EA045729B1 - PROMOTERS SPECIFIC TO ON-BIPOLAR CELLS FOR INTRAOCULAR GENE DELIVERY - Google Patents

Description

The present invention relates to synthetic promoter sequences specific for ON bipolar retinal cells and their use in the therapeutic delivery of transgenes to the eye to improve and/or restore vision. The present invention provides metabotropic glutamate receptor 6 (mGluR6) gene promoters for increased and more specific expression in ON bipolar cells. In particular, for efficient expression in ON bipolar cells, which are cone cells found exclusively in the human macula.

Description

BACKGROUND OF THE INVENTION

Many causes of blindness have only limited treatment options or no treatment at all. The most common among these are age-related macular degeneration (AMD) and inherited retinal diseases (IRDs) such as retinitis pigmentosa (RP). These degenerative diseases are characterized by the progressive loss of photoreceptors (PR), eventually leading to complete blindness. Gene therapies that deliver therapeutic DNA or RNA, replace or silence defective genes, or encode an exogenous therapeutic gene are aimed at slowing disease progression, reducing the severity of symptoms, or restoring lost function.

Optogenetic gene therapy is one of the most promising new technologies that can be used to treat blindness caused by retinal degeneration. Ongoing clinical trials of optogenetic therapies nonspecifically target retinal ganglion cells (RGCs) with channel rhodopsins to restore retinal light sensitivity. In the future, next-generation cell-tailored optogenetic gene therapies will prove superior to these nonspecific therapies. These next-generation therapies use cell type-specific promoters to deliver new and effective optogenetic tools to specific retinal cell types. Among the cell type targets, the most promising are retinal bipolar cells (BCs), the first retinal interneurons that naturally receive direct input from the PR. BCs are divided into ON- and OFF-type BCs, responsive to either increased light or decreased light, respectively, and expressing either mGluR6 or AMPA/kainate glutamate receptors. ON bipolar cells (OBCs) are particularly interesting targets for gene therapy. All mutations in specific OBC genes such as NYX, GRM6, GPR179 or TRPM1 result in complete blindness (congenital stationary night blindness) because these genes are involved in the mGluR6 signaling cascade and hence OBCs become non-functional. More recently, expression of optogenetic proteins in the OBC was shown to restore vision in mouse models of photoreceptor degeneration suffering from advanced stages of degeneration. Channel rhodopsin-2 (Lagali et al., Nat Neurosci 2008. 11:p. 667-675), rhodopsin (Cehajic-Kapetanovic et al., Curr Biol 2015. 25: p. 2111-2122) and chimeric Opto-mGluR6 ( van Wyk et al., PLoS Biol 2015. 13: p. e1002143) were successfully expressed in the OBC of blind mice and restored functional vision at the retinal, cortical, and behavioral levels. For all of the above approaches, it is necessary to specifically target the OBC type, particularly in the case of optogenetic approaches, to avoid inconsistent signal transduction from non-target cells skewing the retinal code. In addition, specific targeting of OBC also allows for lower and thus safer AAV dosage. The lack of a functional and OBC-specific promoter has so far hampered the clinical application of gene therapies targeting OBC.

Short enhancer promoter sequences have been commonly used in the field to achieve OBC-specific targeting in combination with AAV-based gene therapy. This is because the packaging capacity of AAV is limited to 4.7 kb. and usually does not accommodate endogenous promoters several kb in length. In this regard, enhancer promoter sequences derived from the OBC-specific glutamate receptor mGluR6, expressed exclusively in retinal OBCs, have been most successful. Until recently, a 200 bp enhancer sequence derived from the mouse Grm6 gene and in combination with the viral SV40 core promoter (Kim et al. J Neurosci, 2008. 28: p. 7748-7764.), abbreviated as 200En-SV40. However, we have recently shown that its variant, 4x200En-SV40, which carries four repeats of the enhancer sequence (Cronin et al. EMBO Mol Med 2014. 6: p. 1175-1190), is neither OBC-specific nor functional in late stage retinal degeneration (van Wyk et al. Front Neurosci 2017. 11: p. 161). More recently, a short enhancer/promoter was constructed based on the full-length mouse Grm6 gene (200EnmGluR500P), which is expressed in the retina of wild-type C57BL/6 mice with relatively good specificity for OBC (Lu et al. Gene Ther, 2016. 23: p. 680 -9.). However, expression in OBCs of degenerating retina has not been shown, and expression is almost exclusively due to rod-type OBCs. Therefore, cone-type OBCs found exclusively in maca

- 1 045729 le retinas of foveal animals, including humans, and connecting to foveal cones, mediating high-acuity color vision, are practically not targets for 200EnmGluR500P, which makes this promoter unsuitable for restoring high-acuity central vision in humans. In addition, a promoter based on the human GRM6 gene is preferred since it will be completely controlled by the human transcriptomic machinery regulating gene expression, i.e. expression levels of proteins that mediate function, but will lack the induction of cytotoxicity.

Based on the above-mentioned prior art, the object of the present invention is to provide means and methods for producing new synthetic OBC-specific human promoters. This goal is achieved using the subject matter of the invention according to the independent claims of the present invention.

The essence of the invention

The first aspect of the present invention relates to an isolated nucleic acid molecule between 850 base pairs (bp) and 1500 bp in length, comprising:

a) an enhancer sequence element selected from SEQ ID NOs 1-6, and

b) a promoter sequence element selected from SEQ ID NOs 7-10.

An alternative to the first aspect of the present invention provides an isolated nucleic acid molecule between 850 base pairs (bp) and 1500 bp in length, comprising:

a) an enhancer sequence element that is at least 70% (or more), in particular 75% or more, more particularly 80% or more, more particularly 85% or more, more particularly 90% or more, more specifically 95% or greater, even more specifically 98% or greater, most specifically 100% identical to the sequence selected from SEQ ID NOs 1 and 2, and

b) a promoter sequence element that is 70% or more, in particular 75% or more, more particularly 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or more, more particularly 98% or more, most particularly 100% identical to the sequence of SEQ ID NO 7, and wherein said isolated nucleic acid molecule has a ON bipolar cone cell specificity of 40% or more , in particular 50% or more, more particularly 60% or more, even more specifically 70% or more, more particularly 80% or more, even more specifically 90% or more, most particularly 100%, characteristic of the sequence of SEQ ID NO 13, and with respect to cone ON bipolar cells being 20% or more, in particular 25% or more, more particularly 30% or more, even more particularly 35% or more, more particularly 40% or more, most specifically 50% or more.

A second aspect of the present invention relates to a nucleic acid expression vector containing a nucleic acid molecule according to the first aspect.

A third aspect of the present invention relates to a promoter-driven transgene.

A fourth aspect of the present invention relates to an adeno-associated virus virion particle comprising an isolated nucleic acid molecule according to the first aspect, a nucleic acid expression vector according to the second aspect, or a transgene according to the third aspect.

A fifth aspect of the present invention relates to an agent selected from an isolated nucleic acid molecule according to the first aspect, a nucleic acid expression vector according to the second aspect, a transgene according to the third aspect and an adeno-associated virus virion particle according to the fourth aspect, for use as a drug.

Administration forms containing the agents of the present invention are additional aspects of the present invention.

Terms and Definitions.

The term OBC as used herein refers to an ON bipolar cell.

The term RBC as used herein refers to a rod bipolar cell.

The term cOBC as used herein refers to the ON bipolar cell, which is a cone.

The term RGC as used herein refers to a retinal ganglion cell.

The term PR as used herein refers to a photoreceptor.

The abbreviation AAV as used herein refers to adeno-associated virus. Unless otherwise stated, AAV refers to all subtypes or serotypes, as well as both replication-competent and recombinant forms.

The terms AAV virion and AAV viral particle as used herein refer to a viral particle consisting of at least one AAV capsid protein and an encapsulated nucleic acid.

Unless otherwise specified, all technical and scientific terms used in this document have the same meaning as would be commonly understood by a person of ordinary skill in the art.

- 2 045729 ki (for example, in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods (see generally Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al. , Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.), as well as chemical methods.

The term AAV capsid as used herein refers to synthetic genes encoding capsid proteins (cap). The term AAV capsid as described herein can be used to refer to packaging into recombinant adeno-associated viruses for gene therapy.

The term homologous as used herein refers to sequences that are substantially identical but differ at certain positions by the presence of insertion, deletion, or substitution of nucleic acids or amino acids.

The term transgene as used herein refers to a gene or genetic material that has been transferred from one organism to another. In the context of the present invention, the term may also refer to the transfer of a naturally occurring or physiologically intact variant of a genetic sequence into a patient tissue where it is absent. This may further refer to the transfer of a naturally occurring encoded sequence whose expression is driven by a promoter that is absent or silenced in the target tissue. As used herein, the term transgene refers to a polynucleotide encoding a polypeptide of interest that, when expressed in a damaged or diseased retina, may be useful for improving or restoring vision. Transgenes of particular interest for restoring light sensitivity or vision involve light-sensitive proteins such as opsin genes, i.e. channel rhodopsins, vertebrate opsins and their variants.

The term recombinant as used herein refers to a nucleic acid that is the product of one or more cloning, restriction and/or ligation steps and that is different from a naturally occurring nucleic acid. The recombinant viral particle contains recombinant nucleic acid.

The term intravitreal administration as used herein refers to the route of administration of a pharmaceutical agent, such as a virus, in which the agent is delivered into the vitreous body of the eye. Intravitreal administration is a procedure of placing a drug directly into a space at the back of the eye called the vitreous cavity, which is filled with a jelly-like fluid called vitreous gel.

The term subretinal administration as used herein refers to the route of administration of a pharmaceutical agent, in particular a virus as used herein, into the space between the retinal pigment epithelial (RPE) cells and the photoreceptors.

Nucleotides, as used herein, are the building blocks of nucleic acid or nucleic acid analogues, the oligomers of which are capable of forming selective hybrids with RNA or DNA oligomers based on base pairing. The term nucleotides in this context includes the classical ribonucleotide building blocks of adenosine, guanosine, uridine (and ribosylthymine), cytidine, the classical deoxyribonucleotides of deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine.

As used herein, the terms sequence identity and percent sequence identity refer to values determined by comparing two aligned sequences. Methods for aligning sequences for comparison are well known in the art. Alignment of sequences for comparison can be done using the local homology search algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), Needleman and Wunsch's global alignment algorithm, J. Mol. Biol. 48:443 (1970), Pearson and Lipman similarity search method, Proc. Nat. Acad. Sci. 85:2444 (1988) or through computer implementations of these algorithms, including without limitation CLUSTAL, GAP, BESTFIT, BLAST, FASTA and TFASTA. Software for performing BLAST analyzes is publicly available, for example through the National Center for Biotechnology Information:

(http://blast.ncbi.nlm.nih.gov/).

One such example of nucleic acid sequence comparison is the BLASTN algorithm, which uses default settings: expected threshold: 10; word size: 28; maximum number of matches in the requested range: 0; points for match/mismatch: 1.-2; cost of gaps: linear. Unless otherwise noted, sequence identity values reported herein refer to those obtained using the BLAST software package (Altschul et al., J. Mol. Biol. 215:403-410 (1990)) using the defaults identified above parameters for comparing proteins and nucleic acids, respectively.

In the context of the present description, the term above refers to the direction towards the 5'end. For enhancer and promoter sequences in this application, single-stranded sequences are given, and if the enhancer is located upstream of the promoter, this means that the enhancer is located in the 5' direction of the promoter. Likewise, the term below refers to

- 3 045729 to the board towards the 3'-end.

As used herein, the term spacer sequence refers to a nucleic acid of variable length that is used to connect an enhancer and a promoter to produce a single-stranded nucleic acid molecule. Exemplary embodiments of linkers useful for practicing the present invention are oligonucleic acid chains consisting of 1-1000 nucleic acids.

Specificity for ON cone bipolar cells (cOBCs) in human retinal explants is measured using the following protocol.

First, the promoter is combined with the mCitrine reporter transgene and packaged into the AAV-based self-complementary (sc) vector scAAV2(7m8) (Dalkara et al. Sci Transl Med 2013. 5: p. 189ra76). Approximately 10 ¹⁰ vg (vector genomes) are added to the RGC side of cultured postmortem human retinal explants on day 0, as detailed in (van Wyk et al. Front Neurosci 2017. 11: p.161). Retinas are fixed on day 7 of culture with 4% PFA and then cryoprotected (10/20/30% sucrose in PBS) and frozen. Retinal cryosections were treated three times with antibodies to the mCitrine transgene (Invitrogen, A11122, 1:500), antibodies to the ubiquitous OBC marker Gao (EMD, MAB3073, 1:750), and an RBC-specific antibody to PKCa (Santa Cruz, sc8393, 1 :750). Expressing RBCs are identified as [mCitrine(+), PKCa(+)], whereas cells [mCitrine(+), PKCa(-), Gao(+)] are identified as expressing cOBCs. The specificity of the cOBC type is determined by the ratio of expressing cOBC and all expressing OBC: [.N(mCitrinc(+),PKCa(-),Cao(+)}. .

N[mCitrme(+),Gao(+)} ' ’ where N represents the number of cells with the staining characteristics indicated in parentheses.

Preference for ON bipolar cone cells is then determined as follows.

The number of RBCs and cOBCs is not equal and varies in different areas of the retina. Explants are obtained from the middle and periphery of the retina, where the ratio of RBC and cOBC

N{PKCa(+)} ^L N{PKCa(-),Gao(+)} ^{J k} ' is approximately constant over a small area of the explant. Therefore, the ratio of cOBC expressing to RBC expressing

I|-N[mCitrine(-),PKCa(-),Gao(+)}. ,., N(mCitrine(-),PKCa(+),Gao(+)} ¹ can be considered constant in the explant. This allows us to calculate the coefficient of preference for cOBC compared to RBC

N{PKCa(+)} * N{mCitrine(+),PKCa(-),Gao(+))

X------------------------------------------------ ---(J)

N{PKCa(-),Gao(+)} * N{mCitrine(+),PKCa(+],Gao(+)} ' '' which allows one to determine the specific distribution of cOBC and RBC in the explant by multiplying (3) by ( 4).Then the percentage preference of cOBC is calculated using oo%«, „ --------(6)

1+X

As used herein, the term treating or treating any disease or disorder (eg, vision loss) refers in one embodiment to reducing the severity of the disease or disorder (eg, slowing, stopping, or reducing the progression of a disease or at least one of its clinical symptoms). In another embodiment, administering a treatment or treatment relates to alleviating or reducing the severity of at least one physical parameter, including parameters that may not be apparent to the patient. In yet another embodiment, administering a treatment or treatment refers to modulating the disease or disorder either physically (eg, stabilizing an overt symptom), physiologically (eg, stabilizing a physical parameter), or both. In yet another embodiment, administering a treatment or treatment refers to introducing an exogenous therapeutic function into a specific cell type. Methods for evaluating treatment and/or prevention of disease are generally known in the art unless specifically described below herein.

Detailed Description of the Invention

The present invention discloses human GRM6 gene promoter sequences with increased OBC specificity and significantly enhanced cOBC-induced protein expression compared to 200En-mGluR500P in postmortem mouse and human retinas. The promoters described herein consist of the modified metabotropic glutamate receptor 6 (mGluR6) gene promoter, which contains regulatory element sequences that direct mGluR6 protein expression in OBCs, particularly RBCs and cOBCs. The present invention relates to an isolated nucleic acid molecule or nucleic acid expression vector

- 4 045729 volic acid containing an enhancer of the mGluR6 gene or a variant thereof and a promoter of the mGluR6 gene or a variant thereof. This novel enhancer promoter sequence from the GRM6 gene allows for the first time efficient transgene expression in cOBC of the human retina, particularly in the human parafovea. Additionally, novel enhancer promoter sequences from the human GRM6 gene in combination with an optogen (MWOPN_mGluR6, SEQ ID NO: 16) resulted in widespread OBC-specific expression in the degenerating mouse (rd1, C3HHe/OuJ) retina and restoration of functional vision (optomotor response) in otherwise blind mice with photoreceptor degeneration. A novel human GRM6 gene enhancer/promoter demonstrated highly efficient, broad, and specific targeting of OBCs in mouse and human retina.

The first aspect of the present invention relates to an isolated nucleic acid molecule comprising:

a) an enhancer sequence element selected from SEQ ID NOs 1-6, and

b) a promoter sequence element selected from SEQ ID NOs 7-10.

An alternative to the first aspect of the present invention provides an isolated nucleic acid molecule between 850 base pairs (bp) and 1500 bp in length, comprising:

a) an enhancer sequence element selected from SEQ ID NOs 1-6, and a promoter sequence element selected from SEQ ID NOs 7-10.

Another alternative to the first aspect of the present invention relates to an isolated nucleic acid molecule comprising:

a) an enhancer sequence element that is 70% or greater, in particular 75% or greater, more particularly 80% or greater, more specifically 85% or greater, more particularly 90% or greater, more particularly 95% or more, more specifically 98% or more, most specifically 100% identical to the sequence selected from SEQ ID NOs 1 and 2, and

b) a promoter sequence element that is 70% or more, in particular 75% or more, more particularly 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or more, more particularly 98% or more, most particularly 100% identical to the sequence of SEQ ID NO 7, and wherein said isolated nucleic acid molecule has a ON bipolar cone cell specificity of 40% or more , in particular 50% or more, more particularly 60% or more, even more specifically 70% or more, more particularly 80% or more, even more specifically 90% or more, most particularly 100%, characteristic of the sequence of SEQ ID NO 13, and with respect to cone ON bipolar cells being 20% or more, in particular 25% or more, more particularly 30% or more, even more particularly 35% or more, more particularly 40% or more, most specifically 50% or more.

Another alternative to the first aspect of the present invention relates to an isolated nucleic acid molecule between 850 base pairs (bp) and 1500 bp in length, comprising:

a) an enhancer sequence element that is 70% or greater, in particular 75% or greater, more particularly 80% or greater, more specifically 85% or greater, more particularly 90% or greater, more particularly 95% or more, more specifically 98% or more, most specifically 100% identical to the sequence selected from SEQ ID NOs 1 and 2, and

b) a promoter sequence element that is 70% or more, in particular 75% or more, more particularly 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or more, more particularly 98% or more, most particularly 100% identical to the sequence of SEQ ID NO 7, and wherein said isolated nucleic acid molecule has a ON bipolar cone cell specificity of 40% or more , in particular 50% or more, more particularly 60% or more, even more specifically 70% or more, more particularly 80% or more, even more specifically 90% or more, most particularly 100%, characteristic of the sequence of SEQ ID NO 13, and with respect to cone ON bipolar cells being 20% or more, in particular 25% or more, more particularly 30% or more, even more particularly 35% or more, more particularly 40% or more, most specifically 50% or more.

Specificity for cOBC and expression level in cOBC were measured as described above.

The present inventors have shown that the combination of SEQ ID NO 1 or 2 with SEQ ID NO 7 results in high specificity for ON cone bipolar cells and high expression levels in ON cone bipolar cells. One skilled in the art will be able to find similar sequences with equivalent ON cone bipolar cell specificity and expression level in ON cone bipolar cells based on the disclosure of the present invention.

In certain embodiments, the enhancer sequence element is located

- 5 045729 upstream of the promoter sequence element.

In certain embodiments, the isolated nucleic acid molecule further comprises a spacer sequence of 1-1000 base pairs in length, in particular 1-394 base pairs. In certain embodiments, the spacer is located between the enhancer and the promoter. In certain embodiments, the isolated nucleic acid molecule further comprises a spacer sequence of 1-1000 base pairs in length, in particular 1-394 base pairs, and the spacer is located between the enhancer and the promoter.

In certain embodiments, the isolated nucleic acid molecule contains a sequence selected from SEQ ID NO 11 through SEQ ID NO 15.

In certain embodiments, the isolated nucleic acid molecule contains the sequence of SEQ ID NO 11 or SEQ ID NO 13.

A second aspect of the present invention relates to a nucleic acid expression vector containing a nucleic acid molecule according to the first aspect.

In certain embodiments, the viral vector is a viral genome.

In certain embodiments, the vector is an adeno-associated virus vector or a recombinant adeno-associated virus (rAAV) vector.

In certain embodiments, the AAV-based vector is either a single-stranded vector (ssAAV) or a self-complementary vector (scAAV).

In certain embodiments, the vector is a recombinant vector based on AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAV12. In certain embodiments, the vector is a recombinant AAV2-based vector.

In certain embodiments, the nucleic acid expression vector further comprises:

a) a capsid protein coding sequence, and

b) transgene.

From the 5' end to the 3' end, the isolated nucleic acid molecule contains first an enhancer, then optionally a spacer and then a promoter. The transgene is located 3'-direction from the promoter. In certain embodiments, the transgene is preceded by an optimized COZAC sequence.

The Kozak sequence contains the consensus (gcc)gccAccAUGG (SEQ ID NO 24) or (gcc)gccGccAUGG (SEQ ID NO 25) and is important for translation initiation.

In certain embodiments, the nucleic acid expression vector also contains a WPRE (woodchuck hepatitis virus post-transcriptional regulatory element) regulatory sequence. The WPRE is a DNA sequence that, when transcribed, creates a tertiary structure that enhances expression. In certain embodiments, the nucleic acid expression vector also contains a poly(A) tail inserted downstream of the transgene. The poly(A) tail promotes translation of the transgene.

In certain embodiments, the capsid protein is AAV2, AAV2(7m8), or AAV8(BP2).

A third aspect of the present invention relates to a promoter-driven transgene.

In certain embodiments, the transgene is NYX, GRM6, GPR179, or TRPM1 to restore light sensitivity or vision in congenital permanent night blindness.

In certain embodiments, the transgene contains or substantially consists of the sequence of SEQ ID NO 16.

In certain embodiments, the transgene is an opsin gene that restores light perception or vision.

In certain embodiments, the opsin gene is selected from the group consisting of channel rhodopsin, melanopsin, rhodopsin, cone opsins, pineal opsins, photopsins, halorhodopsin, bacteriorhodopsin, proteorhodopsin, jellyfish opsin, jumping spider opsin, or any functional variant or fragment thereof.

In certain embodiments, the opsin gene is a chimeric protein derived from the opsin and the metabotropic glutamate receptor mGluR6 from the retinal OBC.

In certain embodiments, the chimeric protein is Opto-mGluR6.

In certain embodiments, the chimeric protein is murine or human MWOPN_mGluR6 (SEQ ID NO: 16).

A fourth aspect of the present invention relates to an adeno-associated virus virion particle comprising an isolated nucleic acid molecule according to the first aspect or a nucleic acid expression vector according to the second aspect.

A fifth aspect of the present invention relates to an agent selected from an isolated nucleic acid molecule according to the first aspect or a nucleic acid expression vector according to

- 6 045729 to the second aspect and a virion particle of an adeno-associated virus according to the third and fourth aspects, for use as a medicinal product.

A further aspect relates to an agent selected from an isolated nucleic acid molecule according to a first aspect, a nucleic acid expression vector according to a second aspect, a transgene according to a third aspect, and an adeno-associated virus virion particle according to a fourth aspect for use in treating a condition affecting a retinal bipolar cell.

A further aspect relates to an agent selected from an isolated nucleic acid molecule according to the first aspect, a nucleic acid expression vector according to the second aspect, a transgene according to the third aspect, and an adeno-associated virus virion particle according to the fourth aspect, for use in the treatment of congenital stationary night blindness or rod and cone blindness. rod dystrophies, in particular retinitis pigmentosa and macular degeneration.

A further aspect relates to an agent selected from an isolated nucleic acid molecule according to a first aspect, a nucleic acid expression vector according to a second aspect, a transgene according to a third aspect, and an adeno-associated virus virion particle according to a fourth aspect, wherein the agent is administered by:

a) intravitreal administration, in particular by intravitreal injection, or by

b) subretinal injection.

A further aspect relates to a method of treatment in which an agent of the present invention is administered to a patient in need thereof.

Where alternatives to individual shared features, such as, for example, a promoter sequence or a medical indication, are presented herein as embodiments, it is understood that such alternatives can be freely combined to produce individual embodiments of the invention disclosed herein. Thus, any of the alternative promoter sequence embodiments can be combined with any medical indication that compromises OBC function and any DNA delivery vehicle or DNA delivery method, including alternative viruses, nanoparticles, liposomes, or naked DNA delivery using e.g. , gene gun or electroporation.

A non-limiting list of retinal diseases that may benefit from the methods described herein include congenital night blindness, macular degeneration, age-related macular degeneration, congenital cone dystrophies, and a large group of disorders associated with retinitis pigmentosa (RP).

Paragraphs.

1. An isolated nucleic acid molecule from 850 base pairs (bp) to 1500 bp in length, containing:

a) an enhancer sequence element selected from SEQ ID NOs 1-6, and

b) a promoter sequence element selected from SEQ ID NOs 7-10.

2. An isolated nucleic acid molecule from 850 base pairs (bp) to 1500 bp in length, containing:

a) an enhancer sequence element that is at least 70% (or more), in particular 75% or more, 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or greater, even more specifically 98% or greater, most specifically 100% identical to the sequence selected from SEQ ID NOs 1 and 2, and

b) a promoter sequence element that is 70% or more, in particular 75% or more, more particularly 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or more, more particularly 98% or more, most particularly 100% identical to the sequence of SEQ ID NO 7, and wherein said isolated nucleic acid molecule has a ON bipolar cone cell specificity of 40% or more , in particular 50% or more, more particularly 60% or more, even more specifically 70% or more, more particularly 80% or more, even more specifically 90% or more, most particularly 100%, characteristic of the sequence of SEQ ID NO 13, and with a preference for ON bipolar cone cells of 20% or more, in particular 25% or more, more particularly 30% or more, even more particularly 35% or more, more particularly 40% or more, most specifically 50% or more.

3. An isolated nucleic acid molecule according to paragraph 1 or paragraph 2, wherein the isolated molecule consists of one and only one of said enhancer sequence elements, one and only one of said promoter sequence elements, and optionally a spacer separating the enhancer sequence element from the promoter sequence element.

- 7 045729

4. An isolated nucleic acid molecule according to any of the preceding paragraphs, containing or consisting of a sequence selected from SEQ ID NO 11 to SEQ ID NO 15, or containing a sequence having 98% or greater identity to a sequence selected from SEQ ID NO 11 - SEQ ID NO 15, or consisting of it.

5. An isolated nucleic acid molecule as defined in any of the preceding paragraphs, containing or consisting of a sequence of SEQ ID NO 11 or SEQ ID NO 13, or containing a sequence having 98% or greater identity to SEQ ID NO 11 or SEQ ID NO 13 , or consisting thereof, in particular comprising or consisting of the sequence of SEQ ID NO 13, or containing or consisting of a sequence having 98% or greater identity to SEQ ID NO 13.

6. A nucleic acid expression vector containing a nucleic acid molecule according to any of the previous paragraphs.

7. The nucleic acid expression vector according to paragraph 6, where the nucleic acid expression vector is an adeno-associated virus vector or a recombinant adeno-associated virus (rAAV) vector, in particular where the nucleic acid expression vector is a recombinant vector based on AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12, more specifically wherein the nucleic acid expression vector is a recombinant AAV2-based vector.

8. A nucleic acid expression vector according to any of paragraphs 6-7, further comprising:

a) a capsid protein coding sequence, and

b) transgene.

9. The nucleic acid expression vector according to paragraph 8, where the transgene contains the sequence of SEQ ID NO 16.

10. A virion particle of an adeno-associated virus containing an isolated nucleic acid molecule according to any of paragraphs 1-5 or a nucleic acid expression vector according to any of paragraphs 6-9.

11. An agent selected from an isolated nucleic acid molecule according to any of paragraphs 1-5 or a nucleic acid expression vector according to any of paragraphs 6-9 and a virion particle of an adeno-associated virus according to paragraph 10, for use as a medicinal product.

12. An agent selected from an isolated nucleic acid molecule according to any one of paragraphs 1-5, a nucleic acid expression vector according to any one of paragraphs 6-9 and an adeno-associated virus virion particle according to paragraph 10 for use in the treatment of a condition affecting a retinal bipolar cell, in particular in the treatment of congenital stationary night blindness (CSBN1) or rod-cone and cone-rod dystrophies, more specifically retinitis pigmentosa and macular degeneration.

13. An agent selected from an isolated nucleic acid molecule according to any of paragraphs 1-5, a nucleic acid expression vector according to any of paragraphs 6-9 and an adeno-associated virus virion particle according to paragraph 10, where the agent is administered by:

a) intravitreal administration, in particular by intravitreal injection, or by

b) subretinal injection.

The present invention is further illustrated by the following examples and drawings, from which additional embodiments and advantages can be derived. These examples are intended to illustrate the present invention and not to limit its scope.

Brief description of graphic materials

Fig. 1. View of the human GRM6 gene sequences selected for promoter construction in the genomic browser. (A) Distal enhancer region of the human GRM6 gene (located approximately −14 kb relative to the translation start site (TLSS)), indicating three selected enhancer elements, including a conserved 310 bp region. between the mouse Grm6 gene and the human GRM6 gene (shaded with horizontal lines), as well as a 188 bp synthetic region corresponding to the 200En(Grm6) region in the mouse model according to Kim (the part that is shaded with horizontal lines and darkened). (B) Promoter sequence of the human GRM6 gene, including the transcription start site (TSS) and translation start site (TLSS), the latter defined by the present inventors as position 0. Two selected promoters are also indicated, and a conserved region of 167 bp. between mouse and human genes is shown as the portion shaded with horizontal lines. Graphs were downloaded from the UCSC Genome Browser at https://genome.ucsc.edu/ and modified. Regions shown in gray illustrate potentially important cis-regulatory regions, including transcription factor binding sites, cross-species conserved regions (regions conserved in vertebrates)

- 8 045729 and clusters with DNase hypersensitivity (clusters with DNase recognition sites). In addition, the H3K27Ac tag signal peak and Chip-seq peaks were also considered.

Fig. 2. Intensity of promoter-driven expression of mCitrine in OBCs from postmortem human retinal explants. Human retinal explants were transduced with scAAV2(7m8)-407En_566P(hGRM6)-mCitrine (n = 3), scAAV2(7m8)-444En_454P(hGRM6)mCitrine (n = 3), scAAV2(7m8)-770En_454P(hGRM6)-mCitrine (n equals 5), scAAV2(7m8)407En_454P(hGRM6)-mCitrine (n equals 3), and scAAV(7m8)-200En-mGluR500P-mCitrine (n equals 4). mCitrine was immunohistochemically labeled, and the fluorescence intensity in ON-expressing bipolar cells was determined as a measure of the intensity of transgene expression. The 566P promoter element mediated much weaker mCitrine expression in OBCs compared to promoter combinations with the proximal 454P element. Therefore, 454P was chosen for all subsequent experiments. 770En_454P(hGRM6) (F equals 5.42 ± 0.9; mean ± s.d.) and 444En_454P(hGRM6) (F equals 5.59 ± 0.51; mean ± s.d.) were equally effective in terms of transgene expression intensity and significantly higher efficiency than 200En-mGluR500P derived from the mouse genome (F equals 3.94 ± 0.45; mean ± s.d.). * means P equals 0.05 or less, ** means P equals 0.01 or less, *** means P equals 0.001 or less, and n.s. means non-significant differences (one-way ANOVA with Tukey's test of significance).

Fig. 3. Promoter specificity for ON cone bipolar cells (cOBCs) in human retinal explants. Human retinal explants were transduced with scAAV2(7m8)-444En_454P(hGRM6)-mCitrine, scAAV2(7m8)-770En_454P(hGRM6)-mCitrine, scAAV2(7m8)-407En_454P(hGRM6)-mCitrine, or scAAV(7m8)-200En-mGluR5 00P -mCitrine. Vertical cryosections were labeled with mCitrine antibody, PKCa (for rod bipolar cells (RBC)), and Ga0 antibody (a ubiquitous OBC marker), and mCitrine-expressing cells were counted. (A) Based on cell counts, 770En_454P(hGRM6) caused expressed in significantly more cOBCs than 200En-mGluR500P.(B) Normalizing the number of target cOBCs and RBCs to their total numbers within the defined retinal regions in which counts were performed demonstrates that 770En_454P(hGRM6) and 407En_454P(hGRM6) are much more drive expression in cOBC more efficiently than 200En-mGluR500P, which has a clear preference for RBC. 770En_454P(hGRM6) even shows equal preference for cOBC and RBC, at 50% for each, an important distinguishing feature of the foveal gene agent therapies where only cOBC exist.(C) The preference of the 444En_454P(hGRM6) promoter for cOBC type (n equals 5) was not significantly different from the preference of the 770En_454P(hGRM6) promoter. Means ± s.d. are shown, * means P equals 0.05 or less, ** means P equals 0.01 or less (one-way ANOVA with Tukey's test of significance). Only significant differences are indicated.

Fig. 4. Efficiency and specificity of 770En_454P(hGRM6)-driven OBC mCitrine expression in human retinal explants (A) Comparison of 770En_454P(hGRM6)-driven mCitrine expression with 200En-mGluR500P-driven mCitrine expression upon packaging in scAAV2(7m8). 770En_454P(hGRM6) shows a much higher preference for OBCs compared to 200En-mGluR500P, and the latter, in addition, has significantly higher off-target expression in amacrine cells. The % of cells expressing a specific cell type are shown as means ± s.d., ** means P equals 0.01 or less, and *** means P equals 0.001 or less (Student's t test).

Fig. 5. The 770En_454P(hGRM6) promoter robustly and widely drives transgene expression in the degenerating rd1 mouse retina. rd1 mice were injected with 3x109 vg AAV carrying the transgene MWOPN_mGluR6_IRES2_TurboFP635 (SEQ ID NO: 16, plasmid map (Fig. 9), at 22 weeks of age. In diagrams A-D, the transduced areas of the retina in whole retinal mounts are shown in gray. A) ssAAV2( 7m8) in combination with 200En-mGluR500P is also expressed in the rd1 retina, but only in limited areas (unlike 4xGrm6-SV40). B) ssAAV(7m8) in combination with 770En_454P(hGRM6) results in more extensive and widespread transduction of degenerating retina compared with 200En-mGluR500P, likely due to increased expression intensity that crosses the expression threshold if degeneration-induced suppression of Grm6 occurs. C) Example of a whole mount photomicrograph of a treated rd1 mouse retina undergoing OKR testing obtained by laser scanning microscopy (see Example 7 and Fig. 6) where TurboFP635 was immunocytochemically labeled (depicted in Scheme B). (D) Average specificity (% expressing OBCs out of all expressing cells, 66.6 ± 8.5%) and expression efficiency (% expressing OBCs out of all OBCs, 54.7 ± 8.3) in degenerating rd1 retina. Mean ± s.d., N equals 9 (Student's T test).

Fig. 6. Vision recovery, as measured by the optomotor reflex, in photoreceptor-null rd1 mice that were treated intravitreally and bilaterally with

- 9 045729 ssAAV(7m8)-MWOPN_mGluR6_IRES2_TurboFP635 at 22 weeks of age. Visual acuity was measured at 41, 47, 55, 82, and 112 days after transduction by determining the spatial frequency threshold at which an optokinetic response was still evoked in the virtual optomotor system. Treated mice (N equal to 3) showed a significant increase in visual acuity compared to control rd1 littermates that were not injected with vector (N equal to 7), but still had significantly lower visual acuity than wild-type control mice (C57BL/6J, N equals 10). Shown is the mean (across all trials and individuals) ± s.d., ** means P equals 0.01 or less and *** means P equals 0.001 or less (Student's t test).

Fig. 7. Highly efficient expression of mCitrine in cOBC of explanted human macula under the control of the 770En_454P(hGRM6) promoter. An example of a human macular explant transduced with scAAV2(7m8)-770En_454P(hGRM6)-mCitrine and immunohistochemically labeled with an antibody to the mCitrine transgene, as well as an antibody to OBC (Gao) and a cell nuclear dye (DAPI). (A) is a diagram of the human macula and the areas where the micrographs depicted in Figures B and C were taken. The foveola contains only M- and L-cone photoreceptors and contains neither OBCs nor RGCs because their cell bodies are pushed to the side, so that light can pass without diffraction to the photoreceptors. The fovea contains only cones (M, L and S) and is the site of greatest visual acuity with a dwarf cell system where each cone connects to one BPC and one RGC. Figure (B) shows a section through the parafovea with DAPI (top micrograph), demonstrating a clear layering of photoreceptors (ONL), BPCs, and amacrine cells (INL), as well as a 3-dimensional layering of RGCs (GCL) indicating the macula. The bottom micrograph shows only transgene labeling, indicating mCitrine expression exclusively in the INL, where OBCs are located. Figure (C) shows a slice through the fovea. The micrograph on the left shows only Gao labeling in OBC cells, all of which are not labeled with anti-PKC antibody (not shown) and are therefore clearly identifiable as cOBC. The right micrograph further depicts mCitrine labeling in the cytoplasm, indicating that virtually every cOBC from the fovea expresses mCitrine (shown by arrows). This is very clear evidence that 770En_454P(hGRM6) provides superior expression in cOBC, particularly in human macular cOBC, and is therefore well suited for restoring visual acuity in human patients.

Fig. 8. Plasmid map of the AAV plasmid encoding the cone opsin and the chimeric optogenetic protein mGluR6, MWOPN_mGluR6-IRES2-TurboFP635, under the control of the new promoter 770En_454P(hGRM6). TurboFP635 is a red fluorescent protein marker to identify expression, WPRE and BGHpA are regulatory sequences, and 5' and 3' ITRs (internal repeats) are regions used by AAV to package the transgene (between ITRs) into capsid. This plasmid was used to transduce degenerating retinas of rd1 mice (Figures and Examples 5 and 6). Fusion primers for cloning are also provided.

Fig. 9 Example of expression specificity in OBC and efficiency of 770En_454P(hGRM6) and 444En_454P(hGRM6) driving mCitrine expression in human retinal explants. Vertical cryosections through human retinal explants transduced with scAAV2(7m8)770En_454P(hGRM6)-mCitrine (A) and scAAV2(7m8)-444En_454P(hGRM6)-mCitrine (B), respectively. Cryosections were labeled with the nuclear dye DAPI (gray, shown only at the far left of the micrographs for orientation) and the mCitrine transgene marker (white). 770En_454P(hGRM6) has an efficiency against OBC (percentage of clear cells in INL) of 85.2% ± 12.3% (n = 4) and 444En_454P(hGRM6) has an efficiency of 87.9% ± 6.5 % (n equals 5). ONL: outer nuclear layer, INL: inner nuclear layer, GCL: ganglion cell layer. Bipolar cells are located at the periphery of the INL.

Examples

Example 1. Analysis of changes in Grm6 gene expression in the rd1 mouse model.

The present inventors selected a gene (Grm6 in mouse and GRM6 in human) encoding metabotropic glutamate receptor 6 (mGluR6), selectively expressed in ON bipolar cells (OBC) of the retina, as a template for constructing a promoter. This was because mGluR6 expression is selective for OBC, which was recently confirmed through single-cell transcriptomic analyzes of adult mouse retina (Siegert et al. Nat Neurosci 2012. 15: p. 487-95), and is also clearly evident in a transgenic line mice previously created by the present inventors, where the full-length Grm6 gene promoter drives transgene expression, particularly in the OBC of the retina (van Wyk et al., PloS Biol 2015. 13: p. e1002143). In addition, short promoter variants derived from the mouse Grm6 gene have been successfully constructed and shown to mediate preferential expression in OBC (Cronin et al., EMBO Mol Med, 2014. 6(9): p. 11751190; Kim et al. al. J Neurosci 2008. 28: p. 7748-7764; Lagali et al. Nat Neurosci 2008. 11 p.: 667-675). Kim et al. a 200-bp distal enhancer sequence was initially selected. in the promoter

- 10 045729 of the mouse Grm6 gene, which enhanced OBC-specific expression in the retina of wild-type mice. This enhancer sequence was subsequently used in the 4xGRM6-SV40 promoter [Cronin, T., et al., EMBO Mol Med, 2014. 6(9): p. 1175-1190], which contains four of these 200 bp enhancer sequences. in tandem. However, we have recently shown that the 4xGRM6-SV40 promoter [Cronin, T., et al., EMBO Mol Med, 2014. 6(9): p. 1175-1190] was completely suppressed in the degenerating rd1(C3H/HeOu) mouse retina, even when gene therapy was administered at 3.5 weeks of age before complete photoreceptor degeneration (van Wyk et al. Front Neurosci 2017. 11: p. 161). This makes 4xGRM6-SV40 (and equally GRM6-SV40) unsuitable for the treatment of degenerating retina. In addition, the SV40 basal viral promoter faces challenges such as silencing upon persistent activation and protein overexpression leading to cellular cytotoxicity. To design more suitable OBC-specific promoters, we first examined whether Grm6 expression remains elevated during the degeneration process in the rd1 degeneration mouse model. We used the rd1 mouse model on the basis that the promoters active in this model of severe and rapid degeneration are likely to be active in most less severe retinal degenerative diseases. This was previously demonstrated by the present inventors comparing transgene expression in a mouse model of rd10 with slower degeneration (B6.CXB1-Pde6brd10), where 4xGRM6SV40 was still able to drive some expression [van Wyk, M., et al., Front Neurosci, 2017. 11(161): p. 161.]. We quantified Grm6 gene expression in the retinas of rd1 mice by quantitative real-time PCR at time points P14, P21, P28, and P54 and compared the expression levels with those in the retinas of wild-type C57BL/6J mice. Ribosomal protein L8 (Rpl8) expression was used to normalize expression levels. Grm6 expression remained constant throughout degeneration ( P = 0.8795), except for a slight downregulation (0.59-fold) between P21 and P28. From this, the present inventors concluded that the severe suppression observed in the case of the 4xGRM6-SV40 promoter [van Wyk, M., et al., Front Neurosci, 2017. 11(161): p. 161.], was probably not associated with suppression of the Grm6 enhancer elements, but was likely a consequence of reduced functionality of the SV40 basal promoter with progressive degeneration. Therefore, the Grm6 gene was used by the present inventors as a template for constructing an OBC-specific promoter.

Example 2. Construction of promoters based on GRM6.

To be consistent with the human transcription mechanism in light of future applications in human therapy, we used the human GRM6 gene sequence as a template rather than the mouse Grm6 gene sequence.

The present inventors used the Basic Local Alignment Search Tool (BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi) optimized for partially similar sequences (blastn) [Altschul et al., J Mol Biol, 1990. 215(3): p. 403-10; Coordinators, Nucleic Acids Res, 2018. 46(D1): p. D8-D13], to align the sequences of the mouse Grm6 gene and the human GRM6 gene. To determine the characteristics of the enhancer, we aligned 1500 bp. to the left and right of the mouse 200En enhancer sequence identified by Kim et al. [Kim et al., J Neurosci, 2008. 28(31): p. 7748-64.]. The present inventors have discovered a conserved sequence of 310 bp. between the mouse and human genomes [from -13819 to 13510 rel. translation start site (TLSS) from the GRM6 gene], extending beyond the 200En sequence defined by Kim et al. both in the 3' and 5' directions (Fig. 1A, areas shaded with horizontal stripes). To identify promoter sequences, we focused on the GRM6 gene sequences located 5' from the translation start site (TLSS, defined by us as position 0) (Fig. 1B). After alignment, the present inventors used the genomic browser from the Genomics Institute at the University of California, Santa Cruz (UCSC genomic browser) [Church et al., PloS Biol, 2011. 9(7): p. e1001091.], [Kent et al., Genome Res, 2002. 12(6): p. 996-1006.; Kuhn et al. Brief Bioinform, 2013. 14(2): p. 144-61.] [https://genome.ucsc.edu/; Genome Assembly, February 2009 (GRCh37/hg19] to identify potential regulatory sequences of the GRM6 gene, such as cross-species conserved sequences, regions of active chromatin (DNase hypersensitive clusters or H3K27Ac tag fragments), or transcription factor binding sites. Regulatory Database gene transcription (GTRD) [Yevshin et al., Nucleic Acids Res, 2017. 45(D1): p. D61-D67] were additionally used to identify chromatin immunoprecipitation and DNA sequencing (ChIP-seq) peaks, providing experimental confirmation of factor binding sites Transcriptions Taken together, this information allowed the present inventors to determine sequences in the regions identified above with likely functional importance in relation to GRM6 gene expression.

We then selected three possible enhancer regions [407En(hGRM6), 444En(hGRM6) and 770En(hGRM6)] and two possible promoter regions [566P(hGRM6) and 454P(GRM6)] (Figure 1 and Table 1) according to the following rationale: 407En(hGRM6)

- 11 045729 (from -13873 to -13467 rel. TLSS from the GRM6 gene) consists of a conserved sequence of 300 bp in size. between the mouse and human genomes (shaded with horizontal lines in Fig. 1A). 770En(hGRM6) (-14236 to -13467 rel TLSS from the GRM6 gene) in addition to 407En(hGRM6) also contains 3' ChIP-seq peaks and a DNase hypersensitive cluster (-13990 to -13816 rel TLSS from the GRM6 gene). 444En(hGRM6) (-14033 to -13590 rel TLSS from the GRM6 gene) is a 3' and 5' truncated variant of 770En(hGRM6) containing only the 3' and 5' ChiP-seq peaks.

By aligning the sequences -1000 to -1 (rel. TLSS) from the GRM6 gene, the present inventors identified a conserved region of 167 bp. (-425 to -259 rel TLSS from the GRM6 gene) (Fig. 1B, shaded with horizontal lines in Fig. 1B). By incorporating this conserved sequence, the present inventors constructed two promoters: 566P(hGRM6) (-691 to -126 rel. TLSS from the GRM6 gene), additionally containing a 5' transcription start site (TSS, -179 rel. TLSS from the GRM6 gene) and a signal 5' peak of the H3K27Ac tag (from -656 to -405 rel. TLSS from the GRM6 gene), as well as a second 3' peak of ChiP-Seq ERG. ERG is known as an activator that interacts with FLI1 contained in 770En and 444En. The second selected promoter sequence of 454P(hGRM6) (-453 to +1 rel TLSS from the GRM6 gene) extends further 5' than 566P(hGRM6), including TLSS and additional potential regulatory sequences located between TLSS and TSS. such as ChiP-Seq peaks of TCF7L1 and MYC.

Five possible combinations of enhancer and promoter sequences (Table 1) upstream of the reporter transgene were cloned between the ITR sequences of an adeno-associated virus (AAV) vector as detailed in the examples below using standard molecular biology techniques:

Table 1

Selected enhancer/promoter combinations

Name Length Sequence no. 407En_454P(hGRM6) 867 π. O. eleven 444En_454P(hGRM6) 917 π. O. 15 407En_566P(hGRM6) 978 pi. O. 12 770En_454P(hGRM6) 1243 π. O. 13 770En_566P(hGRM6) 1354 π. O. 14

Example 3: Evaluation of a functional promoter in the human retina.

Having a promoter designed for the human GRM6 gene in light of therapeutic use in human patients, all promoters were assessed in postmortem human retinal explants. To do this, the promoters were combined with the mCitrine transgene and packaged into self-complementary (sc) AAV capsids, in particular scAAV2(7m8) (Dalkara et al. Sci Transl Med 2013. 5: p. 189ra76).

Approximately 5x106 vg (vector genomes) were added to the RGC side of cultured postmortem human retinal explants on day 1, as detailed in [van Wyk, M., et al., Front Neurosci, 2017. 11(161): p. 161.]. Retinas were frozen on day 7 of culture, when expression of the scAAV transgene was visually visible. We stained cryosections for the mCitrine reporter protein and the OBC Goa marker to visualize the localization of expression and compare expression intensity values. Up to 85% of OBCs expressed mCitrine in well-transduced regions (Fig. 9). To compare performance with the state of the art, the Lu 200En-mGluR500P promoter (Lu et al. Gene Ther, 2016. 23: p. 680-9.) was also packaged into scAAV2 (7m8) and used for human retinal explant transduction. For each promoter, cultures from three human eyes were transduced with promoter constructs, and cryosections throughout the retina were histologically stained and analyzed. To control for differences between experiments, processing and immunohistochemical analysis were performed on all samples in parallel. Fluorescence images were acquired using a ZEISS LSM 880 with Airyscan and ZEN 2.1 software. Confocal microscopy micrographs (z-stacks) were taken under a 20x objective with identical microscope settings. To determine the average transduction efficiency, cytoplasmic fluorescence of Alexa488 (a secondary antibody to mCitrine) was determined in transduced OBC cell bodies [mCitrine(+) and Goa(+)]. Specifically, random fluorescence values in the 4.15-μm-diameter OBC somatic region were determined using the brightness function of Fiji image processing software. Image analyses, including fluorescence quantification and cell counting, were performed using Fiji ulfils. (version 2.0.0, https://fiji.sc/, Schindelin et al., Nat Methods, 2012. 9(7): p. 676-82). For normalization, the fluorescence value of each expressing OBC [mCitrine(+) and Goa(+)] was divided by the average background fluorescence value determined by measurements in non-expressing OBCs [mCitrine(-) and Goa(+)]. As can be seen from Fig. 2, the basal 566P promoter mediated the weakest expression of mCitrine in OBCs, whereas expression under the control of 454P was always significantly more intense than expression under the control of the Lu 200En-mGluR500P promoter, regardless of the enhancer element used. That's why

- 12 045729 454P was chosen for all subsequent experiments. 770En_454P(hGRM6) (F equals 6.03 ± 1.53; mean ± s.d.) and 407En_454P(hGRM6) (F equals 5.65 ± 0.09; mean ± s.d.) were equally effective and were significantly better than 200En-mGluR500P derived from the Lu mouse (F equals 4.49 ± 0.22; mean ± s.d.) and therefore both were analyzed in more detail.

Example 4 Significantly Increased Preference for ON Bipolar Cone Cells in Human Retinal Explants

In the next step, sections were analyzed for OBC cell type specific expression. To this end, sections were stained with antibodies to the mCitrine transgene, antibodies to the ubiquitous marker OBC Gao, and a specific antibody to PKCa in rod bipolar cells. [mCitrine(+), PKCa(+), Gao(+)] cells were clearly identified as expressing ON rod bipolar cells (RBC), whereas [mCitrine(+), PKCa(-),Gao( +)] were clearly identified as expressing ON bipolar cone cells (cOBC). Accordingly, [mCitrine(-), PKCa(+)] cells were identified as not expressing RBC, and [mCitrine(-), PKCa(-), Gao(+)] cells were identified as not expressing cOBC. The results shown in FIG. 3 clearly indicate that both 770En_454P(hGRM6) and 407En_454P(hGRM6) mediate significantly higher transgene expression in cOBC compared to 200En-mGluR500P. A measure of preference for cOBC (Fig. 3B) was determined by normalizing the number of cOBC and RBC expressing to the total number of cOBC and RBC in the retinal region analyzed. This normalization demonstrated that 770En_454P(hGRM6) (49.5% cOBC preference) and 407En_454P(hGRM6) (36.4% cOBC preference) have significantly increased ability to drive expression in the cOBC cell type compared to 200EnmGluR500P (16.3% preference for cOBC). Of particular note is that 770En_454P(hGRM6) shows equivalent preference for RBC and cOBC (∼50% in each case, Figure 3B).

Maculae of explanted human retinas were also transduced using scAAV2(7m8)-770En_454P(hGRM6)-mCitrine. Immunolabeling with mCitrine, PKCa, and Gao clearly demonstrated that the fovea contains only cOBCs, and that 770En_454P(hGRM6) drives mCitrine expression in virtually all cOBCs (Fig. 7). The ability to efficiently drive transgene expression in cOBCs of the human fovea is of great importance for human therapeutics because the fovea mediates high visual acuity and thus represents the primary target for vision-restoring retinal gene therapy—the fovea contains only cOBCs.

Example 5: Specificity of 770En_454P(hGRM6) for OBC compared to 200EnmGluR500P.

High OBC preference is necessary to avoid off-target effects such as distorted retinal signal transmission. Human retinal sections were labeled with antibodies to mCitrine (a transgene), Goa (a common OBC marker), and the nuclear dye DAPI to distinguish cell layers. This allows us to identify the type of expressing cells: photoreceptor cells (PR, mCitrine(+), located in the outer nuclear layer), OBC [mCitrine(+), Goa(+) and located in the inner nuclear layer], amacrine cells [AC, mCitrine( +), Goa(-) and located in the inner nuclear layer] and ganglion cells (GC, mCitrine(+), located in the ganglion cell layer). Figure 4A clearly shows that the novel promoter 770En_454P(hGRM6) has a significantly increased preference for OBC (88.3 ± 7.8%) compared to 200En-mGluR500P (70.1 ± 12.2%). In addition, off-target expression under the control of 200En-mGluR500P was generally higher, particularly in AC (16.9 ± 9.1%), compared to the novel 770En_454P(hGRM6) promoter (4.1 ± 3.2%). The latter is of particular importance for optogenetic vision restoration, where off-target expression distorts signal transmission in the retina.

Example 6: Promoter Evaluation in Degenerating Mouse Retina.

Important for retinal therapy is the availability of tissue for treatment. This can be challenging in a degenerative process with anatomical, functional and transcriptional changes. We have previously shown that the mouse Kim 200En-SV40 promoter is no longer functional in the rd1 rapid degeneration mouse model (van Wyk et al. Front Neurosci 2017. 11: p. 161). Thus, the effectiveness of 770En_454P(hGRM6) [and for comparison its mouse counterpart 200En-mGluR500P [Lu et al. Gene Ther 2016. 23 p: 680-689] were tested in a mouse model of rd1 degeneration. The promoters were combined with the optogenetic MWOPN_-mGluR6-IRES2-TurboFP635 (SEQ ID NO: 16, plasmid map in Fig. 8) transgene and packaged into ssAAV2(7m8) (Dalkara et al. Sci Transl Med 2013. 5: p. 189ra76). 3x109 vg was administered via intravitreal injection as described in (van Wyk et al. Front Neurosci 2017. 11: p. 161; van Wyk et al., PloS Biol 2015. 13: p. e1002143) into the eyes of rd1 mice aged 22 weeks at an advanced stage of degeneration. 4 weeks after injections, mice were euthanized and retinas were removed for immunohistochemical analysis as previously described [van Wyk,

- 13 045729

M., et al., Front Neurosci, 2017. 11(161): p. 161 ;van Wyk et al., PloS Biol 2015. 13: p. e1002143]. We labeled the sections with an antibody to the TurboFP635 transgene, an antibody to the OBC-specific Goa marker, and the nuclear dye DAPI. In contrast to 200En-SV40, 770En_454P(hGRM6), as well as 200En-mGluR500P, derived from the Grm6 gene of Lu mice, functioned in the OBC of the rd1 retina (Fig. 5). However, 200En-mGluR500P resulted in expression only in limited areas of the retina, as exemplified in Figure 5A, whereas 770En_454P(hGRM6) resulted in much more extensive and widespread transduction in the degenerating retina (Figure 5B), likely due to its increased intensity expression that crosses the expression threshold if some suppression of Grm6 occurs. To analyze the specificity and efficiency of transgene expression (mCitrine) driven by the 770En_454P(hGRM6) promoter in the degenerating retina, we injected an additional 9 rd1 mice at even later time points (29-33 weeks of age). After 4 weeks, the animals were euthanized and the eyes were frozen and sectioned. Cryosections were again labeled with mCitrine and Goa antibodies and analyzed under a confocal microscope. Even so, in these fully degenerated retinas, ~67% of all cells expressing the transgene [mCitrine (+), Goa (-)] were OBCs [mCitrine (+), Goa (+)]. Likewise, ∼55% of all OBCs [mCitrine (−), Goa (+)] expressed the transgene [mCitrine (+), Goa (+)] ( Fig. 5D ). Widespread and specific expression of a therapeutic transgene in the degenerating retina is fundamental for effective gene therapy.

Example 7. Optogenetic gene therapy and vision restoration in rd1 mice.

To see whether the beneficial properties of 770En_454P(hGRM6) support functional optogenetic vision restoration targeting OBC, we performed a proof-of-concept experiment in a mouse model of rd1 degeneration. We injected 3x109 vg ssAAV(7m8)-770En_454P(hGRM6)-MWOPN_mGluR6IRES2-TurboFP635-WPRE-BGHpA (plasmid map, Fig. 8) bilaterally into three photoreceptor-null rd1 mice at 22 weeks of age. MWOPN_mGluR6 (SEQ ID NO 16) is a chimeric protein derived from the mouse mid-wavelength cone opsin (MWOPN) and mouse mGluR6 that functions similarly to Opto-mGluR6 to mediate OBC activity and thereby repair vision (van Wyk et al., PloS Biol 2015. 13: p. e1002143). The present inventors measured visual acuity by detecting optomotor responses (OMR) (according to [Prusky et al., Invest Ophthalmol Vis Sci, 2004. 45(12): p. 4611-6.]) at different time points (days 41, 47 , 55, 82 and 112) after insertion into an automated virtual drum OptoDrum (Striatech®), containing a small chamber (54x54x30 cm) with four screens (23.8 diagonal Full-HD IPS panels) surrounding a platform on which can be animal placed. The brightness of the screens was adjusted to 250 cd/ ^m2 , and the bottom and top of the chamber were covered with mirrors. Using a compact technical camera (IR-sensitive CMOS sensor 1/3 size with global shutter and wide-angle lens, F1.6), the movements of the mice's heads were tracked from above, while a rotating pattern of black and white was displayed on the screen at different spatial frequencies non-sinusoidal vertical stripes. Optodrum software was used to analyze the recorded head movements and control the thickness, contrast and speed of the applied stimuli. The speed of the moving bars was set to 12°/s and the contrast to 100%. As shown in Figure 6, the median visual acuity of each mouse was determined based on all measured visual acuities across trials. The median visual acuity of treated mice was 0.29 ± 0.03 cycles/ ⁰ (n = 3, ± sd, P = 0.0048), which was significantly better than that of uninjected control rd1 mice with 0.15 ± 0.06 cycles/0 (n equals 7, P equals 194 or greater), but still worse than the normal-vision positive control C57BL/6 mouse, which had a mean visual acuity of 0.43 ± 0.05 cycles/° (n equals 10, sd, P equals 0.0006). However, an optogenetic therapy targeting OBC resulted in a marked improvement in optomotor response. Taken together, the results demonstrate that 770En_454P(hGRM6) satisfies all the requirements for human gene therapy targeting OBC, providing a short (1243 bp) human gene-based promoter that, in degeneration, is still highly effective and specific for OBC, including cOBC.

Materials and methods.

Bioactivity assays.

Bioactivity assays are described in the example sections above. Culture and transduction of human retinal explants with AAV, as well as intravitreal injection of AAV into mouse eyes and subsequent immunohistochemical processing of frozen retinal sections are described in detail elsewhere [van Wyk, M., et al., Front Neurosci, 2017. 11(161) :p. 161.].

Determination of specificity for ON bipolar cone cells.

For this purpose, retinal cryosections were treated three times with antibodies to the mCitrine transgene (Invitrogen, A11122, 1:500), antibodies to the ubiquitous marker OBC Gao (EMD,

- 14 045729

MAB3073, 1:750) and RBC-specific anti-PKCa antibody (Santa Cruz, sc8393, 1:750). Cells [mCitrine(+), PKCa(+), Gao(+)] were clearly identified as expressing RBC, whereas cells [mCitrine(+), PKCa(-),Gao(+)] were clearly identified as expressing cOBC. Preference for OBC type as shown in FIG. 3A were determined by the ratios of expressing cOBCs to all OBCs [mCitrine(+), PKCa(-), Gao(+)]/[Gao(+)], and preference for RBC type was determined by the ratio of expressing RBCs to all OBCs [mCitrine( +), PKCa(+), Gao(+)]/[Gao(+)]. To obtain a measure of preference for expression in cOBC, in other words, the likelihood that expression in cOBC occurs, we determined the ratio of the number of expressing cOBC and RBC, respectively, to the number of cOBC and RBC in a given retinal region analyzed. This normalization was possible because [mCitrine(-), PKCa(+),Gao(+)] cells can be clearly identified as not expressing RBC, and [mCitrine(-), PKCa(-), Gao(+)] cells as not expressing cOBC. Thus, the ratio [mCitrine(+), PKCa(+), Gao13(+)]/[mCitrine(-), PKCa(+),Gao(+)] represents the percentage of RBCs transduced and expressing, whereas the ratio [mCitrine (+), PKCa(-),Gao(+)]/[mCitrine(-), PKCa(-), Gao(+)] represents the percentage of cOBC transduced and expressing in the corresponding retinal region analyzed. Therefore, the resulting percentages shown in FIG. 3B indicate the likelihood that cOBC is transduced.

Software used for molecular engineering.

The authors of the present invention used the genome browser of the Genomics Institute of the University of California at Santa Cruz (genome browser, https://genome.ucsc.edu/) [Kent et al., Genome Res, 2002. 12(6): p. 996-1006; Kuhn et al., Brief Bioinform, 2013. 14(2): p. 144-61] to study genomic sequences of promoters and genome annotations.

To identify transcription factors and transcription factor binding sites that are likely involved in the regulation of gene expression controlled by novel GRM6-based promoters, we used ChIP-seq data from the Gene Transcription Regulation Database (GTRD, gtrd.biouml.org/ ) [Yevshin et al., Nucleic Acids Res, 2017. 45(D1): p. D61-D67].

Plasmid maps were generated using Vector NTI Advance software (version 11.5.2).

Antibodies.

Table 3

Antibodies used for immunohistochemical analysis 1_1 Antibody to GFP Rabbit Invitrogen A-11122 1:500 1_2 Antibody to GFP Chicken Abeam abl3970 1:500 Primary antibodies 1_3 1_4 Antibody to tRFP Antibody to RKSa Rabbit Mouse Evrogren Santa Cruz Biotechnology EMD AB234 sc-8393 1:500 1:750 1_5 Antibody to Goa Mouse Millipore Santa Cruz MAB3073 1:750 1_6 Antibody to Gy 13 Antibody to rabbit antibody Rabbit Biotechnology sc-368324 1:500 Secondary antibodies 2_1 conjugated with Alexa Fluor doo Goat Invitrogen A-11008 1:400 2_2 400 Antibody to Goat Invitrogen A-10521 1:400

- 15 045729 mouse antibody, conjugated to cyanine 3

Anti-rabbit antibody,

2_3 Donkey Invitrogen A-21206 1:400 conjugated with Alexa Fluor

488

Chicken Jackson antibody

703-1752_4 antibody, Donkey Imm.Research 1:400

155 conjugated Laboratories e with cyanine 5

Hardware and software for imaging via confocal microscopy.

A ZEISS LSM 880 with an Airyscan detector and ZEN 2.1 software was used to acquire images via confocal microscopy with a 20x or 40x objective. Images were processed and evaluated in Fiji [Schindelin et al., Nat Methods, 2012. 9(7): p. 676-82.]. The cell counter plugin was used for cell counting and standard Fiji tools were used for image processing. Stitch plugin [Preibisch et al., Bioinformatics, 2009. 25(11): p. 1463-5.] were used in cases where Fiji was unable to automatically merge adjacent scanned images.

Statistical analyses.

Unless otherwise stated, values were compared using a two-tailed Student's t test and mean values ± standard deviation for biological samples throughout this work are reported. Significance levels are indicated by asterisks: * means P equals 0.05 or less, ** means P equals 0.01 or less, and *** means P equals 0.001 or less.

Other methods.

Other methods not described above and in examples 1 and 2 can be found in [van Wyk, M., et al., Front Neurosci, 2017. 11(161): p. 161.].

- 16 045729

Sequences.

Table 4

Sequences used in this study

Name SEQ ID Type Origin NO. 407En(hGRM6) 1 Nucleic acid Human 770En(hGRM6) 2 Nucleic acid Human 444En(hGRM6) 3 Nucleic acid Human 429En(mGrm6) 4 Nucleic acid Mouse 792En(mGrm6) 5 Nucleic acid Mouse 460En(mGrm6) 6 Nucleic acid Mouse 454P(hGRM6) 7 Nucleic acid Human 566P(hGRM6) 8 Nucleic acid Human 454P(mGrm6) 9 Nucleic acid Mouse 566P(mGrm6) 10 Nucleic acid Mouse 407En_454P(hGRM6) eleven Nucleic acid Human 407En_566P(hGRM6) 12 Nucleic acid Human 770En_454P(hGRM6) 13 Nucleic acid Human 770En_566P(hGRM6) 14 Nucleic acid Human 444En_454P(hGRM6) 15 Nucleic acid Human MWOPN_mGluR6 16 Nucleic acid Mouse IRES2 17 Nucleic acid Picornavirus mCitrine 18 Nucleic acid Aequorea victoria TurboFP635 19 Nucleic acid Entacmaea quadricolor W.P.R.E. 20 Nucleic acid Marmot hepatitis B virus pABGH 21 Nucleic acid Cattle pA sNRP-1 22 Nucleic acid Human AAV2 WT capsid 23 Amino acid Virus Subsequence KOZAK a) 24 Nucleic acid Eukaryotes Subsequence KOZAK b) 25 Nucleic acid Eukaryotes

- 17 045729

SEQ ID NO. 1: 407En(hG7?A/6) ctctgatttt aaaggaagta gatacttcaa ataattcatc atggagtgca 50 51 atattttctg taggctttta gtagataact tcatcagttt aaagaagatc 100 101 cttagattat gaaacattta caattatgaa tgaatattag atgttatcaa 150 1 51 atgctttttc tgcatccatt tagataatca tgtttttcct ttaatctgtt 200 201 aatgcggtga attacattaa tagatttcct aagtcattaa tctgctaaag 250 251 tgcatttctg ggacaaacca gacttggtta tgacattgta tgtatttcag 300 301 tttgcaaata ttggactagg atttttgtat ctatattcct tagtttgacc 350 351 tgtaaatttt atttcttgta ctaagtatta gcctcacgaa aggcattgtc 400 401 aaatgtt 407

SEQ ID NO. 2: 770En(hG7?A/6) gggtctccaa cttgccaact gtagatcttg gaacctttca tccttcataa 50 51 ctgcataagc caattccttc taataaatct gtataatata tctgtctata 100 101 taataaatat gtacttacat aactctgtat gttacatcta tctattctat 15 0 151 ctatctatct atctatctat ctatctatct atctatcatc tatctatcta 200 201 tttatctatt ctctgtgtct ttggagaacc ctgacatagt aagcaatcat 250 251 atcacctgca aatgatgaaa gctgtgtatt ttccaaatca gtcgttttat 300 301 gtcttttttt cttgcactga ctagtgcccc ctagagggaa tgataattgg 350 351 aattattgtc ttgctctgat tttaaaggaa gtagatactt caaataattc 400 401 atcatggagt gcaatatttt ctgtaggctt ttagtagata acttcatcag 450 451 tt taaagaag atccttagat tatgaaacat ttacaattat gaatgaatat 500 501 tagatgttat caaatgcttt ttctgcatcc atttagataa tcatgttttt 550 551 cctttaatct gttaatgcgg tgaattacat taatagattt cctaagtcat 600 601 taatctgcta aagtgcatt t ctgggacaaa ccagacttgg ttatgacatt 650 651 gtatgtattt cagtttgcaa atattggact aggatttttg tatctatatt 700 701 ccttagtttg acctgtaaat tttatttctt gtactaagta ttagcctcac 750 751 gaaaggcatt gtcaaatgtt 770

- 18 045729

SEQ ID NO 3: 444En(hG7?M6) atctattctc tgtgtctttg gagaaccctg acatagtaag caatcatatc 50 acctgcaaat gatgaaagct gtgtattttc caaatcagtc gttttatgtc 100

101 tttttttctt gcaclgacta gtgcccccta gagggaatga taattggaat 150

151 tattgtcttg ctctgatttt aaaggaagta gatacttcaa ataattcatc 200

201 atggagtgca atattttctg taggctttta gtagataact tcatcagttt 250

251 aaagaagatc cttagattat gaaacattta caattatgaa tgaatattag 300

301 atgttatcaa atgctttttc tgcatccatt tagataatca tgtttttcct 350

351 ttaatctgtt aatgcggtga attacattaa tagatttcct aagtcattaa 400

401 tctgctaaag tgcatttctg ggacaaacca gacttggtta tgac 444

SEQ ID NO 4: 429En(mGrm6), mouse sequence corresponding to 407En(hGW6) aaaacatacc actttagttt aaggactata gtgattccac actaggtaag 50 gtgctttctg taggctttta gttaatagtt ttgtcaagct aaagagatc 100

101 tccagatggc taaactttta aatcatgaat gaagtagata ttaccaaatt 150

151 gctttttcag catccatta gataatcatg ttttttgcct ttaatctgtt 200

201 aatgtagtga attacagaaa tacatttcct aaatcattac atcccccaaa 250

251 tcgttaatct gctaaagtac atctctggct caaacaagac tggttgtgac 300

301 aggtttgtct ctgtcagttt gtgactgttg ggctggctct tcctacccct 350

351 ctgcttcttg gtttggcctg aacattaatt ttattttatt tttttaattt 400

401 tacctacaat caatttcaca atgtgtgtt 429

SEQ ID NO. 5: 792En(mGrm6), mouse sequence corresponding to 770En(hGW6) ggtctcaaca agatacaaat tatgttctct aggtagcaat taacacaagg 50 aacgccttga ggtatgggag gggtgaggaa gctcacaaga tagaccctgg 100

101 tgcctggaag gaagacagcc aactaaaggt catatcacag tgtcccggga 150

151 accaacttga agggcttctg ctgtacaaat gtgggagaat ttcatcgtca 200

201 gaaggctctg caaaggtctg aaagtcaccg aactctgtaa gattctatcc 250

251 tgcttctatt cctgtcaaaa tataccagaa ggaatggaac taccccctcc 300

301 aaaaaataaa taaacaaaca aaccaccaaa ccacgcacag acaaagcatt 350

- 19 045729

351 caatacacat gctaaaacat accactttag tttaaggact atagtgattc 400

401 cacactaggt aaggtgcttt ctgtaggctt ttagttaata gttttgtcaa 450

451 gctaaagaag atctccagat ggctaaactt ttaaatcatg aatgaagtag 500

501 atattaccaa attgcttttt cagcatccat ttagataatc atgttttttg 550

551 cctttaatct gttaatgtag tgaattacag aaatacattt cctaaatcat 600

601 tacatccccc aaatcgttaa tctgctaaag tacatctctg gctcaaacaa 650

651 gactggttgt gacaggtttg tctctgtcag tttgtgactg ttgggctggc 700

701 tcttcctacc cctctgcttc ttggtttggc ctgaacatta attttatttt 750

751 atttttttaa ttttacctac aatcaatttc acaatgtgtg tt 792

SEQ ID NO. 6: 460En(mGr»i6), mouse sequence corresponding to 444En(hC;W6) ggctctgcaa aggtctgaaa gtcaccgaac tctgtaagat tctatcctgc 50 ttctattcct gtcaaaatat accagaagga atggaactac cccctccaaa 100

101 aaataaataa acaaacaaac caccaaacca cgcacagaca aagcattcaa 150

151 tacacatgct aaaacatacc actttagttt aaggactata gtgattccac 200

201 actaggtaag gtgctttctg taggctttta gttaatagtt ttgtcaagct 250

251 aaagaagatc tccagatggc taaactttta aatcatgaat gaagtagata 300

301 ttaccaaatt gctttttcag catccatta gataatcatg ttttttgcct 350

351 ttaatctgtt aatgtagtga attacagaaa tacatttcct aaalcattac 400

401 atcccccaaa tcgttaatct gctaaagtac atctctggct caaacaagac 450

451 tggttgtgac 460

SEQ ID NO 7: 454P(hG7?M6) ggaggggtct ccaccctcgg agcggtctct catccctccc tagaatcctt 50 aaatcctctc tcgctcaggg cctcggccgc atctgtcaca gacttgtcct 100

101 gaaccgacag cggctggcgc aggtgactgg cttggggcgg gagcctgggt 150

151 gtgcgctggg gatggacccc gaggaagagg ggccaagctg tcgggaagcg 200

201 gcagggctgg aggggtggag gcagtggtcg ggcgggaccc cgggcgacag 250

251 ggttcggcgc ttgtaagagc gagacggagg cccgggcagg ccggctgagc 300

301 taactcccca gagccgaagt ggaaggcgcg ccccgagcgc cttctcccca 350

- 20 045729

351 ggaccccggt gtccctcccc gcgccccgag cccgcgctct ccttcccccg 400

401 ccctcagagc gctccccgcc cctctgtctc cccgcagccc gctagacgag 450

451 CCGA

454

SEQ ID NO 8: 566P(hG®U6) ccaagaagag gacagaggca gaaagccagg gacagagact gagaaacaga 50 gacctagagg cagaagaaga ctgagataga gatggacaga gattgtgtca 100

101 gacacagccc cagagacagc cagacagtct gagtcagacg caaaccaaag 150

151 acaagaaaac aggaaaacag acccagagat tgggagaggg aggggaagga 200

201 gatgcgggga gagccagcac cgccaccccc cacactcagg aggggtctec 250

251 accctcggag cggtctctca tccctcccta gaatccttaa atcctctctc 300

301 gctcagggcc tcggccgcat ctgtcacaga cttgtcctga accgacagcg 350

351 gctggcgcag gtgactggct tggggcggga gcctgggtgt gcgctgggga 400

401 tggaccccga ggaagagggg ccaagctgtc gggaagcggc agggctggag 450

451 gggtggaggc agtggtcggg cgggaccccg ggcgacaggg ttcggcgctt 500

501 gtaagagcga gacggaggcc cgggcaggcc ggctgagcta actccccaga 550

551 gccgaagtggaaggcg 566

SEQ ID NO 9: 454P(mG'mtd), mouse sequence corresponding to 454P(hGBA46) agagagaaga gagcccttcc tccactctca agctctggag ggggtctctg 50 ccctcaccct catccctccc cagaatcctt aaatcctcta gactgtagct 100

101 ctgattttac agctgtcaca gactcgtcct actagccaga ggttggctca 150

151 ggtaagcacc actggggagg tagcctaggg tgcgctgggg tgggtccaga 200

201 ggaagagctg cccagaactg tgggggaagg agcgggaccg accatcaaca 250

251 gggggacttt tcagggagaa tgagagcaat cctctggagg cctggggagag 300

301 gctgctgagt tgctggtgcg cgagtcacca acttttcctg cgctctcggt 350

351 gtccggccag aatcccgaag tggcagctga gcacggggtg gcagcttcgt 400

401 ccgccggctc tcaaggcgtc ccggtaactt cctttcccgc agtccaggag 450

451 caga 454

- 21 045729

SEQ ID NO. 10: 566P(mGrtn6), mouse sequence corresponding to 566P(hGW6) gaccgaccag gggagtccct ggacttcttt gttcctcttc tcggggtggc 50 gggactgatt gtgtaaatct cttatctcca actttcactc ttatctgtct 100

101 ctttaatcgg catattgagg atgagtggcc aagcttattg gtgttgctgg 150

151 gtcagacaat ttaaaggcag tctaggggag aagcagaccc agggagtcag 200

201 agaggcagag agagaagaga gcccttcctc cactctcaag ctctggaggg 250

251 ggtctctgcc ctcaccctca tccctcccca gaatccttaa atcctctaga 300

301 ctgtagctct gattttacag ctgtcacaga ctcgtcctac tagccagagg 350

351 ttggctcagg taagcaccac tggggaggta gcctagggtg cgctggggtg 400

401 ggtccagagg aagagctgcc cagaactgtg ggggaaggag cgggaccgac 450

451 catcaacagg gggacttttc agggagaatg agagcaatcc tctggaggcc 500

501 tggggagaggc tgctgagttg ctggtgcgcg agtcaccaac ttttcctgcg 550

551 ctctcggtgt ccggcc 566

SEQ ID NO. 11: 407En 454P(hG7?V/6) ctctgatttt aaaggaagta gatacttcaa ataattcatc atggagtgca 50 atattttctg taggctttta gtagataact tcatcagttt aaagaagatc 150

101 cttagattat gaaacattta caattatgaa tgaatattag atgttatcaa 200

151 atgctttttc tgcatccatt tagataatca tgtttttcct ttaatctgtt 250

201 aatgcggtga attacattaa tagatttcct aagtcattaa tctgctaaag 300

251 tgcatttctg ggacaaacca gacttggtta tgacattgta tgtatttcag 350

301 tttgcaaata ttggactagg atttttgtat ctatattcct tagtttgacc 400

351 tgtaaatttt atttcttgta ctaagtatta gcctcacgaa aggcattgtc 450

401 aaatgttgct agcggagggg tctccaccct cggagcggtc tctcatccct 500

451 ccctagaatc cttaaatcct ctctcgctca gggcctcggc cgcatctgtc 550

501 acagacttgt cctgaaccga cagcggctgg cgcaggtgac tggcttgggg 600

551 cgggagcctg ggtgtgcgct ggggatggac cccgaggaag aggggccaag 650

601 ctgtcgggaa gcggcagggc tggaggggtg gaggcagtgg tcgggcggga 700

651 ccccgggcga cagggttcgg cgcttgtaag agcgagacgg aggcccgggc 750

701 aggccggctg agctaactcc cccagccga agtggaaggc gcgccccgag 800

- 22 045729

751 cgccttctcc ccaggacccc ggtgtccctc cccgcgcccc gagcccgcgc 850

801 tctccttccc ccgccctcag agcgctcccc gcccctctgt ctccccgcag 900

851 cccgctagac gagccga 867

SEQ ID NO. 12: 407En 566P(hGZ?M6) ctctgatttt aaaggaagta gatacttcaa ataattcatc atggagtgca 50 atattttctg taggctttta gtagataact tcatcagttt aaagaagatc 100

101 cttagattat gaaacattta caattatgaa tgaatattag atgttatcaa 150

151 atgctttttc tgcatccatt tagataatca tgtttttcct ttaatctgtt 200

201 aatgcggtga attacattaa tagatttcct aagtcattaa tctgctaaag 250

251 tgcatttctg ggacaaacca gacttggtta tgacattgta tgtatttcag 300

301 tttgcaaata ttggactagg atttttgtat ctatattcct tagtttgacc 350

351 tgtaaatttt atttcttgta ctaagtatta gcctcacgaa aggcattgtc 400

401 aaatgttgct agccaagaag aggacagagg cagaaagcca gggacagaga 450

451 ctgagaaaca gagacctaga ggcagaagaa gactgagata gagatggaca 500

501 gagattgtgt cagacacagc cccagagaca gccagacagt ctgagtcaga 550

551 cgcaaaccaa agacaagaaa acaggaaaac agacccagag attggggagag 600

601 ggaggggaag gagatgcggg gagagccagc accgccaccc cccacactca 650

651 ggaggggtct ccaccctcgg agcggtctct catccctccc tagaatcctt 700

701 aaatcctctc tcgctcaggg cctcggccgc atctgtcaca gacttgtcct 750

751 gaaccgacag cggctggcgc aggtgactgg cttggggcgg gagcctgggt 800

801 gtgcgctggg gatggacccc gaggaagagg ggccaagctg tcgggaagcg 850

851 gcagggctgg aggggtggag gcagtggtcg ggcgggaccc cgggcgacag 900

901 ggttcggcgc ttgtaagagc gagacggagg cccgggcagg ccggctgagc 950

951 taactcccca gagccgaagt ggaaggcg 978

SEQ ID NO. 13: 770En 454P(hG7?A/6) gggtctccaa cttgccaact gtagatcttg gaacctttca tccttcataa 50 ctgcataagc caattccttc taataaatct gtataatata tctgtctata 100

101 taataaatat gtacttacat aactctgtat gttacatcta tctattctat 150

151 ctatctatct atctatctat ctatctatct atctatcatc tatctatcta 200

- 23 045729

201 tttatctatt ctctgtgtct ttggagaacc ctgacatagt aagcaatcat 250 251 atcacctgca aatgatgaaa gctgtgtatt ttccaaatca gtcgttttat 300 301 gtcttttttt cttgcactga ctagtgcccc ctagagggaa tgataattgg 350 3 51 aattattgtc ttgctctgat tttaaaggaa gtagatactt caaataattc 400 401 atcatggagt gcaatatttt ctgtaggctt ttagtagata acttcatcag 450 451 tttaaagaag atccttagat tatgaaacat ttacaattat gaatgaatat 500 501 tagatgttat caaatgcttt t tctgcatcc atttagataa tcatgttttt 550 551 cctttaatct gttaatgcgg tgaattacat taatagattt cctaagtcat 600 601 taatctgcta aagtgcattt ctgggacaaa ccagacttgg ttatgacatt 650 651 gtatgtattt cagtttgcaa atattggact aggatttttg tatctatatt 700 701 ccttagttt g acctgtaaat tttatttctt gtactaagta ttagcctcac 750

751 gaaaggcatt gtcaaatgtt caattgatat aatgctagcg gaggggtctc 800

801 caccctcgga gcggtctctc atccctccct agaatcctta aatcctctct 850

1000 1001 ggggtggagg cagtggtcgg gcgggacccc gggcgacagg gttcggcgct 1050 1051 tgtaagagcg agacggaggc ccgggcaggc cggctgagct aactccccag 1100 1101 agccgaagtg gaaggcgcgc cccgagcgcc ttctccccag gaccccggt g 1150 1151 tccctccccg cgccccgagc ccgcgctctc cttcccccgc cctcagagcg 1200 1201 ctccccgccc ctctgtctcc ccgcagcccg ctagacgagc cga 1243

SEQ ID NO. 14: 770En_566P(b(ZH6) gggtctccaa cttgccaact gtagatcttg gaacctttca tccttcataa 50 51 ctgcataagc caattccttc taataaatct gtataatata tctgtctata 100 101 taataaatat gtacttacat aactctgtat gttacatcta tctatt ctat 150 151 ctatctatct atctatctat ctatctatct atctatcatc tatctatcta 200 201 tttatctatt ctctgtgtct ttggagaacc ctgacatagt aagcaatcat 250 251 atcacctgca aatgatgaaa gctgtgtatt ttccaaatca gtcgttttat 300 3 01 gtcttttttt cttgcactga ctagtgcccc ctagagggaa tgataattgg 350 3 51 aattattgtc ttgctctgat tttaaaggaa gtagatactt caaataattc 400 401 atcatggagt gcaatatttt ctgtaggctt ttagtagata acttcatcag 450 451 tttaaagaag atcct tagat tatgaaacat ttacaattat gaatgaatat 500

- 24 045729

501 tagatgttat caaatgcttt ttctgcatcc atttagataa tcatgttttt 550

551 cctttaatct gttaatgcgg tgaattacat taatagattt cctaagtcat 600

601 taatctgcta aagtgcattt ctgggacaaa ccagacttgg ttatgacatt 650

651 gtatgtattt cagtttgcaa atattggact aggatttttg tatctatatt 700

701 ccttagtttg acctgtaaat tttatttctt gtactaagta ttagcctcac 750

751 gaaaggcatt gtcaaatgtt caattgatat aatgctagcc aagaagagga 800

801 cagaggcaga aagccaggga cagagactga gaaacagaga cctagaggca 850

851 gaagaagact gagatagaga tggacagaga ttgtgtcaga cacagcccca 900

901 gagacagcca gacagtctga gtcagacgca aaccaaagac aagaaaacag 950 951 gaaaacagac cccagattg ggagagggag gggaaggaga tgcggggaga 1000 1001 gccagcaccg ccacccccca cactcaggag gggtctccac cctcggagcg 1050 1051 gt ctctcatc cctccctaga atccttaaat cctctctcgc tcagggcctc 1100

1101 ggccgcatct gtcacagact tgtcctgaac cgacagcggc tggcgcaggt 1150

1151 gactggcttg gggcgggagc ctgggtgtgc gctggggatg gaccccgagg 1200

1201 aagaggggcc aagctgtcgg gaagcggcag ggctggaggg gtggaggcag 1250 1251 tggtcgggcg ggaccccggg cgacagggtt cggcgcttgt aagagcgaga 1300 1301 cggaggcccg ggcaggccgg ctgagctaac tccccagagc cgaagtgga a 1350 1351 ggcg 1354

SEQ ID NO. 15: 4441 η 454I’(hG7?.V/6) atctattctc tgtgtctttg gagaaccctg acatagtaag caatcatatc 50 acctgcaaat gatgaaagct gtgtattttc caaatcagtc gttttatgtc 100

101 tttttttctt gcactgacta gtgcccccta gagggaatga taattggaat 150

151 tattgtcttg ctctgatttt aaaggaagta gatacttcaa ataattcatc 200

201 atggagtgca atattttctg taggctttta gtagataact tcatcagttt 250

251 aaagaagatc cttagattat gaaacattta caattatgaa tgaatattag 300

301 atgttatcaa atgctttttc tgcatccatt tagataatca tgtttttcct 350

351 ttaatctgtt aatgcggtga attacattaa tagatttcct aagtcattaa 400

401 tctgctaaag tgcatttctg ggacaaacca gacttggtta tgaccaattg 450

451 atataatgct agcggagggg tctccaccct cggagcggtc tctcatccct 500

501 ccctagaatc cttaaatcct ctctcgctca gggcctcggc cgcatctgtc 550

551 acagacttgt cctgaaccga cagcggctgg cgcaggtgac tggcttgggg 600

601 cgggagcctg ggtgtgcgct ggggatggac cccgaggaag aggggccaag 650

- 25 045729

651 ctgtcgggaa gcggcagggc tggaggggtg gaggcagtgg tcgggcggga 700

701 ccccgggcga cagggtlcgg cgcttgLaag agcgagacgg aggcccgggc 750

751 aggccggctg agctaactcc cccagccga agtggaaggc gcgccccgag 800

801 cgccttctcc ccaggacccc ggtgtccctc cccgcgcccc gagcccgcgc 850

851 tctccttccc ccgccctcag agcgctcccc gcccctctgt ctccccgcag 900

901 cccgctagac gagccga 917

SEQ ID NO. 16: MWOPN_mGluR6 atggcccaaa ggcttacagg tgaacagaca ctggaccact atgaggatag 50 cacccatgca agcatcttca cctataccaa cagcaacagc accaaaggtc 100

101 cctttgaagg ccccaattat cacattgctc ccaggtgggt gtaccacctc 150

151 accagcacct ggatgattct tgtggtcgtt gcatctgtct tcactaatgg 200

201 acttgtgctg gcagccacca tgagattcaa gaagctgcgc catccactga 250

251 actggattct ggtgaacttg gcagttgctg acctagcaga gaccattatt 300

301 gccagcactatcagtgttgt gaaccaaatc tatggctact tcgttctggg 350

351 acaccctctg tgtgtcattg aaggctacat tgtctcattg tgtggaatca 400

401 caggcctctg gtccctggcc atcatttcct gggagagatg gctggtggtc 450

451 tgcaagccct ttggcaatgt gagattgat gctaagctgg ccactgtggg 500

501 aatcgtcttc tcctgggtct gggctgctat atggacggcc ccaccaatct 550

551 ttggttggag caggtactgg ccttatggcc tgaagacatc ctgtggccca 600

601 gacgtgttca gcggtacctc gtaccccggg gttcagtctt atatgatggt 650

651 cctcatggtc acgtgctgca tcttcccact cagcatcatc gtgctctgct 700

701 acctccaagt gtggctggcc atccgagcag tggcaaagca acagaaagaa 750

751 tctgagtcca ctcagaaggc cgagaaggag gtgacacgca tggtggtggt 800

801 gatggtcttc gcatactgcc tctgctgggg accctatact ttctttgcat 850

851 gctttgctac tgcccaccct ggctatgcct tccaccctct tgtggcctcc 900

901 ctaccatcct actttgccaa aagtgccact atctacaacc ccattatcta 950

951 tgtctttatg aaccggcagt ttcgaaactg catcttacat ctctttggaa 1000

1001 agaaggttga tgatagctct gaactttcca gcacctccaa gacagaagtc 1050

1051 tcatctgtct cttcagtgtc acctgcagag cagaacgtgc agaagcggaa 1100

1101 gcgcagcctc aagaagacct ccacgatggc ggccccgccc aagagcgaga 1150

1151 actcagagga cgccaagaca gagaccagcc aagtggcgcc tgccaagagc 1200

1201 aggatcacca gcgagggcga gtacatcccc ctggaccaga tcgacatcaa 1250

- 26 045729

1251 cgtgtaa 1257

SEQ ID NO 17: IRES2 gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa 50 taaggccggt gtgcgtttgt ctatatgtta ttttccacca tattgccgtc 100

101 ttttggcaat gtgagggccc ggaaacctgg ccctgtcttc ttgacgagca 150

151 ttcctagggg tctttcccct ctcgccaaag gaatgcaagg tctgttgaat 200

201 gtcgtgaagg aagcagttcc tctggaagct tcttgaagac aaacaacgtc 250

251 tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

301 tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa 350

351 ccccagtgcc acgttgtgag ttggalagtt gtggaaagag tcaaatggct 400

401 ctcctcaagc gtattcaaca aggggctgaa ggatgcccag aaggtacccc 450

451 attgtatggg atctgatctg gggcctcggt gcacatgctt tacatgtgtt 500

501 tagtcgaggt taaaaaaacg tctaggcccc ccgaaccacg gggacgtggt 550

551 tttcctttga aaaacacgat gataatatgg ccaca 585

SEQ ID NO. 18: mCitrine atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt 50 cgagctggac ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg 100

101 gcgagggcga tgccacctac ggcaagctga ccctgaagtt catctgcacc 150

151 accggcaagc tgcccgtgcc ctggcccacc ctcgtgacca ccttcggcta 200

201 cggcctgatg tgcttcgccc gctaccccga ccacatgaag cagcacgact 250

251 tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

301 ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 350

351 cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg 400

401 acggcaacat cctggggcac aagctggagt acaactacaa cagccacaac 450

451 gtctatatca tggccgacaa gcagaagaac ggcatcaagg tgaacttcaa 500

501 gatccgccac aacatcgagg acggcagcgt gcagctcgcc gaccactacc 550

551 agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

601 tacctgagct accagtccaa gctgagcaaa gaccccaacg agaagcgcga 650

651 tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actctcggca 700

701 tggacgagct gtacaagtcc ggataa 726

- 27 045729

SEQ ID NO. 19: TurboFP635 atggtgggtg aggatagcgt gctgatcacc gagaacatgc acatgaaact 50 gtacatggag ggcaccgtga acgaccacca cttcaagtgc acatccgagg 150

101 gcgaaggcaa gccctacgag ggcacccaga ccatgaagat caaggtggtc 200

151 gagggcggcc ctctcccctt cgccttcgac atcctggcta ccagcttcat 250

201 gtacggcagc aaaaccttta tcaaccacac cccaggcatc cccgacttct 300

251 ttaagcagtc cttccctgag ggcttcacat gggagaggat caccacatac 350

301 gaagacgggg gcgtgctgac cgctacccag gacaccagcc tccagaacgg 400

351 ctgcctcatc tacaacgtca agatcaacgg ggtgaacttc ccatccaacg 450

401 gccctgtgat gcagaagaaa acactcggct gggaggccag caccgagatg 500

451 ctgtaccccg ctgacagcgg cctgagaggc catagccaga tggccctgaa 550

501 gctcgtgggc gggggctacc tgcactgctc cctcaagacc acatacagat 600

551 ccaagaaacc cgctaagaac ctcaagatgc ccggcttcta cttcgtggac 650

601 aggagactgg aaagaatcaa ggaggccgac aaagagacct acgtcgagca 700

651 gcacgagatg gctgtggcca ggtactgcga cctgcctagc aaactggggc 750

701 acagctga 708

SEQ ID NO. 20: WPRE aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa 50 ctatgttgct ccttttacgc tatgtggata cgctgcttta atgcctttgt 100

101 atcatgctat tgcttcccgt atggctttca ttttctcctc cttgtataaa 150

151 tcctggttgc tgtctcttta tgaggagttg tggcccgttg tcaggcaacg 200

201 tggcgtggtg tgcactgtgt ttgctgacgc aacccccact ggttggggca 250

251 ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

301 attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg 350

351 ggctcggctg ttgggcactg acaattccgt ggtgttgtcg gggaaatcat 400

401 cgtcctttcc ttggctgctc gcctgtgttg ccacctggat tctgcgcggg 450

451 acgtccttct gctacgtccc ttcggccctc aatccagcgg accttccttc 500

501 ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt eg 542

- 28 045729

SEQ ID NO. 21: pA BGH gcctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc 50 cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 100

101 aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg 150 ¹⁵¹ gggggtgggg tggggcagga cagcaagggg gaggattggg aagacaatag 200

201 caggcatgct gggga215

SEQ ID NO. 22: pA sNRP-1 aaataaaata cgaaatg17

SEQ ID NO. 23: AAV2 WT capsid

MAADGYLPDW LEDTLSEGIR QWWKLKPGPP PPKPAERHKD DSRGLVLPGY KYLGPFNGLD60

KGEPVNEADA AALEHDKAYD RQLDSGDNPY LKYNHADAEF QERLKEDTSF GGNLGRAVFQ 120 AKKRVLEPLG LVEEPVKTAP GKKRPVEHSP VEPDSSSGTG KAGQQPARKR LNFGQTGDAD 180 SVPDPQPLGQ PPAAPSGLGT NTMATGSGAP MADNNEGADG VGNSSGNWHC DSTWMGDRVI 240 TTSTRTWALP TYNNHLYKQI SSQSGASNDN HYFGYSTPWG YFDFNRFHCH FSPRDWQRLI 300

NNNWGFRPKR LNFKLFNIQV KEVTQNDGTT TIANNLTSTV QVFTDSEYQL PYVLGSAHQG 360 CLPPFPADVF MVPQYGYLTL NNGSQAVGRS SFYCLEYFPS QMLRTGNNFT FSYTFEDVPF 420 HSSYAHSQSL DRLMNPLIDQ YLYYLSRTNT PSGTTTQSRL QFSQAGASDI RD QSRNWLPG 480 PCYRQQRVSK TSADNNNSEF SWTGATKYHL NGRDSLVNPG PAMASHKDDE EKFFPQSGVL 540

IFGKQGSEKT NVDIEKVMIT DEEEIRTTNP VATEQYGSVS TNLQRGNRQA ATADVNTQGV 600 LPGMVWQDRD VYLQGPIWAK IPHTDGHFHP SPLMGGFGLK HPPPQILIKN TPVPANPSTT 660 FSAAKFASFI TQYSTGQVSV EIEWELQKEN SKRWNPEIQY TSNY NKSVNV DFTVDTNGVY 720 SEPRPIGTRY LTRNL 735

Claims (17)

1. An isolated nucleic acid molecule from 850 base pairs (bp) to 1500 bp in length, containing: a) an enhancer sequence element selected from SEQ ID NOs 1-3, and b) the promoter sequence element of SEQ ID NO 7. 2. An isolated nucleic acid molecule from 850 base pairs (bp) to 1500 bp in length, containing: a) an enhancer sequence element that is at least 70% (or more) identical to the sequence selected from SEQ ID NOs 1-3, and b) a promoter sequence element that is 70% or more identical to the sequence set forth in SEQ ID NO 7, and wherein said isolated nucleic acid molecule has a specificity for ON cone bipolar cells that is 40% or more than that of the sequence set forth below SEQ ID NO 13, and preference is given to ON bipolar cells being cones of 20% or greater. 3. The isolated nucleic acid molecule according to claim 2, wherein the enhancer sequence element is 75% or more, 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or more , even more specifically 98% or more, most specifically 100% identical to the sequence selected from SEQ ID NOs 1-3. 4. The isolated nucleic acid molecule according to claim 2, wherein the promoter sequence element is 75% or more, more particularly 80% or more, more particularly 85% or more, more particularly 90% or more, more particularly 95% or more, even more specifically 98% or - 29 045729 more, most specifically 100% identical to the sequence under SEQ ID NO 7. 5. The isolated nucleic acid molecule of claim 2, wherein said isolated nucleic acid molecule has a specificity for ON cone bipolar cells of 50% or more, more particularly 60% or more, even more particularly 70% or more, more particularly 80% or greater, even more specifically 90% or greater, most particularly 100% of the sequence of SEQ ID NO 13. 6. The isolated nucleic acid molecule of claim 2, wherein said isolated nucleic acid molecule has a preference for ON bipolar cone cells of 25% or more, more particularly 30% or more, even more particularly 35% or more , more specifically 40% or more, most specifically 50% or more. 7. An isolated nucleic acid molecule according to any one of claims 1 to 6, wherein the isolated molecule consists of one and only one of said enhancer sequence elements, one and only one of said promoter sequence elements, and optionally a spacer separating the enhancer sequence element from the promoter sequence element sequences. 8. An isolated nucleic acid molecule according to any of the preceding claims, containing or consisting of a sequence selected from SEQ ID NO 11, SEQ ID NO 13 and SEQ ID NO 15, or containing a sequence characterized by 98% or greater sequence identity, selected from or consisting of SEQ ID NO 11, SEQ ID NO 13 and SEQ ID NO 15. 9. An isolated nucleic acid molecule according to any of the preceding claims, containing or consisting of a sequence of SEQ ID NO 11 or SEQ ID NO 13, or containing a sequence having 98% or greater identity to SEQ ID NO 11 or SEQ ID NO 13 , or consisting of thereof, in particular, containing or consisting of the sequence of SEQ ID NO 13, or containing or consisting of a sequence having 98% or greater identity to SEQ ID NO 13. 10. A nucleic acid expression vector containing a nucleic acid molecule according to any of the previous claims. 11. The nucleic acid expression vector according to claim 10, wherein the nucleic acid expression vector is an adeno-associated virus vector or a recombinant adeno-associated virus (rAAV) vector, in particular, wherein the nucleic acid expression vector is a recombinant AAV1-based vector, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12, more particularly, wherein the nucleic acid expression vector is a recombinant AAV2-based vector. 12. The nucleic acid expression vector according to claim 10 or 11, additionally containing: a) a capsid protein coding sequence, and b) transgene. 13. The nucleic acid expression vector according to claim 12, wherein the transgene contains the sequence of SEQ ID NO 16. 14. A virion particle of an adeno-associated virus containing an isolated nucleic acid molecule according to any of claims 1-9 or a nucleic acid expression vector according to any of claims 10-13. 15. Use of an isolated nucleic acid molecule according to any of claims 1-9, a nucleic acid expression vector according to any of claims 10-13 or a virion particle of an adeno-associated virus according to claim 14 as a drug. 16. Use of an isolated nucleic acid molecule according to any one of claims 1 to 9, a nucleic acid expression vector according to any one of claims 10 to 13 or an adeno-associated virus virion particle according to claim 14 for the treatment of congenital stationary night blindness (CSBN1), rod-cone and cone-rod dystrophies, retinitis pigmentosa or macular degeneration. 17. The isolated nucleic acid molecule according to any one of claims 1-9, the nucleic acid expression vector according to any one of claims 10-13 or the virion particle of an adeno-associated virus according to claim 14, wherein said isolated nucleic acid molecule, expression vector or virion particle is administered through: a) intravitreal injection, b) intravitreal injection, or c) subretinal injection.