired replication may also be advantageous. Different vectors will or will not integrate into the genome of cells. If desired, the constructs may include viral sequences for transfection. Alternatively, the construct can be inserted into vectors capable of episomal replication, such as EPV- and EBV-based vectors. Constructs for recombinant expression of mRNA will typically require regulatory elements, such as promoters, enhancers, etc. to ensure expression of the mRNA in target cells. Other considerations for vectors and constructs are described further below.

Vectors suitable for delivering mRNA will include regulatory elements (promoter, enhancer, etc.) sufficient to allow expression of the mRNA in the desired target cell or tissue. Regulatory elements can be selected to achieve either constitutive or regulated/inducible expression.

Expression of mRNA can be precisely regulated, for example, by using an inducible regulatory sequence that is sensitive to certain physiological regulators, such as circulating glucose levels or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems suitable for controlling dsRNA expression in cells or mammals include, for example, regulation by ecdysone, estrogen, progesterone, tetracycline, chemical dimerization inducers, and isopropyl beta-Dthiogalactopyranoside (IPTG). One of ordinary skill in the art will be able to select the appropriate regulatory/promoter sequence based on the intended use of the mRNA transgene.

Viral vectors that contain nucleic acid sequences encoding mRNA can be used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). Such retroviral vectors contain components necessary for proper packaging of the viral genome and integration into the DNA of the host cell. The nucleic acid sequences encoding the mRNA are cloned into one or more vectors that facilitate delivery of the nucleic acid to the patient. A more detailed description of retroviral vectors can be found, for example, in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy include: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Development. 3:110-114 (1993). Lentiviral vectors contemplated for use include, for example, the HIV-based vectors described in US Pat. Nos. 6,143,520; 5665557 and 5981276, which are incorporated herein by reference.

Adenoviruses are also contemplated for use in delivering mRNA according to the present invention. Adenoviruses are particularly promising vehicles, for example, for gene delivery to the respiratory epithelium. Adenoviruses naturally infect the respiratory epithelium, where they cause mild disease. Other targets for adenovirus-based delivery systems include the liver, central nervous system, endothelial cells and muscle. Adenoviruses have the advantage of being able to infect non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499–503 (1993) provides a review article on adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenoviral vectors to transfer genes into the respiratory epithelium of rhesus monkeys. Additional examples of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publications WO 94/12649 and Wang, et al., Gene Therapy 2:775-783 (1995). A suitable AV vector for expressing the mRNA described in the present invention, the method

- 32 046901 production of a recombinant AV vector and a method for delivering the vector to target cells are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

Adeno-associated virus (AAV) vectors can also be used to deliver the mRNA of the present invention (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); US Pat. No. 5,436,146). In one embodiment, the mRNA can be expressed as two separate complementary single-stranded RNA molecules using a recombinant AAV vector, for example, with either the RNA promoters, U6 or H1, or the cytomegalovirus (CMV) promoter. Suitable AAV vectors for expressing the dsRNA described in the present invention, methods for constructing a recombinant AV vector, and methods for delivering the vectors to target cells are described in Samulski R et al. (1987), J. Virol. 61: 3096-3101; Fisher K J et al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; US Patent No. 5252479; US patent No. 5139941; International Patent Application No. WO 94/13788 and International Patent Application No. WO 93/24641, the entire disclosure of which is incorporated herein by reference.

Another viral vector suitable for delivering mRNA according to the present invention is a poxvirus such as vaccinia virus, for example an attenuated vaccinia virus such as modified Ankara virus (MVA) or NYVAC, avipox such as fowlpox or canaripox .

The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses or by replacing various viral capsid proteins, as appropriate. For example, lentiviral vectors can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies virus, Ebola virus, Mokola virus, and the like. AAV vectors can be designed to target different cells by designing the vectors to express different serotypes of capsid proteins; see, for example, Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is incorporated herein by reference.

The vector pharmaceutical preparation may include the vector in a suitable diluent or may include a sustained release matrix in which the gene delivery vehicle is included. In the alternative, where the whole gene delivery vector can be produced by native recombinant cells, such as retroviral vectors, then the pharmaceutical preparation may include one or more cells that produce the gene delivery system.

V. Pharmaceutical compositions according to the present invention.

The present invention also includes pharmaceutical compositions and formulations that include the mRNA of the present invention. In one embodiment, provided herein are pharmaceutical compositions comprising the mRNAs described herein and a pharmaceutically acceptable carrier. Pharmaceutical compositions containing mRNA are useful for treating a disease or disorder associated with the expression or activity of the PCSK9 gene, for example, a lipid disorder. Such pharmaceutical compositions are formulated based on the method of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, such as intravenous (IV) delivery. Another example is compositions that are formulated for direct delivery to the brain parenchyma, for example, by infusion into the brain, such as continuous infusion using a pump.

Pharmaceutical compositions containing the RNAi agents of the present invention may be, for example, buffered or unbuffered solutions or compositions containing pharmaceutically acceptable carriers. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micellar formulations, emulsions, and gene therapy vectors.

In the methods of the present invention, the RNAi agent can be administered in solution. The free RNAi agent can be administered in an unbuffered solution, such as saline or water. Alternatively, free siRNA can also be administered in a suitable buffer solution. The buffer solution may contain acetate, citrate, prolamine, carbonate or phosphate or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the RNAi agent can be adjusted so that it is suitable for administration to the subject.

In some embodiments, the buffer solution further comprises means for adjusting the osmolarity of the solution such that the osmolarity is maintained at a desired value, for example, physiological values for human blood plasma. Solutes that can be added to the buffer solution to adjust osmolarity include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids or salts. In some embodiments, the agent for adjusting the osmolarity of the solution is a salt. In certain embodiments, the agent for adjusting the osmolarity of the solution is sodium chloride or potassium chloride.

- 33 046901

The pharmaceutical compositions of the present invention can be administered in doses sufficient to inhibit the expression of the PCSK9 gene. Typically, a suitable dose of mRNA according to the present invention will be in the range of from about 0.001 to about 200.0 milligrams per kilogram of body weight of the recipient per day, typically in the range of from about 1 to 50 mg per kilogram of body weight per day. For example, dsRNA can be administered in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 1.5 mg/kg, about 2 mg/kg , about 3 mg/kg, about 10 mg/kg, about 20 mg/kg, about 30 mg/kg, about 40 mg/kg, or about 50 mg/kg per single dose.

For example, an RNAi agent, such as dsRNA, can be administered at a dose of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8 , 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3 , 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8 , 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3 , 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or approximately 10 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

In another embodiment, the RNAi agent, such as dsRNA, is administered at a dose of about 0.1 to about 50 mg/kg, about 0.25 to about 50 mg/kg, about 0.5 to about 50 mg/kg, from about 0.75 to about 50 mg/kg, from about 1 to about 50 mg/kg, from about 1.5 to about 50 mg/kg, from about 2 to about 50 mg/kg, from about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, about 4 to about 50 mg/kg, about 4.5 to about 50 mg/kg, from about 5 to about 50 mg/kg, from about 7.5 to about 50 mg/kg, from about 10 to about 50 mg/kg, from about 15 to about 50 mg/kg, from about 20 to about 50 mg/kg kg, from about 20 to about 50 mg/kg, from about 25 to about 50 mg/kg, from about 25 to about 50 mg/kg, from about 30 to about 50 mg/kg, from about 35 to about 50 mg/kg kg, from about 40 to about 50 mg/kg, from about 45 to about 50 mg/kg, from about 0.1 to about 45 mg/kg, from about 0.25 to about 45 mg/kg, from about 0. 5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/kg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg kg, from about 2.5 to about 45 mg/kg, from about 3 to about 45 mg/kg, from about 3.5 to about 45 mg/kg, from about 4 to about 45 mg/kg, from about 4, 5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg, from about 20 to about 45 mg/kg, from about 20 to about 45 mg/kg, from about 25 to about 45 mg/kg, from about 25 to about 45 mg/kg, from about 30 to about 45 mg/kg, from about 35 to about 45 mg/kg, from about 40 to about 45 mg/kg, from about 0.1 to about 40 mg/kg, from about 0.25 to about 40 mg/kg, from about 0.5 to about 40 mg/kg, about 0.75 to about 40 mg/kg, about 1 to about 40 mg/kg, about 1.5 to about 40 mg/kg, about 2 to about 40 mg/kg, from about 2.5 to about 40 mg/kg, from about 3 to about 40 mg/kg, from about 3.5 to about 40 mg/kg, from about 4 to about 40 mg/kg, from about 4.5 to about 40 mg/kg, about 5 to about 40 mg/kg, about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, from about 35 to about 40 mg/kg, from about 0.1 to about 30 mg/kg, from about 0.25 to about 30 mg/kg, from about 0.5 to about 30 mg/kg, from about 0.75 to about 30 mg/kg, about 1 to about 30 mg/kg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, from about 3 to about 30 mg/kg, from about 3.5 to about 30 mg/kg, from about 4 to about 30 mg/kg, from about 4.5 to about 30 mg/kg, from about 5 to about 30 mg/kg, from about 7.5 to about 30 mg/kg, from about 10 to about 30 mg/kg, from about 15 to about 30 mg/kg, from about 20 to about 30 mg/kg, from about 20 to about 30 mg/kg, about 25 to about 30 mg/kg, about 0.1 to about 20 mg/kg, about 0.25 to about 20 mg/kg, about 0.5 to about 20 mg/kg kg, from about 0.75 to about 20 mg/kg, from about 1 to about 20 mg/kg, from about 1.5 to about 20 mg/kg, from about 2 to about 20 mg/kg, from about 2, 5 to about 20 mg/kg, about 3 to about 20 mg/kg, about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg kg, from about 5 to about 20 mg/kg, from about 7.5 to about 20 mg/kg, from about 10 to about 20 mg/kg, or from about 15 to about 20 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

For example, an RNAi agent, such as dsRNA, can be administered at a dose of about 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 , 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4 , 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9 , 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4 , 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8,

- 34 046901

9.9, or approximately 10 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

In another embodiment, the RNAi agent, such as dsRNA, is administered at a dose of from about 0.5 to about 50 mg/kg, from about 0.75 to about 50 mg/kg, from about 1 to about 50 mg/kg, from about 1.5 to about 50 mg/kg, about 2 to about 50 mg/kg, about 2.5 to about 50 mg/kg, about 3 to about 50 mg/kg, about 3.5 to about 50 mg/kg, from about 4 to about 50 mg/kg, from about 4.5 to about 50 mg/kg, from about 5 to about 50 mg/kg, from about 7.5 to about 50 mg/kg, from about 10 to about 50 mg/kg, from about 15 to about 50 mg/kg, from about 20 to about 50 mg/kg, from about 20 to about 50 mg/kg, from about 25 to about 50 mg/kg, from about 25 to about 50 mg/kg, from about 30 to about 50 mg/kg, from about 35 to about 50 mg/kg, from about 40 to about 50 mg/kg, from about 45 to about 50 mg/kg, from about 0.5 to about 45 mg/kg, about 0.75 to about 45 mg/kg, about 1 to about 45 mg/kg, about 1.5 to about 45 mg/kg, about 2 to about 45 mg/kg, from about 2.5 to about 45 mg/kg, from about 3 to about 45 mg/kg, from about 3.5 to about 45 mg/kg, from about 4 to about 45 mg/kg, from about 4.5 to about 45 mg/kg, about 5 to about 45 mg/kg, about 7.5 to about 45 mg/kg, about 10 to about 45 mg/kg, about 15 to about 45 mg/kg kg, from about 20 to about 45 mg/kg, from about 20 to about 45 mg/kg, from about 25 to about 45 mg/kg, from about 25 to about 45 mg/kg, from about 30 to about 45 mg/kg kg, from about 35 to about 45 mg/kg, from about 40 to about 45 mg/kg, from about 0.5 to about 40 mg/kg, from about 0.75 to about 40 mg/kg, from about 1 to about 40 mg/kg, about 1.5 to about 40 mg/kg, about 2 to about 40 mg/kg, about 2.5 to about 40 mg/kg, about 3 to about 40 mg/kg, from about 3.5 to about 40 mg/kg, from about 4 to about 40 mg/kg, from about 4.5 to about 40 mg/kg, from about 5 to about 40 mg/kg, from about 7.5 to about 40 mg/kg, about 10 to about 40 mg/kg, about 15 to about 40 mg/kg, about 20 to about 40 mg/kg, about 20 to about 40 mg/kg, about 25 to about 40 mg/kg, about 25 to about 40 mg/kg, about 30 to about 40 mg/kg, about 35 to about 40 mg/kg, about 0.5 to about 30 mg/kg, about 0.75 to about 30 mg/kg, about 1 to about 30 mg/kg, about 1.5 to about 30 mg/kg, about 2 to about 30 mg/kg, about 2.5 to about 30 mg/kg, from about 3 to about 30 mg/kg, from about 3.5 to about 30 mg/kg, from about 4 to about 30 mg/kg, from about 4.5 to about 30 mg/kg, from about 5 to about 30 mg/kg, about 7.5 to about 30 mg/kg, about 10 to about 30 mg/kg, about 15 to about 30 mg/kg, about 20 to about 30 mg/kg, from about 20 to about 30 mg/kg, from about 25 to about 30 mg/kg, from about 0.5 to about 20 mg/kg, from about 0.75 to about 20 mg/kg, from about 1 to about 20 mg/kg, from about 1.5 to about 20 mg/kg, from about 2 to about 20 mg/kg, from about 2.5 to about 20 mg/kg, from about 3 to about 20 mg/kg, from about 3.5 to about 20 mg/kg, about 4 to about 20 mg/kg, about 4.5 to about 20 mg/kg, about 5 to about 20 mg/kg, about 7.5 to about 20 mg/kg, about 10 to about 20 mg/kg, or about 15 to about 20 mg/kg. In one embodiment, the dsRNA is administered at a dose of from about 10 mg/kg to about 30 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

For example, subjects may be administered a therapeutic amount of mRNA, such as about 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, , 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or approximately 50 mg/kg. Values and ranges intermediate to the listed values are also intended to be part of the present invention.

The pharmaceutical composition may be administered once daily, or the mRNA may be administered in two, three or more dosage units at regular intervals throughout the day, or even by continuous infusion or delivery via a controlled release formulation. In such a case, the amount of mRNA contained in each portion of the dose must be correspondingly less to provide the total daily dose. The dosage unit can also be formulated for delivery over several days, for example, using a traditional sustained release formulation that provides sustained release of the mRNA over a period of several days. Sustained release formulations are well known in the art and are particularly useful for delivering agents to a specific site, as for example they can be used with the agents of the present invention. In such an embodiment, the dosage unit contains a corresponding plurality of daily dosages.

In other embodiments, a single dose of pharmaceutical compositions may be longer

- 35 046901 telny action, so that subsequent doses are administered at intervals of not more than 3, 4 or 5 days or at intervals of not more than 1, 2, 3 or 4 weeks. In some embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered once per week. In other embodiments of the present invention, a single dose of the pharmaceutical compositions of the present invention is administered every two months.

One of ordinary skill in the art will appreciate that certain factors may influence the dosage and time frame required to effectively treat a subject, including, without limitation, the severity of the disease or disorder, types of prior treatment, general health and/or age of the subject, and others. existing diseases. In addition, treatment of a subject with a therapeutically effective amount of the composition may include a single treatment period or a series of treatment periods. Estimates of effective doses and in vivo half-lives for individual mRNAs covered by the present invention can be obtained using traditional methodologies, or based on in vivo studies using an appropriate animal model, as described elsewhere in this document.

Advances in mouse genetics have provided a number of mouse models for studying various human diseases, such as bleeding disorders, which can be beneficially affected by reducing PCSK9 expression. Such models can be used to conduct in vivo studies of mRNA, as well as to determine a therapeutically effective dose. Suitable mouse models are known in the art and include, for example, a mouse containing a transgene expressing human PCSK9.

The pharmaceutical compositions of the present invention can be administered in various ways depending on whether local or systemic treatment is required and the area to be treated. Administration may be local (for example, using a transdermal patch), pulmonary, for example, by inhalation or blowing powders or aerosols, including using an inhaler; intratracheal, intranasal, epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, for example through an implanted device; or intracranial, for example, intraparenchymal, intrathecal or intraventricular administration.

The mRNA can be delivered in such a way that it targets a specific tissue, such as the liver (eg, liver hepatocytes).

Pharmaceutical and topical compositions may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Traditional pharmaceutical carriers, aqueous, powder or oily bases, thickeners, etc. may be necessary or desirable. You can also use covered condoms, gloves, etc. Suitable topical formulations include those in which the mRNAs described herein are in admixture with a topical delivery vehicle such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (eg, dioleoyl phosphatidylethanolamine (DOPE), dimyristoyl phosphatidylcholine (DMPC), distearoyl phosphatidylcholine), negative (eg, dimyristoyl phosphatidylglycerol (DMPG)) and cationic (eg, dioleoyltetramethylaminopropyl (DOTAP) and dioleoyl phosphatidylethanolamine (DOTMA) ). The mRNAs described in the present invention can be encapsulated in liposomes or can form complexes with them, in particular with cationic liposomes. Alternatively, mRNAs can form complexes with lipids, in particular cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl-1-monocaprate, 1-dodecyl acycloheptan-2-one, acylcarnitine, acylcholine or C _1-20 alkyl esters (eg isopropyl myristate (IPM)), monoglyceride, diglyceride or a pharmaceutically acceptable salt thereof. Topical formulations are described in detail in US Pat. No. 6,747,014, which is incorporated herein by reference.

A. mRNA formulations containing membrane molecular assemblies of mRNA for use in the compositions and methods of the present invention can be formulated for delivery into a membrane molecular assembly, such as a liposome or micelle. As used herein, the term liposome refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer, such as one bilayer or multiple bilayers. Liposomes include single-layer and multilayer vesicles that have a membrane formed of lipophilic material and an aqueous interior. The aqueous part contains a composition with mRNA. The lipophilic material separates the aqueous internal environment from the aqueous external environment, which typically does not include an mRNA composition, although in some examples it may. Liposomes are suitable for carrying and delivering active ingredients to the site of action. Due to the fact that the membrane

- 36 046901 for liposomes is structurally similar to biological membranes; when liposomes are applied to tissues, the liposome bilayer merges with the bilayer of cell membranes. As liposome-cell fusion proceeds, the internal aqueous contents, which include mRNA, are delivered into the cell, where the mRNA can specifically bind to the target RNA and can mediate RNAi. In some cases, liposomes are also specifically targeted, for example to direct mRNA to specific cell types.

Liposomes containing an RNAi agent can be prepared in a number of ways. In one example, the lipid component of the liposome is dissolved in detergent to form micelles with the lipid component. For example, the lipid component may be an amphipathic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be non-ionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate and lauroyl sarcosine. The RNAi agent formulation is then added to micelles that include a lipid component. The cationic groups of the lipid interact with the RNAi agent and condense around the RNAi agent to form a liposome. After condensation, the detergent is removed, for example by dialysis, to obtain a liposomal preparation of the RNAi agent.

If necessary, a carrier compound that promotes condensation can be added during the condensation reaction, for example, by controlled addition. For example, the carrier compound may be a polymer other than a nucleic acid (eg, spermine or spermidine). The pH can also be adjusted to promote condensation.

Methods for preparing stable polynucleotide delivery vehicles that include a polynucleotide/cationic lipid complex as structural components of the delivery vehicles are further described, for example, in WO 96/37194, the entire contents of which are incorporated herein by reference. The formation of liposomes may also include one or more aspects of the illustrative methods described in Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987; US Patent No. 4897355; US Patent No. 5171678; Bangham, et al. M. Mol. Biol. 23:238, 1965; Olson, et al. Biochim. Biophys. Acta 557:9, 1979; Szoka, et al. Proc. Natl. Acad. Sci. 75:4194, 1978; Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984; Kim, et al. Biochim. Biophys. Acta 728:339, 1983; and Fukunaga, et al. Endocrinol. 115:757, 1984. Commonly used techniques for preparing lipid aggregates of appropriate size for use as delivery vehicles include sonication and freeze-thaw extrusion (see, for example, Mayer, et al. Biochim. Biophys. Acta 858:161, 1986 ). Microfluidization can be used in applications where consistently small (50 to 200 nm) and relatively uniform aggregates are desired (Mayhew, et al. Biochim. Biophys. Acta 775:169, 1984). Such methods are easily adapted to package the RNAi agent formulation into liposomes.

Liposomes are divided into two broad classes. Cationic liposomes are positively charged liposomes that interact with negatively charged nucleic acid molecules to form stable complexes. The positively charged nucleic acid/liposome complex binds to the negatively charged cell surface and is internalized into the endosome. Due to the acidic pH inside the endosome, liposomes rupture, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980985).

Liposomes, which are pH-sensitive or negatively charged, trap nucleic acids instead of forming a complex with them. Since both the nucleic acid and the lipid have the same charge, repulsion occurs instead of forming a complex. However, some of the nucleic acids are trapped in the aqueous internal environment of these liposomes. pH-sensitive liposomes were used to deliver nucleic acids encoding the thymidine kinase gene to cell monolayers in culture. Exogenous gene expression was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

One main type of liposomal composition includes phospholipids other than naturally occurring phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are typically formed from dimyristoylphosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleylphosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC), such as, for example, soybean PC and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

Examples of other methods for in vitro and in vivo introduction of liposomes into cells include US Pat. No. 5,283,185; US Patent No. 5171678; WO 94/00569; WO 93/24640; WO 91/16024; Feigner, J. Biol. Chem. 269:2550, 1994; Nabel, Proc. Natl. Acad. Sci. 90:11307, 1993; Nabel, Human Gene Ther. 3:649, 1992; Gershon, Biochem. 32:7143, 1993; and Strauss EMBO J. 11:417, 1992.

Nonionic liposome systems have also been studied to determine their suitability for drug delivery to the skin, in particular systems containing nonionic surfactant and cholesterol. Non-ionic liposomal formulations containing Novasome™ I (glyceryl dylau

- 37 046901 rat/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine-A to the dermal layer of mouse skin. The results showed that such non-ionic liposome systems were effective in ensuring the deposition of cyclosporine A in various layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4(6) 466).

Liposomes also include sterically stabilized liposomes, which as used herein means liposomes containing one or more special lipids that, when incorporated into liposomes, result in increased lifetime in the bloodstream compared to liposomes that lack such special lipids. Examples of sterically stabilized liposomes are those in which the vesicle portion of the lipid moiety of the liposome (A) contains one or more glycolipids, such as monosialoganglioside G _M1 , or (B) is derived from one or more hydrophilic polymers, such as polyethylene glycol (PEG) fragment. Without wishing to be bound by any particular theory, it is believed in the art that at least for spatially stabilized liposomes containing gangliosides, sphingomyelin or PEG-derived lipids, the increased half-life in the circulation of these spatially stabilized liposomes is a consequence of reduced uptake by cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

A variety of liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) described the ability of monosialoganglioside G _M1 , galactocerebroside sulfate and phosphatidylinositol to increase the half-life of liposomes in the blood. These findings were commented on by Gabizon et al. (Proc. Natl. Acad. Sci. USA, 1988, 85, 6949). US Pat. No. 4,837,028 and WO 88/04924, both of Allen et al., disclose liposomes containing (1) sphingomyelin and (2) ganglioside G _M1 or galactocerebroside sulfate esters. US Pat. No. 5,543,152 (Webb et al) discloses liposomes containing sphingomyelin. Liposomes containing 1,2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al.).

In one embodiment, cationic liposomes are used. Cationic liposomes have the advantage of being able to fuse with the cell membrane. Noncationic liposomes, although they cannot fuse as efficiently with the plasma membrane, are taken up by macrophages in vivo and can be used to deliver RNAi agents to macrophages.

Additional advantages of liposomes include the following: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can include a wide range of water and fat-soluble drugs; liposomes can protect encapsulated RNAi agents in internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, volume 1, p. 245). Important aspects in the preparation of liposome formulations are the surface charge of the lipid, the vesicle size and the aqueous volume of the liposomes.

A positively charged synthetic cationic lipid, N-[1-(2,3dioleyloxy)propyl]-NKA-trimethylammonium chloride (DOTMA), can be used to form small liposomes that spontaneously interact with nucleic acid to form lipid-nucleic acid complexes that can fuse with negatively charged lipids of the cell membranes of tissue culture cells, resulting in the delivery of an RNAi agent (see, for example, Feigner, P. L. et al., Proc. Natl. Acad. Sci., USA 8:7413-7417, 1987 and patent US No. 4897355 regarding the description of DOTMA and its application with DNA).

The DOTMA analogue, 1,2-bis(oleoyloxy)-3-(trimethylammonium)propane (DOTAP), can be used in combination with a phospholipid to form vesicles complexed with DNA. Lipofectin™ (Bethesda Research Laboratories, Gaithersburg, MD) is an effective delivery agent for highly anionic nucleic acids into living tissue culture cells that contains positively charged DOTMA liposomes that spontaneously react with negatively charged polynucleotides to form complexes. In cases where liposomes with a sufficient positive charge are used, then the total charge of the resulting complexes is also positive. Positively charged complexes produced in this manner spontaneously attach to negatively charged cell surfaces, fuse with the plasma membrane, and efficiently deliver functional nucleic acids, for example, to tissue culture cells. Another commercially available cationic lipid, 1,2-bis(oleoyloxy)-3,3(trimethylammonium)propane (DOTAP) (Boehringer Mannheim, Indianapolis, IN), differs from DOTMA in that the oleyl moieties are linked by ester rather than ether bonds .

Other published compounds with cationic lipids include those that have been conjugated to a number of moieties, including, for example, carboxyspermine, which has been conjugated to one of two types of lipids and includes compounds such as 5carboxyspermylglycine dioctaoleoylamide (DOGS) (Transfectam™, Promega, Madison , Wisconsin) and

- 38 046901 dipalmitoylphosphatidylethanolamine 5-carboxyspermyl-amide (DPPES) (see, for example, US Pat. No. 5,171,678).

Another cationic lipid conjugate includes derived cholesterol lipid derivatives (DC-Chol) which have been formulated as liposomes in combination with DOPE (see, Gao, X. and Huang, L., Biochim. Biophys. Res. Commun. 179 :280, 1991). Lipopolysine, produced by conjugating polylysine with DOPE, has been reported to be effective when transfected in the presence of serum (Zhou, X. et al., Biochim. Biophys. Acta 1065:8, 1991). For certain cell lines, such liposomes containing conjugated cationic lipids are reported to exhibit lower toxicity and provide more efficient transfection than DOTMA-containing compositions. Other commercially available cationic lipid products include DMRIE and DMRIE-HP (Vical, La Jolla, CA) and Lipofectamine (DOSPA) (Life Technology, Inc., Gaithersburg, MD). Other cationic lipids suitable for the delivery of oligonucleotides are described in WO 98/39359 and WO 96/37194.

Liposome formulations are particularly suitable for topical application, with liposomes exhibiting some advantages over other formulations. Such advantages include reduced side effects relative to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to deliver the RNAi agent into the skin. In some embodiments, liposomes are used to deliver the RNAi agent to epidermal cells and also to enhance penetration of the RNAi agent into dermal tissues, such as skin. For example, liposomes can be applied topically. Local delivery of drugs formulated as liposomes to the skin has been documented (see, for example, Weiner et al., Journal of Drug Targeting, 1992, vol. 2,405-410 and du Plessis et al., Antiviral Research, 18, 1992, 259-265; Mannino, R. J. and Fould-Fogerite, S., Biotechniques 6:682-690, 1988; Itani, T. et al. 1987; Enz. 149:157-176, 1987; Straubinger, R. M. and Papahadjopoulos, D. Meth. USA 84:7851-7855, 1987).

Nonionic liposome systems have also been studied to determine their suitability for drug delivery to the skin, in particular systems containing nonionic surfactant and cholesterol. Nonionic liposome formulations containing Novasome I (glyceryl dilaurate/cholesterol/polyoxyethylene-10-stearyl ether) and Novasome II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver drug to the dermal layer of mouse skin. Such RNAi agent formulations are useful for the treatment of a dermatological disorder.

Liposomes that include mRNA can be produced with high deformability. This deformability may allow liposomes to penetrate through a pore that is smaller than the average radius of the liposome. For example, a type of deformable liposome is transfersome. Transferosomes can be prepared by adding surface interfacial activators, usually surfactants, to a standard liposome composition. Transfersomes that include an RNAi agent can be delivered, for example, by subcutaneous injection to deliver the RNAi agent to keratinocytes in the skin. To pass through intact mammalian skin, lipid vesicles must pass through a series of small pores, each less than 50 nm in diameter, under the influence of a suitable intradermal gradient. In addition, due to the properties of lipids, such transferosomes can be self-optimizing (adapting to the shape of pores, such as in skin), self-repairing, and can often reach their targets without fragmentation, and can often be self-loading.

Other compositions useful in the present invention are described in US Provisional Application Serial Nos. 61/018616, filed January 2, 2008; 61/018611, filed January 2, 2008; 61/039748, filed March 26, 2008; 61/047087, filed April 22, 2008, and 61/051528, filed May 8, 2008. PCT application No. PCT/US2007/080331, filed October 3, 2007, also describes compositions useful in the present invention.

Transfersomes are another type of liposome and are highly deformable lipid aggregates that are promising candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets that have such a high deformability that they can easily penetrate through pores smaller than droplets. Transfersomes are adaptable to the environment in which they are used, for example, they are self-optimizing (adapting to the shape of the pores in the skin), self-repairing, often reach targets without fragmentation, and can often be self-booting. To produce transfersomes, surface interfacial activators, typically surfactants, can be added to a standard liposome composition. Transfersomes have been used to deliver serum albumin into the skin. Transfersome-mediated delivery of serum albumin was shown to be as effective as subcutaneous injection of a solution containing serum albumin.

- 39 046901

Surfactants are widely used in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of many different types of surfactants, both natural and synthetic, is using the hydrolipid balance (HLB). The nature of the hydrophilic group (also known as the head) provides the most effective means for categorizing the various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285 ).

If the surfactant molecule is not ionized, then it is classified as a nonionic surfactant. Nonionic surfactants are widely used in pharmaceutical and cosmetic products and can be used over a wide range of pH values. Typically their HLB values range from 2 to about 18, depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters and ethoxylated esters. Nonionic alkanoamides and esters, such as fatty alcohol ethoxylates, propoxylated alcohols and ethoxylated/propoxylated block copolymers, are also included in this class. Polyoxyethylene surfactants are the most common members of the nonionic surfactant class.

If a surfactant molecule carries a negative charge when dissolved or dispersed in water, then the surfactant is classified as anionic. Anionic surfactants include carboxylates such as saponifiers, acyl lactylates, amino acid acylamides, sulfuric acid esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the class of anionic surfactants are alkyl sulfates and saponifiers.

If a surfactant molecule carries a positive charge when dissolved or dispersed in water, then the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. Quaternary ammonium salts are the most used representatives of this class.

If a surfactant molecule has the ability to carry either a positive or negative charge, then the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines and phosphatides.

The use of surfactants in finished dosage forms, formulations and emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

The mRNA for use in the methods of the present invention may also be provided in the form of micellar formulations. Micelles are defined herein as a specific type of molecular assembly in which the amphipathic molecules are organized in a spherical structure such that all the hydrophobic portions of the molecule face inward, leaving the hydrophilic portions in contact with the surrounding aqueous phase. The opposite arrangement occurs if the environment is hydrophobic.

A mixed micellar formulation suitable for delivery through intradermal membranes can be prepared by mixing an aqueous solution of the siRNA composition, an alkali metal C ₈ -C ₂ 2-alkyl sulfate, and micelle-forming compounds. Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleates, monolaurates, borage oil, evening primrose oil , menthol, trihydroxyoxocholanyl-glycine and its pharmaceutically acceptable salts, glycerin, polyglycerol, lysine, polylysine, triolein, polyoxyethylene ethers and analogs thereof, polidocanol alkyl ethers and their analogs, chenodeoxycholate, deoxycholate and mixtures thereof. Micelle-forming compounds can be added during or after the addition of the alkali metal alkyl sulfate. Mixed micelles will form from essentially any type of mixing of ingredients other than vigorous stirring to produce smaller micelles.

In one method, a first micellar composition is prepared that contains an siRNA composition and at least an alkali metal alkyl sulfate. The first micellar composition is then mixed with at least three micellar compounds to form a mixed micellar composition. In another method, a micellar composition is prepared by mixing the siRNA composition, an alkali metal alkyl sulfate and at least one of the micelle-forming compounds, followed by vigorously mixing the remaining micelle-forming compounds.

Phenol and/or m-cresol can be added to the mixed micellar composition to stabilize

- 40 046901 composition and protection against bacterial growth. Alternatively, phenol and/or m-cresol can be added with micelle-forming ingredients. An isotonic agent such as glycerin can also be added after the mixed micellar composition is formed.

To deliver a micellar formulation as a spray, the formulation can be placed in an aerosol dispenser and the dispenser charged with propellant. The propellant gas, which is under pressure, is found in liquid form in the nebulizer. The ratios of the ingredients are adjusted so that the aqueous phase and the propellant phase become one, i.e. there is one phase. If there are two phases, then it is necessary to shake the sprayer before spraying part of the contents, for example, by means of a dosing valve. The atomized dose of pharmaceutical agent is expelled from the dosing valve in the form of a fine stream.

Propellant gases may include hydrogen-containing chlorofluorocarbons, hydrogen-containing fluorocarbons, dimethyl ether and diethyl ether. In certain embodiments, HFA 134a (1,1,1,2-tetrafluoroethane) can be used.

Specific concentrations of the main ingredients can be determined by performing relatively simple experiments. Oral absorption often requires increasing, eg at least doubling or tripling, the dose intended for injection or gastrointestinal administration.

B. Lipid particles.

The mRNA, eg dsRNA of the present invention, can be completely encapsulated in a lipid composition, eg LNP, or other nucleic acid-lipid particle.

As used herein, the expression LNP refers to a stable nucleic acid-lipid particle. LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents particle aggregation (eg, PEG-lipid conjugate). LNPs are highly suitable for systemic applications because they have a long lifetime in the bloodstream after intravenous (i.v.) injection and accumulate at distal sites (eg, sites physically separated from the injection site). LNPs include pSPLP, which includes an encapsulated condenser-nucleic acid complex, which is described in PCT Publication No. WO 00/03683. The particles of the present invention typically have an average diameter of from about 50 nm to about 150 nm, more often from about 60 nm to about 130 nm, more often from about 70 nm to about 110 nm, most often from about 70 nm to about 90 nm, and generally are non-toxic. In addition, nucleic acids, when present in the nucleic acid-lipid particles of the present invention, are resistant to nuclease degradation in aqueous solution. Nucleic acid-lipid particles and the method for their preparation are disclosed, for example, in US patents No. 5976567; 5981501; 6534484; 6586410; 6815432; US Publication No. 2010/0324120 and PCT Publication No. WO 96/40964.

In one embodiment, the lipid to drug ratio (w/w ratio) (e.g., lipid to dsRNA ratio) will range from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the ranges listed above are also contemplated as part of the present invention.

The cationic lipid may be, for example, N-dioleyl-N,N-dimethylammonium chloride (DODAC), N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(I-(2,3dioleoyloxy)propyl)-H chloride, ^Ntrimethylammonium (DOTAP), N-(I-(2,3-dioleyloxy)propyl)Н.Н.Н-trimethylammonium chloride (DOTMA), ^Ndimethyl-2,3-dioleyloxy)propylamine (DODMA), 1, 2-dilinoleyloxy-N^-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-CDAP), 1,2-dilinoleyloxy-3-(dimethylamino) acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleylthio3-dimethylaminopropane (DLin-S-DMA), 1- linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2DMAP), 1,2-dilinoleoyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP. Cl), 1,2-dilinoleyloxy-3-(Nmethylpiperazino)propane (DLin-MPZ) or 3-(N,N-dilinoleylamino)-1,2-npropanediol (DLinAP), 3-(N,Ndioleylamino)-1, 2-propanediol (DOAP), 1,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), ^-dilinolenyloxy-N^-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl -4dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or its analogs, (3aR,5s,6aS)-N,N-dimethyl-2,2di((9Z,12Z)-octageca-9,12 -dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,3^)-heptatriaconta-6,9,28,31-tetraene-19- yl-4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazine -1-yl)ethylazanediyl)didodecane-2-ol (Tech G1) or a mixture thereof. The cationic lipid may comprise from about 20 to about 50 mol% or about 40 mol% of the total lipid content present in the particle.

In another embodiment, the compound 2,2-dilinoleyl-4 can be used

- 41 046901 dimethylaminoethyl-[1,3]-dioxolane for the production of lipid-siRNA nanoparticles. The synthesis of 2,2-dilinoleyl-4dimethylaminoethyl-[1,3]-dioxolane is described in US provisional application number 61/107998, filed October 23, 2008, which is incorporated herein by reference. In one embodiment, the lipid-siRNA particles include 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane; 10% DSPC; 40% cholesterol; 10% PEG-C-DOMG (mol percent) with a particle size of 63.0 ± 20 nm and a siRNA/lipid ratio of 0.027.

The ionizable/non-cationic lipid may be an anionic lipid or a neutral lipid, including, but not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE) ), palmitoiloleol phosphatidylcholine (RORS), palmitoilleol phosphateanolamine (Pope), dioleoil-phosphatidydanolamine4- (malemidomethyl) -yclogoxan-1-carboxylate (Dope-MAL), dipalmitolphosphatidydidanolamine (DPPE) Miristoil phosphorusfoetanolamine (DMPE), Dostyaroil-phosphatidydil-eTanolamine (DSPE) , 16-Omonomethyl-PE, 16-O-dimethyl-PE, 18-1-trans-PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol or a mixture thereof. The non-cationic lipid may comprise from about 5 to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipid content present in the particle if cholesterol is included.

The conjugated lipid that inhibits particle aggregation may be, for example, a polyethylene glycol (PEG)-lipid conjugate, including, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer) or a mixture thereof. The PEG-DAA conjugate may be, for example, PEG-dilauryloxypropyl (Ci ₂ ), PEG dimyristoyloxypropyl (Ci ₄ ), PEG-dipalmityloxypropyl (Ci ₆ ) or PEG-distearyloxypropyl (Ci ₈ ). The conjugated lipid that prevents particle aggregation may range from 0 to about 20 mol% or about 2 mol% of the total lipid content present in the particle.

In some embodiments, the nucleic acid-lipid particle further includes cholesterol in an amount, for example, from about 10 to about 60 mole% or about 48 mole% of the total lipid content present in the particle.

In one embodiment, the lipidoid ND98-4HCl (MW 1487) (see US Patent Application No. 12/056230, filed March 26, 2008, which is incorporated herein by reference), cholesterol (Sigma-Aldrich), and PEG- C16 ceramide (Avanti Polar Lipids) can be used to prepare lipid-dsRNA nanoparticles (ie LNP01 particles). Stock solutions of each in ethanol can be prepared as follows: ND98, 133 mg/ml; cholesterol, 25 mg/ml, PEG-ceramide C16, 100 mg/ml. Stock solutions of ND98, cholesterol and PEG-ceramide C16 can then be combined, for example in a molar ratio of 42:48:10. The pooled lipid solution can be mixed with an aqueous solution of dsRNA (eg, sodium acetate, pH 5) such that the final ethanol concentration is approximately 3545% and the final sodium acetate concentration is approximately 100-300 mM. LipiddsRNA nanoparticles typically form spontaneously upon mixing. Depending on the desired particle size distribution, the resulting nanoparticle mixture can be extruded through a polycarbonate membrane (eg, 100 nm size cutoff) using, for example, a thermal barrel extruder such as a Lipex Extruder (Northern Lipids, Inc). In some cases, the extrusion step can be skipped. Ethanol removal and simultaneous buffer exchange can be accomplished, for example, by dialysis or tangential flow filtration. The buffer can be replaced, for example, by phosphate buffered saline (PBS) with a pH of about 7, for example, a pH of about 6.9, a pH of about 7.0, a pH of about 7.1, a pH of about 7.2, a pH of about 7.3, or pH approximately 7.4.

ND98 Isomer I

Formula 1

The compositions of LNP01 are described, for example, in International Application Publication No. WO 2008/042973, which is therefore incorporated by reference.

Additional exemplary lipid-dsRNA formulations are described in Table 1. A.

- 42 046901

Table A

Ionizable/cationic lipid Cationic lipid/non-cationic lipid/cholesterol/PEG-lipid conjugate Lipid:siRNA ratio LNP 1 1,2-dilino lenyloxy-N,N- dimethylaminopropane (DLinDMA) DLinDMA/DPPC/xonecTepHH/PEG-cDMA (57.1/7.1/34.4/1.4) lipid: siRNA ~ 7:1 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XT C/ORRS/cholesterol/RES-SOMA 57.1/7.1/34.4/1.4 lipid: siRNA ~ 7:1 LNP05 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]- dioxolane (XTS) XTC/DSPC/xonecTepnH/PEG-DMG 57.5/7.5/31.5/3.5 lipid: siRNA ~ 6:1

- 43 046901

LNP06 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xo.accTcpuH/PEG-DMG 57.5/7.5/31.5/3.5 nnrnu:siRNA~- 11:1 LNP07 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xo.iccTcpHH/PEG-DMG 60/7.5/31/1.5 lipid: siRNA ~ 6:1 LNP08 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xonecTepHH/PEG-DMG 60/7.5/31/1.5 nnniu:siRNA~-11:1 LNP09 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]dioxolane (XTS) XTC/DSPC/xo.iccTcpHH/PEG-DMG 50/10/38.5/1.5 .nnntxsiRNA 10:1 LNP10 (ZaI.55.6a8)-M.M-dimstil-2.2-di((92.122)octadeca-9,12-dienyl)tetrahydro-3 aHcyclopenta[c1] [1,3] dioxo l-5-amine (ALN100) ALNIOO/DSPC/xo.iccTcpuH/PEG-DMG 50/10/38.5/1.5 .nnntxsiRNA 10:1 LNP11 (6Z,9Z,28Z,3^)-heptatriaconta-6,9,28,31 tetraen-19-yl-4-(dimethylamino)butanoate (MSZ) MC-3/DSPC7\o.iccTcpHH/PEG-DMG 50/10/38.5/1.5 .nnntxsiRNA 10:1 LNP12 1,G-(2-(4-(2-((2-(bis(2- hydroxydodecyl)amino)ethyl)(2- hydroxydodecyl)amino)ethyl)piperazine-1- yl)ethylazanediyl)didodecane-2-ol (Tech G1) Tech GI/DSPC/xo.iccTcpuH/PEG-DMG 50/10/38.5/1.5 .nnntxsiRNA 10:1 LNP13 XTS XTC/DSPC/xo.i/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 33:1 LNP14 MSZ MC3/DSPC7\o.i/PEG-DMG 40/15/40/5 lipid: siRNA: 11:1 LNP15 MSZ MC3/DSPC7\o.i/PEG-DSG/GalNAc -PEG-DSG 50/10/35/4.5/0.5 lipid: siRNA: 11:1 LNP16 MSZ MC3/DSPC7\o.a/PEG-DMG 50/10/38.5/1.5 lipid:siRNA: 7:1 LNP17 MSZ MC3/DSPC7\o.a/PEG-DSG 50/10/38.5/1.5 .nnntxsiRNA: 10:1 LNP18 MSZ MC3/DSPC7\o.a/PEG-DMG 50/10/38.5/1.5 .nnntxsiRNA: 12:1 LNP19 MSZ MC3/DSPC7\o.a/PEG-DMG 50/10/35/5 lipid:siRNA: 8:1 LNP20 MSZ MC3/DSPC7\o.a/PEG-DPG 50/10/38.5/1.5 lipidACHA: 10:1 LNP21 S12-200 Cl 2-200/DSPC/xo.a/PEG-DSG 50/10/38.5/1.5 lipid:siRNA: 7:1 LNP22 XTS XTC/DSPC/xo.a/PEG-DSG 50/10/38.5/1.5 .nnntxsiRNA: 10:1

DSPC: distearoylphosphatidylcholine;

DPPC: dipalmitoylphosphatidylcholine;

PEG-DMG: PEG-didimyristoylglycerol (C14-PEG or PEG-C14) (PEG average molecular weight 2000);

PEG-DSG: PEG-distyrylglycerol (C18-PEG or PEG-C18) (PEG average molecular weight 2000);

PEG-cDMA: PEG-carbamoyl-1,2-dimyristoyloxypropylamine (PEG average molecular weight 2000).

Formulations containing LNP (1,2-dilinolenyloxy-X,X-dimethylaminopropane (DLinDMA)) are described

- 44 046901 in International Publication No. WO 2009/127060, filed April 15, 2009, which is therefore incorporated by reference.

CTS-containing compositions are described, for example, in US provisional application Serial No. 61/148366, filed January 29, 2009; US Provisional Application Serial No. 61/156851, filed March 2, 2009; US Provisional Application Serial No. filed June 10, 2009; US Provisional Application Serial No. 61/228373, filed July 24, 2009; US Provisional Application Serial No. 61/239686, filed September 3, 2009, and International Application No. PCT/US2010/022614, filed January 29, 2010, which are hereby incorporated by reference.

MC3-containing compositions are described, for example, in US Publication No. 2010/0324120, filed June 10, 2010, the entire contents of which are therefore incorporated by reference.

ALNY-100-containing compositions are described, for example, in international patent application number PCT/US09/63933, filed November 10, 2009, which is therefore incorporated by reference.

C12-200-containing compositions are described in US Provisional Application Serial No. 61/175770, filed May 5, 2009, and International Application No. PCT/US10/33777, filed May 5, 2010, which are therefore incorporated by reference to links.

Synthesis of ionizable/cationic lipids.

Any of the compounds, eg, cationic lipids and the like, used in the nucleic acid-lipid particles of the present invention can be prepared using known organic synthesis techniques, including those described in more detail in the Examples. All substituents are as defined below unless otherwise noted.

Alkyl means a straight chain or branched, non-cyclic or cyclic, saturated aliphatic hydrocarbon containing from 1 to 24 carbon atoms. Typical straight chain saturated alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, and the like; while saturated branched alkyls include isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl and the like. Typical saturated cyclic alkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl and the like; whereas unsaturated cyclic alkyls include cyclopentenyl and cyclohexenyl and the like.

Alkenyl means alkyl, as defined above, containing at least one double bond between adjacent carbon atoms. Alkenyls include both cis and trans isomers. Typical straight chain and branched alkenyls include ethylenyl, propylenyl, 1-butenyl, 2-butenyl, isobutylenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl -2butenyl, etc.

Alkynyl means any alkyl or alkenyl, as defined above, which additionally contains at least one triple bond between adjacent carbon atoms. Representative straight chain and branched alkynyls include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, and the like.

Acyl means any alkyl, alkenyl or alkynyl in which the carbon atom at the point of attachment is replaced by an oxo group, as defined below. For example, -C(=O)alkyl, -C(=O)alkenyl and C(=O)alkynyl are acyl groups.

Heterocycle means a 5-7 membered monocyclic or 7-10 membered bicyclic, heterocyclic ring which is either saturated, unsaturated or aromatic and which contains 1 or 2 heteroatoms independently selected from nitrogen, oxygen and sulfur, and where the heteroatoms are nitrogen and sulfurs may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized, including bicyclic rings in which any of the above heterocycles are fused to a benzene ring. The heterocycle can be attached via any heteroatom or carbon atom. Heterocycles include heteroaryls, which are defined below. Heterocycles include morpholinyl, pyrrolidinonyl, pyrrolidinyl, piperidinyl, piperisinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, tetrahydropyridinyl, tetrahydroprimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, tetrahydrothiophenyl, tetrahydrothiopyranyl, etc.

The expressions optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted acyl and optionally substituted heterocycle mean that upon substitution, at least one hydrogen atom is replaced by a substituent. In the case of an oxo substituent (=O), two hydrogen atoms are replaced. In this regard, substituents include oxo, halogen, heterocycle, -CN, -OR _x , -NR _x R _y , -NR _x C(=O)R _y , -NR _x SO ₂ R _y , -C(=O )R _x , -C(=O)OR _x , C(=O)NR _x R _y , -SOnR _x and -SOnNR _x R _y where n is 0, 1 or 2, R _x and R _y are the same or different and independently represent hydrogen, alkyl, or heterocycle, and each of said alkyl and heterocycle substituents may further be substituted by one or more of oxo, halogen, -OH, -CN, alkyl, -OR _x , heterocycle, -NR _x R _y , -NR _x C(=O)R _y , -NR _x SO ₂ R _y , -C(=O)R _x , -C(=O)OR _x , C(=O)NR _x R _y , -SO _n R _x and -SO _n NR _x R _y .

Halogen means fluorine, chlorine, bromine and iodine.

In some embodiments, the methods of the present invention may require

- 45 046901 Be wary of the use of protecting groups. The technique of using protecting groups is well known to those skilled in the art (see, for example, Protective Groups in Organic Synthesis, Green, T.W. et al., Wiley-Interscience, New York City, 1999). Briefly, protecting groups in the context of the present invention are any group that reduces or eliminates the undesirable chemical activity of a functional group. A protecting group can be added to a functional group to block its chemical activity during certain reactions and then removed to reveal the original functional group. In some embodiments, a protecting group is used for the alcohol group. A protecting group for an alcohol group is any group that reduces or eliminates the undesirable chemical activity of the alcohol functionality. Protecting groups can be added and removed using techniques well known in the art.

Synthesis of formula A.

In some embodiments, the nucleic acid-lipid particles of the present invention are formulated using a cationic lipid of Formula A:

wherein R ₁ and R 2 are independently alkyl, alkenyl or alkynyl, each optionally being substituted, and R 3 and R 4 are independently lower alkyl, or R 3 and R 4 may, taken together, form an optionally substituted heterocyclic ring. In some embodiments, the cationic lipid is CTS, (2,2-dilinoleyl-4-dimethylaminoethyl[1,3]-dioxolane). In general, the lipid of Formula A above can be prepared using the following Reaction Schemes 1 or 2, wherein all substituents are as defined above unless otherwise indicated.

Scheme 1

Lipid A, wherein R1 and R2 are independently alkyl, alkenyl or alkynyl, each optionally being substituted, and _R3 and _R4 are independently lower alkyl, or _R3 and _R4 may, taken together, form an optionally substituted heterocyclic ring, can be prepared according to Scheme 1. Ketone 1 and bromide 2 can be purchased or prepared according to methods known to one skilled in the art. The reaction between 1 and 2 gives ketal 3. Treatment of ketal 3 with amine 4 gives lipids of formula A. Lipids of formula A can be converted to the corresponding ammonium salt using an organic salt of formula 5, where X is an anion, a counterion selected from halogen, hydroxide, phosphate, sulphate or the like.

- 46 046901

Scheme 2

Alternatively, the starting material, ketone 1, can be prepared according to Scheme 2. Grignard reagent 6 and cyanide 7 can be purchased or prepared according to methods known to one skilled in the art. The reaction between 6 and 7 gives ketone 1. The conversion of ketone 1 to the corresponding lipids of formula A is as described in Scheme 1.

Synthesis of MS3.

The preparation of DLin-M-C3-DMA (ie (67,97,287,317)-heptatriaconta-6,9,28,31-tetraen-19-yl-4(dimethylamino)butanoate) was as follows. A solution of (67,97,287,317)-heptatriakonta-6,9,28,31-tetraen19-ol (0.53 g), 4-N,N-dimethylaminobutyric acid hydrochloride (0.51 g), 4-N,Ndimethylaminopyridine (0.61 d) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (0.53 g) in dichloromethane (5 ml) were stirred at room temperature overnight. The solution was washed with dilute hydrochloric acid followed by dilute aqueous sodium bicarbonate. The organic fractions were dried over anhydrous magnesium sulfate, filtered and the solvent was removed using a rotary vacuum evaporator. The residue was passed through a silica gel column (20 g) using a 1-5% methanol/dichloromethane elution gradient. The fractions containing the purified product were combined and the solvent was removed to give a colorless oil (0.54 g).

Synthesis of ALNY -100.

The synthesis of ketal 519 [ALNY-100] was carried out using the following scheme 3:

Synthesis 515.

To a stirred suspension of LiAlH ₄ (3.74 g, 0.09852 mol) in 200 ml anhydrous THF in two-neck RBF (1 L), a solution of 514 (10 g, 0.04926 mol) in 70 ml THF was slowly added at 0°C in nitrogen atmosphere. After addition was complete, the reaction mixture was warmed to room temperature and then heated until condensation occurred for 4 hours. The reaction progress was monitored by TLC. Once the reaction was complete (determined by TLC), the mixture was cooled to 0°C and quenched by careful addition of saturated Na ₂ SO ₄ solution. The reaction mixture was stirred for 4 hours at room temperature and filtered. The residue was washed well with THF. The filtrate and the precipitate obtained by washing were mixed and diluted with 400 ml of dioxane and 26 ml of conc. HCl, and stirred for 20 min at room temperature. Volatiles were distilled off in vacuo to give hydrochloride salt 515 as a white solid. Yield: 7.12 g ^1H -NMR (DMSO, 400 MHz): δ = 9.34 (broad, 2H), 5.68 (s, 2H), 3.74 (m, 1H), 2.66 -2.60 (m, 2H), 2.50-2.45 (m, 5H).

Synthesis 516.

NEt ₃ (37.2 mL, 0.2669 mol) was added to a stirred solution of compound 515 in 100 mL dry DCM in 250 mL double neck RBF and cooled to 0°C under nitrogen. After slowly adding N(benzyloxy-carbonyloxy)-succinimide (20 g, 0.08007 mol) to 50 ml of dry DCM, the reaction mixture was allowed to warm to room temperature. After completion of the reaction (2-3 hours, determined by TLC), the mixture was washed successively with a 1N solution. HCl (1x100 ml) and saturated NaHCO ₃ solution (1x50 ml). The organic layer was then dried over anhydrous. The Na ₂ SO ₄ and solvent were evaporated to give crude material, which was purified by silica gel column chromatography to give 516 as a sticky mass. Yield: 11 g (89%). ¹ H-NMR (CDCl ₃ , 400 MHz): δ =

- 47 046901

7.36-7.27 (m, 5H), 5.69 (s, 2H), 5.12 (s, 2H), 4.96 (br., 1H) 2.74 (s, 3H), 2 .60 (m, 2H), 2.30-2.25 (m, 2H). LCMS [M+H] -232.3 (96.94%).

Synthesis of 517A and 517B.

Cyclopentene 516 (5 g, 0.02164 mol) was dissolved in a solution of 220 ml of acetone and water (10:1) in one-neck 500 ml of RBF and H-methyl-morpholine-N-oxide (7.6 g, 0.0 06492 mol), followed by 4.2 ml of a 7.6% solution of OsO ₄ (0.275 g, 0.00108 mol) in tert-butanol at room temperature. After completion of the reaction (~3 hours), the mixture was quenched by adding solid Na ₂ SO ₃ and the resulting mixture was stirred for 1.5 hours at room temperature. The reaction mixture was diluted with DCM (300 ml) and washed with water (2x100 ml), followed by saturated NaHCO ₃ solution (1x50 ml), water (1x30 ml) and finally brine (1x50 ml). The organic phase was dried over anhydrous. Na ₂ SO ₄ and the solvent were removed in vacuo. As a result of purification of the crude material using column chromatography with silica gel, a mixture of diastereoisomers was obtained, which were separated using Rev. HPLC. Yield: - 6 g of crude product. 517A - peak-1 (white solid), 5.13 g (96%). 1H-NMR (DMSO, 400 MHz): δ = 7.39-7.31 (m, 5H), 5.04 (s, 2H), 4.78-4.73 (m, 1H), 4.48 -4.47 (d, 2H), 3.94-3.93 (m, 2H), 2.71 (s, 3H), 1.72-1.67 (m, 4H). LC-MS - [M+H]-266.3, [M+NH4+]-283.5 present, HPLC-97.86%. Stereochemistry was confirmed using X-ray diffraction.

Synthesis 518.

Using a procedure similar to that described for the synthesis of compound 505, compound 518 (1.2 g, 41%) was obtained as a colorless oil. 1H-NMR (CDCl ₃ , 400 MHz): δ = 7.35-7.33 (m, 4H), 7.30-7.27 (m, 1H), 5.37-5.27 (m, 8H ), 5.12 (s, 2H), 4.75 (m, 1H), 4.58-4.57 (m, 2H), 2.78-2.74 (m, 7H), 2.06- 2.00 (m, 8H), 1.96-1.91 (m, 2H), 1.62 (m, 4H), 1.48 (m, 2H), 1.37-1.25 (brm, 36H), 0.87 (m, 6H). HPLC-98.65%.

General procedure for the synthesis of compound 519.

A solution of compound 518 (1 eq.) in hexane (15 mL) was added dropwise to an ice-cold solution of LAH in THF (1 M, 2 eq.). After addition was complete, the mixture was heated at 40°C for 0.5 h, then cooled again in an ice bath. The mixture was carefully hydrolyzed with saturated aqueous Na ₂ SO ₄ , then filtered through celite and transferred to oil. Column chromatography provided pure 519 (1.3 g, 68%), which was obtained as a colorless oil. ¹³ C-NMR δ = 130.2, 130.1 (x2), 127.9 (x3), 112.3.79,3.64,4.44,7.38,3.35,4.31, 5, 29.9 (x2), 29.7, 29.6 (x2), 29.5 (x3), 29.3 (x2), 27.2 (x3), 25.6, 24.5, 23 ,3, 226, 14.1; electrospray MS (+ve): Molecular weight for C ₄₄ H ₈₀ NO ₂ (M+H)+ calc. 654.6, detected 654.6.

Formulations prepared either by the standard process or by the non-extrusion process can be characterized in the same way. For example, formulations are typically characterized by visual inspection. These should be whitish transparent solutions in which there are no aggregates or sediment. Particle size and particle size distribution of lipid nanoparticles can be measured using light scattering using, for example, Malvern Zetasizer Nano ZS (Malvern, USA). The particle size should be approximately 20-300 nm, for example 40-100 nm. The particle size distribution should be univertex. The total concentration of dsRNA in the formulation as well as the captured fraction is determined using a dye exclusion assay. A sample of formulated dsRNA can be incubated with an RNA-binding dye, such as Ribogreen (Molecular Probes), in the presence or absence of a disrupting surfactant, such as 0.5% TritonX100. The total dsRNA in the formulation can be determined by the signal from the sample containing the surfactant relative to the calibration curve. The captured fraction is determined by subtracting the free dsRNA content (as measured by the signal in the absence of surfactant) from the total dsRNA content. The percentage of dsRNA captured is typically >85%. For the LNP formulation, the particle size is at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least at least 100 nm, at least 110 nm and at least 120 nm. A suitable range is generally from at least about 50 nm to at least 110 nm, from at least about 60 nm to at least 100 nm, or from at least about 80 nm to at least 90 nm. nm.

Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gelatin capsules, powder packets, tablets or mini-tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersants or binders may be necessary. In some embodiments, oral formulations are those in which the dsRNAs described herein are administered in combination with one or more penetration agents, surfactants, and chelators. Suitable surfactants include fatty acids and/or their esters or salts, bile acids and/or their salts. Suitable bile acids/bile salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycolic acid, glycode

- 48 046901 oxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydrofusidate and sodium glycodihydrofusidate. Suitable fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1dodecyl azacycloheptan-2-one, acylcarnitine, acylcholine or monoglyceride, diglyceride or a pharmaceutically acceptable salt thereof (eg sodium). In some embodiments, combinations of penetration promoting substances are used, for example, fatty acids/fatty acid salts in combination with bile acids/bile salts. One exemplary combination is the sodium salt of lauric acid, capric acid and UDCA. Additional penetration aids include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. The dsRNAs described in the present invention can be delivered orally, in the form of granules, including spray-dried particles, or complexed to form micro- or nanoparticles. Complexing agents for dsRNA include polyamino acids; polyimines; polyacrylates; polyalkyl acrylates, polyoxethanes, polyalkyl cyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethylene glycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derived polyimines, pollulans, celluloses and starches. Suitable complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene (PTDAE), polyaminostyrene (e.g. p-amino), poly(methyl cyanoacrylate), poly(ethyl cyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcyanoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAEalbumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(O.c-lactic acid), DL-copolymer lactic and glycolic acid (PLGA), alginate and polyethylene glycol (PEG). Oral formulations for dsRNA and their preparation are described in detail in US Patent No. 6887906, US Publication No. 20030027780 and US Patent No. 6747014, each of which is incorporated herein by reference.

Compositions and formulations for parenteral, intraparenchymal (brain), intrathecal, intraventricular, or intrahepatic administration may include sterile aqueous solutions, which may also contain buffers, diluents, and other appropriate additives such as, but not limited to, penetration agents, compounds- carriers and other pharmaceutically acceptable carriers or excipients.

Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. Such compositions can be prepared from a number of components, which includes, but is not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semi-solids. In particular, compositions that specifically target the liver for the treatment of liver diseases such as hepatocarcinoma are preferred.

The pharmaceutical compositions of the present invention, which for convenience may be in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of contacting the active ingredients with pharmaceutical carrier(s) or excipient(s). Typically, formulations are prepared by uniformly and thoroughly bringing the active ingredients into contact with liquid carriers or finely divided solid carriers, or both, and then, if necessary, shaping the product.

The compositions of the present invention can be formulated in any of many possible dosage forms, such as, but not limited to, tablets, capsules, gelatin capsules, liquid syrups, plastic gels, suppositories and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may additionally contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

C. Additional compounds.

i. Emulsions.

The compositions of the present invention can be prepared and formulated as emulsions. Emulsions are generally heterogeneous systems of one liquid dispersed in another, in the form of droplets, the diameter of which is usually greater than 0.1 microns (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG. , and Ansel H.C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York. , N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245;

- 49 046901

Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often two-phase systems containing two immiscible liquid phases, thoroughly mixed and dispersed within each other. Typically, emulsions can be either water-in-oil (w/o) or oil-in-water (o/w) emulsions. In cases where the aqueous phase is finely atomized in the total volume of the oil phase and dispersed in the form of tiny droplets therein, then the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, in cases where the oil phase is finely atomized in the bulk of the aqueous phase and dispersed as minute droplets therein, then the resulting composition is referred to as an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases and the active drug, which may be present as a solution in either an aqueous phase, an oil phase, or as such as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, colorants and antioxidants may be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions that consist of more than two phases, such as in the case of oil-in-water-in-oil (o/w/o) and water-in-oil emulsions. input (w/o/w). Such complex formulations often provide certain benefits that simple two-component emulsions do not provide. Multiple emulsions in which the individual oil droplets of the o/w emulsion include small water droplets making up the w/o/w emulsion. Likewise, a system of oil droplets contained within water droplets stabilized in an oil dispersant phase provides an o/w/o emulsion.

Emulsions are characterized by low thermodynamic stability, or they do not have it. Often the dispersed or dispersed phase of the emulsion is well dispersed in the dispersed or dispersed phase and is maintained in that form by emulsifiers or the viscosity of the formulation. Any emulsion phase may be semi-solid or solid, as is the case with emulsion-like ointment bases and creams. Other methods for stabilizing emulsions involve the use of emulsifiers, which can be included in any phase of the emulsion. Emulsifiers can generally be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and fine solids (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG. , and Ansel H.C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York. , N.Y., volume 1, p. 199).

Synthetic surfactants, also known as surfactants, have found widespread use in emulsion formulations and have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC ., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are usually amphiphilic and contain a hydrophilic and a hydrophobic part. The ratio of hydrophilic to hydrophobic nature of a surfactant is called the hydrolipid balance (HLB) and is a valuable tool in categorizing and selecting surfactants in formulations. Surfactants can be classified into various classes based on the nature of the hydrophilic group: nonionic, anionic, cationic, and amphoteric (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC ., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1 , p. 285).

Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and gum arabic. Absorbent bases such as anhydrous lanolin and hydrophilic petrolatum have hydrophilic properties so that they can absorb water to form w/o emulsions while still maintaining their semi-solid consistency. Finely divided solids have also been used as suitable emulsifiers, especially in combination with surfactants and in viscous preparations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminosilicate, pigments and non-polar solids such as carbon or glyceryl tristearate.

A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc. ., New York, N.Y., volume 1, p. 335; in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988.

- 50 046901

Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

Hydrophilic colloids or hydrocolloids include naturally occurring resins and synthetic polymers such as polysaccharides (for example, gum arabic, agar, alginic acid, carrageenan, guar gum, gum caraya and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose) and synthetic polymers ( e.g. carbomers, cellulose ethers and carboxyvinyl polymers). They disperse or swell in water to form colloidal solutions, which stabilize emulsions by forming strong interfacial films around droplets of the dispersed phase and by increasing the viscosity of the dispersed phase.

Since emulsions often contain a number of ingredients, such as carbohydrates, proteins, sterols and phosphatides, which can readily support microbial growth, such formulations often include preservatives. Commonly used preservatives included in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, rhydroxybenzoic acid esters, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent breakdown of the formulation. The antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium matabisulfite, and antioxidant synergists such as citric acid, tartaric acid and lecithin.

The use of emulsion formulations through the dermatological, oral and parenteral routes and methods for their preparation have been reviewed in the literature (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199 ). Emulsion formulations for oral delivery are very widely used due to ease of formulation as well as effectiveness in absorption and bioavailability (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel Hc. ., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral oil laxatives, fat-soluble vitamins, and high-fat nutritional preparations are among the materials commonly administered orally as o/w emulsions.

ii. Microemulsions.

In one embodiment of the present invention, the mRNA and nucleic acid compositions are formulated as microemulsions. A microemulsion can be defined as a system of water, oil and amphiphilic substance that is a separate optically isotropic and thermodynamically stable liquid solution (see, for example, Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG., and Ansel HC ., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically, microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding enough of a fourth component, typically a medium chain alcohol, to form a clear system. Thus, microemulsions have also been described as thermodynamically stable, isotropically pure dispersions of two immiscible liquids that are stabilized by interfacial films of surfactant molecules (Leung and Shah, in Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are typically prepared by combining three to five components, which include oil, water, surfactant, secondary surfactant, and electrolyte. Whether a microemulsion is a water-in-oil (w/o) or an oil-in-water (o/w) emulsion depends on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the molecules. surfactant (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

The phenomenological phase diagram approach has been extensively studied and has provided extensive data on how to formulate microemulsions by those skilled in the art (see, e.g., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, Allen, LV., Popovich NG. , and Ansel H.C., 2004, Lippincott Williams & Wilkins (8th ed.), New York, NY; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York. , N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. Compared to traditional emulsions, microemulsions offer the advantage of stabilizing water-insoluble drugs within thermodynamically stable droplets that form spontaneously.

Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl esters, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750) alone or in combination with secondary surfactants substances. The secondary surfactant, typically a short chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase interfacial fluidity by penetrating the surfactant film and thus creating a disordered film due to empty space formed among the surfactant molecules. However, microemulsions can be prepared without the use of secondary surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may generally be water, an aqueous drug solution, glycerol, PEG300, PEG400, polyglycerols, propylene glycols and ethylene glycol derivatives. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8- _C12 ) mono-, di- and triglycerides, polyoxyethylated fatty acid esters of glyceryl, fatty alcohols, polyglycolyzed glycerides, saturated polyglycolyzed C ₈ -C ₁₀ glycerides, vegetable oils and silicone oil.

Microemulsions are of particular interest in terms of drug solubility and increased drug absorption. Lipid microemulsions (both o/w and w/o) have been proposed to increase the oral bioavailability of drugs, including peptides (see, for example, US Pat. No. 6191105; 7063860; 7070802; 7157099; Constantinides et al., Pharmaceutical Research , 1994, 11, 1385-1390; Meth. Exp. Pharmacol., 1993, 13, 205). Microemulsions provide benefits such as improved drug solubility, protection of the drug from enzymatic hydrolysis, possible increase in drug absorption due to surfactant-induced changes in membrane fluidity and permeability, ease of preparation, ease of oral administration compared to solid dosage form, improved clinical effectiveness and reduced toxicity (see, for example, US patent No. 6191105; 7063860; 7070802; 7157099; Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions can form spontaneously when their components are combined at ambient temperature. This may be particularly advantageous when thermolabile drugs, peptides or mRNA are formulated. Microemulsions have also been effective in the transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The compositions and microemulsion formulations of the present invention are expected to promote increased systemic absorption of mRNA and nucleic acids from the gastrointestinal tract, as well as improve local cellular uptake of mRNA and nucleic acids.

The microemulsions of the present invention may also contain additional components and additives, such as sorbitan monostearate (Grill 3), Labrasol and penetration aids, to improve the properties of the formulation and to enhance the absorption of the mRNA and nucleic acids of the present invention. The penetration aids used in the microemulsions of the present invention can be classified as belonging to one of five general categories: surfactants, fatty acids, bile salts, chelating agents and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes was discussed above.

iii. Microparticles.

The RNAi agent of the present invention may be included in a particle, for example a microparticle. Microparticles can be produced by spray drying, but can also be produced by other methods, including lyophilization, evaporation, fluidized bed drying, vacuum drying, or a combination of these techniques.

iv. Penetration agents

In one embodiment, the present invention uses a variety of penetration promoting agents to influence the efficient delivery of nucleic acids, particularly mRNA, into the skin of animals. Most drugs are present in solution in both ionized and non-ionized forms. However, as a rule, only fat-soluble or lipophilic drugs readily pass through cell membranes. It has been found that even non-lipophilic drugs can pass through cell membranes if the membrane through which it must pass is treated with a substance that promotes penetration. In addition to allowing non-lipophilic drugs to diffuse across cell membranes, permeation promoters also increase permeability to lipophilic drugs.

Penetration agents can be classified as belonging to one

- 52 046901 from five main categories, i.e. surfactants, fatty acids, bile salts, chelating agents and non-chelating nonsurfactants (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above classes of penetration agents is described in more detail below.

Surfactants (or surfactants) are chemical entities that, when dissolved in an aqueous solution, reduce the surface tension of a solution or the interfacial tension between an aqueous solution and another liquid, resulting in increased mucosal absorption of mRNA. In addition to bile salts and fatty acids, these permeation aids include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92) and perfluorinated emulsions such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

A variety of fatty acids and their derivatives that act as penetration promoters include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate , tricaprate, monoolein (1-monooleoyl-racglycerol), dilaurin, caprylic acid, arachidonic acid, 1-monocaprate glycerol, 1-dodecyl acycloheptan-2-one, acylcarnitines, acylcholines, their C _1-20 alkyl esters (e.g. methyl, isopropyl and tert-butyl) and their mono- and diglycerides (i.e. oleate, laurate, caprate, miistate, palmitate, stearate, linoleate, etc.) (see, for example, Touitou, E., et al. Enhancement in Drug Delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Hariri et al., J. Pharm. Pharmacol, 1992, 44, 651-654).

The physiological role of bile includes assisting in the distribution and absorption of lipids and fat-soluble vitamins (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts and their synthetic derivatives act as permeation promoters. Thus, the expression bile salts includes any naturally occurring components of bile, as well as any of their synthetic derivatives. Suitable bile salts include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycolic acid (sodium glycolate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydrofusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (see, for example, Malmsten, M. Surfactants and polymers in drug delivery, Informa Health Care, New York, NY, 2002; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems , 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

Chelating agents used in connection with the present invention can be defined as compounds that remove metal ions from solution by forming complexes with them, resulting in increased mucosal absorption of mRNA. With respect to their use as penetration promoters in the present invention, chelating agents have the added benefit of also serving as DNase inhibitors, since most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Suitable chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate, and homovalinate), N-acyl derivatives of collagen, laureth-9, and N-aminoacyl derivatives of beta-diketones (enamines) (see eg Katdare, A. et al., Excipient development for pharmaceutical, biotechnology, and drug delivery, CRC Press, Danvers, MA, 2006; Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; , Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

As used herein, non-chelating non-surfactant permeation promoting compounds can be defined as compounds that exhibit little activity as chelating agents or surfactants, but which nevertheless enhance the absorption of mRNA through the digestive tract mucosa (see , For example,

- 53 046901

Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration agents includes, for example, unsaturated cycloureas, 1-alkyl 1-alkenyl azacycloalkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92) and non-steroidal anti-inflammatory drugs such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

Agents that enhance the uptake of mRNA at the cellular level can also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids such as lipofectin (Junichi et al., US Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules such as polylysine (Lollo et al., PCT application WO 97/30731) are also known to enhance cellular uptake of dsRNA. Examples of commercially available transfection reagents include, but are not limited to, Lipofectamine™ (Invitrogen; Carlsbad, CA), Lipofectamine 2000™ (Invitrogen; Carlsbad, CA), 293fectin™ (Invitrogen; Carlsbad, CA), Cellfectin™ (Invitrogen; Carlsbad, CA), California), DMRIE-C™ (Invitrogen; Carlsbad, CA), FreeStyle™ MAX (Invitrogen; Carlsbad, CA), Lipofectamine™ 2000 CD (Invitrogen; Carlsbad, CA), Lipofectamine™ (Invitrogen; Carlsbad, CA), RNAiMAX ( Invitrogen; Carlsbad, CA), Oligofectamine™ (Invitrogen; Carlsbad, CA), Optifect™ (Invitrogen; Carlsbad, CA), X-tremeGENE Q2 transfection reagent (Roche; Grenzacherstrasse, Switzerland), DOTAP liposome transfection reagent (Grenzacherstrasse, Switzerland), DOSPER liposome transfection reagent (Grensacherstrasse, Switzerland) or Fugene (Grensacherstrasse, Switzerland), Transfectam® reagent (Promega; Madison, WI), TransFast™ transfection reagent (Promega; Madison, WI), Tfx™-20 reagent (Promega; Madison, WI), Tfx™-50 reagent (Promega; Madison, WI), DreamFect™ (OZ Biosciences; Marseille, France), EcoTransfect (OZ Biosciences; Marseille, France), TransPass ^a D1 transfection reagent (New England Biolabs; Ipswich, MA, USA), LyoVec™/LipoGen™ (Invitrogen; San Diego, CA, USA), PerFectin transfection reagent (Genlantis; San Diego, CA, USA), NeuroPORTER transfection reagent (Genlantis; San Diego , California, USA), GenePORTER transfection reagent (Genlantis; San Diego, California, USA), GenePORTER 2 transfection reagent (Genlantis; San Diego, California, USA), Cytofectin transfection reagent (Genlantis; San Diego, USA), California, USA), BaculoPORTER Transfection Reagent (Genlantis; San Diego, CA, USA), TroganPORTER™ Transfection Reagent (Genlantis; San Diego, CA, USA), RiboFect (Bioline; Taunton, MA, USA), PlasFect (Bioline ; Taunton, MA, USA), UniFECTOR (B-Bridge International; Mountain View, CA, USA), SureFECTOR (B-Bridge International; Mountain View, California, USA) or HiFect™ (B-Bridge International, Mountain View, California, USA)

Other agents can be used to enhance penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrroles such as 2-pyrrole, azones, and terpenes such as limonene and menthone.

v. Carriers.

Certain compositions of the present invention also contain carrier compounds. As used herein, the expressions carrier compound or carrier may mean a nucleic acid or analogue thereof that is inert (i.e., has no biological activity per se) but is recognized as a nucleic acid in vivo by processes that reduce the bioavailability of the nucleic acid with biological activity, for example, by destroying biologically active nucleic acid or by promoting its removal from the bloodstream. Co-administration of a nucleic acid and a carrier compound, usually with an excess of the latter, can result in a significant reduction in the amount of nucleic acid processed by the liver, kidney or other extravascular sites, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, processing of partially phosphorothioate dsRNA in liver tissue may be reduced when coadministered with polyinosinic acid, dextran sulfate, polycytidic acid, or 4-acetamido4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev ., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

vi. Fillers.

In contrast to a carrier compound, a pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected based on the intended route of administration so as to provide the required volume, consistency, etc., when combined with the nucleic acid and other components of the pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binders (eg, pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (for example, lactose and other sugars, microcrystalline cellulose, pectin, gelatin,

- 54 046901 calcium sulfate, ethylcellulose, polyacrylates or secondary calcium phosphate, etc.); lubricants (eg, magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (eg starch, sodium starch glycolate, etc.) and wetting agents (eg sodium lauryl sulfate, etc.).

Pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral, which do not react adversely with nucleic acids, can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

Formulations for topical application of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil bases. Solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for administration other than parenteral that do not adversely interact with nucleic acids may be used.

Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like.

vii.Other components.

The compositions of the present invention may additionally contain other auxiliary components conventionally found in pharmaceutical compositions at levels of use established in the art. Thus, for example, the compositions may contain additional compatible pharmaceutically active materials, such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials suitable for the physical formulation of the compositions according to the present invention in various dosage forms, such as colorants, flavoring agents, preservatives, antioxidants, opacifiers, thickeners and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The compositions can be sterile and, if necessary, they can be mixed with auxiliary agents, for example, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts to influence osmotic pressure, buffers, coloring agents, flavoring agents and/or fragrances and the like, which do not interact adversely with the nucleic acid(s) of the composition.

Aqueous suspensions may contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

In some embodiments, the pharmaceutical compositions described herein include (a) one or more mRNA compounds, and (b) one or more agents that act by a mechanism other than RNAi and that are useful in treating a disorder blood clotting. Examples of such agents include, but are not limited to, an anti-inflammatory agent, an anti-steatosis agent, an antiviral agent, and/or an anti-fibrosis agent. In addition, other substances commonly used to protect the liver, such as silymarin, can also be used in combination with the mRNAs described herein. Other agents useful for the treatment of liver disease include telbivudine, entecavir and protease inhibitors such as telaprevir and others disclosed, for example, in US Patent Application Publications Nos. 2005/0148548, 2004/0167116 and 2003/0144217, Tung et al ., and US Patent Application Publication No. 2004/0127488, Hale et al.

The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD50 (lethal dose in 50% of the population) and ED50 (therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio LD50/ED50. Preference is given to compounds that have a high therapeutic index.

Data obtained from cell culture assays and animal studies can be used to formulate dosage ranges for use in humans. In the present invention, the dose of the compositions described herein is generally within a circulating concentration range that includes the ED50 with little or no toxicity. The dose may vary within this range depending on the dosage form used and the route of administration used. For any compound used in the methods described in the present invention, therapeutically

- 55 046901 the effective dose can initially be determined based on the results of cell culture analyses. The dose can be formulated in animal models to achieve a range of concentrations of the circulating plasma compound or, if necessary, the polypeptide product of the target sequence (eg, achieving a reduced concentration of the polypeptide), which includes the IC50 (i.e., the concentration of the test compound that achieves half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine the appropriate dose in humans. Plasma levels can be measured, for example, using high performance liquid chromatography.

In addition to their administration discussed above, the mRNAs described in the present invention can be administered in combination with other known agents effective in treating pathological processes mediated by PCSK9 expression. In any case, the supervising physician may adjust the amount and timing of mRNA administration based on the results observed using standard performance measures known in the art or described herein.

IV. Methods for inhibiting PCSK9 expression.

The present invention provides methods for inhibiting the expression of proprotein convertase subtilisin/kexin 9 (PCSK9) in a cell. The methods include contacting a cell with an RNAi agent, such as a double-stranded RNAi agent, in an amount effective to inhibit expression of PCSK9 in the cell, thereby inhibiting expression of PCSK9 in the cell.

Contacting a cell with a double-stranded RNAi agent can be done in vitro or in vivo. In vivo, contacting a cell with an RNAi agent involves bringing a cell or group of cells of a subject, such as a human subject, into contact with the RNAi agent. Combinations of in vitro and in vivo contact methods are also possible. Bringing into contact can be direct or indirect, as discussed above. Moreover, cell contact can be accomplished by a targeting ligand, including any ligand described herein or known in the art. In preferred embodiments, the targeting ligand is a carbohydrate moiety, such as a GalNAc3 ligand, or any other ligand that directs the RNAi agent to a site of interest, such as the liver of a subject.

The expression inhibition as used herein is used interchangeably with contraction, silencing, down-regulation and other similar expressions and includes any level of inhibition.

The phrase inhibiting PCSK9 expression is intended to mean inhibiting the expression of any PCSK9 gene (such as, for example, a mouse PCSK9 gene, a rat PCSK9 gene, a monkey PCSK9 gene, or a human PCSK9 gene), as well as variants or mutants of the PCSK9 gene. Thus, the PCSK9 gene may be a wild-type PCSK9 gene, a mutant PCSK9 gene, or a transgenic PCSK9 gene in the context of cells, a group of cells, or an organism that has been genetically manipulated.

Inhibition of PCSK9 gene expression includes any level of inhibition of the PCSK9 gene, such as at least partial suppression of PCSK9 gene expression. PCSK9 gene expression can be assessed based on the level or change in the level of any variable associated with PCSK9 gene expression, such as PCSK9 mRNA levels, PCSK9 protein levels, or lipid levels. This level can be assessed in a single cell or in a group of cells, including, for example, a sample obtained from a subject.

Inhibition can be assessed by a decrease in the absolute or relative level of one or more variables that are associated with PCSK9 expression compared to control levels. The control level can be any type of control level that is used in the art, such as a baseline level before drug administration or a level determined in a similar subject, cell, or sample that is untreated or treated with a control (such as, for example, a buffer-only control or control with inactive agent).

In some embodiments of the methods of the present invention, PCSK9 gene expression is inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25 %, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

Evidence of inhibition of PCSK9 gene expression may be a decrease in the amount of mRNA expressed by the first cell or group of cells (such cells may be present

- 56 046901 for example, in a sample obtained from a subject) in which the PCSK9 gene is transcribed and which has been treated (for example, by contacting the cell or cells with an RNAi agent according to the present invention or by administering an RNAi agent according to the present invention to the subject , in whose body the cells are or were present), such that PCSK9 gene expression is inhibited relative to a second cell or second group of cells substantially identical to the first cell or group of cells, but which or which were not treated (control cell(s) )). In preferred embodiments, inhibition is assessed by expressing the mRNA level in treated cells as a percentage of the mRNA level in control cells using the following formula:

|(mRNA in control cells) - (mRNA in treated cells) , ] qqo (mRNA in control cells)

Alternatively, inhibition of PCSK9 gene expression can be assessed by a decrease in an index that is operatively related to PCSK9 gene expression, eg, PCSK9 protein expression, eg, lipid levels, cholesterol levels, eg, LDLc levels. PCSK9 gene silencing can be detected in any cell expressing PCSK9 either constitutively or by genetic engineering and using any assay known in the art. The liver is the major site of PCSK9 expression. Other important sites of expression include the pancreas, kidney, and intestine.

Evidence of inhibition of PCSK9 protein expression may be a decrease in the level of PCSK9 protein that is expressed by a cell or group of cells (eg, the level of protein expressed in a sample obtained from a subject). As explained above with respect to the assessment of mRNA suppression, the inhibition of protein expression levels in a treated cell or group of treated cells can similarly be expressed as a percentage of the protein level in a control cell or group of control cells.

A control cell or group of control cells that can be used to evaluate inhibition of PCSK9 gene expression includes a cell or group of cells that has not yet been in contact with the RNAi agent of the present invention. For example, a control cell or group of control cells may be obtained from a single subject (eg, a human subject or an animal subject) before treating the subject with an RNAi agent.

The level of PCSK9 mRNA that is expressed by a cell or group of cells can be determined using any method known in the art for assessing mRNA expression. In one embodiment, the level of PCSK9 expression in a sample is determined by detecting a transcribed polynucleotide or portion thereof, such as the PCSK9 gene mRNA. RNA can be extracted from cells using RNA extraction techniques including, for example, acidic phenol/guanidine isothiocyanate extraction (RNAzol B; Biogenesis), RNeasy RNA kits (Qiagen) or PAXgene (PreAnalytix, Switzerland). Typical assay formats that use ribonucleic acid hybridization include nuclear run-on assays, RT-PCR, RNase protection assays (Melton et al., Nuc. Acids Res. 12:7035), Northern blotting, in situ hybridization, and microarray analyses.

In one embodiment, the expression level of PCSK9 is determined using a nucleic acid probe. The expression probe as used herein means any molecule that is capable of selectively binding to a specific PCSK9. The probes can be synthesized by one skilled in the art or obtained from appropriate biological preparations. Probes containing the label may be specially designed. Examples of molecules that can be used as probes include, but are not limited to, RNA, DNA, proteins, antibodies, and organic molecules.

The isolated mRNAs can be used in hybridization or amplification based assays, which include, but are not limited to, Southern or Northern blot assays, polymerase chain reaction (PCR) assays, and probe arrays. One method for determining mRNA levels involves contacting isolated mRNA with a nucleic acid molecule (probe) that can hybridize with PCSK9 mRNA. In one embodiment, the mRNA is immobilized on a solid surface and brought into contact with a probe, for example, by passing the isolated mRNA through an agarose gel and transferring the mRNA from the gel to a membrane such as nitrocellulose. In an alternative embodiment, the probe(s) are immobilized on a solid surface and the mRNA is brought into contact with the probe(s), for example, on an Affymetrix gene microarray. One skilled in the art can readily adapt known mRNA detection methods for use in determining PCSK9 mRNA levels.

An alternative method for determining the level of PCSK9 expression in a sample includes a method of amplifying nucleic acid and/or reverse transcription (to produce cDNA) of, for example, mRNA in a sample, for example, using RT-PCR (an experimental embodiment is set forth in Mullis, 1987, US Pat. No. 4,683,202 ), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self-sustaining sequence replication (Guatelli et al. (1990) Proc. Natl.

- 57 046901

Acad. Sci. USA 87:1874-1878), transcription-mediated amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-beta replicase (Lizardi et al. (1988) Bio /Technology 6:1197), rolling circle replication (Lizardi et al., US Patent No. 5854033), or any other method of nucleic acid amplification followed by detection of the amplified molecules using techniques well known to one skilled in the art. Such detection schemes are particularly suitable for detecting nucleic acid molecules if such molecules are present in very small quantities. In specific aspects of the present invention, PCSK9 expression levels are determined using fluorogenic RT-PCR (ie, the TaqMan™ System).

PCSK9 mRNA expression levels can be monitored using a membrane blot (such as that used in hybridization assays such as Northern, Southern, Dot, etc.) or microwells, test tubes, gels, beads or fibers (or any solid support containing bound nucleic acid). See US Pat. Nos. 5,770,722, 5,874,219, 5,744,305, 5,677,195, and 5,445,934, which are incorporated herein by reference. Determining the level of PCSK9 expression may also involve the use of nucleic acid probes in solution.

In preferred embodiments, the level of mRNA expression is assessed using branched DNA (bDNA) or real-time PCR (qPCR) assays. The use of such methods is described and illustrated in the Examples section presented herein.

The level of PCSK9 protein expression can be determined using any method known in the art for measuring protein levels. Such methods include, for example, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, liquid or gel precipitation reactions, absorption spectroscopy, colorimetric assays, spectrophotometric assays, flow cytometry, immunodiffusion (single or double), immunoelectrophoresis, Western blotting, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA), immunofluorescence assays, electrochemiluminescent assays, etc.

The expression sample, as used herein, means the selection of similar fluids, cells or tissues isolated from the body of a subject, as well as fluids, cells or tissues present in the body of a subject. Examples of biological fluids include blood, serum and serous fluids, plasma, lymph, urine, cerebrospinal fluid, saliva, intraocular fluids, and the like. Tissue samples may include samples from tissues, organs, or local sites. For example, samples can be obtained from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples can be obtained from the liver (eg, the entire liver, or certain segments of the liver, or certain types of cells in the liver, such as, for example, hepatocytes). In preferred embodiments, the sample obtained from the subject means blood or plasma obtained from the subject. In further embodiments, the sample obtained from the subject means liver tissue obtained from the subject.

In some embodiments of the methods of the present invention, the RNAi agent is administered to a subject such that the RNAi agent is delivered to a specific site in the subject's body. Inhibition of PCSK9 expression can be assessed by measuring the level or change in the level of PCSK9 mRNA or PCSK9 protein in a sample obtained from fluid or tissue from a specific location in the subject's body. In preferred embodiments, the site is the liver. A site may also be a subsection or subgroup of cells from any of the above locations. The site may also include cells that express a particular type of receptor.

V. Methods for treating or preventing PCSK9-associated disease.

The present invention also provides methods for treating or preventing diseases and conditions that can be affected by down-regulating the expression of the PCSK9 gene. For example, the compositions described herein can be used to treat lipidemia, such as hyperlipidemia, and other forms of lipid disorders, such as hypercholesterolemia, hypertriglyceridemia, and pathological conditions associated with these disorders, such as heart disease and diseases associated with the disorder. blood circulation Other diseases and conditions that can be affected by down-regulating PCSK9 gene expression include lysosomal storage diseases, including, but not limited to, Niemann-Pick disease, Tay-Sachs disease, lysosomal acid lipase deficiency, and Gaucher disease. The methods include administering to a subject a therapeutically effective amount or a prophylactically effective amount of an RNAi agent of the present invention. In some embodiments, the method includes administering an effective amount of PCSK9 siRNA to a patient with a heterozygous LDLR genotype.

The effect of reducing PCSK9 gene expression preferably results in a reduction in LDLc (low density lipoprotein cholesterol) levels in the blood and, more specifically, in the serum of the mammal. In some embodiments, LDLc levels are reduced by at least 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90% or more compared to pre-treatment levels.

- 58 046901

As used herein, subject includes a human or non-human animal, preferably a vertebrate and more preferably a mammal. The subject may include a transgenic organism. Most preferably, the subject is a human, such as a human suffering from or predisposed to developing a PCSK9-associated disease.

In some embodiments of the methods of the present invention, PCSK9 expression is reduced over an extended period of time, such as at least one week, two weeks, three weeks, or four weeks, or longer. For example, in some cases, the expression of the PCSK9 gene is suppressed by at least about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50% by administration of an mRNA agent described herein. In some embodiments, the PCSK9 gene is suppressed by at least about 60%, 70%, or 80% by administering an mRNA agent. In some embodiments, the PCSK9 gene is suppressed by at least about 85, 90, or 95% by introducing a double-stranded oligonucleotide.

The RNAi agents of the present invention may be administered to a subject by any route of administration known in the art, including, without limitation, subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, lymphatic, spinal, and any combination thereof. . In preferred embodiments, the agents are administered subcutaneously.

In some embodiments, administration is via injection of a delayed absorption agent. Injection of a delayed absorption agent can release the RNAi agent in a sustained manner over a long period of time. Thus, by injecting a retarded agent, it is possible to reduce the frequency of dosing required to obtain the desired effect, eg, desired PCSK9 inhibition, or therapeutic or prophylactic effect. Injection of a delayed-absorption agent may also result in more sustained serum concentrations. Depot injections may include subcutaneous injections or intramuscular injections. In preferred embodiments, the injection of the depot agent is a subcutaneous injection.

In some embodiments, administration is via a pump. The pump may be an external pump or a surgically implanted pump. In certain embodiments, the pump is a subcutaneously implanted osmotic pump. In other embodiments, the pump is an infusion pump. The infusion pump can be used for intravenous, subcutaneous, arterial, or epidural infusions. In preferred embodiments, the infusion pump is a subcutaneous infusion pump. In other embodiments, the pump is a surgically implantable pump that delivers the RNAi agent to the liver.

Other routes of administration include epidural, intracerebral, intracerebroventricular, nasal, intraarterial, intracardiac, intraosseous infusion, intrathecal, and intravitreal, and pulmonary. The route of administration can be selected based on whether local or systemic treatment is needed and based on the area to be treated. The route and site of administration can be selected to enhance targeted effects.

The method includes administering an mRNA agent, for example, a dose sufficient to reduce PCSK9 mRNA levels for at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days; and optionally administering a second single dose of dsRNA, wherein the second single dose is administered at least 5, more preferably 7, 10, 14, 21, 25, 30 or 40 days after administration of the first single dose, thereby inhibiting expression of the PCSK9 gene in subject.

In one embodiment, doses of the mRNA agent of the present invention are administered no more than once every four weeks, no more than once every three weeks, no more than once every two weeks, or no more than once every week. In another embodiment, administrations may continue for one, two, three or six months, or one year, or longer.

In another embodiment, administration may be provided when low-density lipoprotein cholesterol (LDLc) levels reach or exceed a predetermined minimum level, such as greater than 70, 130, 150, 200, 300, or 400 mg/dL.

Typically, an mRNA agent does not activate the immune system, for example, it does not increase cytokine levels such as TNF-alpha or IFN-alpha levels. For example, when measured by assays such as the in vitro PBMC assay, such as those described herein, the increase in TNF-alpha or IFN-alpha levels is less than 30, 20, or 10% of the level in control cells treated with control dsRNA , such as dsRNA that does not target PCSK9.

For example, a therapeutic amount of an mRNA agent, such as 0.5, 1.0, 1.5, 2.0 or 2.5 mg/kg dsRNA, can be administered to a subject. An mRNA agent

- 59 046901 can be administered by intravenous infusion over a period of time, such as over a period of 5, 10, 15, 20 or 25 minutes. The administration is repeated, for example, regularly, such as biweekly (ie, every two weeks) for one month, two months, three months, four months or longer. After the primary treatment regimen, treatments can be administered less frequently. For example, after administration once every two weeks for three months, administration can be repeated once a month for six months, or a year, or longer. Administration of an mRNA agent may reduce the levels of PCSK9, for example, in a cell, tissue, blood, urine or other part of a patient's body by at least 10%, at least 15%, at least 20%, by at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least at least 90% or more.

Before receiving a full dose of the mRNA agent, patients may be given a smaller dose, such as a 5% infusion reaction, and monitored for adverse effects, such as allergic reactions or increased lipid levels or blood pressure. . In another example, the patient may be monitored for undesirable immunostimulatory effects, such as increased levels of a cytokine (eg, TNF-alpha or INF-alpha).

A treatment effect or preventative effect is evident when there is a statistically significant improvement in one or more indicators of a disease state, or by the absence of worsening or development of symptoms where they would otherwise be predicted. As an example, a favorable change in a measured disease index of at least 10% and preferably at least 20, 30, 40, 50% or more may be indicative of effective treatment. The effectiveness of a given mRNA agent of the present invention or a formulation of such an mRNA agent can also be judged using an experimental animal model for a given disease that is known in the art. When using an experimental animal model, treatment is proven to be effective if a statistically significant reduction in marker or symptom reduction is observed.

In one embodiment, the RNAi agent is administered at a dose of about 0.25 to about 50 mg/kg, such as about 0.25 to about 0.5 mg/kg, about 0.25 to about 1 mg/kg, from about 0.25 to about 5 mg/kg, from about 0.25 to about 10 mg/kg, from about 1 to about 10 mg/kg, from about 5 to about 15 mg/kg, from about 10 to about 20 mg/kg, about 15 to about 25 mg/kg, about 20 to about 30 mg/kg, about 25 to about 35 mg/kg, or about 40 to about 50 mg/kg.

In some embodiments, the RNAi agent is administered at a dose of about 0.25 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, about 3 mg/kg, about 4 mg/kg, approximately 5 mg/kg, approximately 6 mg/kg, approximately 7 mg/kg, approximately 8 mg/kg, approximately 9 mg/kg, approximately 10 mg/kg, approximately 11 mg/kg, approximately 12 mg/kg, approximately 13 mg/kg, approximately 14 mg/kg, approximately 15 mg/kg, approximately 16 mg/kg, approximately 17 mg/kg, approximately 18 mg/kg, approximately 19 mg/kg, approximately 20 mg/kg, approximately 21 mg/kg kg, approximately 22 mg/kg, approximately 23 mg/kg, approximately 24 mg/kg, approximately 25 mg/kg, approximately 26 mg/kg, approximately 27 mg/kg, approximately 28 mg/kg, approximately 29 mg/kg, 30 mg/kg, approximately 31 mg/kg, approximately 32 mg/kg, approximately 33 mg/kg, approximately 34 mg/kg, approximately 35 mg/kg, approximately 36 mg/kg, approximately 37 mg/kg, approximately 38 mg /kg, approximately 39 mg/kg, approximately 40 mg/kg, approximately 41 mg/kg, approximately 42 mg/kg, approximately 43 mg/kg, approximately 44 mg/kg, approximately 45 mg/kg, approximately 46 mg/kg , about 47 mg/kg, about 48 mg/kg, about 49 mg/kg, or about 50 mg/kg. In one embodiment, the mRNA agent is administered at a dose of about 25 mg/kg.

The dose of the RNAi agent administered to a subject may be adjusted to balance the risks and benefits of a particular dose, for example, to achieve a desired level of PCSK9 gene suppression (as determined, for example, by PCSK9 mRNA suppression, PCSK9 protein expression, or reduction in lipid levels), or necessary therapeutic or prophylactic action, while simultaneously avoiding unwanted side effects.

In some embodiments, the RNAi agent is administered in two or more doses. When necessary to facilitate repeated or frequent infusions, implantation of a delivery device, such as a pump, semi-permanent stent (eg, intravenous, intraperitoneal, intracisternal, or intraarticular), or vessel, may be appropriate. In some embodiments, the number or number of successive doses depends on achieving a desired effect, such as suppression of the PCSK9 gene, or achieving a therapeutic or prophylactic effect, such as reducing a symptom of hypercholesterolemia. In some embodiments, the RNAi agent is administered according to the schedule. For example, the RNAi agent can be administered once a week, twice a week, three times a week, four times a week, or five times a week. In some embodiments, the regimen includes administration at regular intervals, e.g., every hour, every four hours, every six hours, every eight hours, every twelve hours, every day, every 2 days, every 3 days, every 4 days, every 5 days , once a week, once every two weeks or once a month. In other embodiments, the regimen includes administrations at close intervals with

- 60 046901 followed by a longer period of time during which the agent is not administered. For example, the regimen may include an initial set of doses that are administered over a relatively short period of time (eg, about every 6 hours, about every 12 hours, about every 24 hours, about every 48 hours, or about every 72 hours) followed by a longer period time (eg, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, or about 8 weeks) during which the RNAi agent is not administered. In one embodiment, the RNAi agent is initially administered every hour and subsequently administered at longer intervals (eg, once a day, once a week, once every two weeks, or once a month). In another embodiment, the RNAi agent is initially administered daily and subsequently administered at longer intervals (eg, weekly, biweekly, or monthly). In some embodiments, the longer interval increases over time, or is determined based on the achievement of the desired action. In a specific embodiment, the RNAi agent is administered once daily for the first week, followed by once weekly dosing starting on the eighth day of administration. In another specific embodiment, the RNAi agent is administered every other day for the first week, followed by once-weekly dosing starting on the eighth day of administration.

In one embodiment, the mRNA agent is administered twice a week. In one embodiment, the mRNA agent is administered twice weekly at a dose of 1 mg/kg. In another embodiment, the mRNA agent is administered twice weekly at a dose of 2 mg/kg.

In one embodiment, the mRNA agent is administered once every two weeks. In one embodiment, the mRNA agent is administered once every two weeks at a dose of 1 mg/kg. In another embodiment, the mRNA agent is administered once every two weeks at a dose of 2 mg/kg.

In one embodiment, the mRNA agent is administered once a week. In one embodiment, the mRNA agent is administered once a week at a dose of 0.5 mg/kg. In one embodiment, the mRNA agent is administered once a week at a dose of 1 mg/kg. In another embodiment, the mRNA agent is administered once a week at a dose of 2 mg/kg.

In some embodiments, the RNAi agent is administered in a dosing regimen that includes a saturation phase of administrations at short intervals, which may be followed by a maintenance phase in which the RNAi agent is administered at longer intervals. In one embodiment, the saturation phase includes five daily administrations of the RNAi agent during the first week. In another embodiment, the maintenance phase includes administering the RNAi agent once or twice a week. In a further embodiment, the maintenance phase lasts 5 weeks. In one embodiment, the saturation phase involves administering a dose of 2 mg/kg, 1 mg/kg, or 0.5 mg/kg five times per week. In another embodiment, the maintenance phase includes administering a dose of 2 mg/kg, 1 mg/kg, or 0.5 mg/kg once, twice, or thrice weekly, once every two weeks, once every three weeks, once per month, once every two months, once every three months, once every four months, once every five months or once every six months.

Any of these patterns may not necessarily be repeated for one or more repetitions. The number of repeats may depend on achieving a desired effect, such as suppression of the PCSK9 gene, and/or achieving a therapeutic or prophylactic effect, such as reducing serum cholesterol levels or reducing the symptom of hypercholesterolemia.

In additional embodiments, administration of the siRNA is carried out in combination with an additional therapeutic agent. The siRNA and the additional therapeutic agent can be administered in combination in the same composition, for example, parenterally, or the additional therapeutic agent can be administered as part of a separate composition or in another manner described herein.

Examples of additional therapeutic agents include agents known to treat lipid disorders such as hypercholesterolemia, atherosclerosis or dyslipidemia. For example, the siRNAs described in the present invention can be administered, for example, with an HMG-CoA reductase inhibitor (e.g., a statin), a fibrate, a bile acid sequestrant, niacin, an antiplatelet agent, an angiotensin converting enzyme inhibitor, an angiotensin II receptor antagonist (e.g., losartan potassium , such as Cozaar® from Merck & Co.), acylCoA:cholesterol acyltransferase (ACAT) inhibitor, cholesterol absorption inhibitor, cholesteryl ester transport protein (CETP) inhibitor, microsomal triglyceride transfer protein (MTTP) inhibitor, cholesterol modulator, bile acid modulator, peroxisome proliferator-activated receptor (PPAR) agonist, gene therapy, complex vascular protectant (eg, AGI-1067 from Atherogenics), glycoprotein Ilb/IIIa inhibitor, aspirin or aspirin-like substance, IBAT inhibitor ( e.g. S-8921 from Shionogi), inhibi

- 61 046901 squalene synthesis toroid or monocyte chemoattractant protein (MCP)-I inhibitor. Exemplary HMG-CoA reductase inhibitors include atorvastatin (Lipitor®/Tahor/Sortis/Torvast/Cardyl from Pfizer), pravastatin (Pravachol from Bristol-Myers Squibb, Mevalotin/Sanaprav from Sankyo), simvastatin (Zocor®/Sinvacor from Merck, Denan from Boehringer Ingelheim, Lipovas from Banyu), lovastatin (Mevacor/Mevinacor from Merck, Lovastatina from Bexal, Liposcler from Sera Schwarz Pharma), fluvastatin (Lescol®/Locol/Lochol from Novartis, Cranoc from Fujisawa, Digaril from Solvay), cerivastatin (Lipobay /Glaxo from Bayer, Baycol from SmithKline), rosuvastatin (Crestor® from AstraZeneca) and pitivastatin (itavastatin/rivastatin) (Nissan Chemical, Kowa Kogyo, Sankyo and Novartis). Exemplary fibrates include, for example, bezafibrate (eg, Befizal®/Cedur®/Bezalip® from Roche, Bezatol from Kissei), clofibrate (eg, Atromid-S® from Wyeth), fenofibrate (eg, Lipidil/Lipantil from Fournier, Tricor® from Abbott, Lipantil from Takeda, generics), gemfibrozil (eg, Lopid/Lipur from Pfizer) and ciprofibrate (Modalim® from Sanof-Synthelabo). Exemplary bile acid sequestrants include, for example, cholestyramine (Questran® and Questran Light™ from Bristol-Myers Squibb), colestipol (eg, Colestid from Pharmacia) and colesevelam (WelChol™ from Genzyme/Sankyo). Exemplary niacin therapy agents include, for example, immediate release formulations such as Nicobid from Aventis, Niacor from Upsher-Smith, Nicolar from Aventis, and Perycit from Sanwakagaku. Slow-release niacin formulations include, for example, Niaspan from Kos Pharmaceuticals and Slo-Niacin from Upsher-Smith. Exemplary antiplatelet agents include, for example, aspirin (eg, Aspirin from Bayer), clopidogrel (Plavix from Sanofi-Synthelabo/Bristol-Myers Squibb), and ticlopidine (eg, Ticlid from SanofiSynthelabo and Panaldine from Daiichi). Other aspirin-like compounds useful in combination with dsRNA targeting PCSK9 include, for example, Asacard (slow release aspirin from Pharmacia) and pamicogrel (Kanebo/Angelini Ricerche/CEPA). Exemplary angiotensin-converting enzyme inhibitors include, for example, ramipril (eg, Altace from Aventis) and enalapril (eg, Vasotec from Merck & Co.). Exemplary acylCoA:cholesterol acyltransferase (ACAT) inhibitors include, for example, avasimibe (Pfizer), eflucimibe (BioMsrieux Pierre Fabre/Eli Lilly), CS-505 (Sankyo and Kyoto), and SMP-797 (Sumito). Exemplary cholesterol absorption inhibitors include, for example, ezetimibe (Zetia® from Merck/Schering-Plough Pharmaceuticals) and Pamaqueside (Pfizer). Exemplary CETP inhibitors include, for example, torcetrapib (also called CP-529414 from Pfizer), JTT-705 (Japan Tobacco) and CETi-I (Avant Immunotherapeutics). Exemplary microsomal triglyceride transfer protein (MTTP) inhibitors include, for example, implitapide (Bayer), R-103757 (Janssen), and CP-346086 (Pfizer). Other exemplary cholesterol modulators include, for example, N0-1886 (Otsuka/TAP Pharmaceutical), CI-1027 (Pfizer), and WAY-135433 (Wyeth-Ayerst).

Exemplary bile acid modulators include, for example, HBS-107 (Hisamitsu/Banyu), Btg-511 (British Technology Group), BARI-1453 (Aventis), S-8921 (Shionogi), SD-5613 (Pfizer) and AZD-7806 (AstraZeneca). Exemplary peroxisome proliferator-activated receptor (PPAR) agonists include, for example, tesaglitazar (AZ-242) (AstraZeneca), netoglitazone (MCC-555) (Mitsubishi/Johnson & Johnson), GW-409544 (Ligand Pharniaceuticals/GlaxoSmithKline), GW -501516 (Ligand Pharmaceuticals/GlaxoSmithKline), LY-929 (Ligand Pharmaceuticals and Eli Lilly), LY-465608 (Ligand Pharmaceuticals and Eli Lilly), LY-518674 (Ligand Pharmaceuticals and Eli Lilly) and MK-767 (Merck and Kyorin) . Exemplary gene therapy types include, for example, AdGWEGF 121.10 (GenVec), ApoAl (UCB Pharma/Groupe Fournier), EG-004 (Trinam) (Ark Therapeutics), and ATP-binding cassette transporter-Al (ABCA1) (CV Therapeutics/Incyte , Aventis, Xenon). Exemplary glycoprotein Ilb/IIIa inhibitors include, for example, roxifiban (also called DMP754, Bristol-Myers Squibb), gantofiban (Merck KGaA/Yamanouchi), and cromafiban (Millennium Pharmaceuticals). Exemplary squalene synthesis inhibitors include, for example, BMS-1884941 (Bristol-Myers Squibb), CP-210172 (Pfizer), CP-295697 (Pfizer), CP-294838 (Pfizer), and TAK-475 (Takeda). An exemplary MCPI inhibitor is, for example, RS-504393 (Roche Bioscience). The anti-atherosclerotic agent BO-653 (Chugai Pharmaceuticals) and the nicotinic acid derivative Nyclin (Yamanouchi Pharmacuticals) are also suitable for administration in combination with the dsRNA described in the present invention. Exemplary combination therapies suitable for administration with dsRNA targeting PCSK9 include, for example, Advicor (niacin/lovastatin from Kos Pharmaceuticals), amlodipine/atorvastatin (Pfizer), and ezetimibe/simvastatin (eg, Vytorin® 10/10 tablets , 10/20, 10/40 and 10/80, Merck/Schering-Plough Pharmaceuticals). Agents for the treatment of hypercholesterolemia and suitable for administration in combination with dsRNA targeting PCSK9 include, for example, lovastatin, niacin, Altoprev® extended-release tablet (Andrx Labs), lovastatin, Caduet® tablets (Pfizer), amlodipine besylate, atorvastatin calcium salt, Crestor® tablets (AstraZeneca), rosuvastatin calcium salt, Lescol® capsules (Novartis), fluvastatin sodium salt Lescol® (Reliant, Novartis), fluvastatin sodium salt, Lipitor® tablets (Parke- Davis), atorvastatin calcium, Lofibra® capsules (Gate), Niaspan extended-release tablets (Kos), niacin, Pravachol tablets (Bristol-Myers Squibb), pravastatin sodium, TriCor® tablets (Abbott), fenofibrate , Vytorin® 10/10 strength tablets (Merck/Schering-Plough Pharmaceu

- 62 046901 ticals), ezetimibe, simvastatin, WelChol™ tablets (Sankyo), colesevelam hydrochloride salt, Zetia® tablets (Schering), ezetimibe, Zetia® tablets (Merck/Schering-Plough Pharmaceuticals) and ezetimibe, Zocor® tablets ( Merck).

In one embodiment, the mRNA agent is administered in combination with an ezetimibe/simvastatin combination (eg, Vytorin® (Merck/Schering-Plough Pharmaceuticals)). In one embodiment, the mRNA agent is administered to the patient and then the additional therapeutic agent (or vice versa) is administered to the patient. In another embodiment, the mRNA agent and the additional therapeutic agent are administered simultaneously.

In another aspect, the present invention describes a method of instructing an end user, eg, a caregiver or treatment person, or a subject, how to administer an mRNA agent described herein. The method optionally includes providing the end user with one or more doses of the mRNA agent and instructing the end user to administer the mRNA agent in the manner described herein, thereby instructing the end user.

In one aspect, the present invention provides a method of treating a patient by selecting a patient with the condition that the patient is in need of lowering LDL levels, lowering LDL levels without lowering HDL levels, lowering ApoB levels, or lowering total cholesterol levels. The method includes administering siRNA to a patient in an amount sufficient to reduce LDL levels or ApoB levels in the patient, for example, without significantly reducing HDL levels.

Genetic predisposition plays a role in the development of target gene-associated diseases, such as hyperlipidemia. Thus, a patient in need of siRNA can be identified by reviewing family history or, for example, testing for the presence of one or more genetic markers or variants. Examples of genes involved in hyperlipidemia include, but are not limited to, those of LDL receptor (LDLR), apoliproteins (ApoAl, ApoB, ApoE, etc.), cholesteryl ester transport protein (CETP), lipoprotein lipase (LPL), hepatic lipase (LIPC), endothelial lipase (EL), lecithin:cholesterol acyltransferase (LCAT).

A healthcare professional such as a physician, nurse, or family member may consider family history before prescribing or administering an mRNA agent of the present invention. In addition, an analysis can be performed to determine the genotype or phenotype. For example, DNA testing can be performed on a sample from a patient, such as a blood sample, to establish the PCSK9 genotype and/or phenotype before administering dsRNA to PCSK9 to the patient. In another embodiment, an assay is performed to establish a related genotype and/or phenotype, for example, the LDLR genotype. Examples of genetic variants of the LDLR gene can be found in the prior art, for example, in the following publications, which are incorporated by reference: Costanza et al (2005) Am J Epidemiol. 15;161(8):714-24; Yamada et al. (2008) J Med Genet. Jan; 45(1):22-8, electronic publication August 31, 2007; and Boes et al (2009) Exp. Gerontol 44: 136-160, electronic publication November 17, 2008.

VI. Sets.

The present invention also provides kits for using any of the mRNA agents and/or performing any of the methods according to the present invention. Such kits include one or more RNAi agents and instructions for use, for example, instructions for inhibiting PCSK9 expression in a cell by contacting the cell with an amount of RNAi agent(s) effective to inhibit PCSK9 expression. The kits may optionally further contain means for bringing the cell into contact with the RNAi agent (eg, an injection device) or means for determining the degree of inhibition of PCSK9 (eg, means for determining the degree of inhibition of PCSK9 mRNA or TTR protein). Such means for determining the degree of PCSK9 inhibition may include means for obtaining a sample from a subject, such as, for example, a plasma sample. The kits of the present invention may optionally further contain means for administering the RNAi agent(s) to a subject or means for determining a therapeutically effective or prophylactically effective amount.

Unless otherwise specified, all technical and scientific terms used herein have the meaning that is commonly understood by one skilled in the art to which the present invention relates. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the mRNA and methods described in the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other literature references herein are incorporated by reference in their entirety. In the event of a conflict, this description, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be limiting.

- 63 046901

Examples

Materials and methods.

The following materials and methods were used in the examples.

cDNA synthesis using the ABI High capacity cDNA reverse transcription kit (Applied Biosystems, Forster City, CA, cat. no. 4368813)

A master mix of 2 µl 10X buffer, 0.8 µl 25X dNTPs, 2 µl random primers, 1 µl reverse transcriptase, 1 µl RNase inhibitor and 3.2 µl H ₂ O per reaction was added to 10 µl total RNA. cDNA was prepared using a Bio-Rad C-1000 or S-1000 thermal cycler (Hercules, California) through the following steps: 25°C for 10 min, 37°C for 120 min, 85°C for 5 s, and stored at 4°C.

Cell culture and transfections.

Hep3B, HepG2, or HeLa cells (ATCC, Manassas, VA) were grown to near confluence at 37°C in an atmosphere of 5% CO2 in the recommended medium (ATCC) supplemented with 10% FBS and glutamine (ATCC) before being separated from the petri dish by treatment trypsin. For duplexes sorted in 96-well format, transfection was performed by adding 44.75 μl of Opti-MEM with 0.25 μl of Lipofectamine RNAiMax per well (Invitrogen, Carlsbad, CA, cat. no. 13778-150) to 5 μl of each duplex siRNA in a separate well in a 96-well plate. The mixture was then incubated at room temperature for 15 minutes. Fifty microliters of complete culture media without antibiotic containing ~2 x 10 ⁴ cells was then added to the siRNA mixture. For duplexes sorted in 384-well format, 5 μl of Opti-MEM with 0.1 μl of Lipofectamine RNAiMax (Invitrogen, Carlsbad, CA, cat. no. 13778-150) was mixed with 5 μl of each siRNA duplex per individual well. The mixture was then incubated at room temperature for 15 min, followed by the addition of 40 μl of complete culture media without antibiotic containing ~8 x 10 ³ cells. Cells were incubated for 24 h before RNA purification. Single dose experiments were performed at final duplex concentrations of 10 nM and 0.1 nM, and dose effect experiments were performed using 8 X 5-fold serial dilutions starting at 2 nM.

Transfection by free uptake.

Five microliters of each GalNac-conjugated siRNA in PBS were combined with 3x10 ⁴ freshly thawed cryopreserved cynomolgus hepatocytes (In Vitro Technologies-Celsis, Baltimore, MD; serial number JQD) resuspended in 95 microliters of In Vitro Gro CP media (In Vitro Technologies- Celsis, Baltimore, MD), in each well of a 96-well plate, or 5 μl siRNA and 45 μl media containing 1.2 x 10 ³ cells for a 384-well plate format. The mixtures were incubated for approximately 24 hours at 37°C in an atmosphere of 5% CO ₂ . siRNA was tested at a variety of concentrations from 500 to 0.1 nM for single dose experiments and using 8 X 5-fold serial dilutions starting at 500 nM for dose effect experiments.

Isolation of total RNA using the DYNABEADS mRNA Isolation Kit (Invitrogen, cat. no. 610-12).

Cells were collected and lysed in 150 μl of lysis/binding buffer, then mixed for 5 min at 850 rpm using an Eppendorf Thermomixer (mixing speed was constant throughout the process). Ten microliters of magnetic beads and 80 μl of the lysis/binding buffer mixture were added to the round bottom plate and mixed for 1 min. Magnetic beads were fixed using a magnetic stand and the supernatant was removed without displacing the beads. After removing the supernatant, the lysed cells were added to the remaining beads and mixed for 5 min. After removing the supernatant, the magnetic beads were washed 2 times with 150 μl of wash buffer A and mixed for 1 min. The beads were again fixed and the supernatant was removed. The beads were then washed with 150 μl of wash buffer B, fixed, and the supernatant was discarded. The beads were then washed with 150 μl of elution buffer, fixed, and the supernatant was removed. The granules were allowed to dry for 2 min. After drying, 50 μL of elution buffer was added and mixed for 5 min at 70°C. The granules were fixed on a magnet for 5 min. Fifty microliters of supernatant was removed and added to another 96-well plate.

For the 384-well format, cells were lysed for one minute by adding 50 μl of lysis/binding buffer. Two μl of magnetic beads per well were used. The required volume of granules was divided into aliquots, fixed on a magnetic stand, and the granule storage solution was removed. The beads were then resuspended in the required volume of lysis/binding buffer (25 μl per well) and 25 μl of the bead suspension was added to the lysed cells. The lysate and bead mixture was incubated for 10 min on a VibraTransaltor at setting #7 (UnionScientific Corp., Randallstown, MD). Subsequently, the beads were fixed using a magnetic stand, the supernatant was removed and the beads were washed once with 90 μl of buffer A, followed by separate washing steps with 90 μl of buffer B and 100 μl of elution buffer. The beads were soaked in each wash buffer for ~1 min (without mixing). After the final washing step, the beads were resuspended in 15 μl of elution buffer for 5 min at 70°C, followed by fixation of the beads and removal of the supernatant (up to 8 μl) for cDNA synthesis and/or storage of purified RNA (- 64 046901

20°C).

Real-time PCR.

Two μl of cDNA was added to a master mix containing 0.5 μl TaqMan probe for human GAPDH (Applied Biosystems, cat. no. 4326317E), 0.5 μl TaqMan probe for human PCSK9 (Applied Biosystems, cat. no. Hs03037355_m1) for human cells or 0.5 μl of the Custom TaqMan Assay reagent kit for cynomolgus GAPDH (150 nM cyno GAP F primer-5'GCATCCTGGGCTACACTGA (SEQ ID NO: 5); 150 nM cyno GAP R primer-5'-TGGGTGTCGCTGTTGAAGTC (SEQ ID NO : 6) 250 nM cyno GAP zong-5'-5HEX-CCAGGTGGTCTCCTCC-BHQ1-Q-3' (SEQ ID NO: 7)), 0.5 µl Custom TaqMan Assay Kit for Cynomolgus PCSK9 (900 nM cyno PCSK9 F primer 5'ACGTGGCTGGCATTGCA (SEQ ID NO: 8); 900 nM cyno PCSK9 R primer 5'AAGTGGATCAGTCTCTGCCTCAA (SEQ ID NO: 9); 250 nM cyno PCSK9 probe 5'-6FAMCATGATGCTGTCTGCCGAGCCG-BHQ1-Q-3' (SEQ ID NO: 10)) for cynomolgus monkey cells, and 5 µl of Lightcycler 480 probe master mix (Roche, cat. no. 04887301001) per well in a 384-well plate (Roche, cat. no. 04887301001). Real-time PCR was performed on a Roche LC480 Real Time PCR system (Roche) using a ΔΔCt(RQ) assay. Each duplex was assayed in two independent transfections, and each transfection was assessed in two parallel assays unless otherwise noted.

To calculate relative fold change, real-time data were analyzed using the ΔΔCt method and normalized to those of assays performed with cells transfected with 10 nM AD-1955 or mock-transfected cells. For free uptake assays, data were normalized to those of PBS or GalNAc-1955 (the highest concentration for experimental compounds) treated cells. IC ₅₀ was calculated using a 4-way fit model using XLFit and normalized to those of cells transfected with AD-1955 at the same dose range or its lowest dose.

The sense and antisense sequences of AD-1955 are: sense: 5'cuuAcGcuGAGuAcuucGAdTsdT-3' (SEQ ID NO: 11) and antisense: 5'-UCGAAGuACUcAGCGuAAGdTsdT3' (SEQ ID NO: 12).

Table B

Nucleotide monomer abbreviations used in nucleic acid sequence representation

Reduction Nucleotide(s) A adenosine 3'-phosphate Ab beta-b-adenosine-3'-phosphate Af 2'-fluoroadenosine-3'-phosphate Afs 2'-fluoroadenosine-3'-phosphothioate As adenosine-3'-phosphothioate C Cytidine 3'-phosphate

- 65 046901

Cb beta-b-cytidine-3'-phosphate Cf 2'-fluorocytide in-3'-phosphate Cfs 2'-fluorocytidine-3'-phosphothioate Cs Cytidine-3'-phosphothioate G guanosine 3'-phosphate Gb beta-b-guanosine-3'-phosphate Gbs beta-b-guanosine-3'-phosphothioate Gf 2'-fluoroguanosine-3'-phosphate Gfs 2'-fluoroguanosine-3'-phosphothioate Gs guanosine-3'-phosphothioate T 5'-methylur idine-3'-phosphate Tf 2'-fluoro-5-methyluridine-3'-phosphate Tfs 2'-fluoro-5-methyluridine-3'-phosphothioate Ts 5-methylur idine-3’-phosphothioate U uridine-3'-phosphate Uf 2'-fluorouridine-3'-phosphate UFS 2'-fluororide in-3'-phosphothioate Us uridine-3'-phosphothioate N any nucleotide (G, A, C, T or U) a 2'-O-methyladenosine-3'-phosphate as 2'-O-methyladenosine-3'-phosphothioate c 2'-O-methyl cytidine-3'-phosphate cs 2'-O-methylcytidine-3'-phosphothioate g 2'-O-methylguanosine-3'-phosphate gs 2'-O-methylguanosine-3'-phosphothioate t 2'-O-methyl-5-methylur idine-3'-phosphate ts 2'-O-methyl-5-methyluridine-3'-phosphothioate u 2'-O-methylur idine-3'-phosphate us 2'-O-methylur idine-3'-phosphothioate dT 2'-deoxythymidine dTs 2'-deoxythymidine-3'-phosphothioate dU 2'-deoxyuridine s phosphorothioate bond L96 L>G-[tris(OaPMAc-alkyl)-amidodecanoyl)]-4-hydroxyprolinolNur-(CaHAAc-alkyl)3 (Aeo) 2'-O-methoxyethyladenosine-3'-phosphate

- 66 046901

(Aeos) 2'-O-methox ethyladenosine-3'-phosphothioate (Geo) 2'-O-methoxyethylguanosine-3'-phosphate (Geos) 2'-O-methoxyethylguanosine-3'-phosphothioate (Theo) 2'-O-methoxyethyl-5-methyluridine-3'-phosphate (Teos) 2'-O-methoxyethyl-5-methylur idine-3'-phosphothioate (m5Ceo) 2'-O-methoxyethyl-5-methyl cytidine-3'-phosphate (m5Ceos) 2'-O-methoxyethyl-5-methylcytidine-3'-phosphothioate (AZsh) 3'-O-methyl adenosine-2'-phosphate (AZshh) 3'-O-methyl-xylofuranosyladenosine-2'-phosphate (G3m) 3'-O-methyl guanosine-2'-phosphate (G3mx) 3'-O-methyl-xylofuranosylguanosine-2'-phosphate (NWsh) 3'-O-methylcytidine-2'-phosphate (NWshh) 3'-O-methyl-xylofuranosylcytidine-2'-phosphate (U3m) 3'-O-methylur idine-2'-phosphate (U3mx) 3'-O-methylxylouridine-2'-phosphate (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (pshe) hydroxyethylphosphothioate (UHD) 2'-O-hexadecyl-uridine-3'-phosphate (Tgn) thymidine glycol nucleic acid (GNA), S-isomer (Cgn) cytidine glycol nucleic acid (GNA) (Chd) 2'-O-hexadecyl-cytidine-3'-phosphate (Ggn) 2'-O-hexadecyl-cytidine-3'-phosphate (Agn) adenosine glycol nucleic acid (GNA) P 5'-phosphate (m5Cam) 2'-O-(M-methylacetamide)-5-methylcytidine-3-phosphate (m5Cams) 2'-O-(M-methylacetamide)-5-methylcytidine-3-phosphothioate (Tam) 2'-O-(M-methylacetamide)thymidine-3-phosphate (Tams) 2'-O-(1H-methylacetamide)thymidine-3-phosphothioate (Aam) 2'-O-(M-methylacetamide)adenosine-3-phosphate (Ams) 2'-O-(M-methylacetamide)adenosine-3-phosphothioate (Gam) 2'-O-(M-methylacetamide)guanosine-3-phosphate (Gams) 2'-O-(M-methylacetamide)guanosine-3-phosphothioate (Uyh) 2'-O-(1-hexyl-4-methylene-1,2,3-triazolyl)-uridine-3'-phosphate (Ayh) 2'-O-(1-hexyl-4-methylene-1,2,3-triazolyl)-adenosine-3'-phosphate (Gyh) 2'-O-(1-hexyl-4-methylene-1,2,3-triazolyl)-guanosine-3'-phosphate (Cyh) 2'-O-(1-hexyl-4-methylene-1,2,3-triazolyl)-cytidine-3'-phosphate

Example 1. Synthesis of GalNAc-conjugated oligonucleotides.

A series of siRNA duplexes spanning the PCSK9 mRNA sequence were designed, synthesized, and conjugated to trivalent GalNAc at the 3-end of the sense strand using the procedures described above. The sequences of such duplexes are shown in table. 1. The same sequences were also synthesized with various nucleotide modifications and conjugated to trivalent GalNAc. The sequences of the modified duplexes are shown in table. 2.

- 67 046901

Unmodified sequences for PCSK9

Table 1

Duplex name The name of the semantic oligonukle eotide Semantic trance, ate. SEQ ID NO: Name of antisense oligonucleotide Antisense trance, ate. SEQ ID NO: Started on NMJL7 4936.3 Kone color NM_1 74936 .3 AD-53649.1 A-110542.1 CGAGGACGGCGACUACGAGGA 13 A-109239.2 UCCUCGUAGUCGCCGUCCUCGUC 234 459 481 AD-53661.1 A-110544.1 ACCGCUGCGCCAAGGAUCCGU 14 A-109243.2 ACGGAUCUUGGCGCAGCGGUGG 235 554 576 AD-53667.1 A-110545.1 GCUGCGCCAAGGAUCCGUGGA 15 A-109245.2 UCCACGGAUCCUUGGCGCAGCGG 236 557 579 AD-53679.1 A-110547.1 CUACGUGGUGGUGCUGAAGGA 16 A-109249.2 UCCUUCAGCACCACCAGUAGGU 237 591 613 AD-53685.1 A-110548.1 CCCGCCGGGGAUACCUCACCA 17 A-109251.2 UGGUGAGGUAUCCCCGGCGGGCA 238 668 690 AD-53691.1 A-110549.1 CCGCCGGGGAUACCUCACCAA 18 A-109253.2 UUGGUGAGGUAUCCCCGGCGGGC 239 669 691 AD-53650.1 A-110550.1 GCCGGGGAUACCUCACCAAGA 19 A-109255.2 UCUUGGUGAGGUAUCCCCGGCGG 240 671 693 AD-53656.1 A-110551.1 CCGGGGAUACCUCACCAAGAU 20 A-109257.2 AUCUUGGUGAGGUAUCCCCGGCG 241 672 694 AD-53668.1 A-110553.1 AUACCUCACCAAGAUCCUGCA 21 A-109261.2 UGCAGGAUCUUGGUGAGGUAUCC 242 678 700 AD-53674.1 A-110554.1 CACCAAGAUCCUGCAUGUCUU 22 A-109263.2 AAGACAUGCAGG AUCU UGG UG AG 243 684 706 AD-53680.1 A-110555.1 CAAGAUCCUGCAUGUCUUCCA 23 A-109265.2 UGGAAGACAUGCAGGAUCUUGGU 244 687 709 AD-53692.1 A-110557.1 GUUGCCCCAUGUCGACUACAU 24 A-109269.2 AUGUAGUCGACAUGGGGCAACUU 245 768 790 AD-53651.1 A-110558.1 GCCCCAUG UCGACUACAU CGA 25 A-109271.2 UCGAUGUAGUCGACAUGGGGCAA 246 771 793 AD-53657.1 A-110559.1 CCAUG UCGACU ACAU CGAGGA 26 A-109273.2 UCCUCGAUGUAGUCGACAUGGGG 247 774 796 AD-53663.1 A-110560.1 UCGACUACAUCGAGGAGGACU 27 A-109275.2 AGUCCUCCUCGAUGUAGUCGACA 248 779 801 AD-53669.1 A-110561.1 ACUACAUCGAGGAGGACUCCU 28 A-109277.2 AGGAGUCCCUCCGAUGUAGUCG 249 782 804 AD-53675.1 A-110562.1 UACAUCGAGGAGGACUCCUCUCU 29 A-109279.2 AGAGGAGUCCUCCUCGAUGUAGU 250 784 806 AD-53681.1 A-110563.1 UCGAGGAGGACUCCUCUGUCU thirty A-109281.2 AGACAGAGGAGUCCUCCUCGAUG 251 788 810 AD-53687.1 A-110564.1 CGAGGAGGACUCCUCUGUCUU 31 A-109283.2 AAGACAGAGGAGUCCUCCUCGAU 252 789 811 AD-53693.1 A-110565.1 GUACCGGGCGGAUGAAUACCA 32 A-109285.2 UGGUAUUCAUCCGCCCGGGUACCG 253 855 877 AD-53652.1 A-110566.1 CCUGGUGGAGGUGUAUUCUCCU 33 A-109287.2 AGGAGAUACACCUCCACCAGGCU 254 894 916 AD-53658.1 A-110567.1 CUGGUGGAGGUGUAUCUCCUA 34 A-109289.2 UAGGAGAUACACCUCCACCAGGC 255 895 917 AD-53664.1 A-110568.1 GGUGGAGGUGUAUCUCCUAGA 35 A-109291.2 UCUAGGAGAUACACCUCCACCAG 256 897 919 AD-53670.1 A-110569.1 UGGAGGUGUAUCUCCUAGACA 36 A-109293.2 UGUCUAGGAGAUACACCUCCACC 257 899 921 AD-53676.1 A-110570.1 AGGUGUAUUCUCCUAGACACCA 37 A-109295.2 UGGUGUCUAGGAGAAUACACCUCC 258 902 924 AD-53682.1 A-110571.1 GUAUCUCCUAGACACCAGCAU 38 A-109297.2 AUGCUGGUGUCUAGGAGAAUACAC 259 906 928 AD-53688.1 A-110572.1 UAUCUCCUAGACACCAGCAUA 39 A-109299.2 UAUGCUGGUGUCUAGGAGAUACA 260 907 929 AD-53694.1 A-110573.1 UCUCCUAGACACCAGCAUACA 40 A-109301.2 UGUAUGCUGGUGUCUAGGAGAUA 261 909 931 AD-53653.1 A-110574.1 UCCUAGACACCAGCAUACAGA 41 A-109303.2 UCUGUAUGCUGGUGUCUAGGAGA 262 911 933 AD-53659.1 A-110575.1 AGACACCAGCAUACAGAGUGA 42 A-109305.2 UCACUCUGUAUGCUGGUGUCUAG 263 915 937 AD-53665.1 A-110576.1 CACCAGCAUACAGAGUGACCA 43 A-109307.2 UGGUCACUCUGUAUGCUGGUGUC 264 918 940 AD-53671.1 A-110577.1 UACAGAGUGACCACCGGGAAA 44 A-109309.2 UUUCCCGGUGGUCACUCUGUAUG 265 926 948 AD-53677.1 A-110578.1 ACAGAG UG ACCACCGGG AAAU 45 A-109311.2 AUUUCCCGGUGGUCACUCUGUAU 266 927 949 AD-53683.1 A-110579.1 GAGUGACCACCGGGAAAUCGA 46 A-109313.2 UCGAUUUCCCGGUGGUCACUCUG 267 930 952 AD-53689.1 A-110580.1 GGAAAUCGAGGGCAGGGUCAU 47 A-109315.2 AUGACCCUGCCCUCGAUUUCCCG 268 942 964 AD-53695.1 A-110581.1 AAUCGAGGGCAGGGUCAUGGU 48 A-109317.2 ACCAUGACCCUGCCCUCGAUUUC 269 945 967 AD-53654.1 A-110582.1 GCAGGGUCAUGGUCACCCGACU 49 A-109319.2 AGUCGGUGACCAUGACCCUGCCC 270 953 975 AD-53660.1 A-110583.1 CAGGGUCAUGGUCACCCGACUU 50 A-109321.2 AAGUCGGUGACCAUGACCCUGCC 271 954 976 AD-53666.1 A-110584.1 GGUCAUGGUCACCCGACUUCGA 51 A-109323.2 UCGAAGUCGGUGACCAUGACCCU 272 957 979 AD-53672.1 A-110585.1 UCAUGG UCACCGACU UCGAGA 52 A-109325.2 UCUCGAAGUCGGUGACCAUGACC 273 959 981 AD-53678.1 A-110586.1 AGGACGGGACCCGCUUCCACA 53 A-109327.2 UGUGGAAGCGGGUCCCGUCCUCC 274 992 1014 AD-53684.1 A-110587.1 CGGGACCCGCUUCCACAGACA 54 A-109329.2 UG U CUG UGG AAG CG GG U CCCG U C 275 996 1018 AD-53690.1 A-110588.1 UCCACAGACAGGCCAGCAAGU 55 A-109331.2 ACUUGCUGGCCUGUCUGUGGAAG 276 1007 1029 AD-53696.1 A-110589.1 CCUGCGCGUGCUCAACUGCCA 56 A-109333.2 UGGCAGUUGAGCACGCGCCAGGCU 277 1107 1129 AD-53702.1 A-110590.1 CUGCGCGUGCUCAACUGCCAA 57 A-109335.2 UUGGCAGUUGAGCACGCGCAGGC 278 1108 ISO AD-53708.1 A-110591.1 CGUGCUCAACUGCCAAGGGAA 58 A-109337.2 UUCCCUUGGCAGUUGAGCACGCG 279 1113 1135 AD-53714.1 A-110592.1 CACCUCAUAGGCCUGGAGUU 59 A-109339.2 AACUCCAGGCCUAUGAGGGUGCC 280 1149 1171 AD-53720.1 A-110593.1 ACCUCAUAGGCCUGGAGUUU 60 A-109341.2 AAACUCCAGGCCUAUGAGGGUGC 281 1150 1172 AD-53726.1 A-110594.1 CCCUCAUAGGCCUGGAGUUUA 61 A-109343.2 UAAACUCCAGGCCUAUGAGGGUG 282 1151 1173

- 68 046901

AD-53732.1 A-110595.1 CCUCAUAGGCCUGGAGU UUAU 62 A-109345.2 AUAAACUCCAGGCCUAUGAGGGU 283 1152 1174 AD-53738.1 A-110596.1 CUCAUAGGCCUGGAGUUUAUU 63 A-109347.2 AAUAAACUCCAGGCCUAUGAGGG 284 1153 1175 AD-53697.1 A-110597.1 UAGGCCUGGAGUUUAUUCGGA 64 A-109349.2 UCCGAAUAAACUCCAGGCCUAUG 285 1157 1179 AD-53703.1 A-110598.1 AGGCCUGGAGUUUAUUCGGAA 65 A-109351.2 UUCCGAAUAAACUCCAGGCCUAU 286 1158 1180 AD-53709.1 A-110599.1 GGCCUGGAGUUUAUUCGGAAA 66 A-109353.2 UUUCCGAAUAAACUCCAGGCCUA 287 1159 1181 AD-53715.1 A-110600.1 GCCUGGAGUUUAUUCGGAAAA 67 A-109355.2 U U U U CCG AAU AAACU CCAGG CCU 288 1160 1182 AD-53721.1 A-110601.1 GGAGUUUAUU CGG AAAAG CCA 68 A-109357.2 UGGCUUUUCCGAAUAAACUCCAG 289 1164 1186 AD-53727.1 A-110602.1 GUUUAUUCGGAAAAGCCAGCU 69 A-109359.2 AGCUGGCUUUUCCGAAUAAAACUC 290 1167 1189 AD-53733.1 A-110603.1 GGGCUGGGGUCGUGCUGGUCA 70 A-109361.2 U GACCAG CACGACCCCAG CCCUC 291 1277 1299 AD-53739.1 A-110604.1 GG UCACCGCUGCCGGCAACU U 71 A-109363.2 AAG U U GCCGG CAG CGG U G ACCAG 292 1293 1315 AD-53698.1 A-110605.1 GGGACGAUGCCUGCCUCUACU 72 A-109365.2 AGUAGAGGCAGGCAUCGUCCCGG 293 1316 1338 AD-53704.1 A-110606.1 CAACUUUGGCCGCUGUGUGGA 73 A-109367.2 UCCACACAGCGGCCAAAGUUGGU 294 1419 1441 AD-53710.1 A-110607.1 UUGGCCGCUGUGUGGACCUCU 74 A-109369.2 AGAGGUCCACACAGCGGCCAAAG 295 1424 1446 AD-53716.1 A-110608.1 UGGCCGCUGUGUGGACCUCUU 75 A-109371.2 AAG AGG UCCACACAGCGGCCAAA 296 1425 1447 AD-53722.1 A-110609.1 GGCCGCUGUGUGGACCUCUUU 76 A-109373.2 AA AGAGG U CCACACAG CGGCCAA 297 1426 1448 AD-53728.1 A-110610.1 UGUGUGGACCUCUUUGCCCCA 77 A-109375.2 UGGGGCAAAGAGGUCCACACAGC 298 1432 1454 AD-53734.1 A-110611.1 GGGAGGACAUCAUUGGUGCCU 78 A-109377.2 AGGCACCAAUGAUGUCCUCCCCU 299 1454 1476 AD-53740.1 A-110612.1 ACUGCAGCACCUGCUUUGUGU 79 A-109379.2 ACACAAAGCAGGUGCUGCAGUCG 300 1481 1503 AD-53699.1 A-110613.1 GCAUUGCAGCCAUGAUGCUGU 80 A-109381.2 ACAGCAUCAUGGCUGCAAUGCCA 301 1541 1563 AD-53705.1 A-110614.1 GUUGAGGCAGAGACUGAUCCA 81 A-109383.2 UGGAUCAGUCUCUGCCUCAACUC 302 1590 1612 AD-53711.1 A-110615.1 UGAGGCAGAGACUGAUCCACU 82 A-109385.2 AGUGGAUCAGUCUCUGCCUCAAC 303 1592 1614 AD-53717.1 A-110616.1 GAGGCAGAGACUGAUCCACUU 83 A-109387.2 AAGUGGAUCAGUCUCUGCCCUCAA 304 1593 1615 AD-53723.1 A-110617.1 GGCAGAGACUGAUCCACUUCU 84 A-109389.2 AGAAGUGGAUCAGUCUCUGCCUC 305 1595 1617 AD-53729.1 A-110618.1 CAGAGACUGAUCCACUUCUCUCU 85 A-109391.2 AGAGAAGUGGAUCAGUCUCUGCC 306 1597 1619 AD-53735.1 A-110619.1 ACUGAUCCACUUCUCUGCCAA 86 A-109393.2 UUGGCAGAGAAGUGGAUCAGUCU 307 1602 1624 AD-53741.1 A-110620.1 AUCCACUUCUCUGCCAAAGAU 87 A-109395.2 AUCUUUGGCAGAGAAGUGGAUCA 308 1606 1628 AD-53700.1 A-110621.1 GGCCUGGUUCCCUGAGGACCA 88 A-109397.2 UGGUCCUCAGGGAACCAGGCCUC 309 1638 1660 AD-53706.1 A-110622.1 GG UACUG ACCCCCAACCUGG U 89 A-109399.2 ACCAGGUUGGGGGUCAGUACCCG 310 1662 1684 AD-53712.1 A-110623.1 GUUGGCAGCUGUUUUGCAGGA 90 A-109401.2 UCCUGCAAAACAGCUGCCAACCU 311 1715 1737 AD-53718.1 A-110624.1 UGGCAGCUGUUUUGCAGGACU 91 A-109403.2 AGUCCUGCAAAACAGCUGCCAAC 312 1717 1739 AD-53724.1 A-110625.1 GCAGCUGUUUUGCAGGACUGU 92 A-109405.2 ACAGUCCUGCAAAACAGCUGCCA 313 1719 1741 AD-53730.1 A-110626.1 UCUGCCGGGCCCACAACGCUU 93 A-109407.2 AAGCGUUGUGGGCCCGGCAGACC 314 1883 1905 AD-53736.1 A-110627.1 CUGCCGGGCCCACAACGCUUU 94 A-109409.2 AAAGCGUUGUGGGCCCGGCAGAC 315 1884 1906 AD-53742.1 A-110628.1 GCCCACAACGCUUUUGGGGGU 95 A-109411.2 ACCCCCAA AAG CGUUGUGGGCCC 316 1891 1913 AD-53701.1 A-110629.1 CGCUUUUGGGGGUGAGGGUGU 96 A-109413.2 ACACCCUCACCCCCAAAAGCGUU 317 1899 1921 AD-53707.1 A-110630.1 CUUUUGGGGGUGAGGGUGUCU 97 A-109415.2 AGACACCUCACCCCCAAAAGCG 318 1901 1923 AD-53713.1 A-110631.1 UUUUGGGGGUGAGGGUGUCUA 98 A-109417.2 U AG ACACCCU CACCCCCAAAAG C 319 1902 1924 AD-53719.1 A-110632.1 GGGGUGAGGGUGUCUACGCCA 99 A-109419.2 UGGCGUAGACACCCUCACCCCCA 320 1907 1929 AD-53725.1 A-110633.1 GGGUGAGGGUGUCUACGCCAU 100 A-109421.2 AUGGCGUAGACACCCUCACCCCC 321 1908 1930 AD-53731.1 A-110634.1 GGUGAGGGUGUCUACGCCAUU 101 A-109423.2 AAUGGCGUAGACACCCUCACCCC 322 1909 1931 AD-53737.1 A-110635.1 AGGGUGUCUACGCCCAUUGCCA 102 A-109425.2 UGGCAAUGGCGUAGACACCCUCA 323 1913 1935 AD-53743.1 A-110636.1 GUGUCUACGCCAUUGCCAGGU 103 A-109427.2 ACCUGGCAAUGGGCGUAGACACCC 324 1916 1938 AD-53749.1 A-110637.1 UG CAGCG U CCACACAGCU CCA 104 A-109429.2 UGGAGCUGUGUGGACCGCUGCAGU 325 1960 1982 AD-53755.1 A-110638.1 GCAUGGGGACCCGUGUCCACU 105 A-109431.2 AGUGGACACGGGUCCCCAUGCUG 326 1994 2016 AD-53761.1 A-110639.1 CCCACAAGCCGCCUGUGCUGA 106 A-109433.2 UCAGCACAGCGCGGCUUGUGGGUG 327 2078 2100 AD-53767.1 A-110640.1 GAGGCCACGAGGUCAGCCCAA 107 A-109435.2 UUGGGCUGACCUCGUGGCCUCAG 328 2097 2119 AD-53773.1 A-110641.1 CACGAGGUCAGCCCAACCAGU 108 A-109437.2 ACUGGUUGGGCUGACCUCGUGGC 329 2102 2124 AD-53779.1 A-110642.1 GGGAGGCCAGCAUCCACGCUU 109 A-109439.2 AAGCGUGGAUGCUGGCCUCCCUG 330 2135 2157 AD-53785.1 A-110643.1 AUCCACGCUUCCUGCUGCCAU 110 A-109441.2 AUGGCAGCAGGAAGCGUGGAUGC 331 2146 2168 AD-53744.1 A-110644.1 GGAAUGCAAAGUCAAGGAGCA 111 A-109443.2 UGCUCCUUGACUUUGCAUUCCAG 332 2178 2200 AD-53750.1 A-110645.1 AAUCCCGGCCCCUCAGGAGCA 112 A-109445.2 UGCUCCUGAGGGGCCGGGAUUCC 333 2202 2224 AD-53762.1 A-110647.1 GCUGGGGCUGAGCUUUAAAAU 113 A-109449.2 AU U U U AAAG CU CAG CCCCAG CCC 334 2479 2501

- 69 046901

AD-53768.1 A-110648.1 GGAGGUGCCAGGAAGCUCCCU 114 A-109451.2 AGGGAGCUUCCUGGCACCUCCAC 335 2648 2670 AD-53774.1 A-110649.1 ACUGUGGGGCAUUUCACCAUU 115 A-109453.2 AAUGGUGAAAUGCCCCACAGUGA 336 2674 2696 AD-53780.1 A-110650.1 CCACCAAGGAGGCAGGAUUCU 116 A-109455.2 AGAAUCCUGCCUCCUUGGUGGAG 337 2811 2833 AD-53786.1 A-110651.1 CACCAAGGAGGCAGGAUUCUU 117 A-109457.2 AAGAAUCCUGCCUCCUUGGUGGA 338 2812 2834 AD-53804.1 A-110701.1 ACCAAGGAGGCAGGAU UCU U U 118 A-109557.2 AAAGAAUCCUGCCUCCUUGGUGG 339 2813 2835 AD-53810.1 A-110702.1 GGAGGCAGGAUUCUUCCCAUU 119 A-109559.2 AAUGGGAAGAAUCCUGCCUCCUU 340 2818 2840 AD-53816.1 A-110703.1 GAGGCAGGAUUCUUCCCAUGA 120 A-109561.2 UCAUGGGAAGAAUCCUGCCUCCU 341 2819 2841 AD-53745.1 A-110652.1 UGAUGGCCCUCAUCUCCAGCU 121 A-109459.2 AGCUGGAGAUGAGGGCCAUCAGC 342 2904 2926 AD-53822.1 A-110704.1 CUUUCUGGAUGGCAUCUAGCA 122 A-109563.2 UGCUAGAUGCCAUCCAGAAAGCU 343 2971 2993 AD-53751.1 A-110653.1 UU UCUGGAUGGCAUCUAGCCA 123 A-109461.2 UGGCUAGAUGCCAUCCAGAAAGC 344 2972 2994 AD-53827.1 A-110705.1 UUCUGGAUGGCAUCUAGCCAA 124 A-109565.2 UUGGCUAGAUGCCAUCCAGAAAG 345 2973 2995 AD-53757.1 A-110654.1 UCUGGAUGGCAUCUAGCCAGA 125 A-109463.2 UCUGGCUAGAUGCCAUCCAGAAA 346 2974 2996 AD-53833.1 A-110706.1 CUGGAUGGCAUCUAGCCAGAA 126 A-109567.2 UUCUGGCUAGAUGCCAUCCAGAA 347 2975 2997 AD-53793.1 A-110707.1 CUUUACUCUGCUCUAUGCCAA 127 A-109569.2 UUGGCAUAGAGCAGAGUAAAGGU 348 3053 3075 AD-53799.1 A-110708.1 UUUACUCUGCUCUAUGCCAGA 128 A-109571.2 UCUGGCAUAGAGCAGAGUAAAGG 349 3054 3076 AD-53763.1 A-110655.1 GCUCUAUGCCAGGCUGUGCUA 129 A-109465.2 UAGCACAGCCUGGCAUAGAGCAG 350 3062 3084 AD-53769.1 A-110656.1 CUCAGCCAACCCGCUCCACUA 130 A-109467.2 UAGUGGGAGCGGGUUGGCUGAGAC 351 3158 3180 AD-53805.1 A-110709.1 UCAGCCAACCCGCUCCACUAA 131 A-109573.2 UUAGUGGAGCGGGUUGGCUGAGA 352 3159 3181 AD-53811.1 A-110710.1 CCUG CCAAG CU CACACAGCAA 132 A-109575.2 UUGCUGUGUGAGCUUGGCAGGCA 353 3245 3267 AD-53781.1 A-110658.1 GCCAAGCUCACACAGCAGGAA 133 A-109471.2 UUCCUGCUGUGUGAGCUUGGCAG 354 3248 3270 AD-53817.1 A-110711.1 CCAAGCUCACACAGCAGGAAA 134 A-109577.2 UUUCCUGCUGUGUGAGCUUGGCA 355 3249 3271 AD-53787.1 A-110659.1 CAAGCUCACACAGCAGGAACU 135 A-109473.2 AGUUCCUGCUGUGUGAGCUUGGC 356 3250 3272 AD-53823.1 A-110712.1 AAGCUCACACAGCAGGAACUU 136 A-109579.2 AAGUUCCUGCUGUGUGAGCUUGG 357 3251 3273 AD-53746.1 A-110660.1 CUGAAGCCAAGCCUCUUCUUA 137 A-109475.2 UAAGAAGAGGCUUGGCUUCAGAG 358 3298 3320 AD-53828.1 A-110713.1 UGAAGCCAAGCCUCUUCUUAA 138 A-109581.2 UUAAGAAGAGGCUUGGCUUCAGA 359 3299 3321 AD-53752.1 A-110661.1 GAAGCCAAGCCUCUUCUUACU 139 A-109477.2 AGUAAGAAGAGGCUUGGCUUCAG 360 3300 3322 AD-53758.1 A-110662.1 AAGCCAAGCCUCUUCUUACUU 140 A-109479.2 AAGUAGAAGAGGCUUGGCUUCA 361 3301 3323 AD-53834.1 A-110714.1 AGUGAGGCUGGGAAGGGGGAAA 141 A-109583.2 UUUCCCCUUCCCAGCCUCACUGUGU 362 3355 3377 AD-53764.1 A-110663.1 GUGAGGCUGGGAAGGGGAACA 142 A-109481.2 UGUUCCCCUUCCCAGCCUCACUG 363 3356 3378 AD-53770.1 A-110664.1 GGCUGGGAAGGGGAACACAGA 143 A-109483.2 UCUGUGUUCCCCUUCCCAGCCUC 364 3360 3382 AD-53776.1 A-110665.1 GAAGGGGAACACAGACCAGGA 144 A-109485.2 UCCUGGUCUGUGUUCCCCUUCCC 365 3366 3388 AD-53782.1 A-110666.1 AAGGGGAACACAGACCAGGAA 145 A-109487.2 UUCCUGGUCUGUGUUCCCCUUCC 366 3367 3389 AD-53794.1 A-110715.1 AGGGGAACACAGACCAGGAAA 146 A-109585.2 UUUCCUGGUCUGUGUUCCCCUUC 367 3368 3390 AD-53788.1 A-110667.1 GGGAACACAGACCAGGAAGCU 147 A-109489.2 AGCUUCCUGGUCUGUGUUCCCCU 368 3370 3392 AD-53747.1 A-110668.1 ACUGUCCUCCUUGAGCACCA 148 A-109491.2 UGGUGCUCAAGGAGGGACAGUUG 369 3509 3531 AD-53753.1 A-110669.1 CCAG CCCCACCCAAG CAAG CA 149 A-109493.2 UGCUUGCUUGGGUGGGGCUGGUG 370 3527 3549 AD-53759.1 A-110670.1 CCCCACCCAAGCAAGCAGACA 150 A-109495.2 UGUCUGCUUGCUUGGGUGGGGCU 371 3531 3553 AD-53765.1 A-110671.1 CCCACCCAAGCAAGCAGACAU 151 A-109497.2 AUGUCUGCUUGCUUGGGUGGGGC 372 3532 3554 AD-53771.1 A-110672.1 CCACCCAAGCAAGCAGACAUU 152 A-109499.2 AAUGUCUGCUUGCUUGGGUGGGG 373 3533 3555 AD-53777.1 A-110673.1 CACCCAAGCAAGCAGACAUUU 153 A-109501.2 AAAUGUCUGCUUGCUUGGGUGGG 374 3534 3556 AD-53783.1 A-110674.1 ACCCAAG CAAG CAGACAU U UA 154 A-109503.2 UAAAUGUCUGCUUGCUUGGGUGG 375 3535 3557 AD-53789.1 A-110675.1 CCCAAGCAAGCAGACAUUUAU 155 A-109505.2 AUAAAUGUCUGCUUGCUUGGGUG 376 3536 3558 AD-53800.1 A-110716.1 CCAAGCAAGCAGACAUUUAUU 156 A-109587.2 AAUAAAUGUCUGCUUGCUUGGGU 377 3537 3559 AD-53748.1 A-110676.1 CAAGCAAGCAGACAUUUAUCU 157 A-109507.2 AGAUAAAUGUCUGCUUGCUUGGG 378 3538 3560 AD-53754.1 A-110677.1 AAGCAAGCAGACAUUUAUCUU 158 A-109509.2 AAGAUAAAUGUCUGCUUGCUUGG 379 3539 3561 AD-53760.1 A-110678.1 AG CAAG CAGACAU U UAU CU U U 159 A-109511.2 AAAGAAUAAAUGUCUGCUUGCUUG 380 3540 3562 AD-53806.1 A-110717.1 CAAGCAGACAUUUAUCUUUUU 160 A-109589.2 AAAAAGAUAAAUGUCUGCUUGCU 381 3542 3564 AD-56975.1 A-116394.4 160 A-109589.5 381 AD-56976.1 A-116407.1 160 A-109589.11 381 AD-56977.1 A-116406.2 160 A-109589.11 381 AD-56978.1 A-116418.1 160 A-109589.18 381 AD-56979.1 A-116393.1 Similar 160 A-109589.6 Similar 381 Analogue Anal

- 70 046901

AD-56980.1 A-116408.1 Similar 160 A-109589.12 Similar 381 personal Analogue normal Anal normal AD-56981.1 A-116419.1 160 A-109589.19 381 AD-56982.1 A-116426.1 160 A-109589.19 381 AD-56983.1 A-116400.1 160 A-109589.7 381 AD-56984.1 A-116409.1 160 A-109589.13 381 AD-56985.1 A-116420.1 160 A-109589.20 381 AD-56986.1 A-116428.1 160 A-109589.20 381 AD-56986.2 A-116428.2 160 A-109589.17 381 AD-56987.1 A-116410.1 160 A-109589.14 381 AD-56988.1 A-116421.1 160 A-109589.21 381 AD-56989.1 A-116430.1 160 A-109589.21 381 AD-56990.1 A-116432.1 160 A-109589.9 381 AD-56991.1 A-116415.1 160 A-109589.15 381 AD-56992.1 A-116434.1 160 A-109589.15 381 AD-56993.1 A-116416.1 160 A-109589.16 381 AD-56994.1 A-116436.1 160 A-109589.22 381 AD-56995.1 A-116417.1 160 A-109589.17 381 AD-56996.1 A-116438.1 160 A-109589.17 381 AD-56997.1 A-116450.1 160 A-109589.17 381 AD-56998.1 A-116471.1 160 A-109589.17 381 AD-56999.1 A-116479.2 160 A-109589.17 381 AD-57000.1 A-116492.3 160 A-109589.17 381 AD-57001.1 A-116440.1 160 A-109589.17 381 AD-57002.1 A-116452.1 160 A-109589.17 381 AD-57003.1 A-116460.1 160 A-109589.17 381 AD-57004.1 A-116473.1 160 A-109589.17 381 AD-57005.1 A-116486.1 160 A-109589.17 381 AD-57006.1 A-116494.3 160 A-109589.17 381 AD-57007.1 A-116442.1 160 A-109589.17 381 AD-57008.1 A-116453.1 160 A-109589.17 381 AD-57009.1 A-116462.1 160 A-109589.17 381 AD-57010.1 A-116475.1 160 A-109589.17 381 AD-57011.1 A-116488.1 160 A-109589.17 381 AD-57012.1 A-116498.1 160 A-109589.17 381 AD-57013.1 A-l 16444.1 160 A-109589.17 381 AD-57014.1 A-116454.1 160 A-109589.17 381 AD-57015.1 A-116464.1 160 A-109589.17 381 AD-57016.1 A-116477.1 160 A-109589.17 381 AD-57017.1 A-116490.1 160 A-109589.17 381 AD-57018.1 A-116500.1 160 A-109589.17 381 AD-57019.1 A-116446.1 160 A-109589.17 381 AD-57020.1 A-116455.1 160 A-109589.23 381 AD-57021.1 A-116481.1 160 A-109589.23 381 AD-57022.1 A-116448.1 160 A-109589.23 381 AD-57023.1 A-116467.1 160 A-109589.23 381 AD-57024.1 A-116483.1 160 A-109589.23 381 AD-57025.1 A-116449.1 160 A-109589.23 381 AD-57026.1 A-116457.1 160 A-109589.23 381 AD-57027.1 A-116469.1 160 A-109589.23 381 AD-53812.1 A-110718.1 AAGCAGACAUUUAUCUUUUGA 161 A-109591.2 UCAAAAGAUAAAUGUCUGCUUGC 382 3543 3565 AD-53818.1 A-110719.1 AGCAGACAAUUUAUCUUUUGGA 162 A-109593.2 UCCAAAAGAUAAAUGUCUGCUUG 383 3544 3566 AD-53766.1 A-110679.1 GCAGACAUUAUAUCUUUUGGGU 163 A-109513.2 ACCCAAAAGAU AAAUG UCUGCU U 384 3545 3567

AD-53772.1 A-110680.1 AGACAUUUAUCUUUUGGGUCU 164 A-109515.2 AGACCCAAAAGAUAAAUGUCUGC 385 3547 3569 AD-53824.1 A-110720.1 GACAUUUAUCUUUUGGGUCUU 165 A-109595.2 AAGACCCAAAAGAUAAAUGUCUG 386 3548 3570 AD-53778.1 A-110681.1 ACAUUUAUCUUUUGGGUCUGU 166 A-109517.2 ACAGACCCAAAAGAUAAAUGUCU 387 3549 3571 AD-53784.1 A-110682.1 UUUAUCUUUUGGGUCUGUCCU 167 A-109519.2 AGGACAGACCCCAAAAGAUAAAUG 388 3552 3574 AD-53829.1 A-110721.1 UUAUCUUUUGGGUCUGUCCUU 168 A-109597.2 AAGGACAGACCCAAAAGAUAAAU 389 3553 3575 AD-53790.1 A-110683.1 UAUCUUUUGGGUCUGUCCUCU 169 A-109521.2 AGAGGACAGACCCCAAAAGAUAAA 390 3554 3576 AD-53835.1 A-110722.1 AUCUUUUGGGUCUGUCCUCUU 170 A-109599.2 AAGAGGACAGACCCAAAAGAUAA 391 3555 3577 AD-53796.1 A-110684.1 UCUUUUGGGUCUGUCCUCUCUCU 171 A-109523.2 AGAGAGGACAGACCCAAAAGAUA 392 3556 3578 AD-53802.1 A-110685.1 UUUUGGGUCUGUCCUCUCUGU 172 A-109525.2 ACAGAGAGGACAGACCCAAAAGA 393 3558 3580 AD-53808.1 A-110686.1 UUUGGGUCUGUCCUCUCUGUU 173 A-109527.2 AACAGAGAGGACAGACCCAAAAG 394 3559 3581 AD-53795.1 A-110723.1 UUGGGUCUGUCCUCUCUGUUU 174 A-109601.2 AAACAGAGAGGACAGACCCAAAA 395 3560 3582 AD-53801.1 A-110724.1 UGGGUCUGUCCUCUCUGUUGA 175 A-109603.2 UCAACAGAGAGGACAGACCCAAA 396 3561 3583 AD-53807.1 A-110725.1 GGGUCUGUCCUCUCUGUUGCA 176 A-109605.2 UGCAACAGAGAGGACAGACCCAA 397 3562 3584 AD-53814.1 A-110687.1 GGUCUGUCCUCUCUGUUGCCU 177 A-109529.2 AGGCAACAGAGAGGACAGACCCA 398 3563 3585 AD-53820.1 A-110688.1 GUCUGUCCUCUCUGUUGCCUU 178 A-109531.2 AAGGCAACAGAGAGGACAGACCC 399 3564 3586 AD-53825.1 A-110689.1 UCUGUCCUCUCUGUUGCCUUU 179 A-109533.2 AAAGGCAACAGAGAGGACAGACC 400 3565 3587 AD-53831.1 A-110690.1 CUGUCCUCUCUGUUGCCUUUU 180 A-109535.2 AAAAGGCAACAGAGAGGACAGAC 401 3566 3588 AD-53791.1 A-110691.1 UGUCCUCUCUGUUGCCUUUUU 181 A-109537.2 AAAAAGGCAACAGAGAGGACAGA 402 3567 3589 AD-53797.1 A-110692.1 GUCCUCUCUGUUGCCUUUUUA 182 A-109539.2 UAAAAGGCAACAGAGAGGACAG 403 3568 3590 AD-48400.1 A-98247.2 UUUUCUAGACCUGUUUUGCUU 183 A-93455.4 AAGCAAAACAGGUCUAGAAAAGU 404 3597 3619 AD-53830.1 A-110872.1 A-110873.1 AD-53803.1 A-110693.1 UUUCUAGACCUGUUUUGCUUU 184 A-109541.2 AAAGCAAAACAGGUCUAGAAAAG 405 3598 3620 AD-53809.1 A-110694.1 UUCUAGACCUGUUUUGCUUUU 185 A-109543.2 AAAAG CAAAACAGG U CUAGAAAA 406 3599 3621 AD-53813.1 A-110726.1 UCUAGACCUGUUUUGCUUUUU 186 A-109607.2 AAAAAGCAAAACAGG UCUAGAAA 407 3600 3622 AD-53815.1 A-110695.1 CUAGACCUGUUUUGCUUUUGU 187 A-109545.2 ACAAAAGCAAAACAGGUCUAGAA 408 3601 3623 AD-56610.1 A-115523.2 187 A-115525.1 408 AD-56611.1 A-115533.2 Similar 187 A-115534.1 Similar 408 Anal normal AD-56612.1 A-115536.2 187 A-115540.3 408 AD-56613.1 A-115538.3 187 A-115541.5 408 AD-56614.1 A-110695.9 187 A-115548.1 408 AD-56615.1 A-110695.5 187 A-115519.1 408 AD-56616.1 A-115523.3 187 A-115526.1 408 AD-56617.1 A-115535.1 187 A-109545.7 408 AD-56618.1 A-115537.2 187 A-115540.4 408 AD-56619.1 A-115539.3 187 A-115541.6 408 AD-56620.1 A-115542.2 187 A-115548.2 408 AD-56621.1 A-115520.1 187 A-115519.2 408 AD-56622.1 A-115527.1 187 A-115526.2 408 AD-56623.1 A-115536.1 187 A-109545.8 408 AD-56624.1 A-115538.2 187 A-115540.5 408 AD-56625.1 A-115542.1 187 A-109545.12 408 AD-56626.1 A-115543.2 187 A-115548.3 408 AD-56627.1 A-115521.1 187 A-115519.3 408 AD-56628.1 A-115527.2 187 A-115528.1 408 AD-56629.1 A-115537.1 187 A-109545.9 408 AD-56630.1 A-115539.2 187 A-115540.6 408 AD-56631.1 A-115543.1 187 A-109545.13 408 AD-56632.1 A-115544.2 187 A-115548.4 408 AD-56633.1 A-115520.2 187 A-109545.6 408 AD-56634.1 A-115529.1 187 A-115530.1 408 AD-56635.1 A-115538.1 187 A-109545.10 408 AD-56636.1 A-110695.8 187 A-115541.1 408

- 72 046901

AD-56637.1 A-115544.1 Similar 187 A-109545.14 Similar 408 AD-56638.1 A-115545.2 187 A-115548.5 408 AD-56639.1 A-115520.3 187 A-115522.1 408 AD-56640.1 A-115529.2 187 A-115531.1 408 AD-56641.1 A-115539.1 187 A-109545.11 408 AD-56642.1 A-115535.3 187 A-115541.2 408 AD-56643.1 A-115545.1 187 A-109545.15 408 AD-56644.1 A-115546.2 187 A-115548.6 408 AD-56645.1 A-110695.6 187 A-115522.2 408 AD-56646.1 A-115529.3 187 A-115532.1 408 AD-56647.1 A-110695.7 187 A-115540.1 408 AD-56648.1 A-115536.3 187 A-115541.3 408 AD-56649.1 A-115546.1 187 A-109545.16 408 AD-56650.1 A-115547.2 187 A-115548.7 408 AD-56651.1 A-115523.1 187 A-115524.1 408 AD-56652.1 A-115533.1 187 A-115532.2 408 AD-56653.1 A-115535.2 187 A-115540.2 408 AD-56654.1 A-115537.3 187 A-115541.4 408 AD-56655.1 A-115547.1 187 A-109545.17 408 AD-56656.1 A110695.10 187 A-115549.1 408 AD-56657.1 A-115550.1 187 A-115551.1 408 AD-56658.1 A-115564.1 187 A-115565.1 408 AD-56659.1 A110695.12 187 A-115579.1 408 AD-56662.1 A-115542.3 187 A-115549.2 408 AD-56663.1 A-115552.1 187 A-115553.1 408 AD-56664.1 A-115566.1 187 A-115567.1 408 AD-56668.1 A-115543.3 Similar 187 A-115549.3 Similar 408 AD-56669.1 A-115554.1 187 A-115555.1 408 AD-56670.1 A-115568.1 187 A-115569.1 408 AD-56673.1 A-115544.3 187 A-115549.4 408 AD-56674.1 A-115556.1 187 A-115557.1 408 AD-56678.1 A-115545.3 187 A-115549.5 408 AD-56679.1 A-115558.1 187 A-115559.1 408 AD-56680.1 A-115572.1 187 A-115573.1 408 AD-56683.1 A-115546.3 187 A-115549.6 408 AD-56684.1 A-115560.1 187 A-115561.1 408 AD-56685.1 A-115574.1 187 A-115575.1 408 AD-56688.1 A-115547.3 187 A-115549.7 408 AD-56689.1 A-115535.4 187 A-115562.1 408 AD-56690.1 A-115542.4 187 A-115576.1 408 AD-56693.1 A-115520.4 187 A-115563.1 408 AD-56694.1 A-115577.1 187 A-115578.1 408 AD-53821.1 A-110696.1 UAGACCUGUUUUGCUUUUGUA 188 A-109547.2 UACAAAAGCAAAACAGGUCUAGA 409 3602 3624 AD-56660.1 A-115594.1 AGACCUGUUUUGCUUUUGU Similar 189 A-115595.1 ACAAAAGCAAAACAGGUCUAG Similar 410 3603 3623 AD-56661.1 A-115580.2 189 A-115610.1 410 AD-56665.1 A-115580.1 189 A-115581.1 410 AD-56666.1 A-115596.1 189 A-115597.1 410 AD-56667.1 A-115611.1 GACCUGUUUUGCUUUUGU 190 A-115612.1 ACAAAAGCAAAACAGG U CAU A 411 3603 3623 AD-56671.1 A-115582.1 AGACCUGUUUUGCUUUUGU Similar 191 A-115583.1 ACAAAAGCAAAACAGG U CU AG Similar 412 3603 Analogue 3623 Anal AD-56672.1 A-115598.1 191 A-115599.1 412 AD-56676.1 A-115584.1 191 A-115585.1 412 AD-56677.1 A-115600.1 191 A-115601.1 412

- 73 046901

AD-56681.1 A-115586.1 Similar 191 A-115587.1 Similar 412 personal normal AD-56682.1 A-115602.1 191 A-115603.1 412 AD-56686.1 A-115588.1 191 A-115589.1 412 AD-56687.1 A-115604.1 191 A-115605.1 412 AD-56691.1 A-115590.1 191 A-115591.1 412 AD-56692.1 A-115606.1 191 A-115607.1 412 AD-56695.1 A-115592.1 191 A-115593.1 412 AD-56696.1 A-115608.1 191 A-115609.1 412 AD-53826.1 A-110697.1 UUUUGUAACUUGAAGAUAUUU 192 A-109549.2 AAAAUAUCUUCAAGUUACAAAAGC 413 3616 3638 AD-53832.1 A-110698.1 UUUGUAACUUGAAGAUAUUUA 193 A-109551.2 UAAAUAUCU UCAAG U UACAAAAG 414 3617 3639 AD-53792.1 A-110699.1 UUGUAACUUGAAGAUAUUUAU 194 A-109553.2 AUAAAUAUCUUCAAGUUACAAAA 415 3618 3640 AD-53798.1 A-110700.1 UGUAACUUGAAGAUAUUUAUU 195 A-109555.2 AAUAAAUAUCUUCAAGUUACAAA 416 3619 3641 AD-53819.1 A-110727.1 GUAACUUGAAGAUAUUUAUUU 196 A-109609.2 AAAAUAAAUAUCUUCAAGUUACAA 417 3620 3642 AD-53815.1 CUAGACCUGUUUUGCUUUUGU 197 ACAAAAGCAAAACAGGUCUAGAA 418 3601 AD57928.40 Similar 197 Similar 418 AD-59182.5 197 418 AD-59184.3 197 418 AD-59186.3 197 418 AD59171.13 197 418 AD-59176.7 197 418 AD-59170.7 197 418 AD-59175.7 Similar 197 Similar 418 AD-59179.7 197 418 AD-59218.1 197 418 AD-59222.1 197 418 AD-59226.1 197 418 AD-59230.1 197 418 AD-59235.1 197 418 AD-59207.1 197 418 AD-59211.1 197 418 AD-59215.1 197 418 AD-59219.1 197 418 AD-59223.1 197 418 AD-59181.5 197 418 AD-59172.5 197 418 AD-59177.5 197 418 AD-59180.5 197 418 AD-59183.5 197 418 AD-59185.5 197 418

- 74 046901

AD-59173.5 197 418 AD-59232.1 CUAGACCUGUUUUGCUUUUGU 198 ACAAAAGCAAAACAGG U CU AG AA 419 3600 AD-59236.1 Similar 198 Similar 419 Similar AD-59216.1 198 419 AD-59220.1 198 419 AD-59224.1 198 419 AD-59228.1 198 419 AD-59233.1 198 419 AD-59237.1 198 419 AD-59209.1 198 419 AD-59208.1 198 419 AD-59212.1 CUAGACCUGUUUUGCUUUUGU 199 ACAAAAGCAAAACAGG U CU AG AA 420 3600 AD-59210.1 CUAGACCUGUUUUGCUUUUGU 200 ACAAAAGCAAAACAGGUCUAGAA 421 3601 AD-59214.1 AGACCUGUUUUGCUUUUGU 201 ACAAAAGCAAAACAGG U CU AG 422 3603 AD-59227.1 Similar 201 Similar 422 AD-59231.1 201 422 AD-59198.3 201 422 AD-59200.3 201 422 AD-59203.3 Similar 201 Similar 422 AD-59204.3 201 422 AD-59188.3 201 422 AD-59191.3 201 422 AD-59213.1 201 422 AD-59217.1 201 422 AD-59221.1 201 422 AD-59225.1 201 422 AD-59229.1 201 422 AD-59234.1 201 422 AD-59238.1 201 422 AD-59241.1 201 422 AD-59245.1 201 422 AD-59250.1 201 422 AD-59246.1 CUAGACCUGUUUUGCUUUUGU 202 ACAAAAGCAAAACAGG U CU AG A 423 3602 AD-59253.2 UAGACCUGUUUUGCUUUUGU 203 ACAAAAGCAAAACAGG U CU AG A 424 3602 AD-59242.1 AGACCUGUUUUGCUUUUGU 204 ACAAAAGCAAAACAGG U CU AG A 425 3602 AD-59253.1 UAGACCUGUUUUGCUUUUGU 205 ACAAAAGCAAAACAGG U CU AG A 426 3602

- 75 046901

AD-59258.1 UAGACCUGUUUUGCUUUUGU 206 ACAAAAGCAAAACAGG U CU AG A 427 3602 AD-59251.1 CUAGACCUGUUUUGCUUUUGU 207 ACAAAAGCAAAACAGG U CU AG 428 3603 AD-59256.1 UAGACCUGUUUUGCUUUUGU 208 ACAAAAGCAAAACAGG U CU A 429 3604 AD-59260.1 AGACCUGUUUUGCUUUUGU 209 ACAAAAGCAAAACAGG U CU 430 3605 AD-59248.1 GACCUGUUUUGCUUUUGU 210 ACAAAAGCAAAACAGG U CU 431 3605 AD-59247.1 GACCUGUUUUGCUUUUGU 211 ACAA AAG CAAAACAGG U CU A 432 3604 AD-59252.1 AGACCUGUUUUGCUUUUGU 212 ACAA AAG CAAAACAGG U CU A 433 3604 AD-59257.1 UAGACCUGUUUUGCUUUUGU 213 ACAA AAG CAAAACAGG U CU A 434 3604 AD-59261.1 AGACCUGUUUUGCUUUUGU 214 ACAAAAG CAAAACAGG U CUAG 435 3603 AD-59262.1 UAGACCUGUUUUGCUUUUGU 215 ACAA AAG CAAAACAGG U CU AG 436 3603 AD-59265.1 CUAGACCUGUUUUGCUUUUGU 216 ACAA AAG CAAAACAGG U CU AG 437 3603 AD59196.13 UAGACCUGUUUUGCUUUUGU 217 ACAAAAGCAAAACAGG U CUAGAA 438 3601 AD59189.11 AGACCUGUUUUGCUUUUGU 218 ACAA AAG CAAAACAGG U CU AG AA 439 3601 AD-59190.3 UCUAGACCUGUUUUGCUUUUG U 219 ACAAAAG CAAAACAGG U CUAGAA 440 3601 AD-59192.3 UUCUAGACCUGUUUUGCUUUU G.U. 220 ACAAAAGCAAAACAGG U CU AG AA 441 3601 AD-59240.1 220 441 AD-59244.1 220 — 441 — AD-59202.7 Similar 220 — Similar 441 Analo geeky AD-59195.5 220 441 AD-59249.1 220 441 AD-59254.1 220 441 AD-59259.1 220 441 AD-59264.1 220 441 AD-59264.2 220 441 AD-59255.1 220 441 AD-57928.1 220 441 AD-58893.1 220 441 AD-58894.1 220 441 AD-58895.1 220 441 AD-58896.1 220 441 AD-58897.1 220 441 AD-58898.1 220 441 AD-58899.1 220 441 AD-58900.1 CAAGCAGACAUUUAUCUUUUU 221 AAAAAGAUAAAUGUCUGCUUGCU 442 N/A AD-58902.1 UUUUCUAGACCUGUUUUGCUU 222 AAGCAAAACAGGUCUAGAAAAGU 443 3597

- 76 046901

AGACCUGUUUUGCUUUUGU 223 ACAAAAGCAAAACAGG U CU AG 444 AGACCUGUUUUGCUUUUGU 224 ACAAAAGCAAAACAGG U CU AG 445 AGACCUGUUUUGCUUUUGU 225 ACAAAAGCAAAACAGG U CU AG 446 AGACCUGUUUUGCUUUUGU 226 ACAAAAGCAAAACAGG U CU AG 447 AGACCUGUUUUGCUUUUGU 227 ACAAAAGCAAAACAGG U CU AG 448 AGACCUGUUUUGCUUUUGU 228 ACAAAAGCAAAACAGG U CU AG 449 CUAGACCUGUUUUGCUUUUGU Similar 229 ACAA AAG CAAAACAGG U CU AG AA Similar 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 229 450 AGACCUGUUUUGCUUUUGU 230 ACAAAAGCAAAACAGG U CU AG 451 AGACCUGUUUUGCUUUUGU 231 ACAAAAGCAAAACAGGUCUAG 452 CUAGACCUGUUUUGCUUUUGU Similar 232 ACAAAAGCAAAACAGGUCUAGAA Similar 453 232 453 232 453 232 453 232 453 232 453 CUAGACCUGUUUUGCUUUUGU Similar Similar 233 ACAAAAGCAAAACAGGUCUAGAA Similar Similar 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454

- 77 046901

233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 Similar 233 Similar 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454

- 78 046901

233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 454 233 — 454 Similar 233 Similar 454 233 454 233 454 — 233 — 454 — — 233 — 454 — — 233 — 454 — 233 454 — 233 — 454 — — 233 — 454 — 233 — 454 233 454

table 2

Modified sequences for PCSK9

Name duplex Name of sense oligonucleotide Semantic oligonucleotide subsequence SEQ ID NO: Position relative to NM_174936.3 Antisense oligonucleotide name Antisense oligonucleotide subsequence SEQ ID NO: AD-53649.1 A-110542.1 CfgAfgGfaCfgGfCfGfaCfuAfcGfa GfgAfL96 455 461 A-109239.2 uCfcUfcGfuAfgUfcgcCfgUf cCfuCfgsUfsc 1006 AD-53650.1 A-110550.1 GfcCfgGfgGfaUfAfCfcUfcAfcCfa AfgAfL96 456 673 A-109255.2 uCfuUfgGfuGfaGfguaUfcC fcCfgGfcsGfsg 1007 AD-53651.1 A-110558.1 GfcCfcCfaUfgUfCfGfaCfuAfcAfu CfgAfL96 457 773 A-109271.2 uCf g Af u Gf u Afg U f eg a Cfa U fgGfgGfcsAfsa 1008 AD-53652.1 A-110566.1 CfcUfgGfuGfgAfGfGfuGfuAfuCfu CfcUfL96 458 896 A-109287.2 aGfgAfgAfuAfcAfccuCfcAf cCfaGfgsCfsu 1009 AD-53653.1 A-110574.1 UfcCfuAfgAfcAfCfCfaGfcAfuAfcA fgAfL96 459 913 A-109303.2 uCfuGfuAfuGfcUfgguGfu CfuAfgGfasGfsa 1010 AD-53654.1 A-110582.1 GfcAfgGfgUfcAfUfGfgUfcAfcCfg AfcUfL96 460 955 A-109319.2 aGfuCfgGfuGfaCfcauGfaC fcCfuGfcsCfsc 1011 AD-53696.1 A-110589.1 Cf c UfgCfgCfg U f G f Cf u Cf a Af c U fg CfcAfL96 461 1109 A-109333.2 uGfgCfaGfuUfgAfgcaCfgC fgCfaGfgsCfsu 1012 AD-53697.1 A-110597.1 Ufa GfgCfc UfgGfAfGfu Uf u Af u Ufc GfgAfL96 462 1159 A-109349.2 uCfcGfaAfuAfaAfcucCfaGf gCfcUfasUfsg 1013 AD-53698.1 A-110605.1 GfgGf a CfgAf u G f Cf Cf u Gf c Cf u Cf u AfcUfL96 463 1318 A-109365.2 aGfuAfgAfgGfcAfggcAfuCf gUfcCfcsGfsg 1014 AD-53699.1 A-110613.1 GfcAfuUfgCfaGfCfCfaUfgAfuGfc UfgUfL96 464 1543 A-109381.2 aCfaGfcAfuCfaUfggcUfgCf aAfuGfcsCfsa 1015

- 79 046901

AD-53700.1 A-110621.1 GfgCf c U fgGf u U fCf Cf c U fg Afg Gf a CfcAfL96 465 1640 A-109397.2 uGfgUfcCfuCfaGfggaAfcCf aGfgCfcsUfsc 1016 AD-53701.1 A-110629.1 CfgCfuUfuUfgGfGfGfgUfgAfgGfg UfgUfL96 466 1901 A-109413.2 a Cf a Cfc Cf u Cf a Cfc cc Cf a Af aAfgCfgsUfsu 1017 AD-48400.1 A-98247.2 UfuUfuCfuAfgAfcCfuGfuUfuUfg CfuUfL96 467 A-93455.4 aAfgCfaAfaAfcAfgGfuCfu AfgAfaAfasGfsu 1018 AD-53656.1 A-110551.1 CfcGfgGfgAfuAfCfCfuCfaCfcAfa GfaUfL96 468 674 A-109257.2 aUfcUfuGfgUfgAfgguAfuC fcCfcGfgsCfsg 1019 AD-53657.1 A-110559.1 Cf c Af u G f u Cfg Af Cf U f a Cf a Uf c G fa GfgAfL96 469 776 A-109273.2 uCfcUfcGfaUfgUfaguCfgA fcAfuGfgsGfsg 1020 AD-53658.1 A-110567.1 CfuGfgUfgGfaGfGfUfgUfaUfcUfc CfuAfL96 470 897 A-109289.2 u Af gG f a Gf a U f a Cf a cc U f cCf aCfcAfgsGfsc 1021 AD-53659.1 A-110575.1 AfgAfcAfcCfaGfCfAfuAfcAfgAfg UfgAfL96 471 917 A-109305.2 uCfaCfuCfuGfuAfugcUfgG fuGfuCfusAfsg 1022 AD-53660.1 A-110583.1 CfaGfgGfuCfaUfGfGfuCfaCfcGfa CfuUfL96 472 956 A-109321.2 aAfgUfcGfgUfgAfccaUfgA fcCfcUfgsCfsc 1023 AD-53702.1 A-110590.1 CfuGfcGfcGfuGfCfUfcAfaCfuGfc CfaAfL96 473 1110 A-109335.2 uUfgGfcAfgUfuGfagcAfcG fcGfcAfgsGfsc 1024 AD-53703.1 A-110598.1 AfgGfcCfuGfgAfGfUfuUfaUfuCfg GfaAfL96 474 1160 A-109351.2 uUfcCfgAfaUfaAfacuCfcAf gGfcCfusAfsu 1025 AD-53704.1 A-110606.1 CfaAfcUfuUfgGfCfCfgCfuGfuGfu GfgAfL96 475 1421 A-109367.2 uCfcAfcAfcAfgCfggcCfaAf aGfuUfgsGfsu 1026 AD-53705.1 A-110614.1 Gf u U fg Af gG f c Af G f Af g Af c Ufg Af u CfcAfL96 476 1592 A-109383.2 uGfgAfuCfaGfuCfucuGfcC fuCfaAfcsUfsc 1027 AD-53706.1 A-110622.1 GfgUfaCfuGfa Cf Cf Cf c Cf a Af c Cf u GfgUfL96 477 1664 A-109399.2 aCfcAfgGfuUfgGfgggUfcA fgUfaCfcsCfsg 1028 AD-53707.1 A-110630.1 CfuUfuUfgGfgGfGfUfgAfgGfgUf gUfcUfL96 478 1903 A-109415.2 a Gf a Cf a Cf c Cf u Cf a with c Cfc Cf aAfaAfgsCfsg 1029 AD-53661.1 A-110544.1 Af c CfgCf u G f c Gf Cf Cf a Af gGf a U f c CfgUfL96 479 556 A-109243.2 aCfgGfaUfcCfuUfggcGfcAf gCfgGfusGfsg 1030 AD-53663.1 A-110560.1 Uf cGfa Cf u Afc Af UfCfg Afg Gfa Gfg AfcUfL96 480 781 A-109275.2 aGfuCfcUfcCfuCfgauGfuA fgUfcGfasCfsa 1031 AD-53664.1 A-110568.1 GfgUfgGfaGfgUfGfUfaUfcUfcCfu AfgAfL96 481 899 A-109291.2 uCfuAfgGfaGfaUfacaCfcU fcCfaCfcsAfsg 1032 AD-53665.1 A-110576.1 Cf a Cf c AfgCf a UfAfCf a Gf a Gf u Gf a CfcAfL96 482 920 A-109307.2 uGfgUfcAfcUfcUfguaUfgC fuGfgUfgsUfsc 1033 AD-53666.1 A-110584.1 GfgUfcAfuGfgUfCfAfcCfgAfcUfu CfgAfL96 483 959 A-109323.2 uCfgAfaGfuCfgGfugaCfcA fuGfaCfcsCfsu 1034 AD-53708.1 A-110591.1 CfgUfgCfuCfaAfCfUfgCfcAfaGfg GfaAfL96 484 1115 A-109337.2 uUfcCfcUfuGfgCfaguUfgA fgCfaCfgsCfsg 1035 AD-53709.1 A-110599.1 GfgCfcUfgGfaGfUfUfuAfuUfcGfg AfaAfL96 485 1161 A-109353.2 uUfuCfcGfaAfuAfaacUfcC faGfgCfcsUfsa 1036 AD-53710.1 A-110607.1 UfuGfgCfcGfcUfGfUfgUfgGfaCfc UfcUfL96 486 1426 A-109369.2 aGfaGfgUfcCfaCfacaGfcGf gCfcAfasAfsg 1037

- 80 046901

AD-53711.1 A-110615.1 UfgAfgGfcAfgAfGfAfcUfgAfuCfc AfcUfL96 487 1594 A-109385.2 aGfuGfgAfuCfaGfucuCfuG fcCfuCfasAfsc 1038 AD-53712.1 A-110623.1 GfuUfgGfcAfgCfUfGfuUfuUfgCfa GfgAfL96 488 1717 A-109401.2 uCfcUfgCfaAfaAfcagCfuGf cCfaAfcsCfsu 1039 AD-53713.1 A-110631.1 UfuUfuGfgGfgGfUfGfaGfgGfuGf uCfuAfL96 489 1904 A-109417.2 uAfgAfcAfcCfcUfcacCfcCf cAfaAfasGfsc 1040 AD-53667.1 A-110545.1 GfcUfgCfgCfcAfAfGfgAfuCfcGfu GfgAfL96 490 559 A-109245.2 uCfcAfcGfgAfuCfcuuGfgCf gCfaGfcsGfsg 1041 AD-53668.1 A-110553.1 Af u Af cCf uCfa CfCfAfa Gf a Uf cCf u GfcAfL96 491 680 A-109261.2 uGfcAfgGfaUfcUfuggUfgA fgGfuAfusCfsc 1042 AD-53669.1 A-110561.1 AfcUfaCfaUfcGfAfGfgAfgGfaCfu CfcUfL96 492 784 A-109277.2 aGfgAfgUfcCfuCfcucGfaU fgUfaGfusCfsg 1043 AD-53670.1 A-110569.1 UfgGfaGfgUfgUfAfUfcUfcCfuAfg AfcAfL96 493 901 A-109293.2 uGfuCfuAfgGfaGfauaCfaC fcUfcCfasCfsc 1044 AD-53671.1 A-110577.1 Uf a Cf a Gf a Gf u G fAf Cf c Af c CfgGfg AfaAfL96 494 928 A-109309.2 uUfuCfcCfgGfuGfgucAfcU fcUfgUfasUfsg 1045 AD-53672.1 A-110585.1 UfcAfuGfgUfcAfCfCfgAfcUfuCfg AfgAfL96 495 961 A-109325.2 uCfuCfgAfaGfuCfgguGfaC fcAfuGfasCfsc 1046 AD-53714.1 A-110592.1 CfaCfcCfuCfaUfAfGfgCfcUfgGfa GfuUfL96 496 1151 A-109339.2 aAfcUfcCfaGfgCfcuaUfgAf gGfgUfgsCfsc 1047 AD-53715.1 A-110600.1 GfcCfuGfgAfgUfUfUfaUfuCfgGfa AfaAfL96 497 1162 A-109355.2 uUfuUfcCfgAfaUfaaaCfuC fcAfgGfcsCfsu 1048 AD-53716.1 A-110608.1 UfgGfcCfgCfuGfUfGfuGfgAfcCfu CfuUfL96 498 1427 A-109371.2 aAfgAfgGfuCfcAfcacAfgCf gGfcCfasAfsa 1049 AD-53717.1 A-110616.1 Gfa GfgCfa GfaGfAf Cfu Gfa UfcCfa CfuUfL96 499 1595 A-109387.2 aAfgUfgGfaUfcAfgucUfcU fgCfcUfcsAfsa 1050 AD-53718.1 A-110624.1 UfgGfcAfgCfuGfUfUfuUfgCfaGfg AfcUfL96 500 1719 A-109403.2 aGfuCfcUfgCfaAfaacAfgCf uGfcCfasAfsc 1051 AD-53719.1 A-110632.1 GfgGfgUfgAfgGfGfUfgUfcUfaCfg CfcAfL96 501 1909 A-109419.2 uGfgCfgUfaGfaCfaccCfuCf aCfcCfcsCfsa 1052 AD-53674.1 A-110554.1 Cf a Cf c Af a Gf a Uf Cf Cf u Gf c Af u Gf u CfuUfL96 502 686 A-109263.2 aAfgAfcAfuGfcAfggaUfcU fuGfgUfgsAfsg 1053 AD-53675.1 A-110562.1 UfaCfaUfcGfaGfGfAfgGfaCfuCfc UfcUfL96 503 786 A-109279.2 aGfaGfgAfgUfcCfuccUfcG faUfgUfasGfsu 1054 AD-53676.1 A-110570.1 AfgGfuGfuAfuCfUfCfcUfaGfaCfa CfcAfL96 504 904 A-109295.2 uGfgUfgUfcUfaGfgagAfuA fcAfcCfusCfsc 1055 AD-53677.1 A-110578.1 Af c Afg Afg U fg Af Cf Cf a Cf c G fg G f a AfaUfL96 505 929 A-109311.2 aUfuUfcCfcGfgUfgguCfaC fuCfuGfusAfsu 1056 AD-53678.1 A-110586.1 AfgGf a Cfg G fg Af Cf Cf c Gf c Uf u Cf c AfcAfL96 506 994 A-109327.2 uGfuGfgAfaGfcGfgguCfcC fgUfcCfusCfsc 1057 AD-53720.1 A-110593.1 AfcCfcUfcAfuAfGfGfcCfuGfgAfg UfuUfL96 507 1152 A-109341.2 aAfaCfuCfcAfgGfccuAfuGf aGfgGfusGfsc 1058 AD-53721.1 A-110601.1 GfgAfgUfuUfaUfUfCfgGfaAfaAfg CfcAfL96 508 1166 A-109357.2 uGfgCfuUfuUfcCfgaaUfaA faCfuCfcsAfsg 1059

- 81 046901

AD-53722.1 A-110609.1 GfgCfcGfcUfgUfGfUfgGfaCfcUfc UfuUfL96 509 1428 A-109373.2 aAfaGfaGfgUfcCfacaCfaGf cGfgCfcsAfsa 1060 AD-53723.1 A-110617.1 GfgCfaGfaGfaCfUfGfaUfcCfaCfu UfcUfL96 510 1597 A-109389.2 aGfaAfgUfgGfaUfcagUfcU fcUfgCfcsUfsc 1061 AD-53724.1 A-110625.1 GfcAfgCfuGfuUfUfUfgCfaGfgAfc UfgUfL96 511 1721 A-109405.2 aCfaGfuCfcUfgCfaaaAfcAf gCfuGfcsCfsa 1062 AD-53725.1 A-110633.1 GfgGfuGfaGfgGfUfGfuCfuAfcGfc CfaUfL96 512 1910 A-109421.2 aUfgGfcGfuAfgAfcacCfcUf cAfcCfcsCfsc 1063 AD-53679.1 A-110547.1 CfuAfcGfuGfgUfGfGfuGfcUfgAfa GfgAfL96 513 593 A-109249.2 uCfcUfuCfaGfcAfccaCfcAf cGfuAfgsGfsu 1064 AD-53680.1 A-110555.1 CfaAfgAfuCfcUfGfCfaUfgUfcUfu CfcAfL96 514 689 A-109265.2 uGfgAfaGfaCfaUfgcaGfgA fuCfuUfgsGfsu 1065 AD-53681.1 A-110563.1 Uf cGfa GfgAfgGfAf CfuCfc Ufc Ufg UfcUfL96 515 790 A-109281.2 aGfaCfaGfaGfgAfgucCfuC fcUfcGfasUfsg 1066 AD-53682.1 A-110571.1 Gf u Af u Cf u Cf c U fAf G fa Cfa Cf c Afg CfaUfL96 516 908 A-109297.2 aUfgCfuGfgUfgUfcuaGfgA fgAfuAfcsAfsc 1067 AD-53683.1 A-110579.1 GfaGfuGfaCfcAfCfCfgGfgAfaAfu CfgAfL96 517 932 A-109313.2 uCfgAfuUfuCfcCfgguGfgU fcAfcUfcsUfsg 1068 AD-53684.1 A-110587.1 CfgGfgAfcCfcGfCfUfuCfcAfcAfgA fcAfL96 518 998 A-109329.2 uGfuCfuGfuGfgAfagcGfg GfuCfcCfgsUfsc 1069 AD-53726.1 A-110594.1 CfcCfuCfaUfaGfGfCfcUfgGfaGfu UfuAfL96 519 1153 A-109343.2 uAfaAfcUfcCfaGfgccUfaUf gAfgGfgsUfsg 1070 AD-53727.1 A-110602.1 GfuUfuAfuUfcGfGfAfaAfaGfcCfa GfcUfL96 520 1169 A-109359.2 aGfcUfgGfcUfuUfuccGfaA fuAfaAfcsUfsc 1071 AD-53728.1 A-110610.1 UfgUfgUfgGfaCfCfUfcUfuUfgCfc CfcAfL96 521 1434 A-109375.2 uGfgGfgCfaAfaGfaggUfcC faCfaCfasGfsc 1072 AD-53729.1 A-110618.1 Cf a Gf a Gf a Cf u Gf Af U f cCf a Cf u Uf c UfcUfL96 522 1599 A-109391.2 aGfaGfaAfgUfgGfaucAfgU fcUfcUfgsCfsc 1073 AD-53730.1 A-110626.1 UfcUfgCfcGfgGfCfCfcAfcAfaCfgC fuUfL96 523 1885 A-109407.2 aAfgCfgUfuGfuGfggcCfcG fgCfaGfasCfsc 1074 AD-53731.1 A-110634.1 GfgUfgAfgGfgUfGfUfcUfaCfgCfc AfuUfL96 524 1911 A-109423.2 aAfuGfgCfgUfaGfacaCfcCf uCfaCfcsCfsc 1075 AD-53685.1 A-110548.1 CfcCfgCfcGfgGfGfAfuAfcCfuCfaC fcAfL96 525 670 A-109251.2 uGfgUfgAfgGfuAfuccCfcG fgCfgGfgsCfsa 1076 AD-53687.1 A-110564.1 CfgAfgGfaGfgAfCfUfcCfuCfuGfu CfuUfL96 526 791 A-109283.2 aAfgAfcAfgAfgGfaguCfcUf cCfuCfgsAfsu 1077 AD-53688.1 A-110572.1 UfaUfcUfcCfuAfGfAfcAfcCfaGfc AfuAfL96 527 909 A-109299.2 uAfuGfcUfgGfuGfucuAfg GfaGfaUfasCfsa 1078 AD-53689.1 A-110580.1 GfgAfaAfuCfgAfGfGfgCfaGfgGfu CfaUfL96 528 944 A-109315.2 aUfgAfcCfcUfgCfccuCfgAf uUfuCfcsCfsg 1079 AD-53690.1 A-110588.1 UfcCfaCfaGfaCfAfGfgCfcAfgCfaA fgUfL96 529 1009 A-109331.2 aCfuUfgCfuGfgCfcugUfcU fgUfgGfasAfsg 1080 AD-53732.1 A-110595.1 CfcUfcAfuAfgGfCfCfuGfgAfgUfu UfaUfL96 530 1154 A-109345.2 aUfaAfaCfuCfcAfggcCfuAf uGfaGfgsGfsu 1081

- 82 046901

AD-53733.1 A-110603.1 GfgGfcUfgGfgGfUfCfgUfgCfuGfg UfcAfL96 531 1279 A-109361.2 uGfa Cfc AfgCfa Cfga cCf cCf aGfcCfcsUfsc 1082 AD-53734.1 A-110611.1 GfgGfaGfgAfcAfUfCfaUfuGfgUfg CfcUfL96 532 1456 A-109377.2 a GfgCf a Cf c Af a U fga u Gf u C fcUfcCfcsCfsu 1083 AD-53735.1 A-110619.1 Af c U fgAfu Cf c Af Cf U f u Cf uCf u Gf c CfaAfL96 533 1604 A-109393.2 uUfgGfcAfgAfgAfaguGfgA fuCfaGfusCfsu 1084 AD-53736.1 A-110627.1 CfuGfcCfgGfgCfCfCfaCfaAfcGfcU fuUfL96 534 1886 A-109409.2 aAfaGfcGfuUfgUfgggCfcC fgGfcAfgsAfsc 1085 AD-53737.1 A-110635.1 AfgGfgUfgUfcUfAfCfgCfcAfuUfg CfcAfL96 535 1915 A-109425.2 uGfgCfaAfuGfgCfguaGfaC faCfcCfusCfsa 1086 AD-53691.1 A-110549.1 CfcGfcCfgGfgGfAfUfaCfcUfcAfcC faAfL96 536 671 A-109253.2 uUfgGfuGfaGfgUfaucCfcC fgGfcGfgsGfsc 1087 AD-53692.1 A-110557.1 GfuUfgCfcCfcAfUfGfuCfgAfcUfa CfaUfL96 537 770 A-109269.2 aUfgUfaGfuCfgAfcauGfgG fgCfaAfcsUfsu 1088 AD-53693.1 A-110565.1 GfuAfcCfgGfgCfGfGfa UfgAfa Ufa CfcAfL96 538 857 A-109285.2 uGfgUfaUfuCfaUfccgCfcCf gGfuAfcsCfsg 1089 AD-53694.1 A-110573.1 UfcUfcCfuAfgAfCfAfcCfaGfcAfu AfcAfL96 539 911 A-109301.2 uGfuAfuGfcUfgGfuguCfu AfgGfaGfasUfsa 1090 AD-53695.1 A-110581.1 AfaUfcGfaGfgGfCfAfgGfgUfcAfu GfgUfL96 540 947 A-109317.2 aCfcAfuGfaCfcCfugcCfcUf cGfaUfusUfsc 1091 AD-53738.1 A-110596.1 CfuCfaUfaGfgCfCfUfgGfaGfuUfu AfuUfL96 541 1155 A-109347.2 a Af u Afa Afc Uf cCfaggCfc Uf aUfgAfgsGfsg 1092 AD-53739.1 A-110604.1 GfgUfcAfcCfgCfUfGfcCfgGfcAfa CfuUfL96 542 1295 A-109363.2 aAfgUfuGfcCfgGfcagCfgG fuGfaCfcsAfsg 1093 AD-53740.1 A-110612.1 Afc UfgCfa Gfc AfCfCf uGf c Uf u Ufg UfgUfL96 543 1483 A-109379.2 aCfaCfaAfaGfcAfgguGfcUf gCfaGfusCfsg 1094 AD-53741.1 A-110620.1 AfuCfcAfcUfuCfUfCfuGfcCfaAfa GfaUfL96 544 1608 A-109395.2 aUfcUfuUfgGfcAfgagAfaG fuGfgAfusCfsa 1095 AD-53742.1 A-110628.1 GfcCfcAfcAfaCfGfCfuUfuUfgGfg GfgUfL96 545 1893 A-109411.2 a Cfc Cfc Cf a Afa Afg eg Uf u Gf uGfgGfcsCfsc 1096 AD-53743.1 A-110636.1 GfuGfuCfuAfcGfCfCfaUfuGfcCfa GfgUfL96 546 1918 A-109427.2 aCfcUfgGfcAfaUfggcGfuA fgAfcAfcsCfsc 1097 AD-53744.1 A-110644.1 G fgAf a U fgCf a Af Af G f u Cf a Af gGf a GfcAfL96 547 2180 A-109443.2 uGfcUfcCfuUfgAfcuuUfgC faUfuCfcsAfsg 1098 AD-53745.1 A-110652.1 UfgAfuGfgCfcCfUfCfaUfcUfcCfa GfcUfL96 548 2906 A-109459.2 aGfcUfgGfaGfaUfgagGfgC fcAfuCfasGfsc 1099 AD-53746.1 A-110660.1 CfuGfaAfgCfcAfAfGfcCfuCfuUfc UfuAfL96 549 3300 A-109475.2 uAfaGfaAfgAfgGfcuuGfgC fuUfcAfgsAfsg 1100 AD-53747.1 A-110668.1 Afc U fgU f c Cf c Uf Cf Cf u U fg AfgCf a CfcAfL96 550 3511 A-109491.2 uGfgUfgCfuCfaAfggaGfgG faCfaGfusUfsg 1101 AD-53748.1 A-110676.1 Cf a Afg Cf a AfgCfAf G f a Cf a U f u U f a UfcUfL96 551 3540 A-109507.2 aGfaUfaAfaUfgUfcugCfuU fgCfuUfgsGfsg 1102 AD-53790.1 A-110683.1 UfaUfcUfuUfuGfGfGfuCfuGfuCf cUfcUfL96 552 3556 A-109521.2 a Gf a G fgAfc Af g Af c cc Af a Af aGfaUfasAfsa 1103

- 83 046901

AD-53791.1 A-110691.1 UfgUfcCfuCfuCf UfGfuUfgCfc Ufu UfuUfL96 553 3569 A-109537.2 a Afa Afa GfgCf a Af c a gAf g Af gGfaCfasGfsa 1104 AD-53792.1 A-110699.1 Uf uGf u Af a Cf u UfGfAfa Gfa Ufa Uf uUfaUfL96 554 3620 A-109553.2 aUfaAfaUfaUfcUfucaAfgU fuAfcAfasAfsa 1105 AD-53793.1 A-110707.1 CfuUfuAfcUfcUfGfCfuCfuAfuGfc CfaAfL96 555 3055 A-109569.2 uUfgGfcAfuAfgAfgcaGfaG fuAfaAfgsGfsu 1106 AD-53794.1 A-110715.1 Afg G fg G f a Af c Af CfAfg Af c Cfa G fg AfaAfL96 556 3370 A-109585.2 uUfuCfcUfgGfuCfuguGfu UfcCfcCfusUfsc 1107 AD-53795.1 A-110723.1 UfuGfgGfuCfuGfUfCfcUfcUfcUfg UfuUfL96 557 3562 A-109601.2 aAfaCfaGfaGfaGfgacAfgA fcCfcAfasAfsa 1108 AD-53749.1 A-110637.1 UfgCfaGfcGfuCfCfAfcAfcAfgCfu CfcAfL96 558 1962 A-109429.2 uGfgAfgCfuGfuGfuggAfcG fcUfgCfasGfsu 1109 AD-53750.1 A-110645.1 Afa UfcCfcGfgCfCfCfcUfcAfgGfa GfcAfL96 559 2204 A-109445.2 uGfcUfcCfuGfaGfgggCfcG fgGfaUfusCfsc 1110 AD-53751.1 A-110653.1 UfuUfcUfgGfaUfGfGfcAfuCfuAfg CfcAfL96 560 2974 A-109461.2 uGfgCfuAfgAfuGfccaUfcC faGfaAfasGfsc 1111 AD-53752.1 A-110661.1 GfaAfgCfcAfaGfCfCfuCfuUfcUfu AfcUfL96 561 3302 A-109477.2 aGfuAfaGfaAfgAfggcUfuG fgCfuUfcsAfsg 1112 AD-53753.1 A-110669.1 CfcAfgCfcCfcAfCfCfcAfaGfcAfaG fcAfL96 562 3529 A-109493.2 uGfcUfuGfcUfuGfgguGfg GfgCfuGfgsUfsg 1113 AD-53754.1 A-110677.1 AfaGfcAfaGfcAfGfAfcAfuUfuAfu CfuUfL96 563 3541 A-109509.2 aAfgAfuAfaAfuGfucuGfcU fuGfcUfusGfsg 1114 AD-53796.1 A-110684.1 UfcUfuUfuGfgGfUfCfuGfuCfcUfc UfcUfL96 564 3558 A-109523.2 aGfaGfaGfgAfcAfgacCfcAf aAfaGfasUfsa 1115 AD-53797.1 A-110692.1 GfuCfcUfcUfcUfGfUfuGfcCfuUfu UfuAfL96 565 3570 A-109539.2 u Af a Af a Afg Gf c Af a c a G f a G faGfgAfcsAfsg 1116 AD-53798.1 A-110700.1 UfgUfaAfcUfuGfAfAfgAfuAfuUfu AfuUfL96 566 3621 A-109555.2 aAfuAfaAfuAfuCfuucAfaG fuUfaCfasAfsa 1117 AD-53799.1 A-110708.1 UfuUfaCfuCfuGfCfUfcUfaUfgCfc AfgAfL96 567 3056 A-109571.2 uCfuGfgCfaUfaGfagcAfgA fgUfaAfasGfsg 1118 AD-53800.1 A-110716.1 Cf c Afa Gfc Af a GfCfAfgAfc Af u Uf u AfuUfL96 568 3539 A-109587.2 aAfuAfaAfuGfuCfugcUfuG fcUfuGfgsGfsu 1119 AD-53801.1 A-110724.1 UfgGfgUfcUfgUfCfCfuCfuCfuGfu UfgAfL96 569 3563 A-109603.2 uCfaAfcAfgAfgAfggaCfaGf aCfcCfasAfsa 1120 AD-53755.1 A-110638.1 GfcAfuGfgGfgAfCfCfcGfuGfuCfc AfcUfL96 570 1996 A-109431.2 a Gf u Gfg Af c Af c Gf gg u Cf c Cf cAfuGfcsUfsg 1121 AD-53757.1 A-110654.1 UfcUfgGfaUfgGfCfAfuCfuAfgCfc AfgAfL96 571 2976 A-109463.2 uCfuGfgCfuAfgAfugcCfaU fcCfaGfasAfsa 1122 AD-53758.1 A-110662.1 AfaGfcCfaAfgCfCfUfcUfuCfuUfa CfuUfL96 572 3303 A-109479.2 aAfgUfaAfgAfaGfaggCfuU fgGfcUfusCfsa 1123 AD-53759.1 A-110670.1 CfcCfcAfcCfcAfAfGfcAfaGfcAfgA fcAfL96 573 3533 A-109495.2 uGfuCfuGfcUfuGfcuuGfg GfuGfgGfgsCfsu 1124 AD-53760.1 A-110678.1 AfgCfa AfgCfaGfAfCfa Uf uUfa Ufc UfuUfL96 574 3542 A-109511.2 aAfaGfaUfaAfaUfgucUfgC fuUfgCfusUfsg 1125

- 84 046901

AD-53802.1 A-110685.1 UfuUfuGfgGfuCfUfGfuCfcUfcUfc UfgUfL96 575 3560 A-109525.2 aCfaGfaGfaGfgAfcagAfcCf cAfaAfasGfsa 1126 AD-53803.1 A-110693.1 UfuUfcUfaGfaCfCfUfgUfuUfuGfc UfuUfL96 576 3600 A-109541.2 aAfaGfcAfaAfaCfaggUfcUf aGfaAfasAfsg 1127 AD-53804.1 A-110701.1 AfcCfa AfgGfa Gf GfCfa GfgAf u Ufc UfuUfL96 577 2815 A-109557.2 aAfaGfaAfuCfcUfgccUfcCf uUfgGfusGfsg 1128 AD-53805.1 A-110709.1 UfcAfgCfcAfaCfCfCfgCfuCfcAfcU faAfL96 578 3161 A-109573.2 uUfaGfuGfgAfgCfgggUfu GfgCfuGfasGfsa 1129 AD-53806.1 A-110717.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 579 3544 A-109589.2 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1130 AD-53807.1 A-110725.1 GfgGfuCfuGfuCfCfUfcUfcUfgUfu GfcAfL96 580 3564 A-109605.2 uGfcAfaCfaGfaGfaggAfcA fgAfcCfcsAfsa 1131 AD-53761.1 A-110639.1 Cf c Cf a Cf a AfgCf Cf G f c Cf u Gf u Gf c UfgAfL96 581 2080 A-109433.2 uCfaGfcAfcAfgGfcggCfuUf gUfgGfgsUfsg 1132 AD-53762.1 A-110647.1 GfcUfgGfgGfcUfGfAfgCfuUfuAfa AfaUfL96 582 2481 A-109449.2 aUfuUfuAfaAfgCfucaGfcC fcCfaGfcsCfsc 1133 AD-53763.1 A-110655.1 GfcUfcUfaUfgCfCfAfgGfcUfgUfg CfuAfL96 583 3064 A-109465.2 uAfgCfaCfaGfcCfuggCfaUf aGfaGfcsAfsg 1134 AD-53764.1 A-110663.1 GfuGfaGfgCfuGfGfGfaAfgGfgGf aAfcAfL96 584 3358 A-109481.2 uGfuUfcCfcCfuUfcccAfgCf cUfcAfcsUfsg 1135 AD-53765.1 A-110671.1 CfcCfaCfcCfaAfGfCfaAfgCfaGfaC faUfL96 585 3534 A-109497.2 a UfgUfc UfgCf u Ufgc u UfgG fgUfgGfgsGfsc 1136 AD-53766.1 A-110679.1 GfcAfgAfcAfuUfUfAfuCfuUfuUfg GfgUfL96 586 3547 A-109513.2 a Cf c Cfa Afa Afg Af u a a Af u Gf uCfuGfcsUfsu 1137 AD-53808.1 A-110686.1 UfuUfgGfgUfcUfGfUfcCfuCfuCfu GfuUfL96 587 3561 A-109527.2 aAfcAfgAfgAfgGfacaGfaCf cCfaAfasAfsg 1138 AD-53809.1 A-110694.1 UfuCfuAfgAfcCfUfGfuUfuUfgCfu UfuUfL96 588 3601 A-109543.2 aAfaAfgCfaAfaAfcagGfuCf uAfgAfasAfsa 1139 AD-53810.1 A-110702.1 GfgAfgGfcAfgGfAfUfuCfuUfcCfc AfuUfL96 589 2820 A-109559.2 aAfuGfgGfaAfgAfaucCfuG fcCfuCfcsUfsu 1140 AD-53811.1 A-110710.1 Cf c UfgCfc Afa GfCf Ufc Af cAfc AfgC faAfL96 590 3247 A-109575.2 uUfgCfuGfuGfuGfagcUfu GfgCfaGfgsCfsa 1141 AD-53812.1 A-110718.1 AfaGfcAfgAfcAfUfUfuAfuCfuUfu UfgAfL96 591 3545 A-109591.2 uCfaAfaAfgAfuAfauGfuC fuGfcUfusGfsc 1142 AD-53813.1 A-110726.1 UfcUfaGfaCfcUfGfUfuUfuGfcUf uUfuUfL96 592 3602 A-109607.2 a Afa Afa Gf c Af a Af a ca Gfg U fcUfaGfasAfsa 1143 AD-53767.1 A-110640.1 GfaGfgCfcAfcGfAfGfgUfcAfgCfc CfaAfL96 593 2099 A-109435.2 uUfgGfgCfuGfaCfcucGfuG fgCfcUfcsAfsg 1144 AD-53768.1 A-110648.1 Gfg AfgGf u Gf c CfAf G fg Af a Gf c Uf c CfcUfL96 594 2650 A-109451.2 aGfgGfaGfcUfuCfcugGfcA fcCfuCfcsAfsc 1145 AD-53769.1 A-110656.1 CfuCfaGfcCfaAfCfCfcGfcUfcCfaC fuAfL96 595 3160 A-109467.2 uAfgUfgGfaGfcGfgguUfg GfcUfgAfgsAfsc 1146 AD-53770.1 A-110664.1 GfgCfuGfgGfaAfGfGfgGfaAfcAfc AfgAfL96 596 3362 A-109483.2 uCfuGfuGfuUfcCfccuUfcC fcAfgCfcsUfsc 1147

- 85 046901

AD-53771.1 A-110672.1 CfcAfcCfcAfaGfCfAfaGfcAfgAfcA fuUfL96 597 3535 A-109499.2 aAfuGfuCfuGfcUfugcUfu GfgGfuGfgsGfsg 1148 AD-53772.1 A-110680.1 AfgAfcAfuUfuAfUfCfuUfuUfgGfg UfcUfL96 598 3549 A-109515.2 aGfaCfcCfaAfaAfgauAfaAf uGfuCfusGfsc 1149 AD-53814.1 A-110687.1 GfgUfcUfgUfcCfUfCfuCfuGfuUfg CfcUfL96 599 3565 A-109529.2 aGfgCfaAfcAfgAfgagGfaCf aGfaCfcsCfsa 1150 AD-53815.1 A-110695.1 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u UfgUfL96 600 3603 A-109545.2 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1151 AD-53816.1 A-110703.1 GfaGfgCfaGfgAfUfUfcUfuCfcCfa UfgAfL96 601 2821 A-109561.2 uCfaUfgGfgAfaGfauCfcU fgCfcUfcsCfsu 1152 AD-53817.1 A-110711.1 Cf c Afa Gfc Uf cAfCfAfc AfgCfaGfg A faAfL96 602 3251 A-109577.2 uUfuCfcUfgCfuGfuguGfa GfcUfuGfgsCfsa 1153 AD-53818.1 A-110719.1 AfgCfaGfaCfaUfUfUfaUfcUfuUfu GfgAfL96 603 3546 A-109593.2 uCfcAfaAfaGfaUfaaaUfgU fcUfgCfusUfsg 1154 AD-53819.1 A-110727.1 Gf u Af a Cf u U fg AfAf Gf a U f a U f u U f aUfuUfL96 604 3622 A-109609.2 aAfaUfaAfaUfaUfcuuCfaA fgUfuAfcsAfsa 1155 AD-53773.1 A-110641.1 CfaCfgAfgGfuCfAfGfcCfcAfaCfcA fgUfL96 605 2104 A-109437.2 aCfuGfgUfuGfgGfcugAfcC fuCfgUfgsGfsc 1156 AD-53774.1 A-110649.1 Af c U fgU fgGfgGf Cf Af u U f u Cfa Cf c AfuUfL96 606 2676 A-109453.2 aAfuGfgUfgAfaAfugcCfcCf aCfaGfusGfsa 1157 AD-53776.1 A-110665.1 GfaAfgGfgGfaAfCfAfcAfgAfcCfa GfgAfL96 607 3368 A-109485.2 uCfcUfgGfuCfuGfuguUfcC fcCfuUfcsCfsc 1158 AD-53777.1 A-110673.1 CfaCfcCfaAfgCfAfAfgCfaGfaCfaU fuUfL96 608 3536 A-109501.2 aAfaUfgUfcUfgCfuugCfuU fgGfgUfgsGfsg 1159 AD-53778.1 A-110681.1 AfcAfuUfuAfuCfUfUfuUfgGfgUfc UfgUfL96 609 3551 A-109517.2 aCfaGfaCfcCfaAfaagAfuAf aAfuGfusCfsu 1160 AD-53820.1 A-110688.1 GfuCfuGfuCfcUfCfUfcUfgUfuGfc CfuUfL96 610 3566 A-109531.2 aAfgGfcAfaCfaGfagaGfgA fcAfgAfcsCfsc 1161 AD-53821.1 A-110696.1 UfaGfaCfcUfgUfUfUfuGfcUfuUf uGfuAfL96 611 3604 A-109547.2 u Afc Afa Afa Gfc Afa a a Cfa Gf gUfcUfasGfsa 1162 AD-53822.1 A-110704.1 Cf u Uf u Cf u Gfg Af U f Gfg Cf a U f c Uf a GfcAfL96 612 2973 A-109563.2 uGfcUfaGfaUfgCfcauCfcA fgAfaAfgsCfsu 1163 AD-53823.1 A-110712.1 Afa Gfc Ufc Afc Af CfAfgCfa GfgAfa CfuUfL96 613 3253 A-109579.2 aAfgUfuCfcUfgCfuguGfuG faGfcUfusGfsg 1164 AD-53824.1 A-110720.1 GfaCfaUfuUfaUfCfUfuUfuGfgGf uCfuUfL96 614 3550 A-109595.2 aAfgAfcCfcAfaAfagaUfaAf aUfgUfcsUfsg 1165 AD-48400.4 A-98247.3 UfuUfuCfuAfgAfcCfuGfuUfuUfg CfuUfL96 615 A-93455.5 aAfgCfaAfaAfcAfgGfuCfu AfgAfaAfasGfsu 1166 AD-53779.1 A-110642.1 GfgGf a G fgCf c Af G f Cf a U f cCf a Cfg CfuUfL96 616 2137 A-109439.2 aAfgCfgUfgGfaUfgcuGfgC fcUfcCfcsUfsg 1167 AD-53780.1 A-110650.1 CfcAfcCfaAfgGfAfGfgCfaGfgAfu UfcUfL96 617 2813 A-109455.2 aGfaAfuCfcUfgCfcucCfuUf gGfuGfgsAfsg 1168 AD-53781.1 A-110658.1 GfcCfaAfgCfuCfAfCfaCfaGfcAfg GfaAfL96 618 3250 A-109471.2 uUfcCfuGfcUfgUfgugAfgC fuUfgGfcsAfsg 1169

- 86 046901

AD-53782.1 A-110666.1 Afa Gf gGfg Af a CfAf Cfa G fa Cf c Afg GfaAfL96 619 3369 A-109487.2 uUfcCfuGfgUfcUfgugUfuC fcCfcUfusCfsc 1170 AD-53783.1 A-110674.1 AfcCfcAfaGfcAfAfGfcAfgAfcAfu UfuAfL96 620 3537 A-109503.2 uAfaAfuGfuCfuGfcuuGfc UfuGfgGfusGfsg 1171 AD-53784.1 A-110682.1 UfuUfaUfcUfuUfUfGfgGfuCfuGf uCfcUfL96 621 3554 A-109519.2 a G fg Af c Afg Af c Cfc a a Afa Gf aUfaAfasUfsg 1172 AD-53825.1 A-110689.1 UfcUfgUfcCfuCfUfCfuGfuUfgCfc UfuUfL96 622 3567 A-109533.2 aAfaGfgCfaAfcAfgagAfgGf aCfaGfasCfsc 1173 AD-53826.1 A-110697.1 UfuUfuGfuAfaCfUfUfgAfaGfaUf aUfuUfL96 623 3618 A-109549.2 aAfaUfaUfcUfuCfaagUfuA fcAfaAfasGfsc 1174 AD-53827.1 A-110705.1 UfuCfuGfgAfuGfGfCfaUfcUfaGfc CfaAfL96 624 2975 A-109565.2 uUfgGfcUfaGfaUfgccAfuC fcAfgAfasAfsg 1175 AD-53828.1 A-110713.1 UfgAfaGfcCfaAfGfCfcUfcUfuCfu UfaAfL96 625 3301 A-109581.2 uUfaAfgAfaGfaGfgcuUfgG fcUfuCfasGfsa 1176 AD-53829.1 A-110721.1 UfuAfuCfuUfuUfGfGfgUfcUfgUf cCfuUfL96 626 3555 A-109597.2 aAfgGfaCfaGfaCfccaAfaAf gAfuAfasAfsu 1177 AD-53830.1 A-110872.1 UfuUfuCfuAfgAfCfCfuGfuUfuUf gCfuUfL96 627 A-110873.1 aAfgCfaAfaAfcAfgguCfuAf gAfaAfasGfsu 1178 AD-53785.1 A-110643.1 Af u Cf c Af c Gf c Uf Uf Cfc U fgCf u Gfc CfaUfL96 628 2148 A-109441.2 aUfgGfcAfgCfaGfgaaGfcG fuGfgAfusGfsc 1179 AD-53786.1 A-110651.1 Cfa CfcAfaGfgAfGfGfc AfgGf a Uf u CfuUfL96 629 2814 A-109457.2 aAfgAfaUfcCfuGfccuCfcUf uGfgUfgsGfsa 1180 AD-53787.1 A-110659.1 CfaAfgCfuCfaCfAfCfaGfcAfgGfa AfcUfL96 630 3252 A-109473.2 aGfuUfcCfuGfcUfgugUfgA fgCfuUfgsGfsc 1181 AD-53788.1 A-110667.1 GfgGfaAfcAfcAfGfAfcCfaGfgAfa GfcUfL96 631 3372 A-109489.2 aGfcUfuCfcUfgGfucuGfuG fuUfcCfcsCfsu 1182 AD-53789.1 A-110675.1 CfcCfaAfgCfaAfGfCfaGfaCfaUfu UfaUfL96 632 3538 A-109505.2 aUfaAfaUfgUfcUfgcuUfgC fuUfgGfgsUfsg 1183 AD-53831.1 A-110690.1 CfuGfuCfcUfcUfCfUfgUfuGfcCfu UfuUfL96 633 3568 A-109535.2 aAfaAfgGfcAfaCfagaGfaG fgAfcAfgsAfsc 1184 AD-53832.1 A-110698.1 UfuUfgUfaAfcUfUfGfaAfgAfuAf uUfuAfL96 634 3619 A-109551.2 uAfaAfuAfuCfuUfcaaGfuU faCfaAfasAfsg 1185 AD-53833.1 A-110706.1 Cf u Gf g Af u G fgCfAf U f c U f a G f c Cfa GfaAfL96 635 2977 A-109567.2 uUfcUfgGfcUfaGfaugCfcA fuCfcAfgsAfsa 1186 AD-53834.1 A-110714.1 AfgUfgAfgGfcUfGfGfgAfaGfgGfg AfaAfL96 636 3357 A-109583.2 uUfuCfcCfcUfuCfccaGfcCf uCfaCfusGfsu 1187 AD-53835.1 A-110722.1 AfuCfuUfuUfgGfGfUfcUfgUfcCfu CfuUfL96 637 3557 A-109599.2 aAfgAfgGfaCfaGfaccCfaAf aAfgAfusAfsa 1188 AD-48399.1 A-100981.1 CfaCfuUfaCfgCfuGfaGfuAfcUfuC fgAfL96 638 A-100982.1 uCfgAfaGfuAfcUfcAfgCfg UfaAfgUfgsAfsu 1189 AD-53815.5 A-110695.11 CfuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 639 3603 A-109545.18 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1190 AD-53815.4 A-110695.4 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u UfgUfL96 640 3603 A-109545.5 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1191

- 87 046901

AD-56633.1 A-115520.2 CuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 641 3603 A-109545.6 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1192 AD-56617.1 A-115535.1 CfuagAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 642 3603 A-109545.7 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1193 AD-56623.1 A-115536.1 CfuagAfcCfuGfUfUfuUfgcuUfuU fguL96 643 3603 A-109545.8 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1194 AD-56629.1 A-115537.1 CfuagAfccuGfUfUfuUfgcuUfuUf guL96 644 3603 A-109545.9 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1195 AD-56635.1 A-115538.1 CfuagAfccuGfUfUfuugcuUfuugu L96 645 3603 A-109545.10 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1196 AD-56641.1 A-115539.1 CfuagaccuGfUfUfuugcuuuuguL9 6 646 3603 A-109545.11 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1197 AD-56625.1 A-115542.1 CfuAfGfAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 647 3603 A-109545.12 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1198 AD-56631.1 A-115543.1 CfuAfGfAfcCfuGfUfUfuUfGfCfu UfuUfgUfL96 648 3603 A-109545.13 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1199 AD-56637.1 A-115544.1 CfuAfGfAfcCfuGfUfUfuUfGfCfu UfUfUfgUfL96 649 3603 A-109545.14 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1200 AD-56643.1 A-115545.1 Cf u AfGfAfCfCf u Gf Uf Uf u UfGfCf u UfUfUfGfUfL96 650 3603 A-109545.15 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1201 AD-56649.1 A-115546.1 CfUfAfGfAfCfCfuGfUfUfuUfGfCf UfUfUfUfGfUfL96 651 3603 A-109545.16 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1202 AD-56655.1 A-115547.1 CfUfAfGfAfCfCfUfGfUfUfUfUfGf CfUfUfUfUfGfUfL96 652 3603 A-109545.17 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1203 AD-56615.1 A-110695.5 CfuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 653 3603 A-115519.1 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfsa 1204 AD-56621.1 A-115520.1 CuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 654 3603 A-115519.2 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfsa 1205 AD-56627.1 A-115521.1 c u AfgAfcCf uGf Uf Uf u ugCf u Uf u u gUfL96 655 3603 A-115519.3 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfsa 1206 AD-56639.1 A-115520.3 CuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 656 3603 A-115522.1 ACfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1207 AD-56645.1 A-110695.6 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u UfgUfL96 657 3603 A-115522.2 ACfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsa 1208 AD-56651.1 A-115523.1 (iC)uAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 658 3603 A-115524.1 (iA)CfaAfaAfgCfaAfaacAfg GfuCfuAfgsAfs(iA) 1209 AD-56610.1 A-115523.2 (iC)uAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 659 3603 A-115525.1 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfs(iA) 1210 AD-56616.1 A-115523.3 (iC)uAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 660 3603 A-115526.1 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfs(iA) 1211 AD-56622.1 A-115527.1 (iC)uAfgAfcCfuGfUfUfuUfgCfuUf uugUfL96 661 3603 A-115526.2 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfs(iA) 1212 AD-56628.1 A-115527.2 (iC)uAfgAfcCfuGfUfUfuUfgCfuUf uugUfL96 662 3603 A-115528.1 (iA)caAfaAfgcaAfaacAfgGf uCfuAfgsAfs(iA) 1213

- 88 046901

AD-56634.1 A-115529.1 CbuAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 663 3603 A-115530.1 AbCf a Afa AfgCf a Afa a c Afg GfuCfuAfgsAfsAb 1214 AD-56640.1 A-115529.2 CbuAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 664 3603 A-115531.1 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsAfsAb 1215 AD-56646.1 A-115529.3 CbuAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 665 3603 A-115532.1 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfsAb 1216 AD-56652.1 A-115533.1 CbuAfgAfcCfuGfUfUfuUfgCfuUf uugUfL96 666 3603 A-115532.2 acaAfaAfgcaAfaacAfgGfu CfuAfgsAfsAb 1217 AD-56611.1 A-115533.2 CbuAfgAfcCfuGfUfUfuUfgCfuUf uugUfL96 667 3603 A-115534.1 (iA)caAfaAfgcaAfaacAfgGf uCfuAfgsAfsAb 1218 AD-56647.1 A-110695.7 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u UfgUfL96 668 3603 A-115540.1 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsasa 1219 AD-56653.1 A-115535.2 CfuagAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 669 3603 A-115540.2 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsasa 1220 AD-56612.1 A-115536.2 CfuagAfcCfuGfUfUfuUfgcuUfuU fguL96 670 3603 A-115540.3 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsasa 1221 AD-56618.1 A-115537.2 CfuagAfccuGfUfUfuUfgcuUfuUf guL96 671 3603 A-115540.4 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsasa 1222 AD-56624.1 A-115538.2 CfuagAfccuGfUfUfuugcuUfuugu L96 672 3603 A-115540.5 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsasa 1223 AD-56630.1 A-115539.2 CfuagaccuGfUfUfuugcuuuuguL9 6 673 3603 A-115540.6 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsasa 1224 AD-56636.1 A-110695.8 CfuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 674 3603 A-115541.1 aCfaaaAfgCfaAfaacAfggu CfuAfgsasa 1225 AD-56642.1 A-115535.3 CfuagAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 675 3603 A-115541.2 aCfaaaAfgCfaAfaacAfggu CfuAfgsasa 1226 AD-56648.1 A-115536.3 CfuagAfcCfuGfUfUfuUfgcuUfuU fguL96 676 3603 A-115541.3 aCfaaaAfgCfaAfaacAfggu CfuAfgsasa 1227 AD-56654.1 A-115537.3 CfuagAfccuGfUfUfuUfgcuUfuUf guL96 677 3603 A-115541.4 aCfaaaAfgCfaAfaacAfggu CfuAfgsasa 1228 AD-56613.1 A-115538.3 CfuagAfccuGfUfUfuugcuUfuugu L96 678 3603 A-115541.5 aCfaaaAfgCfaAfaacAfggu CfuAfgsasa 1229 AD-56619.1 A-115539.3 CfuagaccuGfUfUfuugcuuuuguL9 6 679 3603 A-115541.6 aCfaaaAfgCfaAfaacAfggu CfuAfgsasa 1230 AD-56614.1 A-110695.9 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u UfgUfL96 680 3603 A-115548.1 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1231 AD-56620.1 A-115542.2 CfuAfGfAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 681 3603 A-115548.2 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1232 AD-56626.1 A-115543.2 CfuAfGfAfcCfuGfUfUfuUfGfCfu UfuUfgUfL96 682 3603 A-115548.3 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1233 AD-56632.1 A-115544.2 CfuAfGfAfcCfuGfUfUfuUfGfCfu UfUfUfgUfL96 683 3603 A-115548.4 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1234 AD-56638.1 A-115545.2 Cf u AfGfAfCfCf u Gf Uf Uf u UfGfCf u UfUfUfGfUfL96 684 3603 A-115548.5 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1235

- 89 046901

AD-56644.1 A-115546.2 CfUfAfGfAfCfCfuGfUfUfuUfGfCf UfUfUfUfGfUfL96 685 3603 A-115548.6 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1236 AD-56650.1 A-115547.2 CfUfAfGfAfCfCfUfGfUfUfUfUfGf CfUfUfUfUfGfUfL96 686 3603 A-115548.7 aCfaAfAfAfgCfaAfaacAfgG fUfCfuAfgsAfsa 1237 AD-56656.1 A-110695.10 CfuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 687 3603 A-115549.1 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1238 AD-56662.1 A-115542.3 CfuAfGfAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 688 3603 A-115549.2 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1239 AD-56668.1 A-115543.3 CfuAfGfAfcCfuGfUfUfuUfGfCfu UfuUfgUfL96 689 3603 A-115549.3 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1240 AD-56673.1 A-115544.3 CfuAfGfAfcCfuGfUfUfuUfGfCfu UfUfUfgUfL96 690 3603 A-115549.4 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1241 AD-56678.1 A-115545.3 Cf u AfGfAfCfCf u Gf Uf Uf u UfGfCf u UfUfUfGfUfL96 691 3603 A-115549.5 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1242 AD-56683.1 A-115546.3 CfUfAfGfAfCfCfuGfUfUfuUfGfCf UfUfUfUfGfUfL96 692 3603 A-115549.6 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1243 AD-56688.1 A-115547.3 CfUfAfGfAfCfCfUfGfUfUfUfUfGf CfUfUfUfUfGfUfL96 693 3603 A-115549.7 a Cf a Af Af Af G f Cf a Af a a c Afg GfUfCfuAfgsAfsa 1244 AD-56657.1 A-115550.1 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u ugUfL96 694 3603 A-115551.1 aCfAfAfaAfgCfaAfaacAfgG fuCfuAfgsAfsa 1245 AD-56663.1 A-115552.1 Cfu AfgAfcCf u GfUfUfu UfgCf u u u UfgUfL96 695 3603 A-115553.1 aCfaAfAfAfgCfaAfaacAfgG fuCfuAfgsAfsa 1246 AD-56669.1 A-115554.1 CfuAfgAfcCfuGfUfUfuUfgcuUfu UfgUfL96 696 3603 A-115555.1 aCfaAfaAfGfCfaAfaacAfg GfuCfuAfgsAfsa 1247 AD-56674.1 A-115556.1 CfuAfgAfcCfuGfUfUfuugCfuUfu UfgUfL96 697 3603 A-115557.1 a Cf a Af a AfgCf Af Afa a c Afg G fuCfuAfgsAfsa 1248 AD-56679.1 A-115558.1 CfuAfgAfccuGfUfUfuUfgCfuUfu UfgUfL96 698 3603 A-115559.1 aCfaAfaAfgCfaAfaacAfGf GfuCfuAfgsAfsa 1249 AD-56684.1 A-115560.1 CfuAfgacCfuGfUfUfuUfgCfuUfu UfgUfL96 699 3603 A-115561.1 aCfaAfaAfgCfaAfaacAfgGf UfCfuAfgsAfsa 1250 AD-56689.1 A-115535.4 CfuagAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 700 3603 A-115562.1 aCfaAfaAfgCfaAfaacAfgGf uCfUfAfgsAfsa 1251 AD-56693.1 A-115520.4 cuAfgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 701 3603 A-115563.1 aCfaAfaAfgCfaAfaacAfgGf uCfuAfGfsAfsa 1252 AD-56658.1 A-115564.1 Cf u AfgAfcCf u GfUfUfu UfgCf u Uf UfUfgUfL96 702 3603 A-115565.1 aCfaaaAfgCfaAfaacAfgGfu CfuAfgsAfsa 1253 AD-56664.1 A-115566.1 CfuAfgAfcCfuGfUfUfuUfgCfUfUf uUfgUfL96 703 3603 A-115567.1 aCfaAfaagCfaAfaacAfgGfu CfuAfgsAfsa 1254 AD-56670.1 A-115568.1 Cf u AfgAfcCf u GfUfUfu UfGfCf u Uf uUfgUfL96 704 3603 A-115569.1 aCfaAfaAfgcaAfaacAfgGfu CfuAfgsAfsa 1255 AD-56680.1 A-115572.1 CfuAfgAfcCfUfGfUfUfuUfgCfuUf uUfgUfL96 705 3603 A-115573.1 aCfaAfaAfgCfaAfaacagGfu CfuAfgsAfsa 1256 AD-56685.1 A-115574.1 Cf u AfgAfCf Cfu GfUfUfu UfgCf u Uf uUfgUfL96 706 3603 A-115575.1 a Cf a Af a AfgCfa Af a a c Afgg u CfuAfgsAfsa 1257

- 90 046901

AD-56690.1 A-115542.4 CfuAfGfAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 707 3603 A-115576.1 aCfaAfaAfgCfaAfaacAfgGf ucuAfgsAfsa 1258 AD-56694.1 A-115577.1 CfUfAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 708 3603 A-115578.1 aCfaAfaAfgCfaAfaacAfgGf uCfuagsAfsa 1259 AD-56659.1 A-110695.12 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf u UfgUfL96 709 3603 A-115579.1 aCfaAfaAfgCfaAfaacAfgGf uCfuAfgsasa 1260 AD-56665.1 A-115580.1 AfgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 710 3605 A-115581.1 aCfaAfaAfgCfaAfaacAfgGf uCfusAfsg 1261 AD-56671.1 A-115582.1 AfgAfcCfuGfUfUfuUfgCfuUfuug UfL96 711 3605 A-115583.1 aCfAfAfaAfgCfaAfaacAfgG fuCfusAfsg 1262 AD-56676.1 A-115584.1 AfgAfcCfuGfUfUfuUfgCfuuuUfg UfL96 712 3605 A-115585.1 aCfaAfAfAfgCfaAfaacAfgG fuCfusAfsg 1263 AD-56681.1 A-115586.1 AfgAfcCfuGfUfUfuUfgcuUfuUfg UfL96 713 3605 A-115587.1 aCfaAfaAfGfCfaAfaacAfg GfuCfusAfsg 1264 AD-56686.1 A-115588.1 AfgAfcCfuGfUfUfuugCfuUfuUfg UfL96 714 3605 A-115589.1 a Cf a Af a AfgCf Af Afa a c Afg G fuCfusAfsg 1265 AD-56691.1 A-115590.1 AfgAfccuGfUfUfuUfgCfuUfuUfg UfL96 715 3605 A-115591.1 aCfaAfaAfgCfaAfaacAfGf GfuCfusAfsg 1266 AD-56695.1 A-115592.1 AfgacCfuGfUfUfuUfgCfuUfuUfg UfL96 716 3605 A-115593.1 aCfaAfaAfgCfaAfaacAfgGf UfCfusAfsg 1267 AD-56660.1 A-115594.1 agAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 717 3605 A-115595.1 aCfaAfaAfgCfaAfaacAfgGf uCfUfsAfsg 1268 AD-56666.1 A-115596.1 AfgAfcCfuGfUfUfuUfgCfuUfUfUf gUfL96 718 3605 A-115597.1 aCfaaaAfgCfaAfaacAfgGfu CfusAfsg 1269 AD-56672.1 A-115598.1 AfgAfcCfuGfUfUfuUfgCfUfUfuUf gUfL96 719 3605 A-115599.1 aCfaAfaagCfaAfaacAfgGfu CfusAfsg 1270 AD-56677.1 A-115600.1 AfgAfcCfuGfUfUfuUfGfCfuUfuUf gUfL96 720 3605 A-115601.1 aCfaAfaAfgcaAfaacAfgGfu CfusAfsg 1271 AD-56682.1 A-115602.1 AfgAfcCfuGfUfUfUfUfgCfuUfuUf gUfL96 721 3605 A-115603.1 aCfaAfaAfgCfaaaacAfgGfu CfusAfsg 1272 AD-56687.1 A-115604.1 AfgAfcCf UfGfUf Uf u UfgCf u Uf u Uf gUfL96 722 3605 A-115605.1 aCfaAfaAfgCfaAfaacagGfu CfusAfsg 1273 AD-56692.1 A-115606.1 AfgAfCfCfuGfUfUfuUfgCfuUfuUf gUfL96 723 3605 A-115607.1 a Cf a Af a AfgCfa Af a a c Afgg u CfusAfsg 1274 AD-56696.1 A-115608.1 AfGfAfcCfuGfUfUfuUfgCfuUfuUf gUfL96 724 3605 A-115609.1 aCfaAfaAfgCfaAfaacAfgGf ucusAfsg 1275 AD-56661.1 A-115580.2 AfgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 725 3605 A-115610.1 aCfaAfaAfgCfaAfaacAfgGf uCfusasg 1276 AD-56667.1 A-115611.1 gAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 726 3605 A-115612.1 aCfaAfaAfgCfaAfaacAfgGf uCfausa 1277 AD-53806.11 A-110717.10 Cf a Afg Cf a Gf a CfAf Uf u U f a U f c Uf u UfuUfL96 727 3544 A-109589.15 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1278 AD-53806.13 A-110717.11 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 728 3544 A-109589.10 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1279

- 91 046901

AD-53806.12 A-110717.12 Cf a Afg Cf a Gf a CfAf Uf u U f a U f c Uf u UfuUfL96 729 3544 A-109589.22 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1280 AD-53806.5 A-110717.4 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 730 3544 A-109589.5 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1281 AD-53806.6 A-110717.5 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 731 3544 A-109589.7 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1282 AD-53806.7 A-110717.6 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 732 3544 A-109589.8 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1283 AD-53806.8 A-110717.7 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 733 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1284 AD-53806.9 A-110717.8 CfaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 734 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1285 AD-53806.10 A-110717.9 Cf a Afg Cf a Gf a CfAf Uf u U f a U f c Uf u UfuUfL96 735 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1286 AD-56979.1 A-116393.1 c a Af gCf a G fa Cf Af U fuUfaUfcUfu UfuUfL96 736 3544 A-109589.6 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1287 AD-56979.2 A-116393.2 c a Af gCf a G fa Cf Af U fuUfaUfcUfu UfuUfL96 737 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1288 AD-56975.3 A-116394.1 (iC)aAfgCfaGfaCfAfUfuUfaUfcUf uUfuUfL96 738 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1289 AD-56975.4 A-116394.2 (iC)aAfgCfaGfaCfAfUfuUfaUfcUf uUfuUfL96 739 3544 A-109589.15 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1290 AD-56975.5 A-116394.3 (iC)a AfgCfa Gfa CfAf Uf u Ufa Ufc Uf uUfuUfL96 740 3544 A-109589.22 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1291 AD-56975.1 A-116394.4 (iC)aAfgCfaGfaCfAfUfuUfaUfcUf uUfuUfL96 741 3544 A-109589.5 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1292 AD-56975.2 A-116394.5 (iC)aAfgCfaGfaCfAfUfuUfaUfcUf uUfuUfL96 742 3544 A-109589.6 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1293 AD-56983.1 A-116400.1 CbaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 743 3544 A-109589.7 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1294 AD-56983.2 A-116400.2 CbaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 744 3544 A-109589.8 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1295 AD-56983.3 A-116400.3 CbaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 745 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1296 AD-56983.4 A-116400.4 CbaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 746 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1297 AD-56983.5 A-116400.5 CbaAfgCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 747 3544 A-109589.15 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1298 AD-56977.3 A-116406.1 CfaagCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 748 3544 A-109589.10 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1299 AD-56977.1 A-116406.2 CfaagCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 749 3544 A-109589.11 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1300 AD-56977.2 A-116406.3 CfaagCfaGfaCfAfUfuUfaUfcUfu UfuUfL96 750 3544 A-109589.18 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1301

- 92 046901

AD-56976.1 A-116407.1 Cf a agCf a Gf a Cf Af U f u Uf a u c U f u U f uUfL96 751 3544 A-109589.11 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1302 AD-56976.2 A-116407.2 CfaagCfaGfaCfAfUfuUfaucUfuUf uUfL96 752 3544 A-109589.12 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1303 AD-56980.1 A-116408.1 CfaagCfagaCfAfUfuUfaucUfuUfu UfL96 753 3544 A-109589.12 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1304 AD-56980.2 A-116408.2 CfaagCfagaCfAfUfuUfaucUfuUfu UfL96 754 3544 A-109589.13 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1305 AD-56984.1 A-116409.1 CfaagCfagaCfAfUfuUfaucUfuuu UfL96 755 3544 A-109589.13 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1306 AD-56984.2 A-116409.2 CfaagCfagaCfAfUfuUfaucUfuuu UfL96 756 3544 A-109589.14 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1307 AD-56987.1 A-116410.1 CfaagCfagaCfAfUfuUfaucUfuuu uL96 757 3544 A-109589.14 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1308 AD-56987.2 A-116410.2 CfaagCfagaCfAfUfuUfaucUfuuu uL96 758 3544 A-109589.9 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1309 AD-56991.1 A-116415.1 CfaagCfagaCfAfUfuUfaucuuuuu L96 759 3544 A-109589.15 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1310 AD-56993.1 A-116416.1 CfaagcagaCfAfUfuUfaucuuuuuL 96 760 3544 A-109589.16 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1311 AD-56995.1 A-116417.1 CfaagcagaCfAfUfuuaucuuuuuL9 6 761 3544 A-109589.17 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1312 AD-56978.1 A-116418.1 CfaAfGfCfaGfaCfAfUfuUfaUfcUf uUfuUfL96 762 3544 A-109589.18 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1313 AD-56978.2 A-116418.2 CfaAfGfCfaGfaCfAfUfuUfaUfcUf uUfuUfL96 763 3544 A-109589.17 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1314 AD-56981.1 A-116419.1 CfaAfGfCfaGfaCfAfUfuUfAfUfcU fuUfuUfL96 764 3544 A-109589.19 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1315 AD-56985.1 A-116420.1 CfaAfGfCfaGfaCfAfUfuUfAfUfCf UfuUfuUfL96 765 3544 A-109589.20 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1316 AD-56988.1 A-116421.1 CfaAfGfCfAfGfaCfAfUfuUfAfUfCf UfuUfuUfL96 766 3544 A-109589.21 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1317 AD-56988.2 A-116421.2 CfaAfGfCfAfGfaCfAfUfuUfAfUfCf UfuUfuUfL96 767 3544 A-109589.9 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1318 AD-56988.3 A-116421.3 CfaAfGfCfAfGfaCfAfUfuUfAfUfCf UfuUfuUfL96 768 3544 A-109589.15 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1319 AD-56982.1 A-116426.1 CfaAfgcaGfaCfAfUfuUfaUfcUfu UfuUfL96 769 3544 A-109589.19 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1320 AD-56982.2 A-116426.2 CfaAfgcaGfaCfAfUfuUfaUfcUfu UfuUfL96 770 3544 A-109589.23 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1321 AD-56986.1 A-116428.1 Cf a Afg Cf ag a Cf Af U fuUfaUfcUfuU fuUfL96 771 3544 A-109589.20 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1322 AD-56986.2 A-116428.2 Cf a Afg Cf ag a Cf Af U fuUfaUfcUfuU fuUfL96 772 3544 A-109589.17 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1323

- 93 046901

AD-56989.1 A-116430.1 Cf a Afg Cf a Gf a c Af U f u U f a U f c U f u UfuUfL96 773 3544 A-109589.21 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1324 AD-56990.1 A-116432.1 CfaAfgCfaGfaCfAfuuUfaUfcUfuU fuUfL96 774 3544 A-109589.9 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1325 AD-56992.1 A-116434.1 CfaAfgCfaGfaCfAfUfuUfaucUfuU fuUfL96 775 3544 A-109589.15 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1326 AD-56992.2 A-116434.2 Cf a Afg Cf a Gf a CfAf Uf u UfaucUfuU fuUfL96 776 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1327 AD-56994.1 A-116436.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfu uuUfL96 777 3544 A-109589.22 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1328 AD-56994.2 A-116436.2 CfaAfgCfaGfaCfAfUfuUfaUfcUfu uuUfL96 778 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1329 AD-56996.1 A-116438.1 caagCfaGfaCfAfUfuUfaUfcUfuUf uUfL96 779 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1330 AD-57001.1 A-116440.1 CfaAfgcagaCfAfUfuUfaUfcUfuUf uUfL96 780 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1331 AD-57007.1 A-116442.1 Cf a Afg Cf a Gf a CfAf u uuaUfcUfuUf uUfL96 781 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1332 AD-57013.1 A-116444.1 CfaAfgCfaGfaCfAfUfuUfaucuuUf uUfL96 782 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1333 AD-57019.1 A-116446.1 CfaAfgCfaGfaCfAfUfuUfaUfcUfu uuuL96 783 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1334 AD-57022.1 A-116448.1 Cf a Afg Cf a Gf a CfAf Uf u U f a U f c Uf U fUfuUfL96 784 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1335 AD-57025.1 A-116449.1 CfaAfgCfaGfaCfAfUfuUfaUfCfUf uUfuUfL96 785 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1336 AD-56997.1 A-116450.1 CfaAfgCfaGfaCfAfUfuUfAfUfcUf uUfuUfL96 786 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1337 AD-57002.1 A-116452.1 CfaAfgCfaGfaCfAfUfUfUfa UfcUf uUfuUfL96 787 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1338 AD-57008.1 A-116453.1 CfaAfgCfaGfAfCfAfUfuUfa UfcUf uUfuUfL96 788 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1339 AD-57014.1 A-116454.1 CfaAfgCfAfGfAfCfAfUfuUfaUfcU fuUfuUfL96 789 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1340 AD-57020.1 A-116455.1 CfAfAfgCfaGfaCfAfUfuUfa UfcUf uUfuUfL96 790 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1341 AD-57020.2 A-116455.2 CfAfAfgCfaGfaCfAfUfuUfa UfcUf uUfuUfL96 791 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1342 AD-57026.1 A-116457.1 Cf a Afg Cf a Gf a CfAf Uf u U f a U f c u u U fuUfL96 792 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1343 AD-57003.1 A-116460.1 Cf a Afg Cf a Gf a CfAf Uf u uaUfcUfuU fuUfL96 793 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1344 AD-57009.1 A-116462.1 CfaAfgCfaGfaCfauuUfaUfcUfuUf uUfL96 794 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1345

- 94 046901

AD-57015.1 A-116464.1 CfaAfgCfaGfacaUfuUfaUfcUfuUf uUfL96 795 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1346 AD-57023.1 A-116467.1 Cf a Afg Cf a Gf a CfAf Uf u UfaucUfUf UfuUfL96 796 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1347 AD-57027.1 A-116469.1 CfaAfgCfaGfaCfAfUfuuaUfcUfUf UfuUfL96 797 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1348 AD-56998.1 A-116471.1 Cf a Afg Cf ag a Cf Af U fuUfaUfcUfUf UfuUfL96 798 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1349 AD-57004.1 A-116473.1 CfaAfgcaGfaCfAfU fuUfaUfcUfUf UfuUfL96 799 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1350 AD-57010.1 A-116475.1 CfaagCfaGfaCfAfUfuUfaUfcUfUf UfuUfL96 800 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1351 AD-57016.1 A-116477.1 caAfgCfaGfaCfAfUfuUfaUfcUfUf UfuUfL96 801 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1352 AD-56999.2 A-116479.1 CfaAfgCfaGfaCfAfUfuUfAfUfcUf UfUfuUfL96 802 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1353 AD-56999.1 A-116479.2 Cf a Afg Cf a Gf a CfAf Uf u U fAf Uf c Uf UfUfuUfL96 803 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1354 AD-57021.1 A-116481.1 Cf a Afg CfAf G fa CfAf U f u U f a Uf c U f UfUfuUfL96 804 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1355 AD-57024.1 A-116483.1 CfaAfGfCfaGfaCfAfUfuUfaUfcUf UfUfuUfL96 805 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1356 AD-57005.1 A-116486.1 CfaAfgCfaGfaCfAfUfuUfaUfCfUf uuuUfL96 806 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1357 AD-57011.1 A-116488.1 CfaAfgCfaGfaCfAfUfuuaUfCfUfu UfuUfL96 807 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1358 AD-57017.1 A-116490.1 CfaAfGfCfagaCfAfUfuUfaUfcUfu UfuUfL96 808 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1359 AD-57000.2 A-116492.1 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf aUfcUf(Teo)Uf(Teo)UfL96 809 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1360 AD-57000.3 A-116492.2 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf aUfcUf(Teo)Uf(Teo)UfL96 810 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1361 AD-57000.1 A-116492.3 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf aUfcUf(Teo)Uf(Teo)UfL96 811 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1362 AD-57006.2 A-116494.1 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf (Aeo)Uf(m5Ceo)Uf(Teo)Uf(Teo) UfL96 812 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1363 AD-57006.3 A-116494.2 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf (Aeo)Uf(m5Ceo)Uf(Teo)Uf(Teo) UfL96 813 3544 A-109589.23 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1364 AD-57006.1 A-116494.3 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf (Aeo)Uf(m5Ceo)Uf(Teo)Uf(Teo) UfL96 814 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU fgCfuUfgsCfsu 1365 AD-57012.1 A-116498.1 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf 815 3544 A-109589.17 aAfaAfaGfaUfaAfaugUfcU 1366

- 95 046901

aUfcUf(Teo)Uf(Teo)UbL96 fgCfuUfgsCfsu AD-57018.1 A-116500.1 Cf(Aeo)Af(Geo)CfaGfaCfAfUfuUf (Aeo)Uf(m5Ceo)Uf(Teo)Uf(Teo) UbL96 816 3544 A-109589.17 a Afa Afa Gf a U f a Af a ug U f c U fgCfuUfgsCfsu 1367 AD-53815.1 CfuAfgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 817 3601 aCfaAfaAfgCfaAfaacAfgG fuCfuAfgsAfsa 1368 AD-57928.40 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 818 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1369 AD-59182.5 CfsusAfgAfcCfuGfUfUfuugCfuu uuguL96 819 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1370 AD-59184.3 CfsusAfgAfcCfuGfuUfuugCfuuu uguL96 820 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1371 AD-59186.3 CfsusAfgAfcCfuGfUfuuugCfuuu uguL96 821 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1372 AD-59171.13 CfsusAfgAfcCfuGfuuuugCfuuuu guL96 822 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1373 AD-59176.7 CfsusAfgAfcCfuGfuuuugcuuuug uL96 823 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1374 AD-59170.7 CfsusagacCfuGfuuuugCfuuuug uL96 824 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1375 AD-59175.7 CfsusagacCfuGfuuuugcuuuugu L96 825 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1376 AD-59179.7 csusagacCfuGfuuuugcuuuuguL 96 826 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1377 AD-59218.1 CfsusAfgAfcCfuGfuuuugCfuuuu guL96 827 3601 asCfsaAfaAfgCfaAfAfAfc AfgGfuCfuAfgsasa 1378 AD-59222.1 CfsusAfgAfcCfuGfuuuugcuuuug uL96 828 3601 asCfsaAfaAfgCfaAfAfAfcAfg GfuCfuAfgsasa 1379 AD-59226.1 CfsusagacCfuGfuuuugCfuuuug uL96 829 3601 asCfsaAfaAfgCfaAfAfAfc AfgGfuCfuAfgsasa 1380 AD-59230.1 CfsusagacCfuGfuuuugcuuuugu L96 830 3601 asCfsaAfaAfgCfaAfAfAfc AfgGfuCfuAfgsasa 1381 AD-59235.1 csusagacCfuGfuuuugcuuuuguL 96 831 3601 asCfsaAfaAfgCfaAfAfAfc AfgGfuCfuAfgsasa 1382 AD-59207.1 CfsusAfgAfcCfuGfuuuugCfuuuu guL96 832 3601 asCfsaAfAfAfgCfaAfaAfc AfgGfuCfuagsasa 1383 AD-59211.1 CfsusAfgAfcCfuGfuuuugcuuuug uL96 833 3601 asCfsaAfAfAfgCfaAfaAfc AfgGfuCfuagsasa 1384 AD-59215.1 CfsusagacCfuGfuuuugCfuuuug uL96 834 3601 asCfsaAfAfAfgCfaAfaAfc AfgGfuCfuagsasa 1385 AD-59219.1 CfsusagacCfuGfuuuugcuuuugu L96 835 3601 asCfsaAfAfAfgCfaAfaAfc AfgGfuCfuagsasa 1386 AD-59223.1 csusagacCfuGfuuuugcuuuuguL 96 836 3601 asCfsaAfAfAfgCfaAfaAfc AfgGfuCfuagsasa 1387

- 96 046901

AD-59181.5 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgsUfL96 837 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1388 AD-59172.5 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfsgsUfL96 838 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1389 AD-59177.5 CfsusAfgAfcCfuGfUfUfuUfgCfsu UfsuUfsgsUfL96 839 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1390 AD-59180.5 CfsusAfgAfcCfuGfUfUfuUfgCfsu UfsuUfsgsUfsL96 840 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1391 AD-59183.5 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfsgsUfsL96 841 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1392 AD-59185.5 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfsL96 842 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1393 AD-59173.5 CfsusAfgAfcCfuGfUfUfuugCfuu uugsuL96 843 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1394 AD-59232.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 844 3600 PasCfsaAfaAfgCfaAfaacA fgGfuCfuAfgsasa 1395 AD-59236.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 845 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1396 AD-59216.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgsUfL96 846 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1397 AD-59220.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfsgsUfL96 847 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1398 AD-59224.1 CfsusAfgAfcCfuGfUfUfuUfgCfsu UfsuUfsgsUfL96 848 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1399 AD-59228.1 CfsusAfgAfcCfuGfUfUfuUfgCfsu UfsuUfsgsUfsL96 849 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1400 AD-59233.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfsgsUfsL96 850 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1401 AD-59237.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfsL96 851 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1402 AD-59209.1 CfsusAfgAfcCfuGfUfUfuugCfuu uugsuL96 852 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsuAfgsasa 1403 AD-59208.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 853 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfsusAfgsasa 1404 AD-59212.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 854 3600 PasCfsaAfaAfsgCfaAfaac AfgGfuCfsuAfgsasa 1405 AD-59210.1 csusAGAccuGuuuuGcuuuuGuL 96 855 3601 AscsAAAAGcAAAAcAGG ucuAGsasa 1406 AD-59214.1 AsGsAccuGuuuuGcuuuuGuL96 856 3603 AscsAAAAGcAAAAcAGG ucusAsG 1407 AD-59227.1 CfsusAfGfAfccuGfuuuuGfcuuu uGfuL96 857 3601 asCfsAfAfAfAfGfcAfAfAf AfcAfGfGfucuAfGfsasa 1408 AD-59231.1 CfsusAfGfAfccuGfuuuuGfcuuu uGfuL96 858 3601 asCfsAfAfAfAfGfcAfAfaa cAfGfGfucuAfGfsasa 1409

- 97 046901

AD-59198.3 (C3m)usAfgAfcCfuGfUfUfuUfgC fuUfuUfgUfL96 859 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1410 AD-59200.3 (C3m)(U3m)AfgAfcCfuGfUfUfu UfgCfuUfuUfgUfL96 860 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1411 AD-59203.3 (m5Cam)usAfgAfcCfuGfUfUfuU fgCfuUfuUfgUfL96 861 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1412 AD-59204.3 (m5Cam)(Tam)AfgAfcCfuGfUfU fuUfgCfuUfuUfgUfL96 862 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1413 AD-59188.3 (m5Cams)(Tams)AfgAfcCfuGfU fUfuUfgCfuUfuUfgUfL96 863 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1414 AD-59191.3 (m5Cams)usAfgAfcCfuGfUfUfu UfgCfuUfuUfgUfL96 864 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1415 AD-59213.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 865 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(A3m)a 1416 AD-59217.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 866 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAf(G3m)(A3m)a 1417 AD-59221.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 867 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(Aam)a 1418 AD-59225.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 868 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAf(Gam)(Aam)a 1419 AD-59229.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 869 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(Aams)a 1420 AD-59234.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 870 3601 asCfsaAfaAfgCfaAfaacAf gGf uCfuAf(Ga ms)(Aa ms) a 1421 AD-59238.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 871 3601 (A3m)CfsaAfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1422 AD-59241.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 872 3601 as(C3m)aAfaAfgCfaAfaac AfgGfuCfuAfgsasa 1423 AD-59245.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 873 3601 (Aam)CfsaAfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1424 AD-59250.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 874 3601 as(m5Cam)aAfaAfgCfaAf aacAfgGfuCfuAfgsasa 1425 AD-59246.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 875 3602 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfsgsa 1426 AD-59253.2 UsAfsgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 876 3602 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfsgsa 1427 AD-59242.1 AfsgsAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 877 3602 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfsgsa 1428 AD-59253.1 UsAfsgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 878 3602 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfsgsa 1429 AD-59258.1 usasgAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 879 3602 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfsgsa 1430 AD-59251.1 CfsusAfgAfcCfuGfUfUfuUfgCfu 880 3603 asCfsaAfaAfgCfaAfaacAf 1431

- 98 046901

UfuUfgUfL96 gGfuCfusAfsg AD-59256.1 UsAfsgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 881 3604 asCfsaAfaAfgCfaAfaacAf gGfuCfsusAf 1432 AD-59260.1 AfsgsAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 882 3605 asCfsaAfaAfgCfaAfaacAf gGfusCfsu 1433 AD-59248.1 gsAfscCfuGfUfUfuUfgCfuUfuUf gUfL96 883 3605 asCfsaAfaAfgCfaAfaacAf gGfusCfsu 1434 AD-59247.1 gsAfscCfuGfUfUfuUfgCfuUfuUf gUfL96 884 3604 asCfsaAfaAfgCfaAfaacAf gGfuCfsusa 1435 AD-59252.1 AfsgsAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 885 3604 asCfsaAfaAfgCfaAfaacAf gGfuCfsusa 1436 AD-59257.1 UsAfsgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 886 3604 asCfsaAfaAfgCfaAfaacAf gGfuCfsusa 1437 AD-59261.1 AfsgsAfcCfuGfUfUfuUfgCfuUfu UfgUfL96 887 3603 asCfsaAfaAfgCfaAfaacAf gGfuCfusasg 1438 AD-59262.1 UsAfsgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 888 3603 asCfsaAfaAfgCfaAfaacAf gGfuCfusasg 1439 AD-59265.1 csusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 889 3603 asCfsaAfaAfgCfaAfaacAf gGfuCfusasg 1440 AD-59196.13 UsAfsgAfcCfuGfUfUfuUfgCfuUf uUfgUfL96 890 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1441 AD-59189.11 AfsgsAfcCfuGfUfUfuUfgCfuUfu 891 3601 asCfsaAfaAfgCfaAfaacAf 1442 UfgUfL96 gGfuCfuAfgsasa AD-59190.3 usCfsuAfgAfcCfuGfUfUfuUfgCf uUfuUfgUfL96 892 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1443 AD-59192.3 UfsusCfuAfgAfcCfuGfUfUfuUfg CfuUfuUfgUfL96 893 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1444 AD-59240.1 CfsusAfgAfcCfuGfuuuugCfuuuu guL96 894 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfuAfgs(A3m)a 1445 AD-59244.1 CfsusAfgAfcCfuGfuuuugCfuuuu guL96 895 3601 asCfsaAfaAfsgCfaAfaacA fgGfuCfuAfgsasa 1446 AD-59202.7 (C3m)usagaccuguuuugcuuuug uL96 896 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1447 AD-59195.5 (C3m)usAfgAfcCfuGfuuuugCfu uuuguL96 897 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1448 AD-59249.1 CfsusAfgAfcCfuGfUfUfuugCfuu uuguL96 898 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(A3m)a 1449 AD-59254.1 CfsusAfgAfcCfuGfuuuugCfuuuu guL96 899 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(A3m)a 1450 AD-59259.1 (C3m)usAfgAfcCfuGfuuuugCfu uuuguL96 900 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(A3m)a 1451 AD-59264.1 (C3m)usagaccuguuuugcuuuug uL96 901 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(A3m)a 1452 AD-59264.2 (C3m)usagaccuguuuugcuuuug 902 3601 asCfsaAfaAfgCfaAfaacAf 1453

- 99 046901

uL96 gGfuCfuAfgs(A3m)a AD-59255.1 CsusagaccuGfUfUfuugcuuuugu L96 903 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgs(A3m)a 1454 AD-57928.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 904 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1455 AD-58893.1 CfsuAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 905 3601 asCfaAfaAfgCfaAfaacAfg GfuCfuAfgasa 1456 AD-58894.1 CfusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 906 3601 aCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsaa 1457 AD-58895.1 Cf u AfgAfcCf u Gf Uf Uf u UfgCf u Uf uUfgUfL96 907 3601 asCfsaAfaAfgCfaAfaacAf gGfuCfuAfgsasa 1458 AD-58896.1 CfsusAfgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 908 3601 aCfaAfaAfgCfaAfaacAfgG fuCfuAfgaa 1459 AD-58897.1 CfsusAfsgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 909 3601 asCfsasAfaAfgCfaAfaacA fgGfuCfuAfsgsasa 1460 AD-58898.1 CfsusAfsgAfcCfuGfUfUfuUfgCfu UfuUfgUfL96 910 3601 asCfsaAfaAfgCfsaAfaacA fsgGfuCfuAfsgsasa 1461 AD-58899.1 CfsusAfsgAfcCfuGfUfUfuUfgCfu UfuUfsgUfL96 911 3601 asCfsaAfaAfgCfsaAfaacA fsgGfuCfuAfsgsasa 1462 AD-58900.1 CfsasAfgCfaGfaCfAfUfuUfaUfc UfuUfuUfL96 912 N.A. asAfsaAfaGfaUfaAfaugUf cUfgCfuUfgscsu 1463 AD-58902.1 UfsusUfuCfuAfgAfCfCfuGfuUfu 913 3597 asAfsgCfaAfaAfcAfgguCf 1464 UfgCfuUfL96 uAfgAfaAfasgsu (A3mx)(G3mx)AfcCfuGfUfUfuUf gCfuUfuUfgUfL96 914 asCfsaAfaAfgCfaAfaacAfg GfuCfusasg 1465 (A3mx)(G3mx)AfcCfuGfUfUfuUf gCfuUfuUfgUfL96 915 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfusasg 1466 (A3mx)(G3mx)AfcCfuGfUfUfuUf gCfuUfuUfgUfL96 916 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfu(A3mx)g 1467 (A3mx)gAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 917 asCfsaAfaAfgCfaAfaacAfg GfuCfusasg 1468 (A3mx)gAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 918 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfusasg 1469 (A3mx)gAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 919 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfu(A3mx)g 1470 (C3mx)(U3mx)AfgAfcCfuGfUfUf uUfgCfuUfuUfgUfL96 920 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1471 (C3mx)(U3mx)AfgAfcCfuGfUfUf uUfgCfuUfuUfgUfL96 921 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfuAf(G3mx)(A3 mx)a 1472 (C3mx)uAfgAfcCfuGfUfUfuUfgCf uUfuUfgUfL96 922 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1473 (C3mx)uAfgAfcCfuGfUfUfuUfgCf uUfuUfgUfL96 923 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1474

- 100 046901

(C3mx)uAfgAfcCfuGfUfUfuUfgCf uUfuUfgUfL96 924 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfuAfg(A3mx)a 1475 (C3mx)uAfgAfcCfuGfUfUfuUfgCf uUfuUfgUfL96 925 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfuAf(G3mx)(A3 mx)a 1476 (C3mx)usAfgAfcCfuGfUfUfuUfg CfuUfuUfgUfL96 926 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1477 (Chd)susAfgAfcCfuGfUfUfuUfgC fuUfuUfgUfL96 927 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1478 (phe)CfsuAfgAfcCfuGfUfUfuUfg CfuUfuUfgUfL96 928 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1479 (phe)CfuAfgAfcCfuGfUfUfuUfgC fuUfuUfgUfL96 929 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1480 (pshe)CfsuAfgAfcCfuGfUfUfuUf gCfuUfuUfgUfL96 930 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1481 (pshe)CfuAfgAfcCfuGfUfUfuUfg CfuUfuUfgUfL96 931 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1482 AfsgsAfcCfuGfUfUfuUfgCfuUfuU fgUfL96 932 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfusasg 1483 AfsgsAfcCfuGfUfUfuUfgCfuUfuU fgUfL96 933 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfu(A3mx)g 1484 Cfs(Uhd)sAfgAfcCfuGfUfUfuUfg 934 asCfsaAfaAfgCfaAfa acAfg 1485 CfuUfuUfgUfL96 GfuCfuAfgsasa CfsusAfgAf(Chd)CfuGfUfUfuUfg CfuUfuUfgUfL96 935 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1486 CfsusAfgAfc(Chd)uGfUfUfuUfgC fuUfuUfgUfL96 936 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1487 CfsusAfgAfcCf(Uhd)GfUfUfuUfg CfuUfuUfgUfL96 937 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1488 CfsusAfgAfcCfuGfUfUf(Uhd)Ufg CfuUfuUfgUfL96 938 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1489 CfsusAfgAfcCfuGfUfUfuUf(Ggn) CfuUfuUfgUfL96 939 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1490 CfsusAfgAfcCfuGfUfUfuUfg(Cgn) uUfuUfgUfL96 940 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1491 CfsusAfgAfcCfuGfUfUfuUfg(Chd )uUfuUfgUfL96 941 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1492 CfsusAfgAfcCfuGfUfUfuUfgCf(Tg n)UfuUfgUfL96 942 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1493 CfsusAfgAfcCfuGfUfUfuUfgCf(U hd)UfuUfgUfL96 943 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1494 CfsusAfgAfcCfuGfUfUfuUfgCfu( Tgn)uUfgUfL96 944 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1495 CfsusAfgAfcCfuGfUfUfuUfgCfuU 945 asCfsaAfaAfgCfaAfa acAfg 1496

- 101 046901

f(Tgn) UfgUf L96 GfuCfuAfgsasa CfsusAfgAfcCfuGfUfUfuUfgCfuU f(Uhd)UfgUfL96 946 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1497 CfsusAfgAfcCfuGfUfUfuUfgCfuU fu(Tgn)gUfL96 947 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1498 CfsusAfgAfcCfuGfUfUfuUfgCfuU fu(Uhd)gUfL96 948 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1499 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUf(Ggn)UfL96 949 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1500 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfg(Tgn)L96 950 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1501 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfg(Uhd)L96 951 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1502 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 952 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1503 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 953 (Agn)CfsaAfaAfgCfaAfaac AfgGfuCfuAfgsasa 1504 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 954 (Ag n) Cf a Af a Afg Cf a Afa a c A fgGfuCfuAfgsasa 1505 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 955 P(Agn)CfaAfaAfgCfaAfaac AfgGfuCfuAfgsasa 1506 CfsusAfgAfcCfuGfUfUfuUfgCfuU 956 as(Cgn)aAfaAfgCfaAfaacA 1507 fuUfgUfL96 fgGfuCfuAfgsasa CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 957 asCfs(Agn)AfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1508 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 958 asCfsa(Agn)aAfgCfaAfaac AfgGfuCfuAfgsasa 1509 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 959 asCfsaAf(Agn)AfgCfaAfaa cAfgGfuCfuAfgsasa 1510 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 960 asCfsaAfa(Agn)gCfaAfaac AfgGfuCfuAfgsasa 1511 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 961 asCfsaAfaAf(Ggn)CfaAfaa cAfgGfuCfuAfgsasa 1512 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 962 asCfsaAfaAfg(Cgn)aAfaac AfgGfuCfuAfgsasa 1513 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 963 asCfsaAfaAfgCf(Agn)Afaa cAfgGfuCfuAfgsasa 1514 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 964 asCfsaAfaAfgCfa(Agn)aac AfgGfuCfuAfgsasa 1515 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 965 asCfsaAfaAfgCfaAf(Agn)a cAfgGfuCfuAfgsasa 1516 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 966 asCfsaAfaAfgCfaAfa(Agn) cAfgGfuCfuAfgsasa 1517 CfsusAfgAfcCfuGfUfUfuUfgCfuU 967 asCfsaAfaAfgCfaAfaa(Cgn 1518

- 102 046901

fuUfgUfL96 )AfgGfuCfuAfgsasa CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 968 asCfsaAfaAfiCfaAfaacAfiG fuCfuAfisasa 1519 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 969 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfg(A3mx)a 1520 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 970 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgs(A3mx)a 1521 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 971 asCfsaAfaAfgCfaAfaacAfg GfuCfuAf(G3mx)(A3mx)a 1522 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 972 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1523 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 973 (A3mx)CfsaAfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1524 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 974 P(A3mx)CfaAfaAfgCfaAfa acAfgGfuCfuAfgsasa 1525 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 975 a(C3mx)aAfaAfgCfaAfaac AfgGfuCfuAfgsasa 1526 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 976 as(C3mx)aAfaAfgCfaAfaa cAfgGfuCfuAfgsasa 1527 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 977 (A3mx)(C3mx)aAfaAfgCfa AfaacAfgGfuCfuAfgsasa 1528 CfsusAfgAfcCfuGfUfUfuUfgCfuU 978 (A3mx)CfaAfaAfgCfaAfaa 1529 fuUfgUfL96 cAfgGfuCfuAfg(A3mx)a CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 979 (A3mx)CfsaAfaAfgCfaAfaa cAfgGfuCfuAfgs(A3mx)a 1530 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 980 (A3mx)CfaAfaAfgCfaAfaa cAfgGfuCfuAf(G3mx)(A3 mxja 1531 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 981 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgasas(phe) 1532 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 982 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgaas(phe) 1533 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 983 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgaa(phe) 1534 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 984 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsas(phe) 1535 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 985 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgas(phe) 1536 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 986 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfga(phe) 1537 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 987 asCfsaAfaAfgCfaAfaacAfg Gf(Uhd)CfuAfgsasa 1538 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 988 asCfsaAfaAfgCfaAfaacAfg GfuCf(Uhd)Afgsasa 1539

- 103 046901

CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 989 asCfsaAfaAfg(Chd)aAfaac AfgGfuCfuAfgsasa 1540 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfgUfL96 990 asCfsaAfaagCfaAfaacAfgG fucuAfgsasa 1541 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfguL96 991 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1542 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuUfguL96 992 asCfsaAfaagCfaAfaacAfgG fucuAfgsasa 1543 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuugUfL96 993 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1544 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuugUfL96 994 asCfsaAfaagCfaAfaacAfgG fucuAfgsasa 1545 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuuguL96 995 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1546 CfsusAfgAfcCfuGfUfUfuUfgCfuU fuuguL96 996 asCfsaAfaagCfaAfaacAfgG fucuAfgsasa 1547 CfsusAfgAfcCfuGfUfUfuUfgcuuu ugUfL96 997 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1548 CfsusAfgAfcCfuGfUfUfuUfgcuuu ugUfL96 998 asCfsaAfaagCfaAfaacAfgG fucuAfgsasa 1549 CfsusAfgAfcCfuGfUfUfuUfgcuuu uguL96 999 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1550 CfsusAfgAfcCfuGfUfUfuUfgcuuu uguL96 1000 asCfsaAfaagCfaAfaacAfgG fucuAfgsasa 1551 CfsusAfgAfcCfuGfUfUfuUfgUfuU fuUfgUfL96 1001 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1552 CfsusAfgAfcCfuGfUfUfuUfiCfuUf uUfiUfL96 1002 asCfsaAfaAfgCfaAfaacAfg GfuCfuAfgsasa 1553 CfsusAfgAfcCfuGfUfUfuUfiCfuUf uUfiUfL96 1003 asCfsaAfaAfiCfaAfaacAfg GfuCfuAfgsasa 1554 CfsusAfgAfcCfuGfUfUfuUfiCfuUf uUfiUfL96 1004 asCfsaAfaAfiCfaAfaacAfiG fuCfuAfisasa 1555 CfsusAfiAfcCfuGfUfUfuUfiCfuUf uUfiUfL96 1005 asCfsaAfaAfiCfaAfaacAfiG fuCfuAfisasa 1556

Example 2: In vitro and in vivo testing.

A subset of these duplexes was evaluated for efficacy in single-dose free uptake assays in cynomolgus monkey hepatocytes. Briefly, primary cynomolgus macaque hepatocytes (MCH) were treated with conjugated modified siRNA duplexes at three concentrations, 500 nM, 100 nM, and 10 nM. Free uptake assays at 100 nM and 10 nM concentrations were performed in duplicate and data were presented as the remaining mean amount of transcript relative to control +/- standard deviation (SD). The 500 nM test was performed once. In table Figure 3 shows the results of these analyses.

- 104 046901

Table 3

Efficacy test against PCSK9 by free uptake into primary hepatocytes of cynomolgus monkeys

Duplex ID PCH, 500 hM PCH, 100 hM, avg. PCH, 10 hM, avg. PCH, 100 hM, SD PCH, 10 hM, SD AD-48399 1.08 1.03 0.98 0.09 0.02 AD-48399 0.97 0.95 1.10 0.03 0.09 AD-48399 0.89 0.98 1.02 0.06 0.06 AD-48399 1.04 1.00 1.01 0.02 0.08 AD-48399 0.92 1.03 0.96 0.02 0.09 AD-48399 1.13 1.03 0.96 0.05 0.01 AD-48400 0.48 0.63 0.90 0.04 0.00 AD-48400.4 0.65 0.78 0.89 0.14 0.13 AD-53649.1 0.96 0.96 1.14 0.02 0.07 AD-53650.1 0.97 0.92 1.15 0.01 0.06 AD-53651.1 1.02 0.98 1.15 0.13 0.10 AD-53652.1 0.83 0.89 1.14 0.20 0.05 AD-53653.1 0.85 0.95 1.26 0.04 0.07 AD-53654.1 0.84 0.93 1.19 0.02 0.13 AD-53656.1 0.92 0.92 1.07 0.05 0.03 AD-53657.1 0.92 0.89 1.02 0.05 0.03 AD-53658.1 0.89 0.83 0.97 0.04 0.14 AD-53659.1 0.79 0.82 1.05 0.06 0.13 AD-53660.1 0.89 0.86 0.98 0.07 0.07 AD-53661.1 0.92 1.03 1.07 0.02 0.04 AD-53663.1 0.88 0.90 1.08 0.03 0.02

- 105 046901

AD-53664.1 0.95 0.86 1.00 0.09 0.13 AD-53665.1 0.92 0.91 1.05 0.01 0.13 AD-53666.1 0.73 0.80 0.95 0.08 0.02 AD-53667.1 0.95 0.96 1.12 0.06 0.03 AD-53668.1 1.03 0.89 1.17 0.03 0.12 AD-53669.1 1.12 0.90 1.05 0.01 0.15 AD-53670.1 0.85 0.88 1.00 0.06 0.06 AD-53671.1 0.87 0.90 0.93 0.02 0.04 AD-53672.1 0.87 0.86 0.95 0.04 0.16 AD-53674.1 0.69 0.75 0.92 0.08 0.02 AD-53675.1 0.99 0.92 1.17 0.11 0.06 AD-53676.1 0.90 0.87 1.10 0.03 0.08 AD-53677.1 1.22 0.86 1.12 0.10 0.04 AD-53678.1 1.01 0.98 1.03 0.03 0.12 AD-53679.1 0.96 0.85 1.02 0.04 0.11 AD-53680.1 1.21 0.94 0.99 0.03 0.01 AD-53681.1 1.02 0.94 1.01 0.01 0.11 AD-53682.1 0.98 0.90 1.01 0.06 0.11 AD-53683.1 0.95 0.90 1.01 0.02 0.08 AD-53684.1 1.14 1.01 1.01 0.09 0.07 AD-53685.1 0.96 0.92 1.03 0.00 0.07 AD-53687.1 1.31 0.91 1.02 0.02 0.11 AD-53688.1 0.90 0.95 0.96 0.03 0.03 AD-53689.1 0.97 0.95 1.05 0.04 0.07 AD-53690.1 0.82 0.97 0.99 0.13 0.08 AD-53691.1 0.99 1.01 0.97 0.01 0.12 AD-53692.1 1.11 0.91 1.00 0.04 0.03 AD-53693.1 1.02 0.96 1.02 0.04 0.10 AD-53694.1 1.12 0.98 0.97 0.07 0.06 AD-53695.1 0.97 1.04 0.94 0.11 0.08 AD-53696.1 0.85 0.91 1.23 0.10 0.01 AD-53697.1 0.89 0.91 1.06 0.03 0.00 AD-53698.1 0.90 0.86 1.15 0.06 0.01 AD-53699.1 0.84 0.85 1.07 0.00 0.03 AD-53700.1 0.93 1.02 1.21 0.02 0.15

- 106 046901

AD-53701.1 1.01 0.96 1.12 0.00 0.17 AD-53702.1 0.95 0.94 1.06 0.05 0.15 AD-53703.1 0.82 0.85 1.04 0.07 0.13 AD-53704.1 0.92 0.97 0.94 0.04 0.02 AD-53705.1 0.96 0.98 1.00 0.11 0.15 AD-53706.1 0.90 0.97 1.03 0.01 0.20 AD-53707.1 0.86 0.98 1.11 0.14 0.24 AD-53708.1 1.10 0.94 1.05 0.02 0.15 AD-53709.1 0.79 0.84 1.08 0.01 0.18 AD-53710.1 1.03 0.91 1.06 0.01 0.09 AD-53711.1 0.90 0.90 0.99 0.00 0.28 AD-53712.1 0.97 0.92 0.97 0.00 0.12 AD-53713.1 0.98 0.93 1.07 0.01 0.16 AD-53714.1 1.09 0.86 0.99 0.03 0.09 AD-53715.1 1.04 0.83 0.94 0.06 0.06 AD-53716.1 0.82 0.85 1.02 0.05 0.14 AD-53717.1 0.98 0.94 0.98 0.11 0.12 AD-53718.1 0.89 1.04 1.01 0.18 0.01 AD-53719.1 0.98 1.05 1.05 0.06 0.17 AD-53720.1 1.02 0.88 1.08 0.01 0.15 AD-53721.1 0.88 0.95 1.03 0.07 0.11 AD-53722.1 0.98 0.95 1.01 0.06 0.12 AD-53723.1 0.89 0.89 1.02 0.10 0.06 AD-53724.1 0.98 0.93 1.00 0.13 0.01 AD-53725.1 1.04 1.05 1.09 0.19 0.11 AD-53726.1 0.87 0.88 0.88 0.00 0.02 AD-53727.1 0.82 0.92 1.02 0.05 0.13 AD-53728.1 0.86 0.93 1.06 0.03 0.08 AD-53729.1 0.86 0.81 1.02 0.12 0.03 AD-53730.1 1.01 0.95 1.02 0.07 0.01 AD-53731.1 0.99 0.98 1.00 0.08 0.07 AD-53732.1 0.93 0.86 1.01 0.12 0.11 AD-53733.1 1.06 1.02 1.08 0.05 0.06 AD-53734.1 0.95 0.93 1.04 0.12 0.05 AD-53735.1 1.00 0.93 1.01 0.02 0.06

- 107 046901

AD-53736.1 0.90 1.09 1.16 0.05 0.01 AD-53737.1 0.94 0.93 1.00 0.02 0.09 AD-53738.1 0.93 0.79 0.93 0.03 0.01 AD-53739.1 1.11 0.90 0.90 0.05 0.00 AD-53740.1 0.86 0.92 0.97 0.08 0.01 AD-53741.1 0.96 0.84 0.92 0.00 0.07 AD-53742.1 1.03 0.93 1.03 0.04 0.06 AD-53743.1 0.92 0.98 1.05 0.08 0.14 AD-53744.1 0.95 1.02 1.03 0.08 0.12 AD-53745.1 0.81 0.99 1.11 0.10 0.18 AD-53746.1 0.65 0.83 1.04 0.07 0.16 AD-53747.1 0.82 0.88 1.02 0.05 0.13 AD-53748.1 0.46 0.59 0.72 0.06 0.07 AD-53749.1 0.93 0.90 1.04 0.12 0.16 AD-53750.1 0.90 1.02 0.97 0.02 0.10 AD-53751.1 0.92 0.87 1.02 0.19 0.16 AD-53752.1 0.73 0.88 0.99 0.06 0.18 AD-53753.1 0.87 0.97 1.06 0.07 0.19 AD-53754.1 0.43 0.58 0.72 0.10 0.05 AD-53755.1 1.01 0.99 1.03 0.03 0.02 AD-53757.1 0.98 0.91 1.07 0.05 0.13 AD-53758.1 0.63 0.73 0.92 0.05 0.00 AD-53759.1 0.91 0.92 0.99 0.02 0.08 AD-53760.1 0.51 0.67 0.80 0.03 0.12 AD-53761.1 0.89 1.07 1.10 0.11 0.18 AD-53762.1 1.06 1.00 0.96 0.12 0.10 AD-53763.1 0.95 1.10 1.00 0.07 0.09 AD-53764.1 0.99 0.94 0.99 0.05 0.16 AD-53765.1 0.92 0.87 0.86 0.09 0.11 AD-53766.1 0.75 0.78 0.86 0.09 0.14 AD-53767.1 1.01 1.02 0.97 0.05 0.18 AD-53768.1 0.89 1.07 0.97 0.09 0.15 AD-53769.1 0.89 1.11 0.95 0.05 0.11 AD-53770.1 0.76 1.01 0.98 0.01 0.12 AD-53771.1 0.70 0.74 0.84 0.06 0.12

- 108 046901

AD-53772.1 0.72 0.83 0.85 0.04 0.11 AD-53773.1 0.96 1.00 0.98 0.05 0.07 AD-53774.1 0.75 0.92 1.01 0.06 0.14 AD-53776.1 0.78 0.94 0.97 0.11 0.08 AD-53777.1 0.67 0.68 0.74 0.11 0.01 AD-53778.1 0.74 0.73 0.92 0.13 0.14 AD-53779.1 1.00 0.98 0.95 0.14 0.04 AD-53780.1 0.90 0.92 0.98 0.12 0.05 AD-53781.1 0.84 0.95 1.00 0.17 0.06 AD-53782.1 0.87 0.92 0.90 0.11 0.02 AD-53783.1 0.71 0.79 0.78 0.14 0.03 AD-53784.1 0.68 0.82 0.86 0.10 0.10 AD-53785.1 1.10 0.96 0.96 0.09 0.07 AD-53786.1 0.98 0.89 0.95 0.20 0.14 AD-53787.1 1.23 0.93 1.00 0.11 0.21 AD-53788.1 0.95 0.90 0.94 0.17 0.08 AD-53789.1 0.55 0.60 0.78 0.09 0.08 AD-53790.1 0.70 0.91 1.04 0.08 0.16 AD-53791.1 0.47 0.67 0.92 0.12 0.09 AD-53792.1 0.52 0.75 0.89 0.06 0.04 AD-53793.1 0.88 1.03 1.07 0.20 0.09 AD-53794.1 0.85 1.00 1.09 0.17 0.22 AD-53795.1 0.58 0.71 1.00 0.10 0.12 AD-53796.1 0.62 0.78 0.96 0.07 0.12 AD-53797.1 0.72 0.78 0.93 0.12 0.10 AD-53798.1 0.50 0.55 0.76 0.08 0.03 AD-53799.1 0.98 0.92 1.10 0.11 0.21 AD-53800.1 0.59 0.65 0.87 0.15 0.14 AD-53801.1 0.81 0.84 1.05 0.14 0.18 AD-53802.1 0.68 0.79 1.03 0.13 0.13 AD-53803.1 0.51 0.53 0.77 0.09 0.05 AD-53804.1 0.94 0.86 1.05 0.15 0.15 AD-53805.1 0.95 0.93 1.03 0.12 0.19 AD-53806.1 0.38 0.45 0.78 0.05 0.12 AD-53807.1 0.85 0.95 1.15 0.09 0.24

- 109 046901

AD-53808.1 0.81 0.85 0.93 0.08 0.11 AD-53809.1 0.50 0.62 0.77 0.00 0.12 AD-53810.1 0.84 0.82 0.98 0.16 0.22 AD-53811.1 0.94 0.95 1.00 0.10 0.11 AD-53812.1 0.61 0.76 0.97 0.14 0.22 AD-53813.1 0.67 0.76 0.94 0.01 0.15 AD-53814.1 0.58 0.67 0.84 0.11 0.19 AD-53815.1 0.49 0.50 0.72 0.09 0.17 AD-53816.1 0.82 0.91 0.93 0.08 0.10 AD-53817.1 0.92 0.94 1.07 0.13 0.36 AD-53818.1 0.83 0.99 0.99 0.07 0.41 AD-53819.1 0.61 0.75 0.88 0.24 0.16 AD-53820.1 0.71 0.81 0.92 0.17 0.04 AD-53821.1 0.56 0.54 0.68 0.13 0.05 AD-53822.1 1.24 0.88 1.05 0.12 0.17 AD-53823.1 1.03 0.86 0.99 0.11 0.18 AD-53824.1 0.76 0.73 0.93 0.16 0.11 AD-53825.1 0.57 0.63 0.82 0.18 0.04 AD-53826.1 0.54 0.51 0.78 0.08 0.07 AD-53827.1 0.99 0.91 1.05 0.12 0.08 AD-53828.1 0.69 0.77 0.87 0.09 0.16 AD-53829.1 0.72 0.91 0.95 0.11 0.16 AD-53830.1 0.48 0.73 0.76 0.11 0.01 AD-53831.1 0.97 0.92 1.00 0.22 0.25 AD-53832.1 0.68 0.63 0.81 0.15 0.02 AD-53833.1 0.92 0.90 0.84 0.20 0.03 AD-53834.1 1.15 0.93 0.86 0.16 0.02 AD-53835.1 0.88 0.79 0.81 0.18 0.03 PBS 0.90 1.02 0.99 0.04 0.15

Modified and conjugated siRNA duplexes to PCSK9 were also assessed for potency using transfection assays in three human cell lines. siRNA to PCSK9 was transfected into three different cell lines, HeLa, Hep3B, and HepG2, at two doses, 10 nM and 0.1 nM. The results of these analyzes are shown in table. 4, and data are expressed as the proportion of transcript remaining relative to control.

In fig. 1 shows that there is overall reproducibility of PCSK9 duplex silencing activity between free uptake and transfection assays.

The IC50 values for selected duplexes when freely taken up by cynomolgus monkey cells and when transfected into Hep3B cells are shown in Table. 5.

- 110 046901

Table 4

Efficacy test against PCSK9 using transfection of human cell lines

Duplex ID Hela, 10 hM Hela, 0.1 hM Nerzy, 10 hM Nerzy, 0.1 hM HepG2, 10 hM HepG2, 0.1 hM AD-48399 0.94 0.90 1.18 1.03 1.34 1.05 AD-48399 0.90 1.03 0.87 0.88 0.84 0.91 AD-48399 0.88 1.14 0.90 0.99 0.92 1.04 AD-48399 1.22 0.97 0.95 0.98 0.81 0.92 AD-48399 1.04 0.81 1.01 1.10 1.03 1.09 AD-48399 1.06 1.20 1.14 1.04 1.16 1.01 AD-48400 0.05 0.63 0.10 0.51 0.17 0.69 AD-48400.4 0.06 0.28 0.14 0.31 0.13 0.32 AD-53649.1 0.84 1.05 1.07 0.94 0.97 1.11 AD-53650.1 0.16 0.87 0.41 0.87 0.52 1.12 AD-53651.1 0.47 0.86 0.49 0.92 0.71 1.08 AD-53652.1 0.34 0.93 0.50 0.96 0.40 1.21 AD-53653.1 0.36 0.99 0.43 1.01 0.52 1.13 AD-53654.1 0.85 1.06 0.99 0.92 0.95 1.06 AD-53656.1 0.46 0.92 0.78 0.98 0.80 0.74 AD-53657.1 0.71 0.97 0.75 1.01 0.81 0.94 AD-53658.1 0.32 0.97 0.50 0.91 0.58 1.05 AD-53659.1 0.11 0.86 0.24 0.93 0.22 0.94 AD-53660.1 0.35 1.12 0.43 0.99 0.44 1.31 AD-53661.1 0.94 1.07 0.85 0.95 0.88 0.92 AD-53663.1 0.82 1.03 0.74 1.06 1.04 1.04 AD-53664.1 0.60 0.94 0.61 1.06 0.85 1.28 AD-53665.1 0.33 1.00 0.55 1.01 0.45 1.12

- 111 046901

AD-53666.1 0.09 0.98 0.22 0.97 0.21 1.08 AD-53667.1 0.94 1.07 0.95 0.96 0.95 1.02 AD-53668.1 0.27 0.88 0.36 1.07 0.35 1.13 AD-53669.1 0.81 1.02 0.93 1.08 1.35 1.24 AD-53670.1 0.55 0.94 0.52 0.48 0.45 1.13 AD-53671.1 0.68 1.07 0.78 1.02 0.82 1.27 AD-53672.1 0.22 1.04 0.38 1.06 0.34 1.15 AD-53674.1 0.08 0.67 0.15 0.85 0.15 0.80 AD-53675.1 0.25 1.04 0.43 0.95 0.38 1.04 AD-53676.1 0.81 0.94 0.90 1.14 0.98 1.06 AD-53677.1 0.45 0.90 0.70 0.98 0.70 1.14 AD-53678.1 0.41 1.02 0.72 1.04 0.70 1.15 AD-53679.1 0.44 0.93 0.58 0.88 0.50 0.95 AD-53680.1 0.36 0.99 0.55 0.98 0.52 0.96 AD-53681.1 0.33 0.93 0.57 1.12 0.54 1.11 AD-53682.1 0.84 0.94 0.85 1.06 0.93 1.13 AD-53683.1 0.65 0.78 0.95 1.05 0.73 1.06 AD-53684.1 0.57 0.98 0.79 0.92 0.62 1.08 AD-53685.1 0.85 0.90 0.94 0.95 0.69 0.98 AD-53687.1 0.15 0.83 0.39 1.09 0.34 1.23 AD-53688.1 0.45 0.89 0.72 1.01 0.57 1.19 AD-53689.1 0.56 0.93 1.04 1.14 0.59 1.24 AD-53690.1 0.45 0.79 0.53 1.26 0.41 1.22 AD-53691.1 0.82 1.03 0.91 1.22 0.57 1.05 AD-53692.1 0.68 0.81 0.81 0.89 0.82 1.05 AD-53693.1 0.61 0.92 0.85 0.81 0.53 1.03 AD-53694.1 0.59 0.87 0.58 1.01 0.53 0.82 AD-53695.1 0.91 0.78 1.02 1.23 1.14 1.11 AD-53696.1 0.57 0.98 0.82 1.01 0.68 1.05 AD-53697.1 0.31 1.04 0.40 0.95 0.24 0.90 AD-53698.1 0.17 0.97 0.31 0.92 0.32 0.84 AD-53699.1 0.29 1.00 0.47 0.90 0.47 1.23 AD-53700.1 0.81 1.07 0.94 0.99 0.97 1.08 AD-53701.1 0.89 1.07 0.96 0.84 0.65 0.93 AD-53702.1 0.45 1.03 0.84 1.08 0.72 0.99

- 112 046901

AD-53703.1 0.18 0.79 0.28 0.97 0.29 0.90 AD-53704.1 0.77 0.80 0.88 1.06 0.91 0.95 AD-53705.1 0.63 0.89 0.81 1.06 0.76 0.97 AD-53706.1 0.39 0.82 0.41 1.00 0.48 0.88 AD-53707.1 0.42 0.97 0.60 0.83 0.54 0.80 AD-53708.1 0.49 0.95 0.82 0.96 1.07 1.09 AD-53709.1 0.19 0.90 0.43 0.85 0.38 1.05 AD-53710.1 0.66 1.00 0.82 0.85 0.69 1.08 AD-53711.1 0.40 0.90 0.45 0.95 0.23 1.03 AD-53712.1 0.47 0.99 0.51 0.94 0.62 0.97 AD-53713.1 0.52 1.05 0.69 0.83 0.79 0.94 AD-53714.1 0.43 1.01 0.71 1.11 0.75 1.12 AD-53715.1 0.23 0.99 0.58 1.24 0.58 1.09 AD-53716.1 0.39 1.00 0.52 0.98 0.51 0.80 AD-53717.1 0.20 0.84 0.33 1.02 0.41 1.09 AD-53718.1 0.35 1.08 0.33 1.02 0.45 0.97 AD-53719.1 0.58 0.96 0.74 0.84 0.79 1.01 AD-53720.1 0.31 1.00 0.55 1.09 0.48 1.24 AD-53721.1 0.26 1.02 0.62 0.92 0.49 0.94 AD-53722.1 0.50 0.99 0.86 0.99 0.87 1.26 AD-53723.1 0.28 0.86 0.37 0.92 0.54 1.11 AD-53724.1 0.18 1.11 0.20 0.98 0.36 1.05 AD-53725.1 0.47 1.00 0.63 0.95 0.60 1.04 AD-53726.1 0.19 1.01 0.42 0.96 0.41 1.21 AD-53727.1 0.55 0.82 0.77 1.08 0.68 1.35 AD-53728.1 0.44 0.92 0.65 1.11 0.68 1.44 AD-53729.1 0.11 0.92 0.25 0.94 0.11 1.01 AD-53730.1 0.31 0.91 0.51 1.05 0.59 1.34 AD-53731.1 0.26 0.63 0.42 0.95 0.44 1.07 AD-53732.1 0.17 0.87 0.29 0.99 0.36 0.98 AD-53733.1 1.06 0.72 1.21 1.14 1.07 1.28 AD-53734.1 0.79 0.92 0.93 0.98 0.90 1.33 AD-53735.1 0.54 0.87 0.83 1.12 0.66 1.24 AD-53736.1 0.40 0.69 0.76 1.09 0.76 1.11 AD-53737.1 0.29 0.82 0.41 1.04 0.39 0.96

- 113 046901

AD-53738.1 0.19 0.70 0.24 1.09 0.28 1.10 AD-53739.1 0.91 0.94 0.72 1.07 0.78 1.09 AD-53740.1 0.17 1.06 0.42 1.07 0.32 1.05 AD-53741.1 0.17 0.91 0.32 0.99 0.41 1.05 AD-53742.1 0.55 1.07 0.69 0.97 0.72 1.08 AD-53743.1 0.71 0.99 0.75 0.76 0.58 1.08 AD-53744.1 0.13 0.86 0.50 0.69 0.36 0.87 AD-53745.1 0.46 0.91 0.78 0.72 0.87 0.94 AD-53746.1 0.13 0.82 0.23 0.50 0.28 0.90 AD-53747.1 0.29 1.08 0.54 0.77 0.50 1.07 AD-53748.1 0.04 0.22 0.12 0.21 0.20 0.32 AD-53749.1 0.56 0.76 0.48 0.81 0.53 0.85 AD-53750.1 0.61 0.75 0.69 0.81 0.81 1.07 AD-53751.1 0.25 0.69 0.37 0.72 0.26 0.77 AD-53752.1 0.11 0.43 0.13 0.40 0.16 0.61 AD-53753.1 0.70 0.76 0.75 0.92 0.63 1.09 AD-53754.1 0.06 0.31 0.10 0.34 0.12 0.40 AD-53755.1 0.46 0.91 0.66 0.84 0.56 0.79 AD-53757.1 0.61 0.90 0.50 0.89 0.44 0.91 AD-53758.1 0.11 0.31 0.11 0.29 0.11 0.60 AD-53759.1 0.61 0.87 0.57 0.84 0.56 0.98 AD-53760.1 0.05 0.36 0.14 0.42 0.12 0.53 AD-53761.1 0.95 0.99 0.76 0.72 0.55 0.61 AD-53762.1 0.58 1.18 0.74 0.88 0.69 0.88 AD-53763.1 0.16 0.86 0.19 0.64 0.21 0.75 AD-53764.1 0.70 0.91 0.54 0.85 0.59 0.94 AD-53765.1 0.16 0.63 0.38 0.64 0.30 0.87 AD-53766.1 0.09 0.72 0.16 0.67 0.18 0.63 AD-53767.1 0.30 1.14 0.69 0.83 0.71 0.83 AD-53768.1 0.50 0.98 0.75 0.98 0.52 1.06 AD-53769.1 0.36 1.07 0.26 0.62 0.39 0.83 AD-53770.1 0.27 1.08 0.45 1.00 0.44 1.25 AD-53771.1 0.18 0.62 0.19 0.44 0.21 0.65 AD-53772.1 0.12 0.75 0.30 0.66 0.18 0.85 AD-53773.1 0.39 0.98 0.60 0.84 0.19 1.00

- 114 046901

AD-53774.1 0.07 0.54 0.25 0.40 0.20 0.71 AD-53776.1 0.33 0.97 0.45 0.94 0.34 0.95 AD-53777.1 0.06 0.39 0.18 0.30 0.11 0.41 AD-53778.1 0.09 0.72 0.24 0.69 0.23 0.78 AD-53779.1 0.47 0.66 0.68 0.67 0.57 0.81 AD-53780.1 0.29 0.93 0.61 0.71 0.42 0.92 AD-53781.1 0.41 0.99 0.38 0.87 0.28 1.09 AD-53782.1 0.56 0.47 0.56 0.89 0.41 1.16 AD-53783.1 0.16 0.68 0.32 0.46 0.34 0.61 AD-53784.1 0.15 0.71 0.27 0.72 0.25 0.80 AD-53785.1 0.17 0.90 0.57 0.71 0.29 0.64 AD-53786.1 0.11 0.78 0.28 0.48 0.24 0.74 AD-53787.1 0.34 0.72 0.56 1.04 0.46 0.81 AD-53788.1 0.36 0.83 0.46 0.95 0.32 0.65 AD-53789.1 0.09 0.43 0.18 0.42 0.12 0.47 AD-53790.1 0.10 0.74 0.30 0.65 0.31 0.81 AD-53791.1 0.07 0.51 0.20 0.30 0.16 0.58 AD-53792.1 0.05 0.40 0.11 0.30 0.17 0.64 AD-53793.1 0.23 1.19 0.42 0.84 0.45 1.12 AD-53794.1 0.43 1.15 0.65 0.67 0.42 0.95 AD-53795.1 0.08 0.37 0.15 0.34 0.12 0.48 AD-53796.1 0.07 0.33 0.19 0.49 0.15 0.58 AD-53797.1 0.10 0.43 0.16 0.39 0.20 0.62 AD-53798.1 0.04 0.31 0.09 0.29 0.16 0.60 AD-53799.1 0.22 0.71 0.30 0.85 0.27 0.85 AD-53800.1 0.09 0.34 0.16 0.35 0.14 0.51 AD-53801.1 0.09 0.28 0.25 0.55 0.20 0.54 AD-53802.1 0.10 0.31 0.20 0.40 0.15 0.72 AD-53803.1 0.07 0.27 0.08 0.21 0.14 0.29 AD-53804.1 0.18 0.57 0.29 0.47 0.27 0.79 AD-53805.1 0.69 0.85 0.68 0.85 0.48 1.01 AD-53806.1 0.07 0.38 0.18 0.43 0.13 0.50 AD-53807.1 0.29 0.61 0.26 0.71 0.28 0.68 AD-53808.1 0.15 0.68 0.26 0.50 0.28 0.72 AD-53809.1 0.04 0.23 0.17 0.22 0.12 0.31

- 115 046901

AD-53810.1 0.31 0.88 0.30 0.55 0.36 0.85 AD-53811.1 0.28 0.77 0.33 0.57 0.39 0.87 AD-53812.1 0.12 0.69 0.16 0.62 0.22 0.79 AD-53813.1 0.11 0.33 0.18 0.26 0.17 0.40 AD-53814.1 0.12 0.59 0.57 0.60 0.29 0.57 AD-53815.1 0.03 0.27 0.11 0.18 0.18 0.33 AD-53816.1 0.16 0.89 0.24 0.62 0.32 0.75 AD-53817.1 0.26 0.98 0.44 0.69 0.44 1.18 AD-53818.1 0.12 0.71 0.21 0.55 0.21 0.70 AD-53819.1 0.09 0.52 0.12 0.45 0.12 0.46 AD-53820.1 0.20 0.96 0.27 0.67 0.34 0.74 AD-53821.1 0.04 0.29 0.10 0.23 0.13 0.29 AD-53822.1 0.54 1.05 0.60 0.91 0.48 0.96 AD-53823.1 0.21 0.76 0.41 0.59 0.33 0.85 AD-53824.1 0.16 0.78 0.40 0.51 0.36 0.70 AD-53825.1 0.05 0.40 0.12 0.31 0.24 0.73 AD-53826.1 0.04 0.34 0.10 0.21 0.20 0.34 AD-53827.1 0.40 1.11 0.40 0.84 0.31 1.15 AD-53828.1 0.17 0.51 0.23 0.55 0.17 1.14 AD-53829.1 0.06 0.71 0.21 0.58 0.24 1.21 AD-53830.1 0.07 0.27 0.06 0.30 0.15 0.43 AD-53831.1 0.09 0.56 0.21 0.39 0.16 0.95 AD-53832.1 0.08 0.52 0.26 0.31 0.11 0.76 AD-53833.1 1.04 1.05 0.74 1.24 0.60 1.58 AD-53834.1 0.70 1.14 0.71 0.85 0.38 1.47 AD-53835.1 0.11 0.43 0.33 0.35 0.09 0.53 PBS 0.67 1.13 0.90 0.90 0.99 0.99

Table 5

IC ₅₀ values for PCSK9 for selected duplexes when freely taken up into cynomolgus monkey cells and when transfected into the human Hep3B cell line

Transfection Free absorption Duplex IC50, nM IC50, nM AD-53806.1 0.07 18.00 AD-53748.1 0.06 16.88 AD-53815.1 0.05 39.21 AD-53809.1 0.05 571.00 AD-53821.1 0.05 55.41 AD-53830.1 0.08 undefined AD-53754.1 0.25 67.42 AD-53800.1 0.30 undefined AD-53798.1 0.04 undefined AD-53789.1 0.37 undefined AD-48400.4 0.23 undefined

- 116 046901

AD-48400 was also evaluated for in vivo efficacy in female mice carrying a human PCSK9 transgene randomly inserted into the genome without disrupting the endogenous PCSK9 gene. Briefly, mice were injected subcutaneously with a single dose of 20 mg/kg on day 0, a single dose of 100 mg/kg on day 0, and five doses of 20 mg/kg on days 0, 1, 2, 3, 4, and 5. Serum was collected on days -6, -3, 0, 1, 2, 3, 4 and 7 and the amount of PCSK9 protein was determined by ELISA assay. The results of these analyzes are shown in FIG. 2, and it can be seen that for AD-48400 conjugated to GalNAc, at all three doses tested, there is a dose-dependent effect.

The six most effective duplexes identified using the in vitro assays described above were evaluated for potency and duration of response in vivo. PCSK9 transgenic mice were injected on days 0, 1, 2, 3, and 4 with either 5 mg/kg or 25 mg/kg AD-48400, AD-53830, AD53806, AD-53815, AD-53748, or AD-53798. Serum PCSK9 protein levels were determined by ELISA on days -3, 0, 1, 2, 3, 4, 8, 11, 15, 18, 22, 26, 31, and 36. The results are shown in Fig. 3A and 3B.

Example 3. Prototype optimization.

Based on the potency assays described in Example 2 above, siRNAs to PCSK9 based on the parent sequences of AD-53815 and AD-53806, with a number of chemical modifications, were assessed for potency in free uptake assays into primary cynomolgus macaque hepatocytes (MCH) at 200 nM, 20 nM, 2 nM and 0.2 nM. For all doses except the 0.2 nM dose, assays were performed in duplicate and data were expressed as the average fraction of transcript remaining relative to control. The 0.2 nM dose was assessed once. The results of these analyzes are shown in table. 6.

- 117 046901

Table 6

Efficacy Tests to Optimize Prototype AD-53815 and AD-53806 Using Free Uptake into Cynomolgus Macaque Hepatocytes

Original duplex Duplex ID 200 nm, avg. 20 nM, avg. 2nM, avg. 0.2 nM-384 200 nM, SD 20 hM,SD 2 nM, SD AD-53815 AD-53815.5 0.45 0.48 0.74 0.95 0.05 0.00 0.05 AD-53815 AD-53815.4 0.43 0.54 0.84 0.83 0.00 0.04 0.10 AD-53815 AD-56633.1 0.33 0.52 0.82 0.88 0.04 0.01 0.10 AD-53815 AD-56617.1 0.40 0.65 0.91 1.06 0.03 0.02 0.03 AD-53815 AD-56623.1 0.52 0.61 0.87 1.05 0.03 0.04 0.21 AD-53815 AD-56629.1 0.50 0.62 0.87 1.05 0.04 0.13 0.17 AD-53815 AD-56635.1 0.45 0.71 0.92 1.03 0.03 0.02 0.03 AD-53815 AD-56641.1 0.47 0.73 0.84 1.04 0.04 0.00 0.17 AD-53815 AD-56625.1 0.49 0.55 0.82 1.12 0.01 0.16 0.16 AD-53815 AD-56631.1 0.48 0.57 0.82 1.05 0.04 0.11 0.06 AD-53815 AD-56637.1 0.48 0.58 0.76 1.01 0.01 0.14 0.13 AD-53815 AD-56643.1 0.59 0.77 0.93 1.04 0.05 0.01 0.04 AD-53815 AD-56649.1 0.76 0.87 0.95 1.06 0.02 0.07 0.14 AD-53815 AD-56655.1 0.73 0.86 0.85 0.96 0.01 0.04 0.11 AD-53815 AD-56615.1 0.58 0.70 0.92 0.98 0.00 0.02 0.03 AD-53815 AD-56621.1 0.71 0.76 0.93 0.95 0.18 0.07 0.07 AD-53815 AD-56627.1 0.58 0.72 0.93 0.94 0.01 0.08 0.02 AD-53815 AD-56639.1 0.52 0.57 0.72 0.94 0.16 0.00 0.04 AD-53815 AD-56645.1 0.32 0.49 0.74 0.88 0.03 0.03 0.14 AD-53815 AD-56651.1 0.71 0.94 0.88 0.88 0.08 0.29 0.12 AD-53815 AD-56610.1 0.31 0.57 0.82 0.93 0.02 0.01 0.04 AD-53815 AD-56616.1 0.47 0.68 0.70 1.01 0.06 0.08 0.34 AD-53815 AD-56622.1 0.47 0.66 0.88 0.95 0.06 0.10 0.10 AD-53815 AD-56628.1 1.02 1.15 1.04 0.99 0.00 0.12 0.02 AD-53815 AD-56634.1 0.75 0.90 0.97 1.03 0.11 0.04 0.07 AD-53815 AD-56640.1 0.58 0.76 0.81 1.01 0.10 0.05 0.12 AD-53815 AD-56646.1 0.77 0.94 0.82 0.99 0.09 0.12 0.14 AD-53815 AD-56652.1 0.61 0.74 0.78 0.89 0.00 0.00 0.03

- 118 046901

AD-53815 AD-56611.1 0.93 1.02 1.16 0.89 0.05 0.15 0.05 AD-53815 AD-56647.1 0.38 0.58 0.79 0.94 0.05 0.08 0.00 AD-53815 AD-56653.1 0.47 0.46 0.63 0.84 0.12 0.04 0.04 AD-53815 AD-56612.1 0.41 0.61 0.88 0.85 0.03 0.09 0.09 AD-53815 AD-56618.1 0.64 0.60 1.03 1.08 0.21 0.09 0.01 AD-53815 AD-56624.1 0.46 0.61 0.85 1.05 0.04 0.17 0.15 AD-53815 AD-56630.1 0.49 0.69 0.87 1.01 0.01 0.00 0.15 AD-53815 AD-56636.1 0.49 0.57 0.82 1.13 0.01 0.05 0.03 AD-53815 AD-56642.1 0.43 0.55 0.82 1.09 0.00 0.08 0.03 AD-53815 AD-56648.1 0.48 0.66 0.80 0.96 0.00 0.04 0.08 AD-53815 AD-56654.1 0.43 0.53 0.72 0.84 0.01 0.00 0.07 AD-53815 AD-56613.1 0.54 0.61 0.81 0.91 0.16 0.08 0.19 AD-53815 AD-56619.1 0.55 0.67 1.02 1.06 0.04 0.07 0.07 AD-53815 AD-56614.1 0.42 0.56 0.86 0.90 0.05 0.04 0.10 AD-53815 AD-56620.1 0.41 0.52 0.85 0.84 0.01 0.12 0.08 AD-53815 AD-56626.1 0.59 0.68 0.90 1.12 0.01 0.03 0.10 AD-53815 AD-56632.1 0.60 0.73 0.91 1.05 0.04 0.09 0.10 AD-53815 AD-56638.1 0.68 0.89 0.94 1.19 0.03 0.03 0.18 AD-53815 AD-56644.1 0.84 0.89 1.09 1.09 0.08 0.08 0.06 AD-53815 AD-56650.1 0.86 0.95 1.05 1.05 0.10 0.01 0.10 AD-53815 AD-56656.1 0.53 0.64 0.92 0.88 0.09 0.04 0.14 AD-53815 AD-56662.1 0.55 0.61 0.96 1.03 0.02 0.09 0.01 AD-53815 AD-56668.1 0.76 0.79 0.99 1.10 0.07 0.11 0.06 AD-53815 AD-56673.1 0.81 0.87 1.12 1.09 0.01 0.15 0.13 AD-53815 AD-56678.1 0.84 0.76 1.12 1.05 0.04 0.24 0.05 AD-53815 AD-56683.1 0.88 0.93 1.08 1.06 0.05 0.10 0.06 AD-53815 AD-56688.1 0.80 0.86 0.93 0.99 0.10 0.11 0.19 AD-53815 AD-56657.1 0.45 0.63 0.84 0.88 0.20 0.04 0.09 AD-53815 AD-56663.1 0.35 0.49 0.77 1.03 0.00 0.07 0.04 AD-53815 AD-56669.1 0.53 0.68 0.99 1.11 0.00 0.18 0.03 AD-53815 AD-56674.1 0.44 0.64 0.84 1.03 0.06 0.01 0.17 AD-53815 AD-56679.1 0.52 0.67 0.77 1.01 0.01 0.06 0.14 AD-53815 AD-56684.1 0.43 0.59 0.84 1.08 0.01 0.03 0.04 AD-53815 AD-56689.1 0.55 0.57 0.73 0.95 0.09 0.01 0.11 AD-53815 AD-56693.1 0.45 0.48 0.65 0.84 0.04 0.02 0.11

- 119 046901

AD-53815 AD-56658.1 0.46 0.55 0.85 0.84 0.21 0.09 0.07 AD-53815 AD-56664.1 0.35 0.60 0.80 0.91 0.13 0.03 0.14 AD-53815 AD-56670.1 0.62 0.61 0.90 1.11 0.17 0.06 0.00 AD-53815 AD-56680.1 0.74 0.90 1.00 0.91 0.05 0.01 0.05 AD-53815 AD-56685.1 0.64 0.64 0.77 1.07 0.15 0.01 0.15 AD-53815 AD-56690.1 0.39 0.61 0.75 0.97 0.13 0.03 0.08 AD-53815 AD-56694.1 0.41 0.53 0.67 0.94 0.01 0.00 0.04 AD-53815 AD-56659.1 0.57 0.58 0.84 0.95 0.25 0.09 0.05 AD-53815 AD-56665.1 0.38 0.51 0.78 1.01 0.05 0.07 0.17 AD-53815 AD-56671.1 0.32 0.45 0.78 0.94 0.03 0.05 0.01 AD-53815 AD-56676.1 0.31 0.55 0.81 1.02 0.03 0.13 0.02 AD-53815 AD-56681.1 0.54 0.75 0.88 1.02 0.02 0.07 0.11 AD-53815 AD-56686.1 0.50 0.74 0.86 1.03 0.01 0.10 0.10 AD-53815 AD-56691.1 0.44 0.56 0.79 1.03 0.01 0.00 0.05 AD-53815 AD-56695.1 0.37 0.70 0.67 0.89 0.01 0.29 0.11 AD-53815 AD-56660.1 0.36 0.73 0.83 0.93 0.02 0.22 0.10 AD-53815 AD-56666.1 0.39 0.47 0.74 0.94 0.02 0.05 0.13 AD-53815 AD-56672.1 0.63 0.55 0.87 1.03 0.25 0.10 0.04 AD-53815 AD-56677.1 0.54 0.70 0.85 0.99 0.24 0.11 0.00 AD-53815 AD-56682.1 0.48 0.57 0.90 0.96 0.11 0.09 0.05 AD-53815 AD-56687.1 0.81 0.94 1.06 1.08 0.07 0.02 0.05 AD-53815 AD-56692.1 0.45 0.64 0.73 0.95 0.03 0.13 0.05 AD-53815 AD-56696.1 0.40 0.48 0.66 0.95 0.01 0.04 0.06 AD-53815 AD-56661.1 0.52 0.54 0.75 0.98 0.22 0.06 0.04 AD-53815 AD-56667.1 0.40 0.68 0.87 1.03 0.03 0.03 0.11 AD-53806 AD-53806.11 0.28 0.44 0.74 0.98 0.05 0.01 0.13 AD-53806 AD-53806.13 0.31 0.36 0.65 0.92 0.01 0.08 0.06 AD-53806 AD-53806.12 0.53 0.56 0.70 1.04 0.00 0.01 0.15 AD-53806 AD-53806.5 0.34 0.54 0.85 0.87 0.01 0.00 0.10 AD-53806 AD-53806.6 0.41 0.51 0.77 0.91 0.05 0.04 0.08 AD-53806 AD-53806.7 0.39 0.58 0.75 0.97 0.02 0.16 0.14 AD-53806 AD-53806.8 0.35 0.49 0.69 0.91 0.06 0.03 0.09 AD-53806 AD-53806.9 0.36 0.55 0.77 1.01 0.04 0.07 0.13 AD-53806 AD-53806.10 0.29 0.44 0.73 0.93 0.04 0.10 0.14 AD-53806 AD-56979.1 0.43 0.50 0.78 0.96 0.01 0.03 0.11

- 120 046901

AD-53806 AD-56979.2 0.32 0.47 0.65 1.02 0.02 0.11 0.05 AD-53806 AD-56975.3 0.27 0.57 0.72 0.83 0.01 0.16 0.08 AD-53806 AD-56975.4 0.55 0.67 0.81 0.92 0.11 0.10 0.04 AD-53806 AD-56975.5 0.34 0.54 0.71 0.94 0.04 0.22 0.10 AD-53806 AD-56975.1 0.38 0.53 0.74 0.93 0.13 0.14 0.02 AD-53806 AD-56975.2 0.50 0.62 0.82 0.98 0.09 0.16 0.11 AD-53806 AD-56983.1 0.49 0.72 0.89 1.11 0.10 0.09 0.21 AD-53806 AD-56983.2 0.74 0.89 1.14 1.16 0.10 0.06 0.02 AD-53806 AD-56983.3 0.91 1.05 1.02 1.04 0.09 0.10 0.08 AD-53806 AD-56983.4 0.40 0.57 0.83 1.05 0.03 0.02 0.08 AD-53806 AD-56983.5 0.33 0.51 0.83 0.90 0.03 0.04 0.03 AD-53806 AD-56977.3 0.44 0.49 0.62 0.95 0.17 0.16 0.06 AD-53806 AD-56977.1 0.27 0.58 0.81 0.88 0.06 0.07 0.08 AD-53806 AD-56977.2 0.41 0.60 0.81 0.90 0.01 0.07 0.12 AD-53806 AD-56976.1 0.40 0.64 0.85 0.90 0.14 0.21 0.01 AD-53806 AD-56976.2 0.37 0.47 0.70 1.01 0.09 0.10 0.13 AD-53806 AD-56980.1 0.47 0.54 0.83 0.97 0.12 0.02 0.14 AD-53806 AD-56980.2 0.44 0.55 0.81 1.08 0.15 0.11 0.08 AD-53806 AD-56984.1 0.41 0.63 0.81 1.08 0.04 0.07 0.14 AD-53806 AD-56984.2 0.32 0.58 0.86 1.04 0.02 0.17 0.07 AD-53806 AD-56987.1 0.37 0.63 0.82 1.11 0.08 0.08 0.05 AD-53806 AD-56987.2 0.33 0.59 0.79 1.02 0.05 0.05 0.13 AD-53806 AD-56991.1 0.36 0.57 0.73 1.08 0.01 0.07 0.18 AD-53806 AD-56993.1 0.41 0.54 0.75 0.99 0.12 0.09 0.06 AD-53806 AD-56995.1 0.35 0.45 0.67 1.00 0.07 0.02 0.12 AD-53806 AD-56978.1 0.35 0.67 0.88 0.91 0.04 0.22 0.05 AD-53806 AD-56978.2 0.47 0.55 0.78 1.12 0.03 0.01 0.07 AD-53806 AD-56981.1 0.45 0.65 0.86 1.08 0.01 0.16 0.15 AD-53806 AD-56985.1 0.53 0.61 1.08 1.14 0.02 0.09 0.07 AD-53806 AD-56988.1 0.62 0.81 0.91 1.13 0.01 0.05 0.20 AD-53806 AD-56988.2 0.76 0.94 0.85 1.14 0.17 0.10 0.11 AD-53806 AD-56988.3 0.55 0.79 0.86 1.19 0.04 0.05 0.16 AD-53806 AD-56982.1 0.40 0.65 0.84 1.07 0.04 0.10 0.09 AD-53806 AD-56982.2 0.38 0.50 0.70 1.01 0.03 0.03 0.08 AD-53806 AD-56986.1 0.45 0.57 0.80 1.12 0.02 0.11 0.15

- 121 046901

AD-53806 AD-56986.2 0.49 0.59 0.79 1.04 0.01 0.05 0.17 AD-53806 AD-56989.1 0.69 0.84 0.95 1.12 0.08 0.06 0.12 AD-53806 AD-56990.1 0.49 0.56 0.79 1.08 0.03 0.02 0.13 AD-53806 AD-56992.1 0.61 0.70 0.90 1.14 0.01 0.04 0.14 AD-53806 AD-56992.2 0.48 0.63 0.87 0.99 0.05 0.10 0.07 AD-53806 AD-56994.1 0.88 0.89 0.97 1.11 0.02 0.06 0.13 AD-53806 AD-56994.2 0.34 0.42 0.73 0.98 0.01 0.05 0.05 AD-53806 AD-56996.1 0.50 0.59 0.77 0.95 0.07 0.12 0.10 AD-53806 AD-57001.1 0.44 0.54 0.77 1.08 0.01 0.05 0.12 AD-53806 AD-57007.1 0.62 0.68 0.91 1.11 0.04 0.02 0.19 AD-53806 AD-57013.1 0.65 0.78 0.94 1.17 0.05 0.04 0.22 AD-53806 AD-57019.1 0.57 0.74 0.87 1.14 0.01 0.09 0.13 AD-53806 AD-57022.1 0.46 0.48 0.72 0.98 0.14 0.01 0.17 AD-53806 AD-57025.1 0.37 0.47 0.68 0.92 0.04 0.11 0.06 AD-53806 AD-56997.1 0.41 0.56 0.77 0.88 0.00 0.10 0.09 AD-53806 AD-57002.1 0.46 0.58 0.81 1.04 0.03 0.03 0.08 AD-53806 AD-57008.1 0.68 0.75 0.91 1.13 0.02 0.03 0.15 AD-53806 AD-57014.1 0.80 0.82 0.99 1.17 0.02 0.01 0.12 AD-53806 AD-57020.1 0.51 0.53 0.81 1.07 0.17 0.03 0.07 AD-53806 AD-57020.2 0.37 0.46 0.68 1.02 0.04 0.07 0.13 AD-53806 AD-57026.1 0.34 0.51 0.68 0.97 0.01 0.08 0.06 AD-53806 AD-57003.1 0.76 0.90 0.94 1.11 0.02 0.16 0.11 AD-53806 AD-57009.1 0.81 0.88 0.93 0.98 0.01 0.03 0.10 AD-53806 AD-57015.1 0.72 0.92 0.90 1.04 0.01 0.05 0.15 AD-53806 AD-57023.1 0.41 0.50 0.75 1.00 0.08 0.07 0.06 AD-53806 AD-57027.1 0.38 0.46 0.68 0.93 0.11 0.00 0.07 AD-53806 AD-56998.1 0.45 0.57 0.94 0.98 0.01 0.06 0.11 AD-53806 AD-57004.1 0.39 0.61 0.80 1.13 0.03 0.04 0.13 AD-53806 AD-57010.1 0.43 0.64 0.81 1.00 0.01 0.07 0.15 AD-53806 AD-57016.1 0.44 0.71 0.80 0.97 0.01 0.25 0.05 AD-53806 AD-56999.2 0.49 0.60 0.69 1.04 0.04 0.02 0.16 AD-53806 AD-56999.1 0.39 0.55 0.68 0.96 0.01 0.09 0.10 AD-53806 AD-57021.1 0.40 0.58 0.71 1.02 0.03 0.03 0.11 AD-53806 AD-57024.1 0.41 0.49 0.68 1.02 0.14 0.00 0.10 AD-53806 AD-57005.1 0.45 0.56 0.87 1.06 0.03 0.03 0.20

- 122 046901

AD-53806 AD-57011.1 0.53 0.63 0.92 1.02 0.02 0.07 0.10 AD-53806 AD-57017.1 0.48 0.60 0.81 1.07 0.00 0.01 0.12 AD-53806 AD-57000.2 0.50 0.60 0.74 0.93 0.04 0.01 0.02 AD-53806 AD-57000.3 0.54 0.49 0.72 0.97 0.22 0.08 0.00 AD-53806 AD-57000.1 0.70 0.76 0.80 0.95 0.02 0.05 0.04 AD-53806 AD-57006.2 0.48 0.75 0.76 0.94 0.00 0.31 0.12 AD-53806 AD-57006.3 0.45 0.57 0.71 0.98 0.08 0.09 0.12 AD-53806 AD-57006.1 0.64 0.76 0.84 0.97 0.00 0.11 0.10 AD-53806 AD-57012.1 0.53 0.83 0.79 0.93 0.04 0.42 0.02 AD-53806 AD-57018.1 0.67 0.73 0.72 0.93 0.07 0.04 0.03

siRNAs with a number of chemical modifications based on the parent sequences of AD-53815 and AD-53806 were also screened for in vitro potency by transfecting Hep3B cells at 10 nM and 0.1 nM. The results of this test for structure-function relationships are shown in Table. 7 and are expressed as the mean fraction of transcript remaining relative to control +/- SD.

Table 7

Efficacy Tests for Prototype Optimization of AD-53815 and AD-53806 ______________Using Transfection of Human Cells__________________

Original duplex Duplex ID Trans., 10 nM, avg. Trans., 10 nM, SD Trans., 0.1 nM, avg. Trans., 0.1 nM, SD AD-53815 AD-53815.5 0.14 0.05 0.24 undefined AD-53815 AD-53815.4 0.18 0.07 0.38 undefined AD-53815 AD-56633.1 0.18 0.10 0.24 undefined AD-53815 AD-56617.1 0.13 0.06 0.25 undefined AD-53815 AD-56623.1 0.14 0.05 0.24 undefined AD-53815 AD-56629.1 0.14 0.02 0.17 undefined AD-53815 AD-56635.1 0.12 0.02 0.22 undefined AD-53815 AD-56641.1 0.15 0.01 0.16 undefined AD-53815 AD-56625.1 0.12 0.03 0.29 undefined AD-53815 AD-56631.1 0.13 0.01 0.20 undefined AD-53815 AD-56637.1 0.22 0.14 0.16 undefined

- 123 046901

AD-53815 AD-56643.1 0.18 0.08 0.16 undefined AD-53815 AD-56649.1 0.16 0.00 0.19 undefined AD-53815 AD-56655.1 0.24 0.11 0.24 undefined AD-53815 AD-56615.1 0.15 0.00 0.32 undefined AD-53815 AD-56621.1 0.20 0.07 0.41 undefined AD-53815 AD-56627.1 0.17 0.04 0.31 undefined AD-53815 AD-56639.1 0.19 0.08 0.24 undefined AD-53815 AD-56645.1 0.19 0.09 0.27 undefined AD-53815 AD-56651.1 0.29 0.09 0.68 undefined AD-53815 AD-56610.1 0.21 0.11 0.23 undefined AD-53815 AD-56616.1 0.16 0.04 0.29 undefined AD-53815 AD-56622.1 0.18 0.07 0.36 undefined AD-53815 AD-56628.1 0.28 0.07 0.60 undefined AD-53815 AD-56634.1 0.16 0.04 0.29 undefined AD-53815 AD-56640.1 0.21 0.09 0.26 undefined AD-53815 AD-56646.1 0.27 0.21 0.37 undefined AD-53815 AD-56652.1 0.26 0.08 0.29 undefined AD-53815 AD-56611.1 0.35 0.11 0.96 undefined AD-53815 AD-56647.1 0.17 0.09 0.13 undefined AD-53815 AD-56653.1 0.17 0.09 0.28 undefined AD-53815 AD-56612.1 0.17 0.07 0.24 undefined AD-53815 AD-56618.1 0.14 0.00 0.26 undefined AD-53815 AD-56624.1 0.15 0.02 0.27 undefined AD-53815 AD-56630.1 0.13 0.01 0.24 undefined AD-53815 AD-56636.1 0.17 0.08 0.22 undefined AD-53815 AD-56642.1 0.12 0.03 0.13 undefined AD-53815 AD-56648.1 0.15 0.05 0.21 undefined AD-53815 AD-56654.1 0.22 0.10 0.24 undefined AD-53815 AD-56613.1 0.17 0.07 0.40 undefined AD-53815 AD-56619.1 0.21 0.12 0.30 undefined AD-53815 AD-56614.1 0.12 0.01 0.23 undefined AD-53815 AD-56620.1 0.12 0.02 0.15 undefined AD-53815 AD-56626.1 0.14 0.03 0.20 undefined AD-53815 AD-56632.1 0.12 0.02 0.21 undefined AD-53815 AD-56638.1 0.15 0.10 0.23 undefined

- 124 046901

AD-53815 AD-56644.1 0.23 0.11 0.17 undefined AD-53815 AD-56650.1 0.13 0.03 0.20 undefined AD-53815 AD-56656.1 0.26 0.03 0.27 undefined AD-53815 AD-56662.1 0.13 0.06 0.18 undefined AD-53815 AD-56668.1 0.19 0.05 0.20 undefined AD-53815 AD-56673.1 0.18 0.05 0.21 undefined AD-53815 AD-56678.1 0.17 0.00 0.20 undefined AD-53815 AD-56683.1 0.29 0.22 0.27 undefined AD-53815 AD-56688.1 0.19 0.02 0.18 undefined AD-53815 AD-56657.1 0.18 0.14 0.34 undefined AD-53815 AD-56663.1 0.11 0.04 0.18 undefined AD-53815 AD-56669.1 0.11 0.02 0.31 undefined AD-53815 AD-56674.1 0.14 0.00 0.21 undefined AD-53815 AD-56679.1 0.14 0.05 0.19 undefined AD-53815 AD-56684.1 0.14 0.03 0.19 undefined AD-53815 AD-56689.1 0.18 0.09 0.18 undefined AD-53815 AD-56693.1 0.19 0.11 0.21 undefined AD-53815 AD-56658.1 0.19 0.13 0.30 undefined AD-53815 AD-56664.1 0.15 0.07 0.20 undefined AD-53815 AD-56670.1 0.18 0.10 0.26 undefined AD-53815 AD-56680.1 0.27 0.05 0.31 undefined AD-53815 AD-56685.1 0.14 0.02 0.28 undefined AD-53815 AD-56690.1 0.10 0.03 0.18 undefined AD-53815 AD-56694.1 0.15 0.06 0.17 undefined AD-53815 AD-56659.1 0.16 0.04 0.27 undefined AD-53815 AD-56665.1 0.14 0.06 0.26 undefined AD-53815 AD-56671.1 0.11 0.01 0.29 undefined AD-53815 AD-56676.1 0.14 0.06 0.20 undefined AD-53815 AD-56681.1 0.15 0.03 0.30 undefined AD-53815 AD-56686.1 0.15 0.03 0.26 undefined AD-53815 AD-56691.1 0.11 0.02 0.16 undefined AD-53815 AD-56695.1 0.14 0.06 0.24 undefined AD-53815 AD-56660.1 0.10 0.03 0.37 undefined AD-53815 AD-56666.1 0.18 0.13 0.22 undefined AD-53815 AD-56672.1 0.14 0.02 0.35 undefined

- 125 046901

AD-53815 AD-56677.1 0.15 0.04 0.23 undefined AD-53815 AD-56682.1 0.14 0.06 0.28 undefined AD-53815 AD-56687.1 0.24 0.01 0.53 undefined AD-53815 AD-56692.1 0.09 0.01 0.36 undefined AD-53815 AD-56696.1 0.16 0.09 0.26 undefined AD-53815 AD-56661.1 0.21 0.15 0.48 undefined AD-53815 AD-56667.1 0.22 0.16 0.26 undefined AD-53806 AD-53806.11 0.19 0.05 0.25 0.06 AD-53806 AD-53806.13 0.21 0.07 0.21 0.16 AD-53806 AD-53806.12 0.21 0.08 0.21 0.02 AD-53806 AD-53806.5 0.22 0.01 0.29 0.06 AD-53806 AD-53806.6 0.24 0.07 0.33 0.12 AD-53806 AD-53806.7 0.19 0.02 0.24 0.11 AD-53806 AD-53806.8 0.20 0.01 0.23 0.05 AD-53806 AD-53806.9 0.22 0.01 0.19 0.06 AD-53806 AD-53806.10 0.17 0.01 0.21 0.07 AD-53806 AD-56979.1 0.18 0.00 0.29 0.14 AD-53806 AD-56979.2 0.24 0.11 0.24 0.12 AD-53806 AD-56975.3 0.26 0.09 0.28 0.18 AD-53806 AD-56975.4 0.35 0.02 0.50 0.23 AD-53806 AD-56975.5 0.17 0.01 0.21 0.18 AD-53806 AD-56975.1 0.24 0.09 0.32 0.12 AD-53806 AD-56975.2 0.19 0.04 0.16 0.02 AD-53806 AD-56983.1 0.17 0.01 0.32 0.18 AD-53806 AD-56983.2 0.28 0.07 0.63 0.15 AD-53806 AD-56983.3 1.22 0.61 0.83 0.02 AD-53806 AD-56983.4 0.25 0.10 0.24 0.10 AD-53806 AD-56983.5 0.17 0.01 0.26 0.15 AD-53806 AD-56977.3 0.31 0.11 0.28 0.23 AD-53806 AD-56977.1 0.22 0.04 0.34 0.12 AD-53806 AD-56977.2 0.22 0.05 0.29 0.16 AD-53806 AD-56976.1 0.21 0.09 0.34 0.20 AD-53806 AD-56976.2 0.17 0.03 0.25 0.04 AD-53806 AD-56980.1 0.22 0.04 0.20 0.02 AD-53806 AD-56980.2 0.19 0.01 0.20 0.06

- 126 046901

AD-53806 AD-56984.1 0.24 0.11 0.22 0.10 AD-53806 AD-56984.2 0.19 0.01 0.21 0.10 AD-53806 AD-56987.1 0.19 0.05 0.29 0.19 AD-53806 AD-56987.2 0.24 0.03 0.24 0.09 AD-53806 AD-56991.1 0.17 0.01 0.17 0.08 AD-53806 AD-56993.1 0.14 0.09 0.22 0.06 AD-53806 AD-56995.1 0.19 0.07 0.27 0.13 AD-53806 AD-56978.1 0.27 0.12 0.36 0.12 AD-53806 AD-56978.2 0.24 0.03 0.20 0.01 AD-53806 AD-56981.1 0.22 0.03 0.28 0.17 AD-53806 AD-56985.1 0.21 0.00 0.28 0.04 AD-53806 AD-56988.1 0.20 0.02 0.24 0.02 AD-53806 AD-56988.2 0.20 0.03 0.27 0.13 AD-53806 AD-56988.3 0.23 0.03 0.27 0.01 AD-53806 AD-56982.1 0.23 0.06 0.24 0.00 AD-53806 AD-56982.2 0.21 0.06 0.18 0.07 AD-53806 AD-56986.1 0.23 0.05 0.20 0.06 AD-53806 AD-56986.2 0.24 0.04 0.25 0.13 AD-53806 AD-56989.1 0.31 0.02 0.43 0.00 AD-53806 AD-56990.1 0.27 0.00 0.28 0.10 AD-53806 AD-56992.1 0.27 0.06 0.31 0.01 AD-53806 AD-56992.2 0.22 0.10 0.30 0.14 AD-53806 AD-56994.1 0.97 0.05 0.85 0.09 AD-53806 AD-56994.2 0.22 0.09 0.26 0.01 AD-53806 AD-56996.1 0.18 0.04 0.31 0.08 AD-53806 AD-57001.1 0.24 0.09 0.23 0.08 AD-53806 AD-57007.1 0.25 0.01 0.27 0.03 AD-53806 AD-57013.1 0.30 0.08 0.33 0.02 AD-53806 AD-57019.1 0.29 0.03 0.28 0.02 AD-53806 AD-57022.1 0.20 0.06 0.21 0.05 AD-53806 AD-57025.1 0.23 0.12 0.25 0.15 AD-53806 AD-56997.1 0.20 0.05 0.25 0.11 AD-53806 AD-57002.1 0.21 0.07 0.28 0.01 AD-53806 AD-57008.1 0.26 0.01 0.31 0.01 AD-53806 AD-57014.1 0.32 0.03 0.43 0.05

- 127 046901

AD-53806 AD-57020.1 0.19 0.00 0.23 0.01 AD-53806 AD-57020.2 0.20 0.08 0.28 0.22 AD-53806 AD-57026.1 0.34 0.24 0.37 0.24 AD-53806 AD-57003.1 0.34 0.04 0.45 0.15 AD-53806 AD-57009.1 0.30 0.07 0.40 0.02 AD-53806 AD-57015.1 0.32 0.01 0.47 0.04 AD-53806 AD-57023.1 0.17 0.06 0.27 0.13 AD-53806 AD-57027.1 0.20 0.03 0.19 0.11 AD-53806 AD-56998.1 0.23 0.09 0.29 0.24 AD-53806 AD-57004.1 0.24 0.13 0.30 0.12 AD-53806 AD-57010.1 0.23 0.09 0.23 0.11 AD-53806 AD-57016.1 0.21 0.03 0.23 0.06 AD-53806 AD-56999.2 0.25 0.10 0.35 0.05 AD-53806 AD-56999.1 0.24 0.08 0.28 0.21 AD-53806 AD-57021.1 0.18 0.04 0.29 0.17 AD-53806 AD-57024.1 0.20 0.09 0.28 0.11 AD-53806 AD-57005.1 0.18 0.10 0.29 0.17 AD-53806 AD-57011.1 0.21 0.07 0.26 0.12 AD-53806 AD-57017.1 0.20 0.07 0.29 0.21 AD-53806 AD-57000.2 0.20 0.04 0.29 0.21 AD-53806 AD-57000.3 0.22 0.11 0.30 0.16 AD-53806 AD-57000.1 0.25 0.14 0.38 0.33 AD-53806 AD-57006.2 0.22 0.14 0.31 0.18 AD-53806 AD-57006.3 0.19 0.09 0.31 0.25 AD-53806 AD-57006.1 0.20 0.12 0.41 0.29 AD-53806 AD-57012.1 0.16 0.05 0.36 0.17 AD-53806 AD-57018.1 0.20 0.37 0.10 0.14

To determine whether any of the siRNAs from the in vitro SAR assay were more effective at silencing PCSK9 than the parent siRNA (AD-53815) to PCSK9, transgenic mice were administered a single dose of 3 mg/kg siRNA as shown in FIG. 4, and 72 hours post-dose, PCSK9 protein levels were determined using an ELISA assay. The results shown in FIG. 5 indicate that AD-57928 is unexpectedly effective at silencing PCSK9. In fig. Figure 6 shows that not only did a single dose of AD-57928 effectively knock down PCSK9 protein expression, but there was also a dose-dependent effect with AD-57928.

Example 4: Fractional dose study using AD-57928.

The ability of AD-57928 to suppress PCSK9 protein expression was assessed by measuring human PCSK9 protein (hPCSK9) levels in the serum of hPCSK9 transgenic mice after administration of AD-57928. AD-57928 was administered subcutaneously using six different dosing schedules that included a saturation phase for the first week (a single dose of 0.5 mg/kg, 1 mg/kg, or 2 mg/kg daily for 5 consecutive days) followed by a maintenance phase (a dose of either 0.5 mg/kg, 1 mg/kg, or 2 mg/kg was administered once or twice a week for 5 weeks), which are described in Table. 8 below. The last dose was administered on day 38. Each dosing regimen was studied using a group of 3 mice, which included two males and one female. The control group received injections with PBS.

- 128 046901

Table 8

Dosage schedules for administration of AD-57928

Object under study 1 Week 2-6 weeks Saturation dose (mg/kg) Total dose (mg/kg) Maintenance dose (mg/kg) Total weekly dose (mg/kg) PBS 5x 0 2x 0 AD-57928 5x2 10 2x2 4 AD-57928 5x2 10 1x2 2 AD-57928 5x1 5 2x1 2 AD-57928 5x1 5 1x1 1 AD-57928 5x0.5 2.5 2x0.5 1 AD-57928 5x0.5 2.5 1x0.5 0.5

Serum was collected 3 days before the first dose and on days 1, 4, 7, 10, 14, 17, 21, 24, 28, 31, 35, 38, 42, 45, 52, 59, and 65 after the first dose. Serum PCSK9 protein levels were assessed using ELISA assay. The results are shown in Fig. 6, 7 and 8.

A decrease in serum hPCSK9 protein levels was observed 72 hours after the first dose and lasted until day 38. Administration of AD-57928 at loading dose levels of 5x2 mg/kg, 5x1 mg/kg, and 5x0.5 mg/kg resulted in ~90%, ~70%, and ~60% reductions in serum hPCSK9 protein levels, respectively (see Figure 6 -8). In the group dosed using the 2x maintenance dosing schedule, reduced hPCSK9 levels lasted 1 week longer than in the group dosed using the 1x maintenance dosing schedule and returned to baseline levels 4 weeks after the last dose (see fig. 6-8).

Example 5: Phosphothioate titration.

In order to determine the effect of the number and position of phosphorothioate modifications on the ability of dsRNA to inhibit PCSK9 expression, a number of siRNAs based on the parent sequences of AD-57928, AD-53806 and AD-53830 were prepared and tested, which are shown in Table 1. 9. To determine whether either siRNA was more effective at silencing PCSK9 than AD-57928, PCSK9 transgenic mice were administered a single dose of 0.3 mg/kg siRNA from Table 1. 9 and 72 hours post-dose, PCSK9 protein levels were determined using an ELISA assay. The results shown in FIG. 9 indicate that AD-57928 is unexpectedly effective at silencing PCSK9. AD-58893, AD-58894, AD-58896, AD-58897, AD-58898, and AD-58899 were also able to silence PCSK9 compared to controls.

Table 9

siRNAs used in the phosphothioate titration experiment

ID duplex Semantic sequence SEQ ID NO: Antisense sequence SEQ ID NO: Chemical structure AD- 57928 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 1557 a s Cfs a Afa Afg Cf a Afa a c AfgG f u Cf u Af gs asa 1567 TOFFEE with 6 PS and ZOMe at the 3'end of AS AD- 58893 CfsuAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf L96 1558 as Cfa Afa AfgCfa Afa a cAfgGf u Cf u Afgas a 1568 TOFFEE with 3 external PS AD- CfusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUf 1559 aCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsa 1569 TOFFEE with 3

- 129 046901

58894 L96 a internal PS AD- 58895 Cf u Afg Af c CfuGfUfUfuUfgCfuUfuUfgUfL 96 1560 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgs asa 1570 TOFFEE only c 4 PS in antisense threads AD- 58896 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgU fL96 1561 aCfaAfaAfgCfaAfaacAfgGfuCfuAfgaa 1571 TOFFEE only with 2 PS in semantic thread AD- 58897 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 1562 as Cfs a s Afa Afg Cfa Afa a c Afg G f u Cf u Afsg sasa 1572 TOFFEE with 9 PS AD- 58898 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfg UfL96 1563 asCfsaAfaAfgCfsaAfaacAfsgGfuCfuAfs gsasa 1573 TOFFEE with 10 PS AD- 58899 CfsusAfsgAfcCfuGfUfUfuUfgCfuUfuUfsg UfL96 1564 asCfsaAfaAfgCfsaAfaacAfsgGfuCfuAfs gsasa 1574 TOFFEE with 11 PS AD- 58900 CfsasAfgCfaGfaCfAfUfuUfaUfcUfuUfuU fL96 1565 asAfsaAfaGfaUfaAfaugUfcUfgCfuUfgs csu 1575 6P5-version AD- 53806 AD- 58902 UfsusUfuCfuAfgAfCfCfuGfuUfuUfgCfuU fL96 1566 asAfsgCfaAfaAfcAfgguCfuAfgAfaAfas gsu 1576 6P5-version AD- 53830

Example 6 Hepatic Drug Levels of AD-57928 and AD-58895.

The objective of this study was to quantify siRNA levels in the liver of wild-type mice in order to determine appropriate testing conditions for drug levels. The siRNAs used in the experiment were AD-57928 and AD-58895 (which did not cause a decrease in PCSK9 protein levels in Example 5). AD-58895 was used as a comparator to determine the time points at which differences in drug levels reflecting efficacy were observed.

A total of 33 female C57B6 mice were used in the experiment (3 mice per group). These mice were administered a single subcutaneous dose of either AD-57928, AD-58895, or PBS as a control. Livers were collected at 4, 24, 48, 72, 96, and 168 h postdose. Tissue aliquots were collected in duplicate per sample, and liver siRNA concentrations were measured using a newly designed antisense sequence-specific qRT-PCR assay. The measured amount of AD-57928 and AD-58895 per gram of liver over time is shown in Figure 10, and the amount of AD-57928 and AD-58895 expressed as a percentage of the total theoretical dose is shown in FIG. 11. The limit of detection (LOD) of the qRT-PCR assay was ~1 ng/g liver, and the assay showed good productivity and accurate duplicate reproducibility. From the results, it appears that AD-57928 is more stable in the liver and AD-58895 is less stable, and both can be detected at all time points. At day 7 post-dose, AD-57928 was >100-fold higher than the LOD of the qRT-PCR assay and AD-58895 was >10-fold higher than the LOD. On average, there is a >10-fold difference in the concentrations of AD-57928 and AD-58895 according to their predicted stability and observed potency. Time points from 72 to 120 hours post-dose may be suitable for tests based on siRNA concentration.

Example 7: Optimization of AD-57928.

To increase the activity and stability of AD-57928 in vivo, additional mRNA agents based on the parent sequences of AD-57928 were prepared and studied (Table 10; the sense sequences in Table 10 are disclosed as SEQ ID NO: 1653-1658, respectively, in order of occurrence, and the antisense sequences are disclosed as SEQ ID NO: 1659-1664, respectively, in order of occurrence; the same sense and antisense sequences disclosed in Table 10 are also disclosed in FIG.

The unmodified sense and antisense sequences for AD-60212 are as follows:

semantic - 5'-CUAGACCUGUTUUGCUUUUGU - 3' (A-122088.3; SEQ ID NO:1665); and antisense - 5'-ACAAAAGCAAAACAGGUCUAGAA - 3' (A-120190.19; SEQ ID NO:1666).

In general, these compounds contained fewer 2'-fluoro modifications, and fluoro-modified uridines were removed. The in vitro potency of these duplexes was examined by transfecting HeLa and Hep3B cells. As shown in FIG. 12B, AD-59849, AD-59228 and AD-60212 had IC ₅₀ values comparable to the original (AD-57928).

The ability of these duplexes to persist in vivo in the liver was also determined by administering 1 mg/kg

- 130 046901 of each duplex into wild-type mice and determine the level of siRNA using quantitative PCR. As shown in FIG. 13, all duplexes showed greater stability in the liver than the parent duplex starting at 120 hours post-administration.

The ability of these duplexes to suppress PCSK9 protein expression was also assessed in vivo by measuring the levels of PCSK9 protein, LDL, HDL, total cholesterol (Tc), triglycerides (Tg), alanine transaminase (ALT), aspartate aminotransferase (AST) and alkaline phosphatase (ALP) in the serum of lower blood cells. primates (NHP). The presence of a reaction at the injection site was also monitored. Duplexes were administered using a dosing schedule that included a saturation phase for the first week (one dose of 2 mg/kg daily for 5 consecutive days, qdx5) followed by a maintenance phase (three weekly doses of 2 mg/kg for 3 weeks, qwx3). , which are described in table. 11 below.

Table 10

Additional means that are mRNA

Duplex ID semantic Semantic ID antisense Antisense AD-57928 (parent) A-117428 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 A-117429 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa AD-59849 A-121244 CfsusAfgAfcCfuGfUfUfuUfgcuuuuguL96 A-121239 asCfsaAfaagCfaAfaacAfgGfucuAfgsasa AD-60688 A-120188 csusagacCfuGfuuuugcuuuuguL96 A-121239 asCfsaAfaagCfaAfaacAfgGfucuAfgsasa AD-59223 A-120188 csusagacCfuGfuuuugcuuuuguL96 A-120190 asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa AD-60212 A-122088 csusagacCfuGfudTuugcuuuuguL96 A-120190 asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa AD-59228 A-120197 CfsusAfgAfcCfuGfUfUfuUfgCfsuUfsuUfsgsUfsL96 A-120202 asCfsaAfaAfsgCfaAfaacAfgGfuCfsuAfgsasa

Table 11

Dosing regimens

Object under study Group number N Dose level (mg/kg) Dose frequency Cumulative dose (mg/kg) AD-57928 1 3 females 2 qdx5+qwx3, 8 doses 16 AD-59849 2 2 qdx5+qwx3, 8 doses 16 AD-60688 3 2 qdx5+qwx3, 8 doses 16 AD-59223 4 2 qdx5+qwx3, 8 doses 16 AD-60212 5 2 qdx5+qwx3, 8 doses 16 AD-59228 6 2 qdx5+qwx3, 8 doses 16

Blood: days: -9, -6, -3, 4, 7, 10, 14, 17, 21, 24, 28, 31, 35, 42, 49, 56, 63 (first dose, 1 day)

Injection site monitoring: Yes

Indicators: protein PCSK9, LDL, HDL, Tc, Trig, ALT, AST, ALP

As shown in FIG. 14A and 14B, all compounds except AD-60688 achieved greater than 80% PCSK9 silencing, and individual animals in the AD-60212 group achieved greater than 90% PCSK9 silencing. In fig. 15 shows that in the absence of a statin, all compounds except AD60688 had LDL cholesterol reductions of up to 60%, and individual animals in the AD-59223 group had LDL cholesterol reductions of up to 77%. Surprisingly, and as shown in FIG. 18, these agents continued to lower cholesterol levels for 46 days after the last dose of these agents. Even more surprising, and as shown in FIG. 19, AD-60212 and AD-59849 continued to reduce LDL cholesterol levels by up to 60% until at least 120 days (93 days after

- 131 046901 last dose) longer than any effect observed for the RNAi agent in vivo, indicating that after the saturation phase, these compounds can be administered at a frequency of once a month, once every two months, once every three months, once every four months, once every five months, or once every six months during the maintenance phase.

Example 8: Generation of additional AD-57928-based sequences for PCSK9.

Additional mRNA agents based on the original AD-57928 sequences (see Table 12 below) were prepared and tested in vitro for potency by transfecting HeLa and Hep3B cells with these agents. The IC ₅₀ values for these agents are shown in Table. 13.

Table 12

Sequences to PCSK9

ID duplex AD- Semantic SEQ ID NO: Antisense fishing Antisense (5' to 3') SEQ ID NO: a thread Semantic (from 5' to 3') 57928.45 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1577 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1605 AD-60928.1 A-122701.2 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgAfL96 1578 A-122702.2 usCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1606 AD-60929.1 A-122703.2 G fs us AfgAfcCf u Gf U f U f u Uf gCf u U f u U fg U f L96 1579 A-122704.2 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfcsusu 1607 AD-60930.1 A-122705.2 GfsasAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1580 A-122706.2 asCfsaAfaAfgCfaAfaacAfgGfuCfuUfcsusu 1608 AD-60931.1 A-122707.3 GfsasUfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1581 A-122708.2 asCfsaAfaAfgCfaAfaacAfgGfuCfaUfcsusu 1609 AD-60932.1 A-122707.4 GfsasUfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1582 A-122709.2 asCfsaAfaAfgCfaAfaacAfgGfuCfaUfcsasa 1610 AD-60933.1 A-122710.2 CfsasUfcAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1583 A-122711.2 asCfsaAfaAfgCfaAfaacAfgGfuGfaUfgsasa 1611 AD-60934.1 A-122712.2 CfsusUfcUfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1584 A-122713.2 asCfsaAfaAfgCfaAfaacAfgGfaGfaAfgsasa 1612 AD-60927.1 A-122714.2 CfsusAfcUfgCfuGfUfUfuUfgCfuUfuUfgUfL96 1585 A-122715.2 asCfsaAfaAfgCfaAfaacAfgCfaGfuAfgsasa 1613 AD-60906.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1587 A-122309.1 asCfsaAfaAfgCf(Ayh)AfaacAfgGfuCfuAfgsasa 1615 AD-60907.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1588 A-122310.1 asCfsaAfaAfgCfa(Ayh)aacAfgGfuCfuAfgsasa 1616 AD-60908.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1589 A-122311.1 asCfsaAfaAfgCfaAf(Ayh)acAfgGfuCfuAfgsasa 1617 AD-60909.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1590 A-122312.1 asCfsaAfaAfgCfaAfa(Ayh)cAfgGfuCfuAfgsasa 1618 AD-60910.1 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1591 A-122313.1 asCfsaAfaAfgCf(Ayh)AfaacAf(Gyh)GfuCf(Uyh)Afg sasa 1619 AD-60911.1 A-122307.1 Cfsus(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1592 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1620 AD-60912.1 A-122308.1 (Cyh)u(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1593 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1621 AD-60913.1 A-122307.1 Cfsus(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1594 A-122309.1 asCfsaAfaAfgCf(Ayh)AfaacAfgGfuCfuAfgsasa 1622 AD-60914.1 A-122307.1 Cfsus(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) 1595 A-122310.1 asCfsaAfaAfgCfa(Ayh)aacAfgGfuCfuAfgsasa 1623 AD-60915.1 A-122307.1 Uf(Uyh)Uf(Gyh)UfL96 Cfsus(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1596 A-122311.1 asCfsaAfaAfgCfaAf(Ayh)acAfgGfuCfuAfgsasa 1624 AD- 57928.45 A-117428.1 CfsusAfgAfcCfuGfUfUfuUfgCfuUfuUfgUfL96 1597 A-117429.1 asCfsaAfaAfgCfaAfaacAfgGfuCfuAfgsasa 1625 AD-60916.1 A-122307.1 Cfsus(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1598 A-122312.1 asCfsaAfaAfgCfaAfa(Ayh)cAfgGfuCfuAfgsasa 1626 AD-60918.1 A-122308.1 (Cyh)u(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1600 A-122309.1 asCfsaAfaAfgCf(Ayh)AfaacAfgGfuCfuAfgsasa 1628 AD-60919.1 A-122308.1 (Cyh)u(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1601 A-122310.1 asCfsaAfaAfgCfa(Ayh)aacAfgGfuCfuAfgsasa 1629 AD-60920.1 A-122308.1 (Cyh)u(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1602 A-122311.1 asCfsaAfaAfgCfaAf(Ayh)acAfgGfuCfuAfgsasa 1630 AD-60921.1 A-122308.1 (Cyh)u(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1603 A-122312.1 asCfsaAfaAfgCfaAfa(Ayh)cAfgGfuCfuAfgsasa 1631 AD-60922.1 A-122308.1 (Cyh)u(Ayh)(Gyh)(Ayh)(Cyh)CfuGfUfUfuUf(Gyh)Cf(Uyh) Uf(Uyh)Uf(Gyh)UfL96 1604 A-122313.1 asCfsaAfaAfgCf(Ayh)AfaacAf(Gyh)GfuCf(Uyh)Afg sasa 1632

- 132 046901

Table 13 IC50 values for mRNA agents __________ defined in Table. 12__________

Duplex ID Hela, IC ₅₀ (nM) SERRY, IC ₅₀ (nM) AD-57928.47 0.0026 0.0005 AD-60928.1 0.0000 0.0009 AD-60929.1 0.0010 0.0027 AD-60930.1 0.0055 0.0019 AD-60931.1 0.0028 0.0019 AD-60932.1 0.0039 0.0036 AD-60933.1 0.0349 0.1518 AD-60934.1 0.2115 0.5420 AD-60927.1 >10 - AD-57928.45 <3.57225e-005 0.0007 AD-60906.1 0.0048 0.0007 AD-60907.1 0.0001 <3.57225e-005 AD-60908.1 0.0003 0.0072 AD-60909.1 - 0.0142 AD-60910.1 0.0001 0.0030 AD-60911.1 0.0955 0.1935 AD-60912.1 0.1834 0.4106 AD-60913.1 0.2693 0.5715 AD-60914.1 0.2292 0.4319 AD-60915.1 0.2069 0.3185 AD-57928.45 0.0057 0.0027 AD-60916.1 0.0802 0.2040 AD-60917.1 0.1420 0.0976 AD-60918.1 0.4101 0.3268 AD-60919.1 0.3202 0.5143 AD-60920.1 0.5199 0.5978 AD-60921.1 0.7969 2.0875 AD-60922.1 1.1078 1.0307

Example 9 Repeated Dose Efficacy of AD-57928.

The effectiveness of repeated dose AD-57928 in suppressing PCSK9 protein expression was assessed in vivo by measuring PCSK9 protein levels, LDL, HDL, total cholesterol (Tc), triglycerides (Tg), alanine transaminase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP). in the serum of lower primates (NHP). The presence of a reaction at the injection site was also monitored. AD57928 duplexes were administered subcutaneously using the dosing regimens described in Table. 14 below. Groups of 5 animals were re-administered a single dose of 25 mg/kg on day 92. One additional group of animals was administered a single dose of 25 mg/kg. 2xw means twice a week; q2w means once every two weeks; and q1w means once a week.

- 133 046901

Table 14

Dosing regimens

Researchable | subject 1 Number . GGL'TTTTTS Dose level Frequency of administration of 1 use ^: Cumulative dose IIIIIIIIIIII 2>:w.'2 doses Ι·Ι··ΙΙΙ·ΙΙ III 2xw, 12 doses ;|;|||||M|||||| h q2w. o doses Ι····Ι·ΙΙ·Ι AD-57928 SaMaI ΙΙιΙιΙΙΙΙ q2w, 6 doses ΙΟΙΙΙΙΙΐΙΙΙΙΙΙ b' 0.5 q'w. £ doses 3 1 q1w. 10 doses ||||||·1ΙΙΙΙΙ 7 2 y'-w, 10 doses 20

Blood: days -9. -6. -3. 1 (pre-selected blood). 3-129 (efficiency

Injection site monitoring: yes

Indicators: PCSK9 protein. LDL. HDL. Shh, Trig. ALT, AST, ALP

As shown in FIG. 14A and 14B, all compounds except AD-60688 achieved greater than 80% PCSK9 silencing, and individual animals in the AD-60212 group achieved greater than 90% PCSK9 silencing. In fig. 15 shows that in the absence of a statin, all compounds except AD60688 had LDL cholesterol reductions of up to 60%, and individual animals in the AD-59223 group had LDL cholesterol reductions of up to 77%.

As shown in FIG. 16A, the most effective regimen for lowering LDL was the twice-weekly (2xw) regimen, which achieved approximately 60% reduction in LDL levels. The same cumulative dose administered less frequently was less effective than a twice-weekly regimen. In fig. 16B shows that at 2xw mode, PCSK9 silencing reached more than 80%.

In fig. 17A and 17B show that a single 25 mg/kg dose of AD-57928 has the same onset of decline in LDL and PCSK9, the same lowest rate of decline in PCSK9 and LDL, and an equivalent rate of decline in LDL as a lower multiple dose of AD -57928 2 mg/kg administered twice weekly (2xw). It is also clear from these graphs that there is a trend for PCSK9 levels to decline more rapidly at a single dose of 25 mg/kg, and that for a single dose of 25 mg/kg, recovery of both PCSK9 and LDL levels begins approximately 20 days after reaching the nadir. level (7th day). The lowest level for a single dose of 25 mg/kg was observed on day 7.

Example 10: Tolerability of Optimized RNA Agents AD-57928.

Additional mRNA tools derived from the original AD-57928 sequences described in FIG. 12A (and Table 10) were assessed for tolerability in rats. Male rats were administered subcutaneously 225 mg/kg of these mRNA agents on days 1, 8, and 15 and were sacrificed and necropsied on day 16 (see Table 15). Animals were observed daily for any clinical signs and animal body weight was determined before the study and every week throughout the study. On day 16, the animals' blood was assessed hematologically for coagulation and serum biochemical analysis was performed; drug metabolism and drug pharmacokinetics were determined using animal liver samples; and the heart, lungs (insufflated), kidneys, liver, spleen, testes, and first and last injection sites were analyzed for any changes. There were no changes in clinical signs, imaging of the injection site, serum chemistry, coagulation, or microscopic pathologic anatomy of the liver, spleen, lung, heart, or testes. In table Table 16 presents summarized data on liver weight, final body weight, results of hematological tests and an assessment of the severity of pathology for the sites of the last injection and kidneys for each studied drug.

- 134 046901

Dosing regimens

Table 15

Group doses TA Dose (mg/kg) Dose volume (ml/kg) Qty males Scheme dosing Day Nx 1 PBS 0 5 3 SC on days 1, 8 and 15 Day 16 2 AD-57928 (original) 225 3 3 AD-59849 225 3 4 AD-59223 225 3 5 AD-59228 225 3 6 AD-60688 225 3 7 AD-60212 225 3

Summary of tolerability data

Table 16

AD-57928 (original) AD-59849 AD-59223 AD-59228 AD-60688 AD-60212 Qty PS 6 6 6 13 6 6 Qty 2'F 21 15 12 21 9 12

- 135 046901

Number of dT 0 0 0 0 0 1 [liver] (µg/g) 907±62 1139±160 1277=1=231 1999±424 1624=1=147 1258±286 Ultimate BW (% of control) -2.1% -4.6% -2.1% -6.8% -0.5% -2.9% Day 16 General blood test Without changes Without changes TWBC 1LYM, hemolysis Without changes Without changes Without changes Day 16, inflammation at the site of the last injection 3/3 11.7) 3/3 (1.3) 2/3 P.5) 3/3 (2.3) 2/3 (1.0) 3/3 P.Z) Day 16, basophilic granules, kidney 3/3 (2.0) 3/3 (2.3) 3/3 (1.0) 3/3 (2.0) 3/3 (1.3) 3/3 (1.3)

Pathology severity rating: 1 = minimal; 2 = weak; 3 = moderate;

BW = body weight;

WBC = white blood cell;

LYM = lymphocytes.

Claims (50)

1. A double-stranded P1ΙΚΊ-based agent containing a sense strand complementary to an antisense strand forming a double-stranded region, where the antisense strand contains a region complementary to a portion of the mRNA encoding PCSK9, where each strand independently has a length of 14 to 30 nucleotides, where the antisense strand contains at least 19 contiguous nucleotides from the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAG-3' (SEQ ID NO: 412), and the double-stranded RNAi agent represented by formula (III): semantic: 5' n _p -N _a -(XXX);-N _b -YYY -N _b -(Ζ Ζ Z)j -N _a - n _q 3' antisense: 3' n _p '-N _a '-( X'X'X')kN _b '-Y'Y'Y'-N _b '-(Z'Z'Z')iN _a '- n _q '5' (III) where: each i, j, k and l is independently equal to 0 or 1; each p, p', q and q' are independently equal to 0-6; each Na and each Na' independently represents an oligonucleotide sequence containing 0-25 nucleotides, 2-20 of which are modified nucleotides, each sequence containing at least two differently modified nucleotides, where each modified nucleotide independently contains a nucleotide modification selected from the group consisting of 2'-O-methyl, 2'-fluoro and 2'-deoxythymidine (dT); each Nb and each Nb' independently represents an oligonucleotide sequence containing 0-10 nucleotides, 1-10 of which are modified nucleotides, where each - 136 046901 The modified nucleotide is independently selected from the group consisting of 2'-O-methyl, 2'-fluorine and 2'-deoxythymidine (dT); where double-stranded RNA based agent| contains at least one phosphorothioate or methylphosphonate internucleotide linkage; each np, np', nq and nq' may or may not be present, each independently representing an overhanging nucleotide; each XXX, YYY, ZZZ, X'X'X', YYY' and Z'Z'Z' independently represents one motif of three identical modifications on three consecutive nucleotides, where XXX is complementary to X'X'X', YYY is complementary to YYY' and ZZZ is complementary to Z'Z'Z'; and wherein the sense strand is conjugated to at least one ligand, which is one or more GalNAc derivatives attached via a divalent or trivalent branched linker. 2. Double-stranded RNA based agent| according to claim 1, where the YYY motif is located at or near the site of cleavage of the semantic chain. 3. The double-stranded RNA1 agent according to claim 1, wherein the Y'Y'Y' motif is located at positions 11, 12 and 13 of the antisense strand from the 5' end. 4. A drug based on double-stranded RNA1 according to claim 1, where modifications on XXX nucleotides differ from modifications on X'X'X' nucleotides, modifications on YYY nucleotides differ from modifications on Y'Y'Y' nucleotides, and modifications on ZZZ nucleotides differ from modifications on Z'Z'Z' nucleotides. 5. Double-stranded RNA based agent| according to claim 1, where the modifications on the Y'Y'Y' nucleotides are different from the modifications on the YYY nucleotides. 6. Double-stranded RNA based agent| according to claim 1, where p'>0 and at least one pr' is connected to an adjacent nucleotide through a phosphorothioate bond. 7. Double-stranded RNA agent| according to claim 1, where the phosphorothioate or methylphosphonate internucleotide linkage is located at the 5' end of the sense strand; at the 5' end of the antisense strand; or at the 5' end of the sense strand and at the 5' end of the antisense strand. 8. The double-stranded RNA agent according to claim 7, wherein the antisense strand contains two phosphorothioate internucleotide bonds between the three terminal nucleotides at the 3' end and two phosphorothioate internucleotide bonds between the three terminal nucleotides at the 5' end; and wherein the sense strand contains two phosphorothioate internucleotide bonds between the three terminal nucleotides at the 5' end. 9. An agent based on double-stranded RNA1 according to claim 1, where the double-stranded region has a length of 15-30 nucleotide pairs. 10. Double-stranded RNA agent| according to claim 1, where the double-stranded region has a length of 1723 nucleotide pairs. 11. Double-stranded RNA based agent| according to claim 1, where the double-stranded region has a length of 1725 nucleotide pairs. 12. Double-stranded RNA based agent| according to claim 1, where the double-stranded region has a length of 2327 nucleotide pairs. 13. Double-stranded RNA based agent| according to claim 1, where the double-stranded region has a length of 1921 base pairs. 14. Double-stranded RNA based agent| according to claim 1, where the double-stranded region has a length of 2123 nucleotide pairs. 15. A product based on double-stranded RNA1 according to claim 1, where each chain has a length of 15-30 nucleotide pairs. 16. The double-stranded RNA agent according to claim 1, wherein the sense strand has a total of 21 nucleotides and the antisense strand has a total of 23 nucleotides. 17. Double-stranded RNA based agent| according to claim 1, wherein the region complementary to the portion of the mRNA encoding PCSK9 contains the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAGAA3' (SEQ ID NO: 1666). 18. Double-stranded RNA based agent| according to claim 1, wherein the sense strand contains the nucleotide sequence 5'-CUAGACCUGUTUUGCUUUUGU-3' (SEQ ID NO: 1665), and the antisense strand contains the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAGAA-3' (SEQ ID NO: 1666). 19. The double-stranded RNA agent according to claim 1, wherein the antisense strand contains the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAG-3' (SEQ ID NO: 412), and the sense strand contains the nucleotide sequence 5'-AGACCUGUUUUGCUUUUGU-3' (SEQ ID NO : 191). 20. Double-stranded RNA agent| according to claim 1, where the antisense strand consists of the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAGAA-3' (SEQ ID NO: 1666), and the sense strand consists of the nucleotide sequence 5'-CUAGACCUGUTUUGCUUUUGU-3' (SEQ ID NO: - 137 046901 1665). 21. The double-stranded RNAi agent according to claim 1, where the sense strand contains the nucleotide sequence 5'-csusagacCfuGfudTuugcuuuugu-3' (SEQ ID NO:1657), and the antisense strand contains the nucleotide sequence 5'-asCfsaAfAfAfgCfaAfaAfcAfgGfuCfuagsasa-3' (SEQ ID NO :1663), where a, c, g and u are 2'-O-methyl (2'-OMe) A, C, G and U, respectively; Af, Cf, Gf and Uf are 2'-fluoro A, C, G and U, respectively; dT-2' is deoxythymidine; and s represents a phosphorothioate bond. 22. Pharmaceutical composition containing a drug based on double-stranded RNA according to claim 1. 23. The pharmaceutical composition according to claim 22, additionally containing a non-buffer solution. 24. The pharmaceutical composition according to claim 23, wherein said non-buffered solution is saline or water. 25. Pharmaceutical composition according to claim 22, additionally containing a buffer solution. 26. The pharmaceutical composition according to claim 25, where the buffer solution contains acetate, citrate, prolamine, carbonate or phosphate, or any combination thereof. 27. A double-stranded RNA agent containing a sense strand complementary to an antisense strand forming a double-stranded region, where the antisense strand contains a region complementary to a portion of the mRNA encoding PCSK9, where each strand is independently 14 to 30 nucleotides in length, where the antisense strand contains at least 19 contiguous nucleotides from the nucleotide sequence 5'-ACAAAAGCAAAACAGGUCUAG-3' (SEQ ID NO: 412), and the double-stranded RNA agent represented by formula IIIa: semantic: 5' n _p -N _a -YYY - N _a - n _q 3' antisense: 3' n _p '-N _a '- ΥΎΎ'- N _a '- n _q '5' (Sha) where: each np , nq, np' and nq' may or may not be present, each independently representing an overhanging nucleotide; each p, q and q' are independently equal to 0-6; np'>0 and at least one np' is linked to an adjacent nucleotide via a phosphorothioate bond; each N _a and each N _a ' independently represents an oligonucleotide sequence containing 0-10 nucleotides, 1-10 of which are modified nucleotides, where each modified nucleotide is independently selected from the group consisting of 2'-O-methyl, 2'- fluorine and 2'-deoxythymidine (dT); each YYY and Y'Y'Y' independently represents one motif of three identical modifications on three consecutive nucleotides, where the modifications are 2'-O-methyl or 2'-fluoro modifications; where YYY is the complementary of Y'Y'Y'; wherein the sense strand contains at least one phosphorothioate bond; and wherein the sense strand is conjugated to at least one ligand, wherein the ligand is one or more GalNAc derivatives attached via a divalent or trivalent branched linker. 28. The double-stranded RNA agent according to claim 27, wherein the YYY motif is located at or near the site of sense strand cleavage. 29. The double-stranded RNA agent according to claim 1 or 27, wherein each N _a and each N _a ' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, where each sequence contains at least two differently modified nucleotides. 30. The double-stranded RNA agent according to claim 1 or 27, wherein each N _a and each Na' independently represents an oligonucleotide sequence containing 0-25 modified nucleotides, where each sequence contains at least two differently modified nucleotides, where modifications on nucleotides are independently selected from the group consisting of 2'O-methyl, 2'-fluorine and 2'-deoxythymidine (dT). 31. The double-stranded RNA agent according to claim 1 or 27, where each Nb and each Nb' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides. 32. The double-stranded RNA agent according to claim 1 or 27, where each Nb and each Nb' independently represents an oligonucleotide sequence containing 0-10 modified nucleotides, where the modifications on the nucleotides are independently selected from the group consisting of 2'-Omethyl, 2'-fluorine and 2'-deoxythymidine (dT). 33. The double-stranded RNA agent according to claim 1 or 27, wherein substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides. 34. A drug based on double-stranded RNA according to claim 1 or 27, where all nucleotides of the sense strand and all nucleotides of the antisense strand are modified. - 138 046901 35. The double-stranded RNAi agent of claim 1 or 27, wherein all nucleotides of the sense strand and all nucleotides of the antisense strand are modified, and wherein the modifications on the nucleotides are independently selected from the group consisting of 2'-O-methyl, 2'-fluoro, and 2'-deoxythymidine (dT). 36. Double-stranded RNA based product! according to claim 1 or 27, where the Y-nucleotides contain a 2'-Omethyl modification, and the Y'-nucleotides contain a 2'-fluoro modification. 37. An agent based on a double-stranded ΡΗΚϊ according to claim 1 or 27, where each chain has a length of 19 to 25 nucleotides. 38. An agent based on a double-stranded ΡΗΚϊ according to claim 1 or 27, where each chain has a length of 19 to 23 nucleotides. 39. An agent based on a double-stranded ΡΗΚϊ according to claim 1 or 27, where each chain has a length of from 17 to 23 nucleotides. 40. An agent based on a double-stranded ΡΗΚϊ according to claim 1 or 27, where each chain has a length of from 21 to 25 nucleotides. 41. A drug based on a double-chain ΡΗΚϊ according to claim 1 or 27, where the ligand is 42. The double-stranded PI agent according to any one of claims 1 to 27, wherein the ligand is attached to the 3' end of the sense strand. 43. The double-chain ΡΗΚϊ agent according to claim 42, wherein the ΡΗΚϊ agent is conjugated to a ligand as shown in the following diagram where X represents O or S. 44. Pharmaceutical composition containing an agent based on a double-chain ΡΗΚϊ according to claim 27. 45. A method of inhibiting the expression of PCSK9 in a cell, where the method includes: (a) bringing the cell into contact with a double-chain PI-based agent according to claim 1 or 27 or a pharmaceutical composition according to claim 22 or 44; and (b) maintaining the cell obtained in step (a) for a time sufficient to cause cleavage of the PCSK9 gene mRNA transcript, thereby inhibiting expression of the PCSK9 gene in the cell. 46. Use of a therapeutically effective amount of the double-chain PCS agent agent of claim 1 or 27 or the pharmaceutical composition of claim 22 or 44 for treating a patient with lipidemia mediated by PCSK9 expression. 47. Use according to claim 46, where the patient is a human. 48. Use according to claim 47, where the person has hypercholesterolemia. 49. Use according to claim 46, wherein the double-chain drug is intended to be administered in two or more doses. 50. Use according to claim 46, wherein the double-chain drug or pharmaceutical composition is intended to be administered subcutaneously or intravenously to a patient.