EA045710B1 - USE OF COMPOSITIONS CONTAINING AMINO ACIDS FOR PREVENTION AND TREATMENT OF CARDIOTOXICITY INDUCED BY CHEMOTHERAPEUTIC AGENTS - Google Patents

Description

Field of technology

The present description generally relates to the use of compositions containing amino acids for the prevention and treatment of side effects of chemotherapy.

Prior Art

Breast cancer is the most common neoplastic disease among women worldwide. In 2012, approximately 1.67 million new cases of this tumor were diagnosed. In 2018, nearly 2.1 million (11.6%) women were diagnosed with new cases of breast cancer, and approximately 627,000 (6.6%) women died from this type of cancer. This forecast indicates that some types of breast cancer are still incurable diseases leading to high mortality among women.

Anthracyclines such as doxorubicin (DOX) are widely used and highly effective anticancer chemotherapy agents. Unfortunately, administration of DOX results in dose-dependent side effects on noncancerous tissues, including the development of cardiomyopathy, in addition to dyspnea, exercise intolerance, hepatotoxicity, and nephropathy. In addition to anthracyclines, newer therapies, including those targeting human epidermal growth factor (HER) 2 (HER2/ErbB2 inhibitors), several tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, and immune checkpoint inhibitors, have demonstrated potent cardiovascular toxicity. For patients with HER2-positive breast cancer, treatment with trastuzumab was also associated with cardiomyopathy, characterized by loss of left ventricular ejection fraction after treatment. Patients with cancer who develop cancer therapy-related cardiomyopathy have significantly worse survival compared with patients without cardiotoxicity. These toxic effects represent a limiting factor in the treatment of several other treatable neoplasms, and the elderly population with reduced cardiac reserve may be even more susceptible to such effects. Thus, the risk of cardiotoxicity is one of the greatest limiting factors in the clinical use of these drugs, leading to both acute and chronic cardiovascular events. For example, acute cardiac toxicity from DOX can develop within minutes to days after administration and is usually characterized by hypotension, arrhythmia, and, most importantly, left ventricular failure. Although the molecular mechanisms of these adverse effects are not fully understood, and because DOX affects many different intracellular processes, increasing evidence suggests that the primary mediator of cardiac injury through DOX is oxidative stress, with increased active form-dependent lipid peroxidation oxygen (ROS) and decreased levels of antioxidants and sulfhydryl groups. Increased oxidative stress is accompanied by the development of cardiomyopathy and heart failure. Mitochondrial dysfunction may be involved in the side effects caused by DOX and other chemotherapeutic agents in general, as high ROS production causes mitochondrial dysfunction with decreased ATP (adenosine triphosphoric acid) synthesis and cardiac cell apoptosis.

However, cardiomyopathy and heart failure caused by chemotherapeutic agents differ both in terms of pathological anatomy and pathological physiology compared with heart failure caused by cardiovascular causes. This is the reason why chemotherapy-induced cardiomyopathy and heart failure are generally not curable with conventional therapies.

Additionally, additional key challenges in identifying effective treatments for chemotherapy-induced cardiotoxicity include evidence that potentially appropriate approaches to treating cardiomyopathy or heart failure may not be suitable for a specific patient population, i.e. patients suffering from cancer. Cancer cells have metabolic profiles that differ from those of cells from healthy subjects, and conflicting evidence is emerging regarding the role of mitochondrial activity in cancer cell proliferation. Therapeutic approaches that can restore mitochondrial function may lead to increased proliferation of cancer cells and thus reduce the antitumor effect of chemotherapeutic agents.

Brief description of the invention

The purpose of the present disclosure is to provide novel amino acid-based compositions particularly effective in counteracting cardiotoxicity induced by chemotherapeutic agents in a subject suffering from cancer and undergoing chemotherapy.

According to the present description, the above object is achieved by the subject matter of the invention specifically mentioned in the following claims, which are understood to form an integral part of the present invention.

An embodiment of the present disclosure provides the use of a composition for preventing and/or treating cardiotoxicity induced by at least one chemotherapeutic agent in a subject undergoing chemotherapy, wherein the composition contains an active agent, wherein said active agent contains the amino acids leucine, isoleucine, valine, threonine , lysine, and citric acid, succinic acid, malic acid.

- 1 045710

The at least one chemotherapeutic agent may be selected from the group consisting of anthracyclines, HER2/ErbB2 inhibitors, tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, immune checkpoint inhibitors. The anthracyclines are preferably selected from the group consisting of doxorubicin, epirubicin, daunorubicin, idarubicin, pixantrone, sabarubicin, valrubicin.

In one or more embodiments, the active agent of the composition further comprises one or more amino acids selected from the group consisting of histidine, phenylalanine, methionine, tryptophan, cysteine and tyrosine.

Brief description of graphic materials

The invention will now be described by way of example only with reference to the accompanying drawings, in which:

fig. 1 is a diagram showing treatment of HL-1 cardiocytes (a cardiac muscle cell line);

fig. 2 is a diagram showing in vivo treatment of mice;

fig. 3 shows that specific amino acid compositions prevent mitochondrial dysfunction in HL-1 cardiomyocytes exposed to short-term and intense DOX; (A) Mitochondrial biogenesis marker expression: mRNA levels (messenger RNA) of peroxisome proliferator-activated receptor-γ coactivator 1α (PGC1-a), nuclear respiratory factor-1 (NRF1), mitochondrial transcription factor A (Tfam), cytochromes-c ( cyt c) and cytochrome c oxidase subunits IV (COX IV) were measured using quantitative RT-PCR (reverse transcription polymerase chain reaction). Relative expression values for untreated (CTRL) cells were set to 1.0 (n=5 experiments). (B) COX IV and cyt c protein levels were measured by immunoblotting. Relative values were measured by densitometric analysis relative to GAPDH (glyceraldehyde-3-phosphate dehydrogenase) levels; values for untreated (CTRL) cells were set to 1.0 (n=5 experiments). (C) Citrate synthase activity. Values were normalized to protein content (n=3 experiments). *p<0.05, **p<0.01 and ***p<0.001 compared with untreated cells; fp<0.01 compared with DOX-treated cells; §p<0.01 compared to cells treated with BCAAem (a mixture enriched with branched chain amino acids). All data are presented as mean ± SD (standard deviation);

fig. 4 shows that TCA (tricarboxylic acid) intermediates do not interfere with DOX-induced restoration of mitochondrial biogenesis genes in HL-1 cardiomyocytes. (A-C) Peroxisome proliferator-activated receptor-γ coactivator 1α (PGC-1a) (A), nuclear respiratory factor-1 (NRF1) (B), and transcription factor A (Tfam) (C) mRNA levels were measured by quantitative RT- PCR. Relative expression values for untreated (CTRL) cells were set as 1.0 (n=3 experiments). C, citric acid; S, succinic acid, M, malic acid. *p<0.05 compared to untreated cells. All data are presented as mean ±SD;

fig. Figure 5 shows that a5 supplementation prevents DOX-induced oxidative stress in HL-1 cardiomyocytes. (A) mitochondrial H ₂ O ₂ release, (B) basal/total aconitase ratio, and (C) superoxide dismutase (SOD) activity in HL-1 cells (n=3 experiments). (D) Superoxide dismutase 1 (SOD1) and glutathione peroxidase 1 (GPX1) mRNA levels were measured by quantitative RT-PCR. Relative expression values for untreated (CTRL) cells were set to 1.0 (n=5 experiments). (E) Total oxidative DNA damage (disoxyribonucleic acid) measured as 8-hydroxy-2′-deoxyguanosine (8-OHdG) production in untreated (CTRL) and DOX-treated cells (n=3 experiments). *p<0.05, **p<0.01 and ***p<0.001 compared with untreated cells; fp < 0.01 compared with DOX-treated cells. All data are presented as mean ±SD;

fig. 6 shows that composition a5 prevents DOX-induced HL-1 cell death. Cytotoxicity of HL-1 cardiomyocytes was measured using the MTT assay. Cells were treated with 1% a5 for 48 h and 1 μM DOX for 16 h. *p < 0.05 compared to untreated cells; fp < 0.05 compared to DOX-treated cells. All data are presented as mean ±SD;

fig. 7 shows that composition a5 prevents mitochondrial dysfunction in the left ventricle of DOX-treated mice. (A and F) Mitochondrial biogenesis marker expression. (A) The mRNA levels of PGC1-a, NRF1, Tfam, cyt c, COX IV, and (F) SOD1, superoxide dismutase 2 (SOD2), catalase (Cat), and GPX1 were measured by quantitative RT-PCR. Relative expression values for vehicle-treated mice (Veh) were set to 1.0 (n=5 experiments). (B) The amount of mitochondrial DNA (mtDNA) was measured using quantitative RT-PCR. Relative units were expressed compared to units for Veh-treated mice, which were set to 1.0 (n=5 experiments). (C) COX IV and cyt c protein levels were determined by immunoblotting. Regarding

- 2 045710 strong values were measured using densitometric analysis relative to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels; values for mice treated with Veh were set to 1.0 (n=5 experiments). (D) Citrate synthase activity. Values were normalized to protein content (n=3 experiments). (E) Basal oxygen consumption rate. Mitochondria were isolated from the left ventricle of mice treated or not treated with DOX and α5. Oxygen consumption values were normalized to the amount of mitochondrial protein (n=3 experiments). *p<0.05, **p<0.01 and ***p<0.001 compared with Veh-treated mice; fp<0.05 and fp<0.01 compared with DOX-treated mice. All data are presented as mean ± SD;

fig. 8 shows that different signaling pathways are involved in the protective effects of α5 supplementation in DOX-treated mice. (A, E, and F) Gene expression. (A) mRNA levels of endothelial nitric oxide synthase (eNOS), (E) Sestrin-2, and (F) Krhppel-like factor 15 (KLF15) were analyzed by quantitative RT-PCR. Relative expression values for vehicle-treated mice (Veh) were set to 1.0 (n=5 experiments). (B, C, D and G) Protein levels. (B) PhosphoeNOS, (C) phospho-S6 (ribosomal protein S6), (D) phospho-mTOR (mammalian target of rapamycin), and (G) phospho-BCKDH (branched-chain α-ketoacid dehydrogenase complex) protein levels were measured using immunoblotting. Relative values were densitometrically analyzed and presented as ratios to total eNOS, S6, mTOR and BCKDH levels, respectively. Values for Veh-treated mice were set to 1.0 (n=5 experiments). *p<0.05 and **p<0.01 compared with Veh-treated mice; fp < 0.05 compared with DOX-treated mice. All data are presented as mean ±SD;

fig. 9 shows that different signaling pathways are involved in the protective effects of α5 supplementation in DOX-treated HL-1 cardiomyocytes. (A, D, and F) Gene expression. The mRNA levels of (A) eNOS, (D) Sestrin2, (F) KLF15 were analyzed by quantitative RT-PCR. Relative expression values for untreated (CTRL) cells were set to 1.0 (n=5 experiments). (B, C, E-H) Protein levels. (B) Levels of phospho-eNOS, (C) phospho-S6, (E) phospho-Akt (protein kinase B), (F) KLF15, (G) PGC-1a and COXIV, and (H) phospho-S6 and phospho- BCKDH proteins were measured by immunoblotting. Relative values were densitometrically analyzed and presented as ratios to total eNOS, S6, Akt, and BCKDH levels, respectively; KLF15, PGC-1a and COXIV were normalized to GAPDH. Values for untreated HL-1 cells were set to 1.0 (n=5 experiments). (G) PGC1-a AND COX IV protein levels were measured by immunoblotting in HL-1 cells transfected with either KLF15 specific siRNA (small interfering RNA) or nontargeting siRNA and treated with DOX or α5 alone or in combination. Values for untreated HL1 cells were set to 1.0 (n=5 experiments). (H) Phosphorylation of S6 and BCKDH was measured by immunoblotting in HL-1 cells as in (H). *p<0.05, **p<0.01 and ***p<0.001 compared with untreated cells; fp < 0.05 compared to DOX-treated cells. All data are presented as mean ±SD;

fig. 10 shows specific silencing of Klf15, eNOS and Raptor (mTOR regulatory associated protein) in HL-1 cardiomyocytes. (A–C) Klf15, eNOS, and Raptor mRNA levels were measured by qRT-PCR, and KLF15, eNOS, and Raptor protein levels were measured by immunoblotting. Relative expression values for untreated (CTRL) cells were set to 1.0 (n=5 experiments). *p<0.05 compared to untreated cells. All data are presented as mean ±SD;

fig. 11 shows specific silencing of eNOS and Raptor in HL-1 cardiomyocytes. (A) PGC1-a AND COX IV protein levels were measured by immunoblotting in HL-1 cells transfected with either specific eNOS siRNA or nontargeting siRNA and treated with DOX or α5 alone or in combination. (B) PGC1-a and COX IV protein levels were measured by immunoblotting in HL1 cells transfected with either Raptor-specific siRNA or nontargeting siRNA and treated with DOX or α5 alone or in combination. Values for untreated (CTRL) cells were set to 1.0 (n=3 experiments). *p<0.05, **p<0.01 and ***p<0.001 compared with untreated cells; fp < 0.05 compared to DOX-treated cells. All data are presented as mean ±SD;

fig. 12 shows a proposed model for the protective effect of α5 on doxorubicin (DOX)-induced mitochondrial damage in cardiomyocytes. Plus (+) and minus (-) symbols indicate stimulation or inhibition induced by DOX and potentially α5 target sites. DOX reduces mitochondrial biogenesis and the functions of 1) binding to topoisomerase ΙΙβ (TOP2B), which forms complexes with the Ppargc1a and Ppargc1b promoters and blocks the transcription of mitochondrial genes, including anti-ROS defense genes, 2) reducing the expression of eNOS and mTORC1 activity, which are important regulators of mitochondrial physiology, 3) limitation of KLF15 gene expression and presumably BCAA oxidation, with accumulation of α-keto acid and BCAA, which are toxic at high levels, beyond reduced intermediates

- 3 045710 tov of the TCA cycle and mitochondrial energy production. Mitochondrial accumulation of DOX is accompanied by an increase in ROS;

fig. 13 refers to the proliferation of MCF7 breast cancer cells. The antiproliferative effect of DOX remained unchanged in MCF7 cells in the presence of a mixture of amino acids. (A) Acid phosphatase assay: cells (5000-20000/well in 96-well plates) treated with 1% α5 for 48 h and 1 μM DOX for 16 h. (B) Proliferation assay: cells (50000/well in 12 -well plates) were processed as in (A) and a trypan blue exclusion assay was used. n=3 experiments. *p<0.05 and **p<0.01 compared with untreated cells. All data are presented as mean ±SD.

Detailed Description of Preferred Embodiments

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the embodiments. Embodiments may be implemented without one or more specific details or with other methods, components, materials, etc. In other cases, well-known structures, materials, or operations are not shown or described in detail so as not to obscure aspects of the invention.

As used herein, reference to one embodiment or embodiment means that a particular element, feature, structure, or characteristic described in connection with an embodiment is included in at least one embodiment. Thus, the use of an expression in accordance with one embodiment or in accordance with an embodiment in different places herein does not necessarily always refer to the same embodiment. In addition, individual features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. The headings presented here are for convenience only and do not interpret the scope or meaning of the embodiments.

The purpose of the present disclosure is to provide novel amino acid-based compositions particularly effective in counteracting cardiotoxicity induced by chemotherapeutic agents in a subject undergoing chemotherapy. The composition is capable of preventing and treating mitochondrial dysfunction specifically induced by chemotherapeutic agents in cardiac cells. Cardiotoxicity induced by chemotherapeutic agents may include cardiomyopathy or heart failure.

The present description provides the use of a composition for preventing and/or treating cardiotoxicity induced by at least one chemotherapeutic agent in a subject suffering from cancer and undergoing chemotherapy, wherein the composition contains an active agent, wherein said active agent contains the amino acids leucine, isoleucine, valine , threonine, lysine, and citric acid, succinic acid, malic acid.

Chemotherapeutic agents, also called antitumor agents, are used to directly or indirectly inhibit the proliferation of rapidly growing cells, producing an antitumor effect. The composition disclosed herein is effective for preventing and/or treating cardiotoxicity induced by anthracyclines, HER2/ErbB2 inhibitors, tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, immune checkpoint inhibitors. Anthracyclines may be selected from the group consisting of doxorubicin, epirubicin, daunorubicin, idarubicin, pixantrone, sabarubicin, valrubicin.

The present description further proposes the use of combination preparations containing a composition, wherein the composition contains an active agent containing the amino acids leucine, isoleucine, valine, threonine, lysine, and citric acid, succinic acid, malic acid; and at least one chemotherapeutic agent for preventing and/or treating cardiotoxicity induced by the at least one chemotherapeutic agent in a subject suffering from cancer, wherein the use of the composition and the at least one chemotherapeutic agent is simultaneous, separate, sequential.

Chronic (3 months) dietary supplementation with a mixture enriched with branched-chain amino acids (BCAAem) was shown to promote mitochondrial biogenesis in cardiac and skeletal muscle of middle-aged mice. A composition containing the branched chain amino acids leucine, isoleucine, valine, in combination with threonine, lysine and citric acid, succinic acid, malic acid, has also been shown to be effective in improving mitochondrial function, as described in WO 2019/021135 A1 . However, it has also been shown that increased efforts to prevent and treat cardiotoxicity specifically induced by chemotherapeutic agents, including the administration of potentially effective drugs, have been proposed to no avail [1].

The inventors of the present invention have unexpectedly discovered that the composition disclosed herein can be advantageously used for the treatment of cardiotoxicity induced by chemotherapeutic agents in subjects undergoing chemotherapy. In particular, tests

- 4 045710 conducted in vitro and in vivo show that i) cardiocytes treated with doxorubicin as a chemotherapeutic agent are not resistant to treatment with the composition disclosed herein while restoring mitochondrial functionality and ii) that the composition is able to counteract the cardiotoxicity induced chemotherapeutic agent.

In addition, as shown in the following sections, the composition can also be safely administered to a specific group of subjects, i.e. subjects undergoing chemotherapy, thus suffering from tumor pathologies. An unexpected aspect of these data arises from the consideration that, as disclosed in the previous section, cancer cells have metabolic profiles that differ from those of cells from healthy subjects, and conflicting data focus on the role of mitochondrial activity in cancer cell proliferation. For example, deletion of the mitochondrial DNA of cancer cells has been shown to reduce their growth and tumorigenicity; Based on these observations, restoration of mitochondrial function may, on the contrary, lead to an increase in the proliferation of tumor cells, as well as determine a decrease in the antitumor effect exerted by chemotherapeutic agents.

In contrast, the composition disclosed herein: i) is effective in restoring mitochondrial function in doxorubicin-treated cardiocytes, ii) does not promote tumor cell proliferation, iii) does not alter the antitumor effects exerted by doxorubicin, iv) is very surprisingly capable of enhancing the antiproliferative effect of doxorubicin.

As disclosed below, a composition containing essential amino acids and tricarboxylic acid cycle intermediates, called composition α5, was tested and its effect was examined in HL-1 cardiomyocytes and DOX-treated mice. Compared to a composition containing branched chain essential amino acids, called a BCAAem composition, without the tricarboxylic acid, the addition of the α5 composition was significantly more effective in promoting protective effects on DOX-induced mitochondrial dysfunction. The results were prolonged in vivo in young mice exposed to short-term and intensive DOX treatment. The results showed the following data: i) the occurrence of mitochondrial dysfunction after short-term and intensive administration of DOX, ii) a pronounced protective ability of short-term supplementation with composition α5. Thus, the composition can be used to prevent and/or treat cardiotoxicity induced by a chemotherapeutic agent, thereby also preventing cardiomyopathy and/or heart failure that may result from such induced cardiotoxicity.

The composition described herein contains an active agent, said active agent contains citric acid, succinic acid and malic acid in combination with leucine, isoleucine, valine, threonine, lysine, and the weight ratio between the total amount of citric acid, succinic acid and malic acid and the total amount of amino acids - leucine, isoleucine, valine, threonine, lysine, can be from 0.05 to 0.3, preferably from 0.1 to 0.25.

In one or more embodiments, the composition may consist of leucine, isoleucine, valine, threonine, lysine, citric acid, succinic acid and malic acid, and optionally vitamin B1 and/or vitamin B6.

In one or more embodiments of the invention, the active agent may further comprise one or more amino acids selected from the group consisting of histidine, phenylalanine, methionine, tryptophan, cysteine and tyrosine.

In one or more embodiments, the composition may contain an active agent consisting of leucine, isoleucine, valine, threonine, lysine, histidine, phenylalanine, methionine, tryptophan, cysteine and optionally tyrosine, as well as citric acid, succinic acid and malic acid, said amino acids are the only amino acids contained in the composition.

In one or more embodiments, the composition may not contain any other active agents, such as any chemotherapeutic agent, that is, any agent that directly or indirectly inhibits the proliferation of rapidly growing cells, providing an antitumor effect.

In one or more embodiments of the invention, the composition may consist of leucine, isoleucine, valine, threonine, lysine, histidine, phenylalanine, methionine, tryptophan, cysteine, tyrosine, citric acid, succinic acid and malic acid, and optionally vitamin B1 and/or vitamin B6 .

The composition may contain the amino acids isoleucine, leucine and valine, in an amount of from 35 to 65% by weight, preferably from 42 to 56% by weight, relative to the weight of the active agent.

The weight ratio between leucine and citric acid is from 5 to 1, preferably from 2.50 to 3.50.

In one or more embodiments, the mass or molar amount of citric acid is greater than the mass or molar amount of each of malic acid and succinic acid. Preferably the mass or molar amount of citric acid is higher than the total mass or molar

- 5 045710 new amount of malic and succinic acid. In a further embodiment, the weight ratio between citric acid and the sum of malic and succinic acid is from 1.0 to 4.0, preferably from 1.5 to 2.5. In a preferred embodiment, the weight ratio of citric acid: malic acid: succinic acid is from 10:1:1 to 2:1.5:1.5, preferably from 7:1:1 to 1.5:1:1, more preferably from 5:1:1 to 3:1:1. In a preferred embodiment, the weight ratio of citric acid:malic acid:succinic acid is 4:1:1.

The preferred isoleucine:leucine molar ratio is in the range of 0.2-0.7, preferably in the range of 0.30-0.60 and/or the preferred valine:leucine weight ratio is in the range of 0.2-0.70, preferably in the range 0.30-0.65.

The threonine:leucine molar ratio may be in the range of 0.10-0.90, preferably in the range of 0.20-0.70, and/or the lysine:leucine mass ratio is in the range of 0.20-1.00, preferably in the range 0.40-0.90.

In a preferred embodiment, the ratio between the total molar amount of citric acid, malic acid, succinic acid and the total molar amount of methionine, phenylalanine, histidine and tryptophan is greater than 1.35.

In one or more embodiments, the weight ratio between the sum of citric acid, malic acid, succinic acid and the sum of branched chain amino acids leucine, isoleucine, valine is from 0.1 to 0.4, preferably from 0.15 to 0.35 .

In a further embodiment, the total weight amount of the branched chain amino acids leucine, isoleucine, valine, threonine and lysine is higher than the total weight amount of the three acids: citric acid, malic acid, succinic acid. Preferably, the weight amount of the individual acids (citric acid, succinic acid or malic acid) is less than the weight amount of each of the individual amino acids (leucine, isoleucine, valine, threonine and lysine).

In a further embodiment, the total molar amount of lysine and threonine is higher than the total molar amount of the three acids: citric acid, succinic acid, malic acid. Preferably, the ratio between the total molar amount of the three acids: citric acid, succinic acid, malic acid and the total molar amount of lysine and threonine is from 0.1 to 0.7, preferably from 0.15 to 0.55.

In one or more embodiments, the composition disclosed herein further comprises vitamins, preferably selected from the group of B vitamins, such as vitamin B1 and/or vitamin B6. In addition, the composition may further contain carbohydrates and/or flavorings.

In one or more embodiments, the composition may be a pharmaceutical composition further comprising a pharmaceutically acceptable carrier. The composition may also contain pharmaceutically acceptable excipients, such as, for example, proteins, vitamins, carbohydrates, natural and artificial sweeteners and/or flavoring agents. In a preferred embodiment, pharmaceutically acceptable excipients may be selected from whey proteins, maltodextrins, fructose, calcium caseinate, fish oil, citric acid or salts thereof, sucralose, sucrose esters, vitamin D3, B vitamins.

In one or more embodiments, the active agent of the composition may further comprise at least one chemotherapeutic agent. The chemotherapeutic agent may be selected from the group consisting of anthracyclines, HER2/ErbB2 inhibitors, tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, immune checkpoint inhibitors. Anthracyclines may be selected from the group consisting of doxorubicin, epirubicin, daunorubicin, idarubicin, pixantrone, sabarubicin, valrubicin.

In addition, in particular, when preparing the compositions according to the present invention and, in particular, the active agent, the amino acid arginine should be avoided. In addition, additional amino acids specifically excluded from the composition described herein are serine, proline, alanine. Such amino acids may be counterproductive or even harmful at certain concentrations or stoichiometric ratios in the composition.

The amino acids disclosed herein may be replaced by corresponding pharmaceutically acceptable derivatives, namely salts.

In one or more embodiments, the compositions described herein can be used to prevent and/or treat cardiomyopathy and/or heart failure induced by chemotherapy agents in a subject undergoing chemotherapy.

For oral administration, the compositions as described may be in the form of tablets, capsules, granules, gel, gelling powder, powder.

Additional descriptions regarding the amounts and ratios between the various amino acids provided in the compositions are contained in the accompanying claims, which form an integral part of the technical concept presented herein with respect to the invention.

- 6 045710

Examples

In table 1 shows two different amino acid formulations tested in HL-1 cells as described below. The two compositions are a BCAAem composition, as also disclosed in EP 2196203 B1, and a composition α5 containing an active agent containing amino acids and citric acid, succinic acid and malic acid.

Table 1

Composition (wt.%) BCAAem α5 L-leucine 30.01 31.0885 L-lysine hydrochloride 19.58 16.9030 L-isoleucine 15.00 10.3628 L-valine 15.00 10.3628 L-threonine 8.40 7.2540 L-cysteine 3.60 3.1089 L-histidine 3.60 3.1089 L-phenylalanine 2.40 2.0726 L-methionine 1.20 1.0363 L-tyrosine 0.72 0.6218 L-tryptophan 0.48 2.0726 Lemon acid - 8,001 succinic acid - 2.00 Apple acid - 2.00 Vitamin B1 (thiamine hydrochloride) - 0.004 Vitamin W6 (pyridoxine - 0.0038 hydrochloride)

The compositions given in table. 1 above can be obtained by first sifting all components using a 0.8 sieve. To prepare the premix, each ingredient (in an amount less than 10% by weight based on the total amount) was placed in a plastic bag along with a portion of L-lysine hydrochloride to provide about 10% by weight based on the total composition. The bag was then shaken by hand for 5 min. The premix was then added to a mixer (Planetaria) along with the remaining ingredients and mixed for 15 minutes at 120 rpm to obtain a homogeneous final composition.

Ways.

Cell culture and processing.

The rules of the Declaration of Helsinki were followed. HL-1 cardiomyocytes were obtained from W.C. Claycomb (Millipore cat. no. SCC065) and seeded into fibronectin/gelatin-coated flasks, grown to 70-80% confluency in Claycomb medium (Sigma-Aldrich) supplemented with 100 μM norepinephrine (from 10 mM norepinephrine stock solution [Sigma-Aldrich] , dissolved in 30 mM L-ascorbic acid [Sigma-Aldrich]), 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin and 10% fetal bovine serum (FBS, Sigma-Aldrich) [2,3 ]. The human breast cancer cell line MCF-7 (ATCC®HTB-22™), also available from P. Limonta (Pharmacological and Biomolecular Sciences, University of Milan, Milan, Italy), was cultured at pH 7.4 DMEM (Modified Eagle's Medium according to Dulbecco's method) containing streptomycin (100 U/ml), penicillin (200 mg/ml) and gentamicin (50 mg/ml), and 10% FBS was added. Both cell types were treated with 1% BCAAem or α5 for 48 h and 1 μM DOX for 16 h (Fig. 1). Detailed percentages of the composition of the mixtures are given in table. 1.

For phospho-protein assays, HL-1 cells were treated with 1% α5 for 2 h and 1 μM DOX (Doxo-HCl (doxorubicin hydrochloride) from Sigma-Aldrich D15D15) for the last 60 min. For Klf15, eNOS, and Raptor knockdown experiments, HL-1 cells were transfected with 50–100 nM Klf15, eNOS, and Raptor SMARTpool siRNA (Dharmacon; Lafayette, CO) or nontargeting siGENOME siRNA using Dharmafect 1 transfection reagent. After 24 h of transfection, cells were treated with 1% α5 for 24 h and 1 μM DOX for 16 h. Transfection efficiency was determined using non-targeting siRNA containing no siGLO-RISC and siRNA capture by a fluorescent detector (absorbance/emission 557/570). Proteins were then extracted for Western blotting.

Animals and treatment.

The experimental protocol used was approved by the Institutional Ethical Committee of the University of Milan (No. 16/09) and complied with the National Guidelines for the Protection of Life

- 7 045710 vot. Forty male C57BL6/J mice (9 weeks old) were housed separately in clean polypropylene cages and divided into four groups (Fig. 2): 1) control group (CTRL, n=10 mice) fed a standard diet (4.3% kcal fat, 18.8% kcal protein, 76.9% kcal carbohydrate; Laboratorio Dottori Piccioni) and received one intraperitoneal injection of saline (vehicle); 2) α5 group (n=10 mice) fed standard diet and α5 supplement (1.5 mg/g body weight/day in drinking water) and received one intraperitoneal injection of saline (vehicle). Composition α5 was dissolved in drinking water, after calculating the average daily volume of drinking 2 weeks before the start of treatment and storing at 4°C before daily administration; 3) DOX group (n=10 mice) treated with a standard diet and intraperitoneal injection of DOX (Doxo-HCl from Sigma-Aldrich) at a dose of 20 mg/kg, a dose that has been shown to be cardiotoxic [4-6]; and 4) DOX plus α5 group (n=10 mice) fed standard diet and intraperitoneal injection of 20 mg/kg DOX supplemented with α5 (1.5 mg/g body weight/day in drinking water). α5 was added for 10 days, on a 12-h light/12-h dark cycle at 22°C in a quiet, temperature- and humidity-controlled environment; a single dose of DOX was administered on the third day until the end of α5 treatment (Fig. 2). Drinking volume, food intake and body weight were checked twice a week. At the end of the treatment period, mice were killed by cervical dislocation, and the hearts were quickly removed and used immediately (for oxygen consumption analysis) or frozen in liquid nitrogen and stored at -80°C (for mtDNA, mRNA and protein level measurements, in addition to the analysis citrate synthase activity).

Quantitative RT-PCR analysis.

Quantitative RT-PCR was performed as previously described [3–7] using iQ SybrGreenI SuperMix (Bio-Rad; Segrate, Italy) on an iCycler iQ real-time PCR detection system (Bio-Rad). Briefly, RNA was isolated from the left ventricle using the RNeasy Tissue Mini Kit (Qiagen) or from HL-1 cells using the RNeasy Mini Kit (Qiagen). cDNA (complementary DNA) was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories). Primers were designed using Beacon Designer 2.6 software from Premier Biosoft International and are shown in Table. 2.

table 2

Gene SEQ ID. Product ct PCR (p.o. (par base NII)) Ta (°C) Cat CACTGACGAGATGGCACA CTTTG TGGAGAACCGAACGGCAA TAGG Sense primer (5'-3') Antisense primer (5'-3') No. 1 No. 2 173 60 COX IV TGGGACTATGACAAGAAT GAGTGG TTAGCATGGACCATTGGAT ACGG Sense primer (5'-3') Antisense primer (5'-3') No. 3 No. 4 FROM 60 cyt with ATAGGGGCATGTCACCTC AAAS GTGGTTAGCCATGACCTGA AAG Sense primer (5'-3') Antisense primer (5'-3') No. 5 No. 6 172 60 eNOS AGCGGCTGGTACATGAGT TS Sense primer (5'-3') No. 7 No. 8 116 60

- 8 045710

GATGAGGTTGTCCTGGTGT SS Antisense primer (5'-3') GPX1 TCTGGGACCTCGTGGACTG CACTTCGCACTTCTCAAAC AATG Sense primer (5'-3') Antisense primer (5'-3') No. 9 No. 10 156 60 KLF1 5 ACACCAAGAGCAGCCACC TS TGAGATCGCCGGTGCCTTG A Sense primer (5'-3') Antisense primer (5'-3') No. I No. 12 130 60 mtDN TO SSASTTSATSTTASSATTT A ATCTGCATCTGAGTTTAAT WITH Sense primer (5'-3') Antisense primer (5'-3') No. 13 No. 14 106 54 NRF1 ACAGATAGTCCTGTCTGGG GAAA TGGTACATGCTCACAGGG ATST Sense primer (5'-3') Antisense primer (5'-3') No. 15 No. 16 99 60 PGC- 1α ACTATGAATCAAGCCACT ACAGAC TTCATCCCTCTTGAGCCTT TCG Sense primer (5'-3') Antisense primer (5'-3') No. 17 No. 18 148 60 SESN 2 (sister in 2) GCCCCTGAGAAGCTCCGC AA GAGTTCGGGCCAGGGACCA G.C. Sense primer (5'-3') Antisense primer (5'-3') No. 19 No. 20 129 60 SOD1 GGCTTCTCGTCTTGCTCTC AACTGGTTCACCGCTTGC Sense primer (5'-3') Antisense primer (5'-3') No. 21 No. 22 153 60 SOD2 GCCTCCCAGACCTGCCTTA WITH GTGGTACTTCTCCTCGTG GCG Sense primer (5'-3') Antisense primer (5'-3') No. 23 No. 24 131 60 TBP (TAT Associating Protein) ACCCTTCACCAATGACTCC TATG TGACTGCAGCAAATCGCTT GG Sense primer (5'-3') Antisense primer (5'-3') No. 25 No. 26 186 60 Tfam AAGACCCTCGTTCAGCATAT AASATT TTTTTCCAAGCCTCATTTAC AAGC Sense primer (5'-3') Antisense primer (5'-3') No. 27 No. 28 104 60 18S CTGCCCTATCAACTTTCGA TGGTAG CCGTTTCTCAGGCTCCCTC TS Sense primer (5'-3') Antisense primer (5'-3') No. 29 No. 30 100 60

Ta annealing temperature (°C); Cat, catalase; COX IV, cytochrome c oxidase subunit IV; cyt c, cytochrome c; eNOS, endothelial nitric oxide synthase; GPX1, glutathione peroxidase 1; KLF15, Kruppel-like factor 15; mtDNA, mitochondrial DNA; NRF1, nuclear respiratory factor 1; PGC-1a, peroxisome proliferator-activated receptor-α coactivator 1α; SESN2, sister 2;

- 9 045710

SOD1, superoxide dismutase 1; SOD2, superoxide dismutase 2; TBP, TATA-binding protein; Tfam, mitochondrial transcription factor A; 18S, 18S ribosomal RNA.

Account number: NM_009804.2; account number: COX IV: NM_009941; account number: Cyt c: NM_007808; account number: eNOS: NM_008713.4; account number: GPX1: NM_008160.6; account number: KFL15: NM_023184.4; mitochondria of Mus musculus (house mouse), complete genome: NC_005089.1; account number: NRF1: AF098077; PGC-1a: AF049330; account number: SESN2: NM_144907.1; account number: SOD1: NM_011434; account number: SOD2: NM_013671; account number: TBP: NM_013684.3; account number: Tfam: NM_009360.4; account number: X03205.

The cycle number at which different transcripts were detectable (threshold cycle, CT) was compared with a TBP called ACT. Relative gene expression level was expressed as 2-(AACT), in which AACT equals the ACT of DOX-, α5-, or DOX plus α5-treated mice (or treated HL-1 cells) minus the ACT of control mice (or untreated HL-1 cells).

Western blotting.

Protein extracts were prepared from left ventricle with T-PER Mammalian Protein Extraction Reagent (Pierce, ThermoScientific, Rockford, USA) or from HL-1 cells in M-PER Mammalian Protein Extraction Reagent (Pierce, ThermoScientific, Rockford, USA) as as indicated by the manufacturer, in the presence of 1 mM NaVO ₄ , 10 mM NaF and protease inhibitor mixture (Sigma-Aldrich, Milan, Italy). Protein content was determined using the bicinchoninic acid protein assay (BCA, Pierce, Euroclone, Milan, Italy), and 50 μg of protein extract was separated by SDS-PAGE (protein polyacrylamide gel electrophoresis) under reducing conditions. The separated proteins were then electrophoretically transferred to a nitrocellulose membrane (Bio-Rad Laboratories, Segrate, Italy) [38]. Proteins of interest were detected with specific antibodies: anti-COX IV (Cell Signaling Technology cat. no. 4844, Euroclone, Milan, Italy), anti-cyt c (Cell Signaling Technology cat. no. 4280), anti-PGC-1α (Cell Signaling Technology cat. no. 2178), anti-phospho-AKT (Ser473) (Cell Signaling Technology cat. no. 4060), anti-AKT (Cell Signaling Technology cat. no. 4685), anti-phospho-eNOS (Ser1177) (Cell Signaling Technology cat. no. 9571), anti-eNOS (Cell Signaling Technology cat. no. 9572), anti-phospho-S6 (Ser235/236) (phospho-S6, Cell Signaling Technology cat. no. 4858), anti-S6 (Cell Signaling Technology cat. no. 2217), anti-phospho-mTOR (Ser2481) (Cell Signaling Technology cat. no. 2974), anti-mTOR (Cell Signaling Technology cat. no. 2972), anti-phospho-BDKDH (Ser293) (Abcam cat. no. 200577 ), anti-BDKDH (Abcam cat. no. 138460), and anti-GAPDH (1:1000, Cell Signaling Technology cat. no. 2118) at 1:1000 dilution each. After visualizing phospho-eNOS, phospho-AKT, phospho-mTOR, phospho-S6 and anti-phospho-BCKDH, filters were stripped using Restore™ Western Blot Stripping Buffer (Euroclone, Milan, Italy) and further used to visualize total eNOS , total AKT, total mTOR, total S6, or total BCKDH. Immunostaining was performed using horseradish peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin for 1 h at room temperature. Protein was detected using SuperSignal substrate (Pierce, Euroclone, Milan, Italy) and quantified by densitometry using ImageJ image analysis software.

Mitochondrial DNA.

For mtDNA analysis, total DNA was extracted using the QIAamp DNA Extraction Kit (Qiagen). mtDNA was amplified using mtDNA-specific primers and normalized to the 18S gene (Table 2) [9]. mtDNA content was determined using qRT-PCR (quantitative RT-PCR) by measuring the threshold cycle ratio (ACT) of the mtDNA gene compared to the nuclear encoded gene (18S) in the left ventricle of mice treated with DOX-, α5-, or DOX plus α5, in addition to untreated control mice [10,11].

Citrate synthase activity.

Activity was measured spectrophotometrically at 412 nm at 30°C in left ventricular extracts [12,13]. The tissue was added to a buffer containing 0.1 mM 5,5-dithio-bis(2-nitrobenzoic) acid, 0.5 mM oxaloacetate, 50 μM EDTA (ethylenediaminetetraacetic acid), 0.31 mM acetyl-CoA (acetyl coenzyme A), 5 mM triethanolamine hydrochloride and 0.1 M Tris-HCl (pH 8.1). Citrate synthase activity was expressed as nmol of citrate produced per minute per mg of protein. Data were normalized to total protein content, which was determined using the bicinchoninic acid assay as above.

Oxygen consumption.

Oxygen consumption was measured as described [14,15]. Mitochondria were isolated from the left ventricle of control and treated mice. Samples were analyzed at 37°C in a gas-tight vessel equipped with a Clark type oxygen electrode (Rank Brothers Ltd.) connected to a data logger. The oxygen electrode was calibrated assuming that the oxygen concentration in the incubation medium was 200 μmol/L at 37°C.

Oxidative stress of mitochondria.

To study mitochondrial oxidative stress, mitochondria were isolated using

- 10 045710 using the Qproteome mitochondrial isolation kit (Qiagen). Mitochondrial H2O2 release was measured in the presence of horseradish peroxidase (HRP) using the Amplex Red Hydrogen Peroxide/Peroxidase Assay kit (Molecular Probes). Fluorometric measurements were performed using a Fusion Universal Microplate Analyzer (Packard/PerkinElmer) with an excitation filter at 550 nm and an emission filter at 590 nm. H2O2 production calculated from the standard curve was expressed in nmol/min/mg protein as described [9]. In addition, mitochondrial aconitase and SOD activity were measured as previously described [16]. Briefly, NADPH (nicotinamide adenine dinucleotide phosphate) production was monitored spectrophotometrically (340 nm) at 25°C (for aconitase activity), while SOD activity was measured using a superoxide dismutase assay kit (Calbiochem). One unit of SOD activity was defined as the amount of enzyme required to exhibit 50% dismutation of the superoxide radical. Finally, oxidative DNA damage was measured as an additional marker of oxidative stress. A highly sensitive 8-hydroxy-2'deoxyguanosine (8-OHdG) Check ELISA kit (JaICA, Hamamatsu, Japan) was used [17]. Measurements were carried out in accordance with the manufacturer's protocol. Total DNA was extracted using the QIampDNAMini Kit (Qiagen) and digested with P1 nuclease and alkaline phosphatase (Sigma). DNA quality and quantity were confirmed by NanoDrop ND-1000 spectrophotometric analysis. The absorbance of the ELISA reaction product was determined spectrophotometrically using 450 nm as the primary wavelength.

Viability analysis.

HL-1 cell viability was assessed using MTT [3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide] reagent (Sigma, Milan, Italy). HL-1 was seeded in 96-well culture plates at a density of 20,000 cells/well (100 μl). Violet formazan crystals were dissolved in 5% SDS/0.1 M HCl (100 μL/well) and absorbance was recorded on a microplate reader (ELx800, BioTek Instruments, VT, USA) at a wavelength of 570 nm. Each test was repeated at least four times in quadruplicate.

Acid phosphatase assay.

To quantify MCF7 cell growth, an acid phosphatase assay was used as described [30]. Briefly, MCF7 cells were plated in 96-well plates at a density of 5,000 to 20,000 cells per well and treated with 1% α5 (for 48 h) and 1 μM DOX (for 16 h). The culture medium was removed and each well was washed once with phosphate-buffered saline (PBS, pH 7.2) and 100 μl of buffer containing 0.1 M sodium acetate (pH 5.0), 0.1% Titon X-100 and 5 mM pnitrophenylphosphatase (pNPP). The plates were then placed in an incubator at 37°C for 2 hours. The reaction was stopped by adding 10 μl of 1 N NaOH and color development was assessed at 405 nm. Non-enzymatic hydrolysis of pNPP was measured in cell-free wells.

Statistical analysis and presentation of data.

Statistical analysis was performed using one-way analysis of variance followed by Student-Newman-Keuls test or Student's t test. Data are presented as means ± standard deviations (SD) unless otherwise stated. A statistically significant difference was accepted at p<0.05.

Results.

A specific amino acid formulation prevents mitochondrial dysfunction in HL-1 cardiomyocytes exposed to short-term and acute DOX exposure.

To protect cardiomyocytes from DOX toxicity, impaired mitochondrial function and oxidative stress were corrected in chemotherapeutic-exposed HL-1 cells. The optimal combination of relevant metabolic precursor substances capable of maximizing oxidative metabolism in HL-1 cardiomyocytes was assessed. In particular, the effect of two amino acid-based compositions (Table 1) on the differentiation of HL-1 cells was tested. For this screen, differentiating cardiomyocytes were treated for 48 hours with 1) a composition containing branched chain amino acids (i.e., BCAAem) or 2) a composition of the present invention α5, which also contains tricarboxylic acids, with or without DOX (Fig. 1 ). While α5 (1% w/v) increased mRNA levels of markers of mitochondrial biogenesis in HL-1 cells, including PGC-1a, NRF1, Tfam, cyt c and COX IV compared to baseline values, only PGC- 1a was increased by BCAAem (Fig. 3A). Conversely, the expression of these genes was reduced when cardiomyocytes were exposed to 1 μM DOX for 16 h ( Fig. 3A ). Notably, addition of α5 prevented this DOX toxicity with complete restoration of gene expression (Figure 3A). With the exception of cyt c and COX IV, BCAAem failed to reverse the effect of DOX with statistical significance (Fig. 3A). Therefore, composition a5 was used further. It is noteworthy that in FIG. Figure 4 shows that the TCA intermediates citric acid, succinic acid, and malic acid, supplemented individually or collectively at equal concentrations in a5, failed to prevent DOX-induced reduction in mitochondrial biogenesis, nor alter mitochondrial gene expression when added individually. Protective

- 11 045710 the ability of α5 supplementation on mitochondrial health was also evident at the protein level (eg, COX IV and, with a trend, cyt c) (Fig. 3B). Moreover, the decrease in citrate synthase activity stimulated by DOX exposure, which is an index of reduced mitochondrial mass and function, was completely reversed by the addition of α5, which increased enzyme activity also when added alone to HL-1 cells (Figure 3C). These healthy effects of α5 on DOX-induced mitochondrial damage were further confirmed by the reduction in oxidative stress. Compared with untreated cells, H2O2 release (an index of mitochondrial superoxide anion production) was markedly increased by DOX treatment; addition of α5 prevented this effect (Fig. 5A). α5 reduced H2O2 release also when added alone. Accordingly, measurements of mitochondrial ROS production (assessed by the ratio of basal/total aconitase activity) and superoxide scavenging capacity via SOD activity demonstrated that α5 supplementation prevented DOX-induced oxidative stress, with beneficial effects also when added alone (Figure 5B and C). . Because oxidative stress triggers the anti-ROS defense system, the expression of anti-ROS enzymes was examined. Specifically, glutathione peroxidase 1 (GPX1) and superoxide dismutase 1 (SOD1) gene expression was increased in DOX-treated cells compared to untreated HL-1 cells (Figure 5D), consistent with increased ROS production.

This was confirmed by higher amounts of 8-hydroxy-2′-deoxyguanosine (8-OHdG), a marker of oxidative DNA damage, in cells exposed to DOX ( Figure 5E ). Supplementation of α5 in DOX-treated cells was able to antagonize ROS production, as evidenced by decreased SOD1 and GPX1 gene expression (Figure 5D) and restoration of 8-OHdG production to the amount observed in untreated cells (Figure 5E). In fig. 5D also shows that α5 is more effective than BCAAem in protecting against ROS. Together, these results support the notion that α5 mixture can prevent mitochondrial damage caused by short-term and acute DOX exposure in HL-1 cardiomyocytes. Notably, this can have a significant impact on cell survival. DOX-induced HL-1 cell death was actually prevented by the α5 mixture when co-added (Fig. 6). No effect was observed on cell survival when HL-1 cells were exposed to α5 alone (Fig. 6).

α5 formulation prevents mitochondrial dysfunction in the hearts of DOX-treated mice.

To confirm the in vitro results, short-term and intensive in vivo DOX treatment was performed as described [6]. On the third day before the end of α5 treatment, which was carried out for 10 days, a single intraperitoneal injection of 20 mg/kg DOX was performed (Fig. 2). In table Figure 3 shows that DOX treatment significantly reduced body weight and heart weight compared with the control group, and this may be due to its significant anorexigenic effect. α5 failed to alter body weight, heart weight, and food intake either when supplemented with DOX alone or when supplemented with DOX (Table 3). In contrast, although water intake in DOX-treated mice remained unchanged compared with control animals, α5 increased water intake either when added alone or when added with DOX.

Table 3

CTRL "5 DOX DOX + os5 Body weight (g) 24.84±1.3 24.46±2 20.75±0.82* 20.46±1.04* Weight hearts (g) 0.12±0.01 0.11 ±0.02 0.085±0.02* 0.09±0.02* Food consumption (g) 5.2±0.41 5.34±0.7 3.73±0.6* 3.59±0.47* Water consumption (g) 6.1±0.7 8.24±0.88* 6.13±1.0 7.07±1.3

Measurements were performed on 10 mice per group. Values represent mean ±D.S. *p<0.05 compared with control animals (i.e., mice injected with saline).

The mRNA levels of mitochondrial biogenesis genes were reduced in the left ventricle of DOX-treated mice compared with controls (Fig. 7A). In addition to increasing the mRNA levels of PGC-1a, cyt c, and COX IV when added alone, the α5 mixture was able to significantly prevent the DOX-induced decrease in PGC-1a, Tfam, and cyt c (Fig. 7A). Mitochondrial mass and function, measured as the amount of mitochondrial DNA (mtDNA), respiratory proteins (particularly COX IV), and active

- 12 045710 citrate synthase activity was lower in DOX-treated mice than in saline-treated mice, and these decreases were prevented when mice were supplemented with α5 (Figure 7, B-D). In addition, mitochondrial respiratory function was examined by measuring oxygen consumption rate (OCR) using a Clark electrode in mitochondria isolated from the left ventricle of different treatment groups. In fig. Figure 7E shows that DOX injection reduced OCR, while α5 addition completely preserved mitochondrial respiration in DOX-treated mice. The amino acid mixture increased OCR also when added alone (Fig. 7E). Finally, the results presented in Fig. 7F confirmed in ex vivo samples that DOX increased the expression of anti-ROS defense enzymes, including SOD1, SOD2, catalase and GPX1, while α5 supplementation almost completely blocked this effect. No changes were observed in mice treated with α5 alone (Fig. 7F). Taken together, these results suggest that α5 supplementation prevents DOX-induced mitochondrial toxicity in the heart, at least in part, by promoting mitochondrial biogenesis and function and by reducing oxidative stress.

Various signaling pathways are involved in the protective effects of α5 supplementation.

Signaling pathways in the left ventricle of mice treated with DOX and α5 were analyzed. In fig. 8A and B show that DOX injection reduces eNOS expression but only partially eNOS activity [i.e. ratio (Ser1177) of phospho-eNOS to total eNOS]. Remarkably, addition of α5 completely abolished these effects. When added alone, the α5 formulation was able to increase eNOS expression (Figure 8A). Given that eNOS-dependent nitric oxide (NO) production is in turn known to regulate the mTOR complex 1 (mTORC1) signaling pathway, and that mTORC1 activity is necessary and sufficient for (Ser1177)-eNOS phosphorylation in various cell types, we measured S6 phosphorylation in as a marker of downstream mTORC1 activation. DOX treatment decreased (Ser235/236) the ratio of phospho-S6 to total S6 in the left ventricle compared with saline injection, while α5 supplementation at least partially prevented this effect (Fig. 8C). No significant changes were observed in the α5 mixture when added alone. Various physiological stimuli modulate mTORC1 signaling through site-specific phosphorylation of mTOR. The data disclosed herein demonstrate a functional role for mTOR Ser2481 phosphorylation in DOX and the action of α5, in which DOX reduced and α5 restored this reduction in selective mTOR phosphorylation in the heart (Fig. 8D). Phosphorylation of mTOR was also increased when α5 was added alone. Together, the results suggested that both eNOS and mTORC1 may play a role in the effects of DOX and α5 treatment.

Underscoring this hypothesis, sestrin 2 has recently been proposed as a leucine sensor for the mTORC1 pathway, since high levels of sestrin 2 inhibit mTORC1 activity when intracellular leucine concentrations are low. Conversely, low levels of Sestrin 2 or high intracellular leucine concentrations displacing Sestrin 2 from the mTORC1 inhibitor GATOR2 promote mTORC1 activation. Given that the α5 formulation contains a large amount of leucine, the expression of Sestrin 2 was measured. DOX treatment markedly increased Sestrin 2 mRNA in the left ventricle (Fig. 8E). Notably, α5 completely prevented this DOX-induced effect, although it failed to alter the expression of Sestrin 2 when added alone (Fig. 8E).

Likewise, KrUppel-like factor 15 (KLF15) has recently emerged as a critical transcriptional regulator of amino acid metabolism, particularly BCAA catabolism (i.e., the oxidation of BCAA to form acetyl-CoA and succinyl-CoA, two TCA intermediates), especially in the heart, and also as an inducer of eNOS expression in endothelial cells. Therefore, KLF15 expression was analyzed in the left ventricle of different treatment groups. Klf15 mRNA levels were significantly reduced by DOX treatment, and this reduction was completely prevented by the addition of α5 ( Fig. 8F ). No significant changes were observed when α5 was added alone (Fig. 8F). Given that the expression or activity of mitochondrial BCAA catabolic enzymes, such as branched-chain α-keto acid dehydrogenase (BCKDH), in cardiac tissue is reduced in Klf15 null mice with heart failure, BCKDH protein transcript was examined in addition to BCKDH phosphorylation in DOX-treated animals. When phosphorylated, BCKDH is actually inactive, while when dephosphorylated, it is, on the contrary, active. Notably, phosphorylation of (Ser293)-BCKDH was unchanged in DOX-fed mice compared to saline-fed mice, while α5 supplementation markedly reduced it in the presence of DOX, with a trending inhibitory effect also when added alone (Fig. 8G). Together, these results suggested that in vivo protection of mitochondrial homeostasis in cardiac tissue by α5 supplementation may be linked to the KLF15/eNOS/mTORC1 signaling axis, which entails BCAA catabolism.

The effects of KLF15, eNOS, and mTORC1 on mitochondrial homeostasis in HL1 cells exposed to DOX and α5 were also assessed. First, although eNOS gene expression was only slightly reduced by exposure to 1 μM DOX, phosphorylation of (Ser1177)-eNOS was markedly reduced

- 13 045710 (Fig. 9, A and B). α5 (1% w/v) completely abolished both DOX inhibitory effects, significantly increasing eNOS expression also when added alone (Fig. 9, A and B). Second, phosphorylation of (Ser235/236)-S6 was markedly reduced by DOX, and this reduction was completely abolished by α5 (Fig. 9C). Conversely, the amino acid mixture was ineffective when added alone. Consistent with its role as a regulator of mTORC1, Sestrin 2 expression was markedly increased by DOX, and this increase was completely reversed by the addition of α5 (Fig. 9D). The amino acid composition was ineffective when added alone. Third, based on the modulatory role of Akt, also known as protein kinase B (PKB), on both eNOS and mTORC1 activation, phosphorylation of (Ser 473)-Akt in HL-1 cells treated with DOX and α5 was also studied. DOX markedly reduced Akt phosphorylation, while α5 prevented this effect (Figure 5E). Since the Akt/PKB signaling pathway was recently found to mediate the effects of BCAA on KLF15 expression, the role of this transcriptional regulator in the protective effects of α5 supplementation on DOX-mediated mitochondrial damage was examined. Notably, KLF15 expression was reduced at both mRNA and protein levels when HL-1 cells were exposed to DOX, and α5 completely abolished this effect (Figure 9F). Only a small, non-statistically significant increase in KLF15 expression was observed in HL-1 cardiomyocytes exposed to α5 alone (Fig. 9F).

HL-1 cells were then transfected with either Klf15-specific siRNA or nontargeting siRNA. Silencing efficiency was measured at both mRNA and protein levels (Fig. 10). DOX exposure significantly reduced both PGC-1a protein and COX IV protein in cells transfected with Klf15 siRNA or left untreated (Fig. 9G). Conversely, Klf15 knockdown markedly reduced PGC1-a and COX IV levels per se and abolished the ability of α5 supplementation to preserve protein levels when administered with DOX ( Figure 9G ). Moreover, knockdown of Klf15 markedly reduced the ability of α5 to stimulate PGC1-a and COX IV expression when α5 was added alone (Fig. 9G). Of note, knockdown of Klf15 significantly impaired the ability of α5 to restore phosphorylation of DOX-reduced (Ser235/236)-S6 ( Figure 9H ). Finally, while (Ser293)-BCKDH phosphorylation did not differ between DOX-treated and untreated control HL-1 cardiomyocytes, p-BCKDH was completely abolished when cells were exposed to α5, with or without DOX (Figure 9H). Klf15 knockdown partially prevented the inhibitory effect of α5 on (Ser293)-BCKDH phosphorylation in both DOX-treated and untreated cells, while DOX failed to alter phosphorylation when added alone (Figure 9H). Likewise, silencing eNOS and Raptor - one of the scaffolding proteins of mTORC1 (mTOR regulator-associated protein) - with specific siRNAs reduced PGC1-a and COX IV levels themselves and abolished the ability of α5 supplementation to maintain reduced protein levels when administered with DOX (Fig. 11, A and B). Both eNOS knockdown and Raptor knockdown did not alter the expression of PGC1-a and COX IV when α5 was added alone (Fig. 11, A and B). The efficiency of specific silencing was assessed using RT-PCR and Western blotting; about 70% and 60% suppression of eNOS and mTORC1 were obtained by eNOS and Raptor siRNA, respectively (Fig. 10, B and C). Overall, these results suggest that the protective effects of α5 mixture on DOX-mediated mitochondrial dysfunction in cardiomyocytes may be related to the KLF15/eNOS/mTORC1 signaling axis and BCAA catabolism.

The antiproliferative effect of DOX remained unchanged in MCF7 breast cancer cells in the presence of α5 composition.

Exposure of the breast cancer cell line MCF7 to the α5 formulation did not promote MCF7 cell proliferation as assessed by two different assays (FIGS. 13A and 13B). Likewise, the antiproliferative effect of DOX in MCF7 cells was completely unaffected by the presence of amino acids (Figures 13A and 13B). It is noteworthy that the effect of DOX is enhanced when administered together with the α5 composition.

As described in the section above, although the anthracycline DOX (trade name Adriamycin) is a highly effective and commonly used anticancer drug since its introduction in the 1960s, it causes dose-dependent cardiotoxicity that can lead to severe heart failure. Once the heart has been damaged by DOX, there are few treatment options. Typically, DOX-induced cardiomyopathy and heart failure are resistant to traditional therapies [1]. Increasing efforts to predict which patients will be susceptible to cardiotoxicity via DOX, including analysis of patient-specific human induced pluripotent stem cell-derived cardiomyocytes, and appropriate prevention of this risk, including drugs such as iron chelating agents, angiotensin-converting enzyme inhibitors, β- blockers, antioxidants and natural products or dietary supplements have been suggested to no avail. The effectiveness of the α5 composition and the BCAAem composition in preventing DOX-induced mitochondrial damage in cultured HL-1 cardiomyocytes was tested. α5

- 14 045710 was statistically more effective than BCAAem in counteracting DOX-induced deficiency of mitochondrial biogenesis markers. Dietary supplementation of α5 activates the KLF15/Akt/eNOS/mTORC1 signaling axis (Figure 12). These results also do not exclude a role for mTORC2, a signaling pathway that appears to be required for normal cardiac development and for the maintenance of postnatal cardiac structure and function, particularly for adaptation to stressful conditions. However, mTORC2 has not yet been implicated in DOX cardiotoxicity. Moreover, the present data on KLF15 and Sestrin 2 also question the relevance of mTORC2 signaling in this experimental model. One of the most significant results shown in this application is the massive suppression of PGC-1a and COX-IV proteins, which are markers of mitochondrial biogenesis, induced by KLF15 silencing in HL-1 cardiomyocytes. The Kruppel-like factor (KLF) family of Cys2/His2 zinc finger-containing transcription regulators controls many aspects of cardiomyocyte and mitochondrial structure and function. Importantly, KLF15 regulates Wnt/β-catenin transcription and controls cardiac progenitor cell commitment in the postnatal period, suggesting a role in cardiac development.

The present application demonstrates that Klf15-, eNOS-, and Raptor-silenced cardiomyocytes did not respond to α5, which failed to stimulate mitochondrial biogenesis per se and protect against mitochondrial damage upon DOX addition. Moreover, after 72 hours of DOX treatment, the expression of the Klf15 gene in cardiac tissue was reduced.

α5 supplementation prevents mitochondrial dysfunction induced by short-term and acute DOX exposure by stimulating 1) mitochondrial biogenesis, 2) the anti-ROS defense system, and 3) BCAA oxidation, with likely production of TCA intermediates, apparently in an mTORC1-dependent manner (Figure 12 ).

Klf15 knockdown actually markedly reduced mTORC1 activity in HL-1 cells and impaired the ability of the α5 mixture to restore DOX-impaired S6 phosphorylation. Similarly, Klf15 silencing partially prevented α5-induced activation of BCAA catabolism, measured as BCKDH phosphorylation, in both DOX-treated and untreated cardiomyocytes. This suggests that in cardiac cells the protective effect of α5 is mediated, at least in part, by mTORC1 activation, which is dependent on KLF15 expression and thus on BCAA oxidation. Moreover, in cardiac cells and tissues, α5 is restored to control levels of Sestrin 2, which is highly expressed after DOX treatment. The sestrins are a family of stress-inducible proteins (sestrins 1–3), and various data indicate that sestrin 2 is a leucine sensor for the mTORC1 pathway. Normally associated with GATOR2, which is thus inhibited under non-stress conditions, sestrin 2 is displaced from GATOR2 when leucine is present at micromolar intracellular concentrations, activating mTORC1. The α5 formulation promoted eNOS expression and activity in both DOX-treated and untreated cardiac cells and tissue. These effects were likely mediated by (Ser473)-Akt phosphorylation.

Notably, although the role of amino acid-based compositions in the nutritional support of cancer patients has been well established to date, the present application shows that exposure of the breast cancer cell line MCF7 to the α5 composition did not promote MCF7 cell proliferation as assessed by two different assays (Figs. 13A and 13B). Likewise, the antiproliferative effect of DOX in MCF7 cells was completely unaffected by the presence of amino acids (Figures 13A and 13B). It is noteworthy that the proliferation rate is reduced when the α5 composition is administered.

Overall, the results presented herein showed: 1) short-term and intensive DOX treatment induces mitochondrial dysfunction in both cardiac tissue and cardiomyocytes, 2) α5 formulation markedly prevents such impairment, 3) eNOS and mTORC1 signaling pathways are critical significance for the action of this protector, 4) KLF15, a specific transcription factor particularly important for cardiac development and circadian regulation, plays an important role in the control of this signaling axis, 5) the antiproliferative effect of DOX in MCF7 cells is completely independent of the presence of amino acids.

These results highlight the effectiveness of the α5 composition in preventing and treating cardiotoxicity induced by chemotherapeutic agents, such as, for example, doxorubicin, in subjects undergoing chemotherapy.

- 15 045710

Sources

1. Singal, R.K.; Iliskovic, N. Doxorubicin-induced cardiomyopathy. N.Engl. J. Med. 1998, 339, 900-5.

2. Claycomb, W.C.; Lanson, N.A.; Stallworth, B.S.; Egeland, D.B.; Delcarpio, J.B.; Bahinski, A.; Izzo, N.J. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc. Natl. Acad. Sci. U.S.A. 1998, 95, 2979-84.

3. Vettor, R.; Valerio, A.; Ragni, M.; Trevellin, E.; Granzotto, M.; Olivieri, M.; Tedesco, L.; Ruocco, C.; Fossati, A.; Fabris, R.; and others. Exercise training boosts eNOS-dependent mitochondrial biogenesis in mouse heart: role in adaptation of glucose metabolism. Am. J. Physiol. Endocrinol. Metab. 2014, 306, E519-28.

4. Gao, J.; Chen, T.; Zhao, D.; Zheng, J.; Liu, Z. Ginkgolide In Exerts Cardioprotective Properties against Doxorubicin-Induced Cardio toxicity by Regulating Reactive Oxygen Species, Akt and Calcium Signaling Pathways In Vitro and In Vivo. PLoS One 2016, 11, e0168219.

5. Palanivel, R.; Eguchi, M.; Shuralyova, I.; Coe, I.; Sweeney, G. Distinct effects of short- and long-term leptin treatment on glucose and fatty acid uptake and metabolism in HL-1 cardiomyocytes. Metabolism. 2006, 55, 1067-75.

6. Abdullah, C.S.; Alam, S.; Aishwarya, R.; Miriyala, S.; Bhuiyan, M. A. N.; Panchatcharam, M.; Pattillo, C.B.; Orr, A. W.; Sadoshima, J.; Hill, J. A.; and others. Doxorubicin-induced cardiomyopathy associated with inhibition of autophagic degradation process and defects in mitochondrial respiration. Sci. Rep. 2019, 9, 2002.

7. Tedesco, L.; Valerio, A.; Cervino, C.; Cardile, A.; Pagano, C.; Vettor, R.; Pasquali, R.; Carruba, M.O.; Marsicano, G.; Lutz, W.; and others. Cannabinoid type 1 receptor blockade promotes mitochondrial biogenesis through endothelial nitric oxide synthase expression in white adipocytes. Diabetes 2008, 57, 2028-36.

8. Frontini, A.; Bertolotti, P.; Tonello, C.; Valerio, A.; Nisoli, E.; Cinti, S.; Giordano, A. Leptin-dependent STAT3 phosphorylation in postnatal mouse hypothalamus. Brain Res. 2008, 1215, 105-115

9. D'Antona, G.; Ragni, M.; Cardile, A.; Tedesco, L.; Dossena, M.; Bruttini, F.; Caliaro, F.; Corsetti, G.; Bottinelli, R.; Carruba, M.O.; et al. Branched-Chain Amino Acid Supplementation Promotes Survival and Supports Cardiac and Skeletal Muscle Mitochondrial Biogenesis in Middle-Aged Mice. Cell Metab. 2010, 12, 362-372.

10. Flamment, M.; Gueguen, N.; Wetterwald, C.; Simard, G.; Malthiery, Y.; Ducluzeau, P.-H. Effects of the cannabinoid CB1 antagonist rimonabant on hepatic mitochondrial function in rats fed a high-fat diet. Am. J. Physiol. Endocrinol. Metab. 2009, 297, El 162-70.

11. Sparks, L.M.; Xie, H.; Koza, R. A.; Mynatt, R.; Hulver, M.W.; Bray, G. A.; Smith, S.R. A high-fat diet coordinately downregulates genes required for mitochondrial oxidative phosphorylation in skeletal muscle. Diabetes 2005, 54, 1926-33

12. Lopez-Lluch, G.; Hunt, N.; Jones, B.; Zhu, M.; Jamieson, H.; Hilmer, S.; Cascajo, M. V.; Allard, J.; Ingram, D.K.; Navas, P.; and others. Calorie restriction induces mitochondrial biogenesis and bioenergetic efficiency. Proc. Natl. Acad. Sci. 2006, 103, 1768-1773.

13. Tedesco, L.; Corsetti, G.; Ruocco, C.; Ragni, M.; Rossi, F.; Carruba, M.O.; Valerio, A.; Nisoli, E. A specific amino acid formula prevents alcoholic liver disease in rodents. Am. J. Physiol. Gastrointest. Liver Physiol. 2018, 314, G566-G582

14. Nisoli, E. Mitochondrial Biogenesis in Mammals: The Role of Endogenous Nitric Oxide. Science (80-.). 2003, 299, 896-899.

- 16 045710

15. Valerio, A.; Cardile, A.; Cozzi, V.; Bracale, R.; Tedesco, L.; Pisconti, A.; Palomba,

L.; Cantoni, O.; Clementi, E.; Moncada, S.; and others. TNF-alpha downregulates eNOS expression and mitochondrial biogenesis in fat and muscle of obese rodents. J. Clin. Invest. 2006, 116, 2791-8.

16. Lionetti, L.; Mollica, M.P.; Crescenzo, R.; D'Andrea, E.; Ferraro, M.; Bianco, F.;

Liverini, G.; lossa, S. Skeletal muscle subsarcolemmal mitochondrial dysfunction in high-fat fed rats exhibiting impaired glucose homeostasis. Int. J. Obes. 2007, 31, 1596-1604.

17. Pervin, S.; Singh, R.; Hernandez, E.; Wu, G.; Chaudhuri, G. Nitric oxide in physiological concentrations targets the translational machinery to increase the proliferation of human breast cancer cells: involvement of mammalian target of rapamycin/eIF4E pathway. Cancer Res. 2007, 67, 289-99.

Claims (15)

1. The use of a composition for preventing and/or treating cardiotoxicity induced by at least one chemotherapeutic agent in a subject undergoing chemotherapy, wherein the composition contains an active agent, wherein said active agent contains the amino acids leucine, isoleucine, valine, threonine, lysine, and citric acid, succinic acid, malic acid. 2. Use according to claim 1, wherein said chemotherapeutic agent is selected from the group consisting of anthracyclines, HER2/ErbB2 (epidermal growth factor receptor 2) inhibitors, tyrosine kinase inhibitors, vascular endothelial growth factor inhibitors, immune checkpoint inhibitors, said anthracyclines being preferred selected from the group consisting of doxorubicin, epirubicin, daunorubicin, idarubicin, pixantrone, sabarubicin, valrubicin. 3. Use according to claim 1 or 2, where the mass ratio between the total amount of citric acid, malic acid, succinic acid and the total amount of branched chain amino acids leucine, isoleucine, valine, lysine and threonine is from 0.05 to 0.3 , preferably from 0.1 to 0.25. 4. Use according to any one of claims 1 to 3, where the mass ratio between the total amount of citric acid, malic acid, succinic acid and the total amount of branched chain amino acids leucine, isoleucine, valine is from 0.1 to 0.4, preferably from 0.15 to 0.35. 5. Use according to any one of claims 1 to 4, wherein the weight ratio between citric acid and the total amount of malic acid and succinic acid is from 1.0 to 4.0, preferably from 1.5 to 2.5. 6. Use according to any one of claims 1 to 5, where the mass ratio of citric acid: malic acid: succinic acid is from 10:1:1 to 2:1.5:1.5, preferably from 7:1:1 to 1 5:1:1, more preferably 5:1:1 to 3:1:1. 7. Use according to any one of claims 1 to 6, wherein said active agent further contains at least one amino acid selected from the group consisting of histidine, phenylalanine, methionine, tryptophan, tyrosine, cysteine. 8. Use according to any one of claims 1 to 7, wherein said active agent further comprises histidine, phenylalanine, methionine, tryptophan, cysteine and optionally tyrosine. 9. Use according to claim 7 or 8, wherein the ratio between the total molar amount of citric acid, malic acid, succinic acid and the total molar amount of methionine, phenylalanine, histidine and tryptophan is more than 1.35. 10. Use according to any one of claims 1 to 9, where the ratio between the total molar amount of the three acids: citric acid, succinic acid, malic acid and the total molar amount of lysine and threonine is from 0.10 to 0.70, preferably from 0. 15 to 0.55. 11. Use according to any one of claims 1 to 10, wherein the mass or molar amount of citric acid is higher than the total mass or molar amount of malic and succinic acids. 12. Use according to any one of claims 1 to 11, wherein the weight ratio between leucine and citric acid is from 5 to 1, preferably from 2.50 to 3.50. 13. Use according to any one of claims 1 to 12, wherein said composition does not contain arginine. 14. Use according to any of claims 1 to 13, where said composition does not contain serine, proline, or alanine. 15. The use of a combined preparation containing a composition, wherein the composition contains an active agent containing amino acids - leucine, isoleucine, valine, threonine, lysine, and citric acid, succinic acid, malic acid; and at least one chemotherapeutic agent for preventing and/or treating cardiotoxicity induced by the at least one chemotherapeutic agent in a subject suffering from cancer, wherein the use of the composition and the at least one chemotherapeutic agent is simultaneous, separate, sequential.